DEFORMED WING VIRUS (DWV) TRANSMISSION ACROSS
POLLINATORS OF HAWAI‘I
A THESIS SUBMITTED TO THE GRADUATE DIVISION OF THE
UNIVERSITY OF HAWAI‘I AT MĀNOA FOR THE
DEGREE OF MASTER OF SCIENCE
IN
ENTOMOLOGY
DECEMBER 2020
BY
JESSIKA SANTAMARIA
DISSERTATION COMMITTEE:
ETHEL M. VILLALOBOS, CHAIRPERSON
MARK G. WRIGHT
LEYLA KAUFMAN
Dedicated to Ophelia Diana Litzelman Santamaria, my little larva
i
ACKNOWLEDGEMENTS
I would like to thank the entire UH Bee Lab – Ethel Villalobos, Scott Nikaido, Jason
Wong, and Zhening Zheng - for the immeasurable support, both physical and emotional, they have provided over the years. I would also like to offer my thanks to our extended bee family,
Laura Brettell, Steve Martin, George Hudes, and Charlie Repun. Additionally, Minami Sato,
Melissa Seymour, and Hannah Hiraki for the help and company they provided me during lab work. Furthermore, to the various beekeepers, farmers, and organizations who let us sample on their lands. And lastly, to my husband Eli Litzelman, whose love, support, patience, and encouragement made finishing my degree possible.
ii
ABSTRACT
These studies explore the impact Deformed wing virus (DWV) on the pollinators of
Hawai‘i. DWV is a well-studied virus, now commonly associated with the European honey bee,
Apis mellifera (Hymenoptera: Apidae), populations. The documented decline of honey bee populations worldwide led past researchers to determine this virus played a vital role in their dwindling numbers. Research attention had now shifted to look at the DWV presence in non-
Apis communities in the mainland, but only recently has research explored the unique ecology
Hawai‘i offers.
The first chapter investigates the indirect role of the Varroa destructor mite, a honey bee pest, and how its introduction to the state of Hawai‘i in 2007, influences the continued spread of
DWV, not only within honey bee communities, but to surrounding insect populations. In this study, we utilized the limited distribution of the Varroa mite in the Hawaiian archipelago to compare DWV prevalence on non-Apis flower visitors, and test whether Varroa presence is linked to a viral spillover to these populations. We select the two islands: O‘ahu, where V. destructor has been present since 2007, and Maui, where the mite remains absent. Individuals of
A. mellifera, Ceratina smaragdula, and Polistes spp. were assessed and used to compare the
DWV prevalence in the Hymenoptera community of the two islands. DWV was detected in the non-Apis Hymenoptera collected from O‘ahu but was absent from samples collected on Maui.
These results suggest an indirect, but significant, increase on the DWV prevalence in the
Hymenoptera community in mite-infected islands.
The second study focused on the DWV prevalence in the bee genus, Hylaeus
(Hymenoptera: Colletidae). The Hawaiian Islands are home to more than 60 endemic species of
Hylaeus, commonly referred to as yellow-faced bees. Their ecological history and distribution
iii
are unique to the archipelago and their numbers have unfortunately dwindled in the past years.
The decrease in populations have to do with many factors which include destruction of natural habitats, the introduction of predatory wasps, and the introduction of ants to the islands. The introduction of pathogens and diseases has also been suspected but not documented. We sampled populations of two non-native species of Hylaeus, on Oahu, to determine their DWV status.
Additionally, DWV strains for these species are reported. For the first time, DWV presence was found for this genus in Hawai‘i. DWV viral levels of combined Hylaeus species were comparable to those of Hymenoptera in previous Hawai‘i studies. However, when divided across the two species, H. albonitens had almost twice the DWV prevalence when compared to H. strenuus. These results may indicate that despite being ecologically and evolutionarily closely related, DWV prevalence can still have great variability within a genus, and DWV strain types vary across non-Apis groups.
The third chapter sets a foundation for future DWV research in Hawai‘i, by making a preliminary list of the groups of flower-visiting insects that carry DWV at sites where they overlap with honey bee populations. Pollinators, which rely on flowers as their food source, also encounter a myriad of pathogens when visiting these sites. Yet, determining when and which pathogen a pollinator will encounter during a flower visit is a difficult task. The disease interactions between flower visiting insects is a diverse and complex web, made up of many variables and factors. By mapping these interactions, we can start to better understand the spread of diseases between pollinator communities at these sites, especially when we consider the potential impact DWV may have on these communities. This survey, conducted over a period of
4 years, across various sites on the island of O‘ahu, explores the prevalence of DWV in different flower-visiting insects, and how these viral rates differ over time and across species.
