Proc. NatI. Acad. Sci. USA Vol. 76, No. 7, pp. 3233-3237, July 1979 Biochemistry Contacts between Escherichia coli RNA polymerase and thymines in the lac UV5 promoter (Escherichia coli genetic control/RNA polymerase-promoter interaction/bromouracil substitution/photochemical probe/ RNA nucleotidyltransferase) ROBERT B. SIMPSON* Biological Laboratories, Harvard University, Cambridge, Massachusetts 02138 Communicated by Walter Gilbert, April 23, 1979

ABSTRACT I have identified those 5 positions of thymines enine on double-stranded DNA, other probes with different in the lac UV5 promoter that lie close to bound Escherichia coli specificities are needed to get a complete picture of the crucial RNA polymerase (nucleosidetriphosphate:RNA nucleotidyl- promoter elements. transferase, EC 2.7.7.6). Although ultraviolet irradiation of DNA interaction between RNA and with 5-bromouracil substituted in place of thymine normally I have probed the polymerase cleaves the DNA at the bromouracils, a protein bound to the a strong promoter by using a photochemical method developed DNA can perturb these cleavages at those locations at which by Ogata and Gilbert (22) that identifies 5 positions of thymine the protein lies close to the bromine. In the lac promoter most that are close to a bound protein. Ultraviolet irradiation of the of these contacts lie in three regions. Four contacts lie in the DNA, with 5-bromouracil substituted in place of thymine, region where transcription initiates; four lie in the "Pribnow displaces the bromine and leaves an activated uracilyl radical box," which is located about 10 base pairs upstream from the in the major groove of the DNA helix. Normally, this free initiation site; and three more lie in the "-35 region," located about 35 base pairs upstream from the initiation site. The radical seizes a hydrogen atom from the sugar on the 5' side, "Pribnow box" and the "-35 region" are regions whose se- destroying the ribose ring and breaking the DNA at that point quences are partially conserved between promoters and in (23). However, the presence of a bound protein can alter the which most promoter mutations are located; thus, contacts in cleavage at locations where the protein is close enough to the these two regions probably represent sites of sequence-specific free radical to react with it. The experiment, then, is to monitor recognition by RNA polymerase. this cleavage in the presence and absence of bound RNA Which features of a promoter direct RNA polymerase polymerase at each bromouracil in the promoter. (nucleosidetriphosphate:RNA nucleotidyltransferase, EC The lac UV5 promoter mutant is a strong promoter charac- 2.7.7.6) to initiate RNA synthesis? DNA sequence determina- terized by a rapid association with RNA polymerase resulting tion of promoters and promoter mutants provides a partial in a stable complex (8, 24, 25). Unlike the wild-type promoter, answer to this question. When the sequences of promoters are it is not catabolite repressed: RNA polymerase action does not compared, two regions of prominent homology have been ob- require activated cyclic AMP receptor protein (26). Thus this served: the "Pribnow box" and the "-35 region" located about promoter is a simple object for studies in vitro of a chromosomal 10 and 35 base pairs, respectively, upstream from the start site promoter. of transcription (1-4). Furthermore, almost all promoter My results identify points of contact between RNA poly- mutations are located within these regions (5-12). merase and the lac UV5 promoter. The locations within the Another approach examines different portions of the pro- promoter sequence of the contact points are nonrandom. Their moter for their accessibility to various probes in the presence dispositions stress the importance of particular regions within or absence of RNA polymerase. For example, RNA polymerase the promoter. One region covers the site where transcription bound to any of several promoters protects about 40 base pairs begins. The other two regions correspond well to the location of DNA from endonuclease attack (1, 2, 13, 14). Although of promoter mutations, the contacts inferred from