Proc. NatI. Acad. Sci. USA Vol. 83, pp. 7405-7409, October 1986 Genetics Promoters selected from random DNA sequences (mutagenesis/evolution) MARSHALL S. Z. HORWITZ AND LAWRENCE A. LOEB The Joseph Gottstein Memorial Cancer Research Laboratory, Department of Pathology SM-30, University of Washington, Seattle, WA 98195 Communicated by Earl P. Benditt, July 3, 1986 ABSTRACT We have selected a group of Escherichia coli moter recognition site of the tetracycline resistance gene of promoters from random DNA sequences by replacing 19 base pBR322 (tet). This technique may be generalized for the pairs at the -35 promoter region of the tetracycline resistance selection of other genetic regulatory elements or protein gene te" of the plasmid pBR322. Substitution of 19 base pairs coding sequences. with chemically synthesized random sequences results in a maximum of 419 (about 3 x 1011) possible replacement se- MATERIALS AND METHODS quences. From a population of about 1000 bacteria harboring Oligonucleotides. Oligonucleotides were synthesized by plasmids with these random substitutions, tetracycline selec- the phosphoramidite method with an Applied Biosystems tion has revealed several functional -35 promoter sequences. 380A DNA synthesizer and purified by thin layer chroma- These promoters have retained only partial. homology to the tography (10). Random sequences were synthesized with -35 promoter consensus sequence. In three ofthese promoters, equimolar mixtures of phosphoramidites. the consensus agent shifts 10 nucleotides downstream, allow- Plasmid Constructions. Restriction endonucleases and en- ing the RNA polymerase to recognize another Pribnow box from zymes of nucleic acid metabolism were obtained commer- within the original pBR322 sequence. Two of the sequences cially and use followed the supplier's instructions. Standard promote transcription more strongly than the native promoter. molecular cloning methods were employed (11). This technique may have application for theselection ofadditional A plasmid with a deletion in the promoter recognition site, DNA sequences with varied biological activity. pBdEC, was constructed by digestion ofpBR322 with EcoRI and Cla I, by extension of the 5' overhangs with the large Comparison of known RNA polymerase binding sites of fragment of DNA polymerase I, and by blunt-end recircu- different genes of Escherichia coli reveals two highly con- larization with T4 DNA ligase. The plasmid sequences were served promoter elements centered at about -10 and -35 confirmed by DNA sequence analysis. base pairs (bp) from the start of transcription (1-5). A The plasmid populations containing random substitution consensus sequence of the nontemplate strand includes with all four bases, pRAN4, or just three bases (cytosine, "TATAAT" from positions -13 to -8, the "Pribnow box," guanine, and thymine), pRAN3, were constructed by hybrid- and "TTGACA" from positions -36 to -31, the "recogni- izing 4 x 10-' pM of primer 8-mer, 5' GGATCGAT 3', to 2 tion" site, with 17 bp between the two (6). The involvement X 10- pM of template 35-mer of mixed sequence, either 5' of each nucleotide in the initiation of transcription has been CCGAATTC(A,C,G,T)19ATCGATCC 3' or 5' CCGAATTC- inferred largely from an analysis of mutations. Rare muta- (C,G,T)19ATCGATCC 3', respectively, in 90 mM NaCl/15 tions that increase transcription, "up mutations," usually mM Tris HCl, pH 7.9/1 mM MgCl2 at 650C for 5 min and 570C increase homology with the consensus sequence and spacing, for 90 min. The primed template was extended with the large while the more common mutations that decrease transcrip- fragment of DNA polymerase I and digested with an excess tion, "down mutations," usually decrease homology with the of EcoRI and Taq I. The resulting product was ligated into consensus sequence and spacing (7). EcoRI- and Cla I-digested pBR322 that had been treated with Targeted random mutagenesis has been used to define bacterial alkaline phosphatase and purified by agarose gel prokaryotic (8) and eukaryotic (9) translation initiation sig- electrophoresis. nals. In these experiments base substitutions were limited in One of the new promoter sequences was duplicated in a number to no more than three and were identified before second plasmid to rule out the possibility of mutation outside activity was manually assayed. This strategy limits the search the promoter region. The insert of plasmid pBT9 was recon- for functional sequences to derivatives of those already structed in the plasmid pBT9R by hybridizing 105 pM known. 