DOCSLIB.ORG

Comprehensive Comparative Homeobox Gene Annotation in Human and Mouse Laurens G

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Comprehensive Comparative Homeobox Gene Annotation in Human and Mouse Laurens G Database, 2015, 1–12 doi: 10.1093/database/bav091 Original Article Original Article Comprehensive comparative homeobox gene annotation in human and mouse Laurens G. Wilming*,Veronika Boychenko and Jennifer L. Harrow HAVANA Group, Informatics Department, Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridgeshire CB10 1SA, UK *Corresponding author: Tel: +44(0)1223496830, Fax: +44(0)1223494919 Email: [email protected] Citation details: Wilming,L., Boychenko, V. and Harrow,J. Comprehensive comparative homeobox gene annotation in human and mouse. Database (2015) Vol. 2015: article ID bav091; doi:10.1093/database/bav091 Received 12 February 2015; Revised 28 August 2015; Accepted 31 August 2015 Abstract Homeobox genes are a group of genes coding for transcription factors with a DNA-bind- ing helix-turn-helix structure called a homeodomain and which play a crucial role in pat- tern formation during embryogenesis. Many homeobox genes are located in clusters and some of these, most notably the HOX genes, are known to have antisense or oppo- site strand long non-coding RNA (lncRNA) genes that play a regulatory role. Because automated annotation of both gene clusters and non-coding genes is fraught with diffi- culty (over-prediction, under-prediction, inaccurate transcript structures), we set out to manually annotate all homeobox genes in the mouse and human genomes. This includes all supported splice variants, pseudogenes and both antisense and flanking lncRNAs. One of the areas where manual annotation has a significant advantage is the annotation of duplicated gene clusters. After comprehensive annotation of all homeobox genes and their antisense genes in human and in mouse, we found some discrepancies with the current gene set in RefSeq regarding exact gene structures and coding versus pseudogene locus biotype. We also identified previously un-annotated pseudogenes in the DUX, Rhox and Obox gene clusters, which helped us re-evaluate and update the gene nomenclature in these regions. We found that human homeobox genes are enriched in antisense lncRNA loci, some of which are known to play a role in gene or gene cluster regulation, compared to their mouse orthologues. Of the annotated set of 241 human protein-coding homeobox genes, 98 have an antisense locus (41%) while of the 277 orthologous mouse genes, only 62 protein coding gene have an antisense locus (22%), based on publicly available transcriptional evidence. Introduction Homeobox genes were first discovered in Drosophila mu- Homeobox genes code for transcription factors that have tants where they were found to affect segmentation and the homeodomain, a DNA-binding helix-turn-helix struc- subsequently they have been found in virtually all other ture encoded by the homeobox, as the defining feature (1). animals and in plants and fungi (2). Through their VC The Author(s) 2015. Published by Oxford University Press. Page 1 of 12 This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. (page number not for citation purposes) Page 2 of 12 Database, Vol. 2015, Article ID bav091 influence on patterning and cell differentiation and reprog- (16–18). It was shown by Zhong et al.(6) that the DUX ramming, homeodomain family proteins play an important subclass of the PRD domain family in human (with our role in embryogenesis (2–4). new annotation 47 members in total) is mostly clustered A large number of homeobox genes exist in gene clus- on chromosomes 4, 10 and Y, with isolated family mem- ters (4). Automatic annotation of cluster genes formed by bers found on other chromosomes, while a total of only six genomic duplication is hampered by high sequence similar- DUX members (eight with our new annotation) were ity between the genes and, in addition, it can be difficult to found in mice, with three of these (Duxbl1, Duxbl2 and distinguish coding genes from pseudogenes. In order to Duxbl3) found in a locally triplicated region on chromo- generate a complete and accurate homeobox gene set, we some 14 (19). Data presented in the paper showed that the initiated an annotation project within the ENCODE (5) human genome is enriched in neighboring lncRNAs com- consortium, focused on homeobox family genes in the pared with the mouse genome and in some genomic re- human and mouse genomes, using the HomeoDB database gions a human protein coding gene had an antisense (6–8) as our main reference source. lncRNA where the mouse orthologue had an opposite The emerging data on the role of long non-coding RNAs strand lincRNA and vice versa. This finding implies that (lncRNAs) in epigenetic regulation (9) inspired us to annotate the antisense nature of non-coding RNAs (as currently all lncRNAs—which includes long intergenic ncRNAs defined) is not as crucial as the simple presence of opposite (lincRNAs), anti-sense lncRNAs and sense intronic strand lncRNAs in