Molecular Determinants of Dihydrouridine Synthase Activity

FEBS Letters 580 (2006) 5198–5202

Molecular determinants of dihydrouridine synthase activity

Dan F. Savagea, Vale´rie de Cre´cy-Lagardb, Anthony C. Bishopa,* a Department of Chemistry, Amherst College, Amherst, MA 01002, USA b Department of Microbiology and Cell Science, University of Florida, P.O. Box 110700, Gainesville, FL 32611-0700, USA

Received 31 May 2006; revised 20 July 2006; accepted 14 August 2006

Available online 5 September 2006

Edited by Lev Kisselev

conformational flexibility of tRNA [5,6]. However, the biolog- Abstract Dihydrouridine is one of the most abundant modified bases in tRNA. However, little is known concerning the biochemical ramifications of this increased flexibility are unclear. istry of dihydrouridine synthase (DUS) enzymes. To identify The family of dihydrouridine synthase (DUS) enzymes, molecular determinants that are necessary for DUS activity, which catalyze the modification of uridine to dihydrouridine, we have developed a DUS-complementation assay in Escherichia has been identified in Saccharomyces cerevisiae and E. coli coli. Using this assay, we have identified amino-acid residues that [7,8]. DUSs comprise a discrete gene family, allowing putative are critical for the activity of YjbN, an E. coli DUS. We also DUS genes from other organisms to be proposed based on show that the aq1598 gene product, a putative DUS from Aqui- sequence homology. However, little is known concerning DUS fex aeolicus, catalyzes dihydrouridine formation, providing the biochemistry. No previous studies have described the regions first biochemical demonstration that A. aeolicus encodes an ac- of DUS enzymes that give rise to their activity, specificity, or tive DUS. mechanism of action. Ó 2006 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. The goal of the current work is to elucidate the biochemical determinants that are necessary for DUS activity. Toward this Keywords: tRNA; tRNA modification; Dihydrouridine; end, our attempts at developing an in vitro activity assay for Dihydrouridine synthase; YjbN; Site-directed mutagenesis the three E. coli DUSs (YjbN, YhdG, and YohI) have not, to date, been successful, presumably due to a combination of two factors: protein instability (we have observed precipitation of purified DUSs) and incorrect choice of tRNA substrate (the tRNA specificity of the individual E. coli DUSs is not known). 1. Introduction To circumvent these technical hurdles, we have developed an in vivo DUS-complementation assay. Utilizing an E. coli strain 3 Transfer RNA is the central adapter molecule in translation, from which all three DUS genes have been deleted (D dus), as it provides the physical link between the genetic information and, consequently, produces tRNA with no detectable of messenger RNA and the addition of correctly ordered dihydrouridine, we have reconstituted the tRNA’s dihydrouri- amino acids to a growing polypeptide chain. One of the struc- dine content through reintroduction of plasmid-borne DUS tural hallmarks of tRNA is the presence of a wide variety of genes. The dihydrouridine-free strain thus acts as a ‘‘blank post-transcriptionally modified RNA bases [1]. More than 90 slate’’ for testing the ability of mutant DUS genes, or putative different modifications have been identified [2,3] (30–50 can DUS genes, to catalyze dihydrouridine formation in living be found in a given organism [4]) and each tRNA isoacceptor cells. Measurement of the dihydrouridine levels in tRNA puri- has a particular modification pattern [1]. Dihydrouridine is one fied from the reconstituted strains gives a direct readout of the of the most abundant modified tRNA bases in prokaryotes DUS capability of the introduced gene. We have applied this and eukaryotes [1]. It differs from uridine only by the reduction complementation scheme to mutant E. coli DUSs, as well as of uridine’s carbon-carbon double bond (Fig. 1), and is found a putative DUS from the thermophilic bacterium Aquifex predominantly in the D-loop of tRNA, which can contain aeolicus, allowing us to identify amino-acid residues that are varying numbers of dihydrouridine residues. (The tRNA mol- critical for DUS activity, and to unambiguously assign DUS ecules of, for instance, Escherichia coli contain up to four activity to a biochemically uncharacterized gene. dihydrouridine residues with the vast majority containing at least one [1].) Despite its widespread occurrence, little is known about dihydrouridine’s roles in mediating tRNA function. The 2. Materials and methods most likely chemical role of dihydrouridine is to enhance the 2.1. Strain and plasmid construction 2.1.1. D3dus. The construction of the E. coli D3dus strain has been described previously [8]. 2.1.2. YjbN-expressing plasmids. The yjbN gene was amplified from E. coli (MG1655) genomic DNA using the following primers (50–30): *Corresponding author. Fax: +1 413 542 2735. ATAACATAACCCCATGATATATCG and ACGGTGCGC- E-mail address: [email protected] (A.C. Bishop). AGGGCGTGGTGAATTTG. The resulting PCR product was inserted into pPCR4-topo (Invitrogen), according to the manufacturer’s Abbreviations: DUS, dihydrouridine synthase; DHODH, dihydrooro- instructions, to give pVDC597. Digestion of pVDC597 with EcoRI, tate dehydrogenase; DHPDH, dihydropyrimidine dehydrogenase; yielded a 1.1 kb fragment which was ligated into EcoRI-digested FMN, flavin mononucleotide pVDC521 (a slightly modified version of pBAD18 [9]) yielding