the dimethyl polymerase in the resulting complex can initiate correctly and sulfate probe of this promoter by Johnsrud (21), and the posi- synthesize a transcript about 20 bases long, the 40 base pair tions of homologies revealed when available promoter se- fragment does not rebind the polymerase, showing that this quences are compared. fragment lacks some information required for promoter rec- MATERIALS AND METHODS ognition. And, in fact, enzymatic digestion with exonuclease (15) or restriction endonucleases (5, 9, 16-19) suggests that RNA Polymerase. RNA polymerase was purified from roughly 65 base pairs of DNA are required and that the ap- Escherichia coli K cells (Grain Processing Co., Muscatine, IA) proximate boundaries of a promoter are located about 45 base by the method of Burgess and Jendrisak (27). Then chroma- pairs upstream and 20 base pairs downstream from the site of tography on single-stranded DNA-agarose as suggested by initiation. A finer probe is the chemical attack on DNA by di- Lowe et al. (28) yielded RNA polymerase with a complete methyl sulfate (20), which gives a more detailed picture of the complement of the a subunit. Polyacrylamide gel electropho- interaction because the chemical probe is much smaller than resis in sodium dodecyl sulfate showed that the protein was the enzymes that degrade DNA. This probe shows that contacts more than 95% pure. in one promoter extend from the point of initiation to at least Bromouracil-Substituted DNA. Promoter DNA was isolated 38 base pairs upstream (21). Because the dimethyl sulfate at- from the tetracycline-resistant plasmid pLJ3 constructed by tacks only the N-7 group of guanine and the N-3 group of ad- Johnsrud (21). All manipulations of recombinant DNA were done at the P1 level of containment. To increase the incorpo- The publication costs of this article were defrayed in part by page ration of exogenous bromouracil, the plasmid was carried in a charge payment. This article must therefore be hereby marked "ad- vertisement" in accordance with 18 U. S. C. §1734 solely to indicate *Present address: Department of Microbiology, University of Wash- this fact. ington, Seattle, WA 98195. 3233 Downloaded by guest on September 24, 2021 3234 Biochemistry: Simpson Proc. Nati. Acad. Sci. USA 76 (1979) mutant requiring thymine (FMA 10 from F. Ausubel; W3102, the DNA, denaturing the products, and separating the resulting lacking restriction enzyme). The cells were grown in M9 me- fragments by size with gel electrophoresis. The distance be- dium plus casamino acids (29) supplemented with thymine at tween the label and the break identifies the location of the 2 Aig/ml and tetracycline at 10 ,g/ml. At an ODsso of 1.2, the break. Thus, the autoradiograph of the gel reveals a series of plasmid was amplified by the addition of chloramphenicol to bands corresponding to breaks at successive bromouracils in the 170 ,gg/ml. At the same time bromouracil was added to a con- labeled strand of the fragment. If RNA polymerase is bound centration of 50 ,g/ml. After incubation overnight at 370C, to the fragment during the irradiation, the intensity of specific the plasmid DNA was isolated as described by Tanaka and bands changes. My interpretation is that these bands correspond Weisblum (29) with one modification. Because DNA in which to bromouracils in the immediate vicinity of the bound pro- bromouracil has substituted for thymine has a density greater tein. than that of unsubstituted DNA, the final density of the ethi- Fig. 1 illustrates the results of such an experiment. Labeled dium bromide/CsCl gradient was increased to 1.65 g/ml. From restriction fragments were irradiated in the absence or presence this gradient, I isolated a broad band that represented heavily of increasing amounts of RNA polymerase. The fragments were substituted supercoiled plasmid DNA. labeled at the 5' terminus of the "top strand" (as portrayed in Johnsrud (21) described the isolation from this plasmid of Fig. 4). The figure shows the autoradiograph of such a gel. In restriction fragments containing the promoter 32P-labeled at lane c, each band represents ultraviolet-induced cleavage at a