the vicinity of a coding gene or gene lncRNAs—in the vicinity of the homeobox genes. Human cluster. This observation is in line with emerging experi- cell line microarray data on HOX clusters (10) revealed strik- mental data showing a more complex functionality of ingly coordinated transcriptional activity antisense to HOX lncRNAs than that which could be drawn from their gen- genes in intergenic regions, suggesting that previously over- omic position relative to coding genes (20). looked lincRNAs play an important role in gene expression In this article, we present an updated analysis of the regulation through yet to be discovered mechanisms. homeobox gene containing regions in human and mouse Recently, the HAVANA group (11) developed new guidelines and highlight the similarities and differences of architecture for lncRNA annotation allowing us to distinguish two main within each genome and give insights into their evolution. groups of lncRNAs according to their genomic location rela- tive to coding genes: antisense and intergenic (lincRNA). This positional classification allows researchers to study the correl- Methods ation, if any, between the expression of different types of Annotation was performed using our in-house Otterlace an- non-coding loci and protein-coding genes. We define a locus notation system, which includes the ZMap graphical ana- (or single transcript) as antisense if it is positioned on the op- lysis and annotation viewer (21, 22). Briefly, genomic posite strand of a protein-coding gene and their maximum sequence in the form of genomic clones (mostly BACs) is genomic spans overlap; intergenic non-coding RNAs, i.e. not analysed through an automated pipeline comprising se- overlapping a protein coding locus, receive the lincRNA bio- quence similarity searches against peptide and nucleotide se- type. Experimental data on a number of antisense lncRNAs quence databases and analysis for repeats, protein domains, obtained in several laboratories has not shown a direct gene CpG islands and gene predictions. In addition, data from a silencing effect caused by antisense transcripts or siRNAs large number of external sources are imported, such as derived from it. However, it was shown that some partici- ENCODE and Ensembl BodyMap (23) RNA-seq transcript pated in other regulatory processes in cis, such as histone models, RNA-seq reads, polyA-seq, Ensembl and RefSeq demethylation, and, more interestingly, in trans,suchasregu- gene models, and CAGE-TSS transcription start site predic- lating genes on the same or a different chromosome by partic- tions (24, 25). Using the annotation system, annotators visu- ipating in polycomb mediated biochemical pathways (12, 13) alize the analysis results and where necessary perform or as ceRNA (competitive endogenous RNA) ‘sponges’ regu- additional analysis, and annotate transcript models where lating the distribution of miRNAs (14). evidence is deemed to support such models. Support comes In general, homeobox genes and gene clusters are con- primarily from aligned sequence data (ESTs, mRNAs, pep- served between the human and mouse genomes. However, tides) from the analysis pipeline with additional features, some families exist in one species but not in the other, or such as functional genomics, transcriptomics and prote- have expanded in one species relative to another. For ex- omics data, taken into account, as outlined in our annota- ample, Obox (oocyte specific homeobox) clusters (15) are tion guidelines (11) and described elsewhere (26–29). specific to mouse (or rodents) while the Rhox (reproduct- Relative levels of sequence similarity referred to in this paper ive homeobox) family is represented by just three members were judged from BLAST or Dotter (30) alignments or, in in human versus 42 members on mouse chromosome X the case of RHOXF versus Rhox, CLUSTALW. Alignments Database, Vol. 2015, Article ID bav091 Page 3 of 12 Figure 1. The Obox cluster and its neighbourhood compared to the orthologous region in human. Figure is not to scale. See figure for a guide to sym- bols and colours. Overlapping symbols on same strand indicate nested genes; overlapping symbols on opposite strands indicate antisense genes. Gene names in italic between brackets indicate—for yet to be named coding genes—the name of the family or closest homologue or—for pseudo- genes—the name of the parent gene or gene family; approved gene names are in bold; pseudogene and lncRNA names are in italic. Some unnamed genes are provided with RefSeq or VEGA identifiers (for the latter, prefix the 11-digit number with OTTHUMG or OTTMUSG for the full ID for human and mouse, respectively). Core duplicated gene cassettes are boxed. Note the complete absence of any OBOX loci in the human genome between the orthologues of the mouse genes that flank its Obox cluster. The bulk of the expansion of the cluster, which contains 52 Obox genes, appears to have been through the tandem duplication of a six-gene cassette—Obox–Obox3–Obox4–Gtpbp4–Ranbp2–Obox—of which eleven copies (not all complete) are present.