0014-5793/$32.00 Ó 2006 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2006.08.062 D.F. Savage et al. / FEBS Letters 580 (2006) 5198–5202 5199

Fig. 1. Chemical structures of uridine and dihydrouridine. pVDC205. Site-directed mutagenesis on pVDC205 was performed using the Quikchange mutagenesis kit (Stratagene) according to the manufacturer’s guidelines. The sequences of the eleven sets of mutagenic primers can be found in ‘‘Supplementary material’’ (Table S1). After mutagenesis, the DNA products were transformed into DH5a and selected on LB-agar/ampicillin. Plasmid DNA from individual ampicillin-resistant colonies was harvested. Introduction of the desired mutations was confirmed by sequencing over the YjbN-coding region (Biotechnology Resource Center, Cornell University). Mutant plasmids were heat transformed into D3dus, and plasmid-harboring colonies were selected on LB-agar/ampicillin/chloramphenicol. 2.1.3. Aq1598-expressing plasmid (pVDC581). The aq1598 gene was amplified from A. aeolicus genomic DNA using the following primers (50–30): GCGCCATGGACTTCAAAAAGGGAGAGGTA- ATTC and GCGAAGCTTTTAGTCGACGGCATAAAGTAATT- CCCTCTCCTTCG. (Addition of 10% DMSO to the PCR mixture was necessary for efficient amplification.) The resulting PCR product was doubly digested with NcoI and HindIII, gel purified, and inserted into NcoI/HindIII-digested pBAD24 [9].