the 5' end of one or the other strand. The "top" and "bottom" bromouracil in the labeled strand. The pattern of the same DNA strands (defined in Fig. 4) are labeled on fragments of 117 and cleaved at the bromouracils by chemical means (lane b) iden- 168 base pairs, respectively. Restriction enzymes Hae III and tifies the irradiation products. The patterns are displaced by EcoRI were generous gifts from A. Jeffrey and L. Johnsrud, one base with respect to each other because chemical attack respectively. D'Andrea and Haseltine (30) have published the decomposes the sugar attached to the bromouracil (unpublished deoxynucleotide sequence of these fragments. data), whereas irradiation destroys the sugar that is the 5' Ultraviolet Irradiation. The ultraviolet light source was a neighblr of the bromodeoxyuridine (23). The bases are num- 500-W medium-pressure mercury lamp (Hanovia), jacketed bered with respect to the startpoint of transcription (see Fig. with a chilled circulating solution of 1 M NiSO4 and 0.2 M 4). As Ogata and Gilbert (22) observed, the ultraviolet-induced CuSO4. The NiSO4 absorbs most of the infrared radiation while cleavage is not uniform throughout the DNA fragment but the CuSO4 absorbs most ultraviolet light with wavelengths less appears to be sequence specific. As a result, some bands are too than 300 nm. This spectrum of radiation is preferentially ab- sorbed by the bromouracil, because between 300 and 315 nm the absorption coefficient of bromodeoxyuridine is 10 to 100 a d e times greater than that of thymidine (31). The number of breaks in the DNA is proportional to the time of irradiation. The indicated amount of RNA polymerase was added to 0.25 pmol of end-labeled promoter fragment in 50 ,ul of binding buffer (50 ,ug of bovine serum albumin per ml/10 mM MgCI2/ 1 mM EDTA/50 mM NaCl/0.1 mM dithiothreitol/10 mM Tris-HCl, pH 8.0). After 5 min at 37°C, heparin (Upjohn) was added where indicated and the solution was irradiated at 5 cm from the lamp for 10 min. After irradiation the DNA was precipitated by the addition of 50 ,ul of 5 M ammonium acetate, 1 ,ug of tRNA, and 0.3 ml of ethanol. The pellet was rinsed with ethanol and dried under reduced pressure. The DNA was -4 resuspended in loading buffer (50 mM NaOH/0.5 mM -3 - EDTA/5 M urea/0.025% xylene cyanol/0.025% bromophenol blue/0. 1% sodium dodecyl sulfate). The samples were heated 15 sec at 900C, electrophoresed on a "sequencing gel," and prepared for autoradiography as described by Maxam and Gilbert (32). The films were scanned with an Ortec model 4310 densitometer. Preferential Chemical Cleavage of DNA at Bromouracil. Approximately 50 nmol of a restriction fragment substituted -25-- ~t -34 with bromouracil and labeled at one 5' end with 32p was placed -35 in 20 t1. of 0.5 M piperidine (Fisher). The solution was drawn up into a glass capillary tube, sealed with a flame, and held at 90°C for about 1.5 hr. The solution was then returned to the tube, diluted with an equal volume of water, and lyophilized FIG. 1. RNA polymerase protection of the "top strand" of the several times. The last residue was resuspended in loading lac UV5 promoter from ultraviolet-induced cleavage. A restriction and fragment containing the promoter sequence and substituted with buffer electrophoresed. bromouracil was labeled at the 5' end of the "top strand" (as shown in Fig. 4). The DNA (about 0.25 pmol) was incubated with 0 ,ug (lane RESULTS c), 0.1 Mg (lane d), 0.3 Mg (lanes a and e), or 0.5 ,ug (lane f) of RNA The strategy of the photochemical probe (22) is based on the polymerase. In addition, for the reaction represented by lane a, hep- severs DNA with 5-bromouracils arin was added at 0.6 Mg/ml after complex formation. After irradiation, fact that ultraviolet light the products were displayed on an acrylamide urea gel; the autora- substituted for thymines. Using a restriction fragment con- diograph of the gel is shown. Lane b is a length standard resulting from taining the promoter DNA sequence and radioactively labeled chemical specific cleavage of the DNA fragment at the bromouracil at one 5' end only, one can monitor the extent of this cleavage bases. The