Load more

Recommended publications
  • University of California, San Diego
    UNIVERSITY OF CALIFORNIA, SAN DIEGO The post-terminal differentiation fate of RNAs revealed by next-generation sequencing A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Gloria Kuo Lefkowitz Committee in Charge: Professor Benjamin D. Yu, Chair Professor Richard Gallo Professor Bruce A. Hamilton Professor Miles F. Wilkinson Professor Eugene Yeo 2012 Copyright Gloria Kuo Lefkowitz, 2012 All rights reserved. The Dissertation of Gloria Kuo Lefkowitz is approved, and it is acceptable in quality and form for publication on microfilm and electronically: __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ Chair University of California, San Diego 2012 iii DEDICATION Ma and Ba, for your early indulgence and support. Matt and James, for choosing more practical callings. Roy, my love, for patiently sharing the ups and downs of this journey. iv EPIGRAPH It is foolish to tear one's hair in grief, as though sorrow would be made less by baldness. ~Cicero v TABLE OF CONTENTS Signature Page .............................................................................................................. iii Dedication ....................................................................................................................
    [Show full text]
  • Small Cell Ovarian Carcinoma: Genomic Stability and Responsiveness to Therapeutics
    Gamwell et al. Orphanet Journal of Rare Diseases 2013, 8:33 http://www.ojrd.com/content/8/1/33 RESEARCH Open Access Small cell ovarian carcinoma: genomic stability and responsiveness to therapeutics Lisa F Gamwell1,2, Karen Gambaro3, Maria Merziotis2, Colleen Crane2, Suzanna L Arcand4, Valerie Bourada1,2, Christopher Davis2, Jeremy A Squire6, David G Huntsman7,8, Patricia N Tonin3,4,5 and Barbara C Vanderhyden1,2* Abstract Background: The biology of small cell ovarian carcinoma of the hypercalcemic type (SCCOHT), which is a rare and aggressive form of ovarian cancer, is poorly understood. Tumourigenicity, in vitro growth characteristics, genetic and genomic anomalies, and sensitivity to standard and novel chemotherapeutic treatments were investigated in the unique SCCOHT cell line, BIN-67, to provide further insight in the biology of this rare type of ovarian cancer. Method: The tumourigenic potential of BIN-67 cells was determined and the tumours formed in a xenograft model was compared to human SCCOHT. DNA sequencing, spectral karyotyping and high density SNP array analysis was performed. The sensitivity of the BIN-67 cells to standard chemotherapeutic agents and to vesicular stomatitis virus (VSV) and the JX-594 vaccinia virus was tested. Results: BIN-67 cells were capable of forming spheroids in hanging drop cultures. When xenografted into immunodeficient mice, BIN-67 cells developed into tumours that reflected the hypercalcemia and histology of human SCCOHT, notably intense expression of WT-1 and vimentin, and lack of expression of inhibin. Somatic mutations in TP53 and the most common activating mutations in KRAS and BRAF were not found in BIN-67 cells by DNA sequencing.