2.2. tRNA preparation Fig. 2. Reconstitution of dihydrouridine in E. coli tRNA through Two ml of saturated E. coli cultures were diluted into 250 ml LB genetic complementation. An E. coli strain containing no genomic (supplemented with the appropriate antibiotics and glucose or arabi- DUSs (D3dus) was transformed with empty vector or a vector nose concentration) and harvested during late log phase growth containing yjbN. The strains were grown with the indicated concen- (OD600 0.8–1.0). Frozen cell pellets were resuspended in 7 ml re-sus- trations of glucose (G) or arabinose (A), and their tRNA as harvested. pension buffer (0.3 M sodium acetate, 10 mM EDTA, pH 5.2) and ex- The dihydrouridine content of 80 lg tRNA from each sample was tracted twice with buffer-saturated phenol (pH 4.3). The aqueous layer quantified as described in Section 2. The right bar indicates the was collected and total RNA was precipitated with ethanol. The tRNA equivalent experiment performed with a double-DUS-knockout strain was purified on a Nucleobond AX-500 column (Clontech) according to (DyhdG/DyohI) that harbors genomic yjbN as its sole DUS gene. the manufacturer’s protocol, precipitated with isopropanol, washed with 80% ethanol, and re-dissolved in RNase-free water. Concentra- tions of tRNA samples were assessed by measuring their respective was found to be independent of arabinose concentration, A260 values. and reached maximum levels even in the absence of arabinose or in the presence of glucose, an expression repressor (Fig. 2). 2.3. Total dihydrouridine assay The reintroduced dihydrouridine levels (regardless of arabi- Colorimetric measurement of dihydrouridine content in tRNA con- nose concentration) are also comparable to that of a previ- tent was performed essentially as described [8,10,11] (also see ‘‘Supple- mentary material’’ for a detailed protocol.) Bars and error bars in Figs. ously described double-DUS-knockout strain (DyhdG/DyohI) 2–4 represent the average (A550–A465) values and standard deviations, [8] that harbors genomic yjbN as its sole DUS gene. These respectively, derived from at least three independent experiments. results suggest that, for wild-type YjbN, tRNA-dihydrouridine levels are essentially independent of the enzyme concentration in a cell, as the population of highly YjbN- 3. Results expressing cells increases at high arabinose concentrations [12]. (See Figure S1 in ‘‘Supplementary material’’ for a dem- 3.1. Reconstitution of E. coli YjbN activity onstration of arabinose-dependent YjbN overexpression.) It has not previously been shown that DUS activity can be Moreover, the presence of full-dihydrouridine content in the reconstituted in an organism that lacks dihydrouridine. To absence of arabinose, implies that even low levels of active investigate complementation as a means of evaluating DUS YjbN are sufficient to completely modify YjbN’s cellular tar- activity, we cloned yjbN, a DUS-encoding gene from E. coli gets. [8], into a plasmid carrying an arabinose-inducible promoter (pBAD18). Introduction of the resulting plasmid (pVDC205) 3.2. DUS activity of YjbN mutants into D3dus gave rise to substantial tRNA-dihydrouridine for- To identify residues that are for critical DUS activity mation (Fig. 2). The YjbN-produced dihydrouridine content in E. coli, and, potentially, in DUS enzymes from other 5200 D.F. Savage et al. / FEBS Letters 580 (2006) 5198–5202

Fig. 3. Design and analysis of YjbN mutants. (A) Partial sequence alignment of the three E. coli DUSs (YjbN, YhdG, and YohI) with human DUS2 (hDUS2). Positions that are conserved among the four DUSs, but not mutated in the current work, are marked with asterisks. Mutated YjbN residues are highlighted and numbered. (B) and (C) DUS activity of YjbN mutants. The indicated YjbN mutants were introduced into D3dus, and the resulting strains were grown in 0.02% arabinose (B) or in the absence or arabinose (C). Purification of tRNA samples and dihydrouridine quantification (80 lg tRNA) for panels B and C was carried out as described in the legend of Fig. 2 and Section 2. organisms as well, we introduced a series of alanine mutations mutants (C114A and K153A) produced tRNA with no detect- into yjbN. Our mutational analysis was guided by a primary able dihydrouridine (Fig. 3B). sequence alignment of four DUSs: the three E. coli DUSs, Among the mutants that retained significant DUS activity and a human DUS, hDUS2, that has been implicated in pul- when grown in the presence of 0.02% arabinose were monary carcinogenesis (Fig. 3A) [13]. Only 22 positions are N111A, R155A, H186A, and R188A YjbN. These results were conserved among these four DUSs, and from these we selected somewhat unexpected, as N111 and R155 are two of the four eight yjbN positions for mutation (N111, C114, P115, K153, residues that are rigorously conserved among DUSs, and H186 R155, H186A, R188, R249, Fig. 3A). (We avoided hydropho- and R188 are also strongly conserved. All four of these amino bic residues and glycine residues. An exception: P115, which acids are also predicted to lie in the active site of DUSs (see was mutated, as it lies in the most highly conserved region of Section 4). We hypothesized that the observed activity of these DUSs.) Among our mutational positions are the only four mutants may be an artifact of overexpression. To test this idea, positions that are rigorously conserved in a more extensive we re-grew these strains in media that lacked arabinose, and alignment of 64 putative DUSs from various organisms: purified the resulting tRNA. In contrast to wild-type YjbN, N111, C114, K153, and R155. Additionally, R27 and E57 of whose DUS-complementation level is arabinose-independent YjbN were mutated, as these residues are conserved in the (Fig. 2), N111A, R155A, H186A, and R188A YjbN all pro- three E. coli DUSs, if the alignment is performed without duce no detectable dihydrouridine when grown in the absence hDUS2 (not shown). A total of eleven mutants at ten positions of arabinose (Fig. 3C). Most likely, these four mutants have were constructed and introduced into D3dus (the one conserved substantial catalytic deficiencies, which preclude detectable DUS cysteine residue, C114, was replaced with both serine and dihydrouridine formation at low enzyme-expression levels. alanine). These deficiencies can be overcome in vivo, however, through We harvested tRNA from each of the mutant DUS-express- protein overexpression (Fig. 3B). ing strains and analyzed the tRNA samples for dihydrouridine content (Fig. 3B). We found that YjbN activity is surprisingly 3.3. DUS activity of Aq1598 resilient to mutation when the mutant-expressing strains are Although putative DUS genes can be readily identified grown in the presence of arabinose (0.02%). Nine of the eleven through sequence homology, few DUSs have been biochemi- YjbN mutants retained substantial DUS activity, while two cally confirmed. DUS complementation may provide a rapid D.F. Savage et al. / FEBS Letters 580 (2006) 5198–5202 5201