numbers at the side are defined in Fig. 4 and identify the at specific substituted bases within that sequence by irradiating bands whose intensities are changed by polymerase binding. Downloaded by guest on September 24, 2021 Biochemistry: Simpson Proc. Nati. Acad. Sci. USA 76 (1979) 3235 weak to be quantitated-for example, base -12. RNA polymerase bound to the promoter markedly altered the irradiation pattern (lanes d, e, f). As the approximate molar ratio of enzyme to promoter increased from 0 to 4, three dra- matic effects appeared: the intensity of some bands decreased, the intensity of others increased, and an increasing amount of labeled DNA remained near the top of the gel, corresponding presumably, to DNA covalently crosslinked to RNA polymer- ase. Fig. 2 (lane a) shows that some bands resulting from pho- tochemical cleavage at bromouracils in the other strand, the "bottom",strand (of Fig. 4) are also-affected by RNA poly- merase binding (lane b). I have quantitated the changes in band intensity by scanning Distance the autoradiographs shown in Figs. 1 and 2 and those produced FIG. 3. Superimposed densitometer tracings of the autoradio- by similar experiments. Fig. 3 shows such a scan; positions -21, gram in Fig. 1. The tracings represent irradiation of the promoter -10, and -15 are examples of bands whose intensity changed DNA in the absence (-) or presence (---) of 0.5 ,g of RNA poly- little, decreased, and increased, respectively, when RNA merase. polymerase was present. Extended electrophoresis (not shown) was necessary to separate the band at position +3 from that at that increase in intensity by at least 60% in the presence of RNA +4. For bromouracils in the vicinity of the promoter, Table 1 polymerase; these bases are crowned with a caret. RNA poly- lists the ratio of the band intensity in the presence of RNA merase suppresses the strand scission at positions +4, +3, -10, polymerase (I) to the band intensity of the control (I,); the data -34, -35, and -36 of the "top strand" and +2, -8, -9, and represent the average of three experiments. Bands too weak to -11 of the "bottom strand." The enzyme enhances ultraviolet quantitate are indicated in the table by an asterisk. cleavage at positions -3, -15, -25, and -27 of the "top Fig. 4 indicates on a sequence of the promoter the positions strand." of bases whose band intensities are consistently reduced by at Two characteristics of the complex show that it contains RNA least 60% in the presence of RNA polymerase; these bases are polymerase bound to the promoter: the complex is stable to in boldface. Also shown are the positions corresponding to bands heparin attack, and it is able to initiate transcription. Heparin, a polyanionic competitor of DNA, rapidly binds free RNA polymerase or polymerase nonspecifically bound to DNA (34). a b Enzyme bound to the lac UV5 promoter is much more resistant

Table 1. Ratio of band intensities in the presence and absence of RNA polymerase "Top strand" "Bottom strand" Base W/IO SD I. Base I/1O SD IO -36 0.2 0.1 46 -40 0.8 0.2 16 -40-1l -35 0.3 0.1 22 -33 0.7 0.2 4 -33_ A--9 -34 0.2 0.1 34 -31 * -31 ~j -29 0.8 0.1 18 -26 1.3 0.3 25 -26-4 -28 1.3 0.1 33 -11 0.3 0.1 15 -27 1.6 0.3 34 -9 0.3 0.1 48 -25 2.3 0.2 6 -8 0.3 0.1 50 -22 1.0 0.1 46 +1 0.6 0.1 45 -1 1- -21 0.9 0.1 47 +2 0.4 0.2 63 -9:_ -15 1.7 0.2 36 +8 1.4 0.2 22 -12 *- +13 0.8 0.1 17 -10 0.2 0.1 27 +15 0.8 0.1 20 -7 * - +16 * +2-_ -*5 - +18 0.9 0.1 9 -3 2.7 0.2 2 +19 0.7 0.2 27 +3 0.3 0.1 80 +4 0.2 0.1 80 +14 0.6 0.1 21 FIG. 2. RNA polymerase protection of the "bottom +20/21/22t 1.0 0.1 54 strand" of the lac UV5 promoter Autoradiographs such as those in Figs. 1 and 2 were scanned to + 1 3- from ultraviolet-induced cleav- measure the intensity of each band: I/Io is the band intensity in the age. Lane b represents the reac- presence of RNA polymerase divided by the band intensity in the tion of about 0.25 pmol of pro- absence of RNA polymerase. Intensity units are arbitrary. The ratio + 1 5~ 41_b moter DNA labeled at the 5' end represents the average of three experiments; the standard deviation + 1 6- of its "bottom strand" (as shown (SD) is indicated. The values listed for 10 were generated from *e in Fig. 4) with 0.3 gg of RNA control lanes of Figs. 1 and 2. The "strand" refers to the DNA.' polymerase; lane a is the control. portrayed in Fig. 4, which also indicates the numbering convention The numbers at the side are de- for the bases. 