    [Show full text]
  • Multiple Activities of Arl1 Gtpase in the Trans-Golgi Network Chia-Jung Yu1,2 and Fang-Jen S
    © 2017. Published by The Company of Biologists Ltd | Journal of Cell Science (2017) 130, 1691-1699 doi:10.1242/jcs.201319 COMMENTARY Multiple activities of Arl1 GTPase in the trans-Golgi network Chia-Jung Yu1,2 and Fang-Jen S. Lee3,4,* ABSTRACT typical features of an Arf-family GTPase, including an amphipathic ADP-ribosylation factors (Arfs) and ADP-ribosylation factor-like N-terminal helix and a consensus site for N-myristoylation (Lu et al., proteins (Arls) are highly conserved small GTPases that function 2001; Price et al., 2005). In yeast, recruitment of Arl1 to the Golgi as main regulators of vesicular trafficking and cytoskeletal complex requires a second Arf-like GTPase, Arl3 (Behnia et al., reorganization. Arl1, the first identified member of the large Arl family, 2004; Setty et al., 2003). Yeast Arl3 lacks a myristoylation site and is an important regulator of Golgi complex structure and function in is, instead, N-terminally acetylated; this modification is required for organisms ranging from yeast to mammals. Together with its effectors, its recruitment to the Golgi complex by Sys1. In mammalian cells, Arl1 has been shown to be involved in several cellular processes, ADP-ribosylation-factor-related protein 1 (Arfrp1), a mammalian including endosomal trans-Golgi network and secretory trafficking, lipid ortholog of yeast Arl3, plays a pivotal role in the recruitment of Arl1 droplet and salivary granule formation, innate immunity and neuronal to the trans-Golgi network (TGN) (Behnia et al., 2004; Panic et al., development, stress tolerance, as well as the response of the unfolded 2003b; Setty et al., 2003; Zahn et al., 2006).
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • The Middle Temporal Gyrus Is Transcriptionally Altered in Patients with Alzheimer’S Disease
    1 The middle temporal gyrus is transcriptionally altered in patients with Alzheimer’s Disease. 2 1 3 Shahan Mamoor 1Thomas Jefferson School of Law 4 East Islip, NY 11730 [email protected] 5 6 We sought to understand, at the systems level and in an unbiased fashion, how gene 7 expression was most different in the brains of patients with Alzheimer’s Disease (AD) by mining published microarray datasets (1, 2). Comparing global gene expression profiles between 8 patient and control revealed that a set of 84 genes were expressed at significantly different levels in the middle temporal gyrus (MTG) of patients with Alzheimer’s Disease (1, 2). We used 9 computational analyses to classify these genes into known pathways and existing gene sets, 10 and to describe the major differences in the epigenetic marks at the genomic loci of these genes. While a portion of these genes is computationally cognizable as part of a set of genes 11 up-regulated in the brains of patients with AD (3), many other genes in the gene set identified here have not previously been studied in association with AD. Transcriptional repression, both 12 pre- and post-transcription appears to be affected; nearly 40% of these genes are transcriptional 13 targets of MicroRNA-19A/B (miR-19A/B), the zinc finger protein 10 (ZNF10), or of the AP-1 repressor jun dimerization protein 2 (JDP2). 14 15 16 17 18 19 20 21 22 23 24 25 26 Keywords: Alzheimer’s Disease, systems biology of Alzheimer’s Disease, differential gene 27 expression, middle temporal gyrus.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • The Role of Myc-Induced Protein Synthesis in Cancer