However, the aq1598 gene product gives rise to substantially lower amounts of dihydrouridine than does E. coli YjbN. (Due to the lower dihydrouridine content of Aq1598-modified tRNA, 150 lg of tRNA, instead of 80 lg, was used, as a means to increase the signal-to-noise ratio of the assay.) The low dihydrouridine content of Aq1598-expressing cells is presumably due to a combination of specificity (Aq1598 may only rec- ognize a subset of E. coli tRNAs) and activity (Aq1598 has been transferred from a thermophilic organism into a meso- philic one, and it presumably has non-optimal kinetic param- eters with E. coli tRNA substrates). Our results demonstrate that A. aeolicus does encode an active DUS. Moreover, modification of E. coli tRNAs by the aq1598 gene product provides the first example of cross-species DUS activity.

4. Discussion

We have developed a DUS-complementation assay that has allowed us to identify six amino acids that are necessary for Fig. 4. DUS activity of Aq1598. (A) Partial sequence alignment of E. coli YjbN and Aq1598. Activity-determining residues, as identified YjbN’s full in vivo catalytic activity. (While it is possible that in the experiments shown in Fig. 3 are highlighted. (B) E. coli strain these mutations disrupt activity through a trivial mechanism, D3dus was transformed with empty vector, a vector containing yjbN,or such as disruption of protein folding, this scenario is unlikely, a vector containing aq1598. The resulting strains were grown in the as all six mutants express efficiently as soluble 6-His-tagged presence of 0.02% arabinose, and their tRNA was harvested. The dihydrouridine content of each sample (150 lg of tRNA) was constructs and can be purified at wild-type levels. See Figure quantified as described in the legend of Fig. 2 and Section 2. S2 of ‘‘Supplementary material.’’) Due to the strong conserva- tion of the activity-determining residues across the DUS family, it is likely that they will control the activity of other means for testing the biochemical activity of exogenous DUS DUSs, as well. To better understand the role of these amino genes, including genes from organisms that have not been acids, we have mapped them onto the three-dimensional struc- shown to contain dihydrouridine. To test this idea, we intro- ture of TM0096, a putative DUS from Thermotoga maritima, duced aq1598 from A. aeolicus into D3dus E. coli. The which comprises a flavin mononucleotide (FMN)-binding aq1598 gene encodes a putative DUS that possesses all six of a/b-barrel domain in addition to a C-terminal 4-helix bundle the amino acid residues that we found to be required for (Fig. 5A) [14]. (No structure of a biochemically confirmed wild-type-like YjbN activity (N93, C96, K138, R140, H166, DUS has been reported.) When aligned with TM0096 R168 in Aq1598 numbering, Fig. 4A). As shown in Fig. 4B, (Fig. 5B), all six of YjbN’s catalytically important residues Aq1598-expressing E. coli cells do, indeed, produce dihydro- lie in the putative active site of the a/b barrel; and all six are uridine, when grown in the presence of arabinose (0.02%). within 6 A˚ of the bound FMN molecule (Fig. 5C). Together,