8- fined in Fig. 4 and identify bands * Band intensity too weak to quantitate. + 19-_ corresponding to thymines in the t Bands not quantitated individually but all appear to be unchanged promoter. by RNA polymerase. Downloaded by guest on September 24, 2021 3236 Biochemistry: Simpson Proc. Natl. Acad. Sci. USA 76(1979) - 35 Region Pribnow Box TTGACA TATAAT PPPA AU UG U pppGAA U UG U -40 -30 -20 -10 +1 CAGGC'JAC'A TT+A+GCTT CGGCtCGTATAA.TGTGtGGAAUJGT GTCCG AAATGTGAAATACGAAGGCCGAGCATATTACACACCTTAACA * V A A L305 T T L241 parae TATATT TATGTT PS wt -40 -30 -20 -10 +1 'A I NA ' C AGGCTTTACACTTTATC&TTCCGGCTCG1T)TAATGTI~ 1TGGAATTGTA TTG GTCCGAAAT©TGAAATACGAACGCCGAOCATATTACACACCTTAACA FIG. 4. Structural features of the lac UV5 promoter. The second line shows the effects of RNA polymerase binding on the rate of ultravio- let-induced cleavage of nucleotides in this promoter. RNA polymerase decreases the rate of cleavage at bases in boldface; it has the opposite effect at bases crowned with a caret; no information is available on bases at positions -31, -12, -7, and -5 because the intensities ofthe bands corresponding to these positions were too weak to quantitate. The top line shows the preferred sequences determined by Siebenlist (33) in regions of homology implicated by Pribnow (1), Schaller et at. (2), Maniatis et at. (3), and Gilbert (4). Below the UV5 promoter sequence (J. Gralla, in ref. 4) are the sequences of promoter mutations L305 (a deletion), L241, Pr la (6), and p8 (8), and the wild-type-promoter (6). The bottom line shows the results of the dimethyl sulfate protection experiment done by Johnsrud (21). Methylation of circled bases is blocked by RNA polymerase; half circles indicate partial blockage; carets indicate points of enhanced methylation. Alternative mRNAs transcribed from the initiation region are shown in the upper right. The majority of transcripts initiate at position +1. (8, 24, 25). Addition of heparin to 0.6 Asg/ml after complex radical. (Mi) The protein could cause a local change in DNA formation and prior to irradiation had no effect (lane a in Fig. structure, altering either the target size for ultraviolet absorption 1), whereas the addition of heparin before the polymerase or the position of the uracilyl radical with respect to the sugar eliminated the protection. Furthermore, the complex was also hydrogen. (iv) Solvent molecules can quench the radicals and stable to a 15-min chase of heparin at 100 Aug/ml. The binary bound protein could alter the rate of this reaction. These complex was also productive in the sense that it was transcrip- mechanisms are apparently not mutually exclusive at an indi- tionally competent. The addition of all four nucleoside tri- vidual base, because RNA polymerase can enhance both the phosphates after heparin almost entirely eliminated the pro- cleavage at -3 on the "top strand" and the formation of a tection (data not shown). crosslink to this base. Although the contribution of each of these mechanisms is not known, it is likely that the alteration of the DISCUSSION cleavage rate at a base results from the close approach of RNA Technique of ultraviolet-induced cleavage polymerase to that base. RNA polymerase bound specifically to the promoter alters the Interaction sites for RNA polymerase within the rate of photochemical cleavage at certain bromouracils within promoter sequence the promoter sequence. This cleavage is a consequence of the RNA polymerase strongly affects the photoinduced cleavage irradiation displacing the bromine to leave an activated uracilyl at specific bases within the lac UV5 promoter. Fig. 4 displays radical in the major groove of the DNA helix; this free radical these bases, which probably represent points of contact with seizes a hydrogen atom from the sugar on the 5' side, breaking RNA polymerase. That these contacts are important is em- the