    Published OnlineFirst November 24, 2009; DOI: 10.1158/0008-5472.CAN-09-1970 Review The Role of Myc-Induced Protein Synthesis in Cancer Davide Ruggero School of Medicine and Department of Urology, Helen Diller Family Comprehensive Cancer Center, University of California, San Francisco, San Francisco, California Abstract tions and processing by directly controlling the expression of ribo- Deregulation in different steps of translational control is an nucleases, rRNA-modifying enzymes, and nucleolar proteins NPM emerging mechanism for cancer formation. One example of involved in ribosome biogenesis such as nucleophosmin ( ), Nop52, Nop56 DKC1 an oncogene with a direct role in control of translation is , and (Table 1;ref. 16). Furthermore, Myc in- UBF the Myc transcription factor. Myc directly increases protein duces Upstream Binding Factor ( ) expression, which is an es- synthesis rates by controlling the expression of multiple com- sential transcription factor for RNA Pol I-mediated transcription ponents of the protein synthetic machinery, including ribo- (21). It has also been recently shown that a fraction of the Myc somal proteins and initiation factors of translation, Pol III protein is localized in the nucleolus and directly regulates rRNA rDNA and rDNA. However, the contribution of Myc-dependent in- synthesis by binding to E-box elements located in the pro- – creases in protein synthesis toward the multistep process moter (17 19). In addition, it can activate Pol I transcription by rDNA leading to cancer has remained unknown. Recent evidence binding and recruiting to the promoter SL1, which is essen- strongly suggests that Myc oncogenic signaling may monopo- tial for the assembly of the RNA Pol I pre-initiation complex (18).
    [Show full text]
  • Supplementary Information
    SUPPLEMENTARY INFORMATION Myeloperoxidase-derived 2-chlorohexadecanal is generated in mouse heart during endotoxemia and induces modification of distinct cardiomyocyte protein subsets in vitro Jürgen Prasch, Eva Bernhart, Helga Reicher, Manfred Kollroser, Gerald N. Rechberger, Chintan N. Koyani, Christopher Trummer, Lavinia Rech, Peter P. Rainer, Astrid Hammer, Ernst Malle, Wolfgang Sattler Table S1: Biological process gene ontology (GO) enrichment analysis. #term ID term description observed background false discovery matching proteins in network (labels) gene count gene count rate GO:0006457 protein folding 10 153 5.21e-09 Cct3,Cct5,Cct8,Fkbp4,Hsp90aa1,Hsp a1l,Hspb1,Pdia3,Pdia6,Tcp1 GO:0007339 binding of sperm to 6 36 4.02e-07 Aldoa,Cct3,Cct5,Cct8,Hspa1l,Tcp1 zona pellucida GO:0061077 chaperone-mediated 6 60 2.67e-06 Cct3,Cct5,Cct8,Fkbp4,Hspb1,Tcp1 protein folding GO:0017144 drug metabolic process 11 494 4.06e-06 Aldh2,Aldoa,Eno1,Gapdh,Hsp90aa1,I dh3a,Ldha,Ndufs2,Pgam1,Phgdh,Uq crc1 GO:2000573 positive regulation of 6 69 4.16e-06 Cct3,Cct5,Cct8,Ddx39b,Hsp90aa1,Tc DNA biosynthetic p1 process GO:0009987 cellular process 47 12459 4.22e-06 Alad,Alb,Aldh2,Aldoa,Cct3,Cct5,Cct8, Dctn2,Ddx39,Ddx39b,Des,Eef1g,Eef 2,Eif3f,Eif4a2,Eno1,Fdps,Fkbp4,Gap dh,Hnrnpl,Hsp90aa1,Hspa1l,Hspb1,I dh3a,Ldha,Lmna,Lyz1,Ndufs2,Pcna, Pdia3,Pdia6,Pgam1,Phgdh,Prph,Psm d13,Rpsa,Ruvbl2,Tcp1,Tuba3b,Tubal 3,Tubb3,Tubb6,Uap1l1,Uqcrc1,Uqcrc 2,Vim,Ywhab GO:1904851 positive regulation of 4 10 4.22e-06 Cct3,Cct5,Cct8,Tcp1 establishment of protein localization to telomere GO:0046031
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • A Upf3b-Mutant Mouse Model with Behavioral and Neurogenesis Defects