Fig. 5. Proposed locations of catalytically important YjbN residues. (A) The three-dimensional structure of the putative DUS, TM0096, is shown as a ribbon diagram in magenta (PDB: 1VHN) [14]. The sidechains of N111, C114, K153, R155, H186, R188 are shown as balls and sticks. FMN and an active-site-bound sulfate ion are shown as sticks. Atom coloring is by element: gray for carbon, red for oxygen, blue for nitrogen, and yellow for sulfur. (B) Partial sequence alignment of E. coli YjbN and TM0096. Activity-determining residues, as identified in the experiments shown in Fig. 3 are highlighted. (C) A close-up representation of the DUS active site. Atomic rendering and coloring are as in panel A. Amino-acid numbering is according to E. coli YjbN. 5202 D.F. Savage et al. / FEBS Letters 580 (2006) 5198–5202 these six residues make up a large fraction of the FMN-bind- [3] Grosjean, H., Sprinzl, M. and Steinberg, S. (1995) Posttranscrip- ing catalytic site. tionally modified nucleosides in transfer RNA: their locations and Previous work from other families of oxidoreductases allows frequencies. Biochimie 77, 139–141. [4] Bjork, G.R., Ericson, J.U., Gustafsson, C.E., Hagervall, T.G., us to speculate further regarding the catalytic role of one of Jonsson, Y.H. and Wikstrom, P.M. (1987) Transfer RNA YjbN’s critical residues, C114. Our data from the C114S and modification. Annu. Rev. Biochem. 56, 263–287. C114A YjbN mutants show that an amino acid capable of [5] Dalluge, J.J., Hashizume, T., Sopchik, A.E., McCloskey, J.A. and acid/base (or, less likely, nucleophilic) catalysis is necessary Davis, D.R. (1996) Conformational flexibility in RNA: the role of dihydrouridine. Nucleic Acids Res. 24, 1073–1079. at position 114 for DUS activity: a serine mutation at 114 is [6] Dalluge, J.J., Hamamoto, T., Horikoshi, K., Morita, R.Y., tolerated, but the alanine mutant is devoid of detectable activ- Stetter, K.O. and McCloskey, J.A. (1997) Posttranscriptional ity. These findings are analogous to previous studies on homol- modification of tRNA in psychrophilic bacteria. J. Bacteriol. 179, ogous enzymes that catalyze similar redox chemistry, namely 1918–1923. the dihydroorotate dehydrogenases (DHODHs) and dihydro- [7] Xing, F., Martzen, M.R. and Phizicky, E.M. (2002) A conserved family of Saccharomyces cerevisiae synthases effects dihydrouri- pyrimidine dehydrogenases (DHPDHs) [15–18]. Both of these dine modification of tRNA. RNA. 8, 370–381. families are weakly homologous to the DUSs, and each pos- [8] Bishop, A.C., Xu, J., Johnson, R.C., Schimmel, P. and de Crećy- sesses a conserved cysteine that aligns with C114 of YjbN. Lagard, V. (2002) Identification of the tRNA-dihydrouridine Mutagenic and kinetic data have pinpointed this conserved synthase family. J. Biol. Chem. 277, 25090–25095. [9] Guzman, L.M., Belin, D., Carson, M.J. and Beckwith, J. (1995) cysteine as a key general-acid/base catalyst in both DHODHs Tight regulation, modulation, and high-level expression by and DHPDHs [17,18]. (Interestingly, the catalyst is a serine vectors containing the arabinose pBAD promoter. J. Bacteriol. residue in one DHODH family [19].) Our data suggest that 177, 4121–4130. C114 is likely to play a similar role in the DUS-catalyzed reac- [10] Jacobson, M. and Hedgcoth, C. (1970) Determination of 5,6- tion. dihydrouridine in ribonucleic acid. Anal. Biochem. 34, 459–469. [11] Hunninghake, D. and Grisolia, S. (1966) A sensitive and One of the fascinating and outstanding questions regarding convenient micromethod for estimation of urea, citrulline, and DUS function is that of tRNA specificity. Previous work has carbamyl derivatives. Anal. Biochem. 