DNA chain at that point (23). Bound polymerase suppresses phasized by their proximity to lac promoter mutations (Fig. 4). the level of breakage at some bases but actually enhances this There is a contact with each thymine at which promoter level at others. Ogata and Gilbert (22) observed only the former mutations have arisen (-34, -9, -8). Although at the positions effect in their analogous probe of the lac repressor-operator of two other promoter mutations (-37, -16) there is no thymine interaction. In other experiments (unpublished), I have iden- in the lac UV5 sequence, in each case a thymine that is an im- tified bases actually crosslinked to the polymerase. RNA mediate neighbor does form a contact with the enzyme. polymerase suppresses the cleavage rate at one of the cross- The disposition of these bases highlights three regions within linked bases (+3) but enhances the rate at the other (-3). These the promoter sequence: the "Pribnow box," the "-35 region," results suggest that the ability of a bound protein to alter the and the start point of transcription. In the first region, the ultraviolet-induced cleavage rate of DNA can reflect several "Pribnow box," Pribnow (1) and Schaller et al. (2) observed a different mechanisms. (i) Protein in the immediate vicinity of high degree of homology when they compared the base se- the free radical (either on the activated uracilyl or the 2' position quences of known promoters. The prominent homology of the sugar) could react with it, resulting in a covalent crosslink suggests that contacts critical for optimal promoter function between the two molecules. Weintraub (35), Linn and Riggs exist within this region. Strong support for this hypothesis is the (36), and Ogata and Gilbert (22) detected such events. (ii) The location within this region of mutations that alter promotion protein could serve as a hydrogen donor, quenching the free of transcription at the lac promoter (Fig. 4). The dimethyl Downloaded by guest on September 24, 2021 Biochemistry: Simpson Proc. Natl. Acad. Sci. USA 76 (1979) 3237 sulfate probe by Johnsrud (21) also revealed contacts in this 8. Majors, J. (1977) Dissertation (Harvard Univ., Cambridge, region. In the second region, the "-35 region," Maniatis et al. MA). 9. Musso, R. E., DiLauro, R., Adhya, S. & DeCrombrugghe, B. (3) and Gilbert (4) noted a degree of homology. Two promoter (1977) Cell 12, 847-854. mutations and two dimethyl sulfate-defined contacts also reside 10. Calos, M. P. (1978) Nature (London) 274,762-765. in this section of the promoter. These first two regions, the 11. Miozzari, G. & Yanofsky, C. (1978) Proc. Natl. Acad. Sci. USA "Pribnow box" and the "-35 region," probably represent sites 75,5580-5584. of sequence-specific recognition by RNA polymerase. In these 12. Post, L. E., Arfsten, A. E., Nomura, M. & Jaskunas, S. R. (1978) two regions there is a total of seven contacted thymines; the Cell 15, 231-236. effect of RNA polymerase on three others (-31, -12, -7) is not 13. Pribnow, D. (1975) J. Mol. Biol. 99,419-443. known because the corresponding bands were too weak to be 14. Walz, A. & Pirrotta, V. (1975) Nature (London) 254, 118- 121. quantitated. 15. Ptashne, M., Bachman, K., Humayun, Z., Jeffrey, A., Maurer, The third region is near the start point of transcription. The R., Meyer, B. & Sauer, R. (1976) Science 194, 156-161. existence of four contacts in this region is not unexpected be- 16. Maurer, R., Maniatis, T. & Ptashne, M. (1974) Nature (London) cause of its proximity to the catalytic site of the enzyme. 249,221-223. The lac repressor binds specifically to the lac operator, a 17. Allet, B., Roberts, R. J., Gesteland, R. F. & Solem, R. (1974) Na- region centered at base +11 (20), and inhibits initiation at the ture (London) 249,217-220. lac promoter. Using the same photochemical technique de- 18. Hsieh, T. & Wang, J. C. (1976) Biochemistry 15,5776-5783. scribed in this report, Ogata and Gilbert (22) identified those 19. Brown, K. D., Bennett, G. N., Lee, F., Schweingruber, M. E. & 5 positions of thymine in the operator that lie close to bound Yanofsky, C. (1978) J. Mol. Biol. 121, 153-177. repressor. Three of these contacts are at positions (+2, +3, +4) 20. Gilbert, W., Maxam, A. & Mirzabekov, A. (1976) in Control of also interacts. This is consistent Ribosome Synthesis, Alfred Benzon Symposium 9, eds. Kjeld- with which RNA polymerase gaard, N. 0. & Maaloe, 0. (Munksgaard, Copenhagen), pp. with the fact that the binding of the repressor to the operator 139-148. is competitive with the binding of RNA polymerase to the 21. Johnsrud, L. (1978) Proc. Natl. Acad. Sci. USA 75, 5314- promoter (37). 