26-mer (5' AATTCTTGGGCGCGCGTCGGCTTGAT 3') to We report here a technique that has allowed us to create 10-5 pM 24-mer (5' CGATCAAGCCGACGCGCGCCCAAG several unusual promoter recognition sequences. We have 3') using the conditions described above. Incubation with T4 substituted for the promoter recognition site of a plasmid- polynucleotide kinase in the presence of ATP added 5'- borne selectable marker chemically synthesized random phosphoryl termini. The resulting product contains EcoRI sequences of 19 bp, such that every particular plasmid and Cla I sticky ends and was ligated into similarly digested molecule contains a unique, randomly chosen sequence. pBR322. The expected plasmid sequences were confirmed by When introduced into competent cells, growth selection DNA sequence analysis. Competent DH5 and DH5.1 E. coli identifies those sequences with promoter activity. When all (endAl, recAl), prepared by the method ofHanahan (12) and four DNA bases are present in the 19-bp random stretch, purchased from Bethesda Research Laboratories and Vector there are 419 (about 3 x 1011) different possible replacement Cloning Systems (San Diego, CA), respectively, were used sequences. We have used antibiotic selection to identify for DNA transformation. Transformants were grown in several unusual promoters from a population of about 1000 Luria-Bertani Medium (LB) (with 0.1% glucose) for 60 min such bacteria, heterogeneous in DNA sequence at the pro- (approximately two doublings) prior to antibiotic selection. DNA Sequence Analysis. Rapid plasmid DNA preparation was The publication costs of this article were defrayed in part by page charge was by the alkaline lysis method (11). DNA sequencing payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: tetr, tetracycline resistance gene; bp, base pair(s). 7405 Downloaded by guest on September 28, 2021 7406 Genetics: Horwitz and Loeb Proc. Natl. Acad. Sci. USA 83 (1986) by dideoxy chain-termination (13) using double-strand I in the presence of all four dNTPs, and digested with EcoRI pBR322 templates (14) from these rapid preparations. Both and Taq I to produce a heterogeneous restriction fragment DNA strands were sequenced. population. We then ligated the restriction fragments into the Tetracycline Resistance Determination. Tetracycline resist- parent plasmid to produce a population ofplasmids, pRAN4, ance was determined by the 50% efficiency ofplating (EOP50) containing random 19-bp promoter substitutions. For this method (15) on LB agar (with 0.1% glucose). population, there is a maximum of 419 different possible RNA Gel Blot Analysis. Nucleic acids were purified from E. replacement sequences. The plasmid population was used to coli (16) and electrophoresed on 1% agarose/2.2 M formal- transform E. coli. Growth in ampicillin selects for bacteria dehyde (11). Hybridization was on GeneScreenPlus mem- containing plasmids, while growth in tetracycline selects for branes (New England Nuclear) following manufacturer's plasmids with functional tetr promoters. instructions. Densitometry of the autoradiogram was per- Specifically, we transformed DH5.1 with pRAN4 (Table formed on a Hoefer GS300 scanning densitometer. 1). Ampicillin selection yielded 125 colonies. To determine the nature of insertions present, plasmids from 10 of these RESULTS colonies have been characterized. Plasmid sizes were com- The Promoter Recognition Sequence Is Necessary for Tran- pared by agarose gel electrophoresis (not shown), and in each scription. The location of the tet( promoter has been deduced plasmid about 200 bp centered at -35 were sequenced. Two from promoter consensus sequence homology in pBR322 plasmids are identical to pBR322, and three plasmids contain (17), deletion mutations (18), and electron microscopic map- deletions bounded by the EcoRI and Cla I sites (sequences ping (19). The transcription initiation site has been identified not shown); these are assumed to be part of a background of by Si-nuclease mapping (16). The gene encodes a single, about 50% of the vectors that escaped either digestion with noninducible, 43.5-kDa polypeptide (20) that functions at the restriction enzymes or ligation of the insert. The other five cell membrane to block accumulation of the antibiotic (21). plasmids derived from pRAN4-pBB3, pBB5, pBB9, We first deleted the promoter recognition sequence in tetr pBB10, and pBB13-contain promoter substitutions of 10-23 to confirm the importance of this sequence in the transcrip- bp (Fig. 2). Of the total of 77 bases substituted among these tion of that gene. EcoRI and Cla I restriction sites flank the five plasmids, the average insert length is 15, and the -35 sequence in tet' (Fig. 1). We constructed pBdEC, a composition is 22% adenine, 27% cytosine, 34% guanine, and plasmid with a 22-bp deletion extending from position -42 in 17% thymine. the EcoRI site to position -21 in the Cla I site. E. coli DH5.1