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Mol Psychiatry Manuscript Author . Author Manuscript Author manuscript; available in PMC 2018 September 27. Published in final edited form as: Mol Psychiatry. 2018 August ; 23(8): 1773–1786. doi:10.1038/mp.2017.173. A Upf3b-mutant mouse model with behavioral and neurogenesis defects L Huang1, EY Shum1, SH Jones1, C-H Lou1, J Dumdie1, H Kim1, AJ Roberts2, LA Jolly3,4, J Espinoza1, DM Skarbrevik1, MH Phan1, H Cook-Andersen1, NR Swerdlow5, J Gecz3,4, and MF Wilkinson1,6 1Department of Reproductive Medicine, School of Medicine, University of California, San Diego, La Jolla, California, USA 2Department of Molecular and Cellular Neuroscience, The Scripps Research Institute, 10550 North Torrey Pines Road, MB6, La Jolla, CA 92037, USA 3School Adelaide Medical School and Robison Research Institute, University of Adelaide, Adelaide, SA 5005, Australia 4South Australian Health and Medical Research Institute, Adelaide, SA, 5005, Australia 5Department of Psychiatry, School of Medicine, University of California, San Diego, La Jolla, California, USA 6Institute of Genomic Medicine, University of California, San Diego, La Jolla, CA Abstract Nonsense-mediated RNA decay (NMD) is a highly conserved and selective RNA degradation pathway that acts on RNAs terminating their reading frames in specific contexts. NMD is regulated in a tissue-specific and developmentally controlled manner, raising the possibility that it influences developmental events. Indeed, loss or depletion of NMD factors have been shown to disrupt developmental events in organisms spanning the phylogenetic scale. In humans, mutations in the NMD factor gene, UPF3B, cause intellectual disability (ID) and are strongly associated with autism spectrum (ASD), attention deficit hyperactivity disorder (ADHD), and schizophrenia (SCZ).
    [Show full text]
  • Transcription Factor Gene Expression Profiling and Analysis of SOX Gene Family Transcription Factors in Human Limbal Epithelial
    Transcription factor gene expression profiling and analysis of SOX gene family transcription factors in human limbal epithelial progenitor cells Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat. vorgelegt von Dr. med. Johannes Menzel-Severing aus Bonn Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg Tag der mündlichen Prüfung: 7. Februar 2018 Vorsitzender des Promotionsorgans: Prof. Dr. Georg Kreimer Gutachter: Prof. Dr. Andreas Feigenspan Prof. Dr. Ursula Schlötzer-Schrehardt 1 INDEX 1. ABSTRACTS Page 1.1. Abstract in English 4 1.2. Zusammenfassung auf Deutsch 7 2. INTRODUCTION 2.1. Anatomy and histology of the cornea and the corneal surface 11 2.2. Homeostasis of corneal epithelium and the limbal stem cell paradigm 13 2.3. The limbal stem cell niche 15 2.4. Cell therapeutic strategies in ocular surface disease 17 2.5. Alternative cell sources for transplantation to the corneal surface 18 2.6. Transcription factors in cell differentiation and reprogramming 21 2.7. Transcription factors in limbal epithelial cells 22 2.8. Research question 25 3. MATERIALS AND METHODS 3.1. Human donor corneas 27 3.2. Laser Capture Microdissection (LCM) 28 3.3. RNA amplification and RT2 profiler PCR arrays 29 3.4. Real-time PCR analysis 33 3.5. Immunohistochemistry 34 3.6. Limbal epithelial cell culture 38 3.7. Transcription-factor knockdown/overexpression in vitro 39 3.8. Proliferation assay 40 3.9. Western blot 40 3.10. Statistical analysis 41 2 4. RESULTS 4.1. Quality control of LCM-isolated and amplified RNA 42 4.2.
    [Show full text]