16, 200–205. shown that E. coli DUSs have non-overlapping tRNA sub- [12] Morgan-Kiss, R.M., Wadler, C. and Cronan, J.E. (2002) Long- strates [8], and that the DUSs of S. cerevisiae act specifically term and homogeneous regulation of the Escherichia coli araBAD promoter by use of a lactose transporter of relaxed specificity. on particular D-loop positions [20]. However, this cannot be Proc. Natl. Acad. Sci. USA 99, 7373–7377. the case for all organisms. For example, the Mycoplasma [13] Kato, T. et al. (2005) A novel human tRNA-dihydrouridine mycoides genome encodes only a single DUS, yet its tRNA synthase involved in pulmonary carcinogenesis. Cancer Res. 65, contains multiple modification sites [1,21]. Moreover, our cur- 5638–5646. rent results show that the specificity of a DUS is not limited to [14] Park, F. et al. (2004) The 1.59 A resolution crystal structure of TM0096, a flavin mononucleotide binding protein from Thermo- the corresponding tRNAs of its natural host—DUS activity toga maritima. Proteins 55, 772–774. can be readily transferred from A. aeolicus to E. coli. The bio- [15] Jensen, K.F. and Bjornberg, O. (1998) Evolutionary and func- chemical means by which DUSs are able to achieve this deli- tional families of dihydroorotate dehydrogenases. Paths to cate balance between promiscuity and specificity of tRNA Pyrimidines 6, 20–28. [16] Rowland, P., Norager, S., Jensen, K.F. and Larsen, S. (2000) target remains to be explored. Structure of dihydroorotate dehydrogenase B: electron transfer between two flavin groups bridged by an iron–sulphur cluster. Acknowledgements: Molecular-graphics images were produced using Structure Fold. Des. 8, 1227–1238. the UCSF Chimera package from the Computer Graphics Laboratory, [17] Marcinkeviciene, J., Tinney, L.M., Wang, K.H., Rogers, M.J. and University of California, San Francisco (supported by NIH P41 RR- Copeland, R.A. (1999) Dihydroorotate dehydrogenase B of 01081). The authors thank Amherst College and the University of Enterococcus faecalis. Characterization and insights into chemical Florida for funding. mechanism. Biochemistry 38, 13129–13137. [18] Rosenbaum, K., Jahnke, K., Curti, B., Hagen, W.R., Schnackerz, K.D. and Vanoni, M.A. (1998) Porcine recombinant dihydropyrimidine dehydrogenase: comparison of the spectroscopic and Appendix A. Supplementary data catalytic properties of the wild-type and C671A mutant enzymes. Biochemistry 37, 17598–175609. Detailed experimental protocols for measuring tRNA- [19] Bjornberg, O., Jordan, D.B., Palfey, B.A. and Jensen, K.F. (2001) dihydrouridine content, Table S1, and Figs. S1 and S2. Supple- Dihydrooxonate is a substrate of dihydroorotate dehydrogenase mentary data associated with this article can be found, in the (DHOD) providing evidence for involvement of cysteine and serine residues in base catalysis. Arch. Biochem. Biophys. 391, online version, at doi:10.1016/j.febslet.2006.08.062. 286–294. [20] Xing, F., Hiley, S.L., Hughes, T.R. and Phizicky, E.M. (2004) The References specificities of four yeast dihydrouridine synthases for cytoplasmic tRNAs. J. Biol. Chem. 279, 17850–17860. [21] Westberg, J., Persson, A., Holmberg, A., Goesmann, A., Lunde- [1] Sprinzl, M., Horn, C., Brown, M., Ioudovitch, A. and Steinberg, berg, J., Johansson, K.E., Pettersson, B. and Uhlen, M. (2004) S. (1998) Compilation of tRNA sequences and sequences of The genome sequence of Mycoplasma mycoides subsp. mycoides tRNA genes. Nucleic Acids Res. 26, 148–153. SC type strain PG1T, the causative agent of contagious bovine [2] McCloskey, J.A. and Crain, P.F. (1998) The RNA modification pleuropneumonia (CBPP). Genome Res. 14, 221–227. database-1998. Nucleic Acids Res. 26, 196–197.