5318. Does the substitution of bromouracil for thymine in the 22. Ogata, R. & Gilbert, W. (1977) Proc. Natl. Acad. Sci. USA 74, promoter alter its contacts with RNA polymerase? This sub- 4973-4976. stitution replaces the 5-methyl group of thymine with a bro- 23. Hutchinson, F. (1973) Qt. Rev. Biophys. 6,201-246. mine, which has approximately the same van der Waals radius. 24. Reznikoff, W. S. (1976) in RNA Polymerase, eds. Losick, R. & DNA binds many more tightly, including Chamberlin, M. (Cold Spring Harbor Laboratory, Cold Spring Substituted proteins Harbor, NY), pp. 441-454. the lac repressor (38), the cyclic AMP receptor protein (39), 25. Maquat, L. E. & Reznikoff, W. S. (1978) J. Mol. Biol. 125, histones (40), and several nonhistone chromosomal proteins (41). 476-490. However, the effect on RNA polymerase binding has not been 26. Silverstone, A. E., Arditti, R. R. & Magasanik, B. (1970) Proc. investigated carefully. Jones and Dove (42) did observe a sig- Natl. Acad. Sci. USA 66,773-779. nificant reduction in transcription in vvo from a template 27. Burgess, R. & Jendrisak, J. (1975) Biochemistry 14, 4634- substituted with bromouracil, but the responsible step was not 4638. identified. Because the complex between RNA polymerase and 28. Lowe, P., Hager, D. & Burgess, R. (1979) Biochemistry 18, DNA studied here has the expected stability of an enzyme- 1345-1352. promoter complex and is competent to initiate transcription, 29. Tanaka, T. & Weisblum, B. (1975) J. Bacteriol. 121, 354-362. is those in the 30. D'Andrea, A. D. & Haseltine, W. A. (1978) Proc. Nati. Acad. Sci. it likely that the contacts revealed are exploited USA 75,3608-3612. interaction with unsubstituted DNA. 31. Rapaport, S. A. (1964) Virology 22, 125-130. I thank Walter Gilbert for guidance, Ronald Ogata and Ulrich Sie- 32. Maxam, A. M. & Gilbert, W. (1977) Proc. Natl. Acad. Sci. USA benlist for valuable discussions and criticisms of the manuscript, and 74,560-564. Richard Burgess for communication prior to publication of the protocol 33. Siebenlist, U. (1979) Nucleic Acids Res. 6, 1895-1907. for purification of a-saturated enzyme. This work was supported by 34. Zillig, W., Zechel, K., Rabussay, D., Schachner, M., Sethi, V. S., National Institutes of Health Grant GM-21514 to W. Gilbert. Palm, P., Heil, A. & Seifert, W. (1970) Cold Spring Harbor Symp. Quant. Biol. 35,47-58. 1. Pribnow, D. (1975) Proc. Natl. Acad. Sci. USA 72,784-788. 35. Weintraub, H. (1973) Cold Spring Harbor Symp. Quant. Biol. 2. Schaller, H., Gray, C. & Herrmann, K. (1975) Proc. Natl. Acad. 38,247-256. Sci. USA 72,737-741. 36. Lin, S. Y. & Riggs, A. D. (1974) Proc. Natl. Acad. Sci. USA 71, 3. Maniatis, T., Ptashne, M., Backman, K., Kleid, D., Flashman, S., 947-951. Jeffrey, A. & Maurer, R. (1975) Cell 5, 109-113. 37. Majors, J. (1975) Proc. Natl. Acad. Sci. USA 72,4394-4398. 4. Gilbert, W. (1976) in RNA Polymerase, eds. Losick, R. & 38. Lin, S. & Riggs, A. (1972) Proc. Natl. Acad. Sci. USA 69, Chamberlin, M. (Cold Spring Harbor Laboratory, Cold Spring 2574-2576. Harbor, NY), pp. 193-205. 39. Lin, S. & Riggs, A. D. (1976) Biochim. Biophys. Acta 432, 5. Meyer, B. J., Kleid, D. G. & Ptashne, M. (1975) Proc. Natl. Acad. 185-191. Sci. USA 72,4785-4789. 40. Lin, S., Lin, D. & Riggs, A. D. (1976) Nucleic Acids Res. 3, 6. Dickson, R. C., Abelson, J., Barnes, W. M. & Reznikoff, W. S. 2183-2191. (1975) Science 187, 27-35. 41. Bick, M. D. & Devine, E. A. (1977) Nucleic Acids Res. 4, 7. Kleid, D., Humayun, Z., Jeffrey, A. & Ptashne, M. (1976) Proc. 3687-3700. Nati. Acad. Sci. USA 73,293-297. 42. Jones, T. C. & Dove, W. F. (1972) J. Mol. Biol. 64, 409-416. Downloaded by guest on September 24, 2021