iv
TABLE OF CONTENTS
DEDICATION ...... i
ACKNOWLEDGMENTS ...... ii
ABSTRACT ...... iii
CHAPTER 1: EVIDENCE OF VARROA-MEDIATED DEFORMED WING VIRUS
SPILLOVER IN HAWAI‘I ...... 1
Abstract ...... 1
1.1 Introduction ...... 2
1.2 Methods ...... 4
1.2.1 Specimen collection ...... 4
1.2.2 DWV Detection ...... 5
1.2.3 Statistical analysis ...... 6
1.3 Results ...... 6
1.4 Discussion ...... 7
1.5 Conclusion ...... 11
References ...... 13
CHAPTER 2: MOUTHFUL OF VIRUS: DEFORMED WING VIRUS PRESENCE IN
HYLAEUS (HYMENOPTERA: COLLETIDAE) ...... 22
Abstract ...... 22
2.1 Introduction ...... 23
2.2 Methods ...... 27
2.2.1 Specimen collection ...... 27
v
2.2.2 DWV Detection ...... 27
2.2.3 Statistical analysis ...... 29
2.3 Results ...... 29
2.4 Discussion ...... 30
References ...... 42
CHAPTER 3: FLOWERS ARE DIRTY DOORKNOBS: POSSIBLE DWV TRANSMISSION
ROUTES ACROSS THE POLLINATORS OF O‘AHU ...... 52
Abstract ...... 52
3.1 Introduction ...... 53
3.2 Methods ...... 56
3.2.1 Specimen collection ...... 56
3.2.2 DWV Detection ...... 57
3.3 Results ...... 58
3.4 Discussion ...... 66
References ...... 71
RECOMMENDATIONS FOR FUTURE WORKS ...... 76
Appendix ...... 78
vi
LIST OF TABLES
Table 2.1 A list of all primers used in this study. All three known Deformed wing virus (DWV)
master variants were tested to determine presence or absence in our bee samples. Primers
sequences were obtained from previously published studies ...... 37
Table 2.2 Deformed wing virus (DWV) strain prevalence in Apis and Hylaeus spp. in 2016 and
in 2018 in Hawai‘i ...... 38
Table 2.3 Deformed wing virus (DWV) positive Hymenoptera species from studies in different
countries...... 39
Table 3.1 Summary of Deformed wing Virus (DWV) positive prevalence among insects sharing
floral resources in the field (O‘ahu, HI)...... 60
vii
LIST OF FIGURES
Fig. 1.1 Comparison of DWV prevalence in several species of Hymenoptera on O‘ahu, (light
blue bars) and Maui (purple bar) ...... 12
Fig. 2.1 a) Hylaeus female dehydrating nectar (image Karl Magnacca); b) Hylaeus with nectar
collected from bottlebrush, Callistemon sp. (image Ethel M. Villalobos) ...... 35
Fig. 2.2 Honey bee (Apis mellifera) foraging on bottlebrush, Callistemon sp. Picture taken
August 19th, 2019 at the Urban Garden Centre, Pearl City, HI (image Ethel M.
Villalobos)...... 36
Fig. 3.1 Relative prevalence of Deformed wing virus (DWV) for common bee species. Apis
mellifera (n = 70), Ceratina smaragdula (n = 104), and 6 other species of bees combined
(Xylocopa sonorina, Megachile umbripennis, Ceratina dentipes, Lasioglossum sp.,
Hylaeus strenuus, and Hylaeus albonitens) (n = 43) ...... 61
Fig. 3.2 Prevalence of DWV in the paper wasp Polistes aurifer (n = 20) and the solitary bee
Hylaeus strenuus (n = 15) sharing flower use with honey bees ...... 62
Fig. 3.3 Prevalence of DWV in combined Diptera and Lepidoptera species that share floral
resources with honey bees: Diptera 12% (n = 25) and in Lepidoptera 13% (n =15) ...... 63
Fig. 3.4 The relative prevalence of DWV in Apis mellifera during the years of 2015 and 2018;
sample sizes for those year were similar. The number of sites visited were two for 2015
and three for 2018; there was no overlap on the sites between the 2 years ...... 64
Fig. 3.5 The high variability across the years for DWV in Ceratina smaragdula on O‘ahu. The
number of sites samples varied from four, to three, to two, in 2014, 2015, and 2018
respectively ...... 65
viii
LIST OF ABBREVIATIONS
DWV, Deformed wing virus; RNA, Ribonucleic acid; PCR, Polymerase chain reaction.
ix
CHAPTER 1
EVIDENCE OF VARROA-MEDIATED DEFORMED WING VIRUS SPILLOVER IN
HAWAI‘I
Abstract
Varroa destructor, a parasitic mite of honey bees, is also a vector for viral diseases. The mite displays high host specificity and requires access to colonies of Apis spp. to complete its lifecycle. In contrast, the Deformed wing virus (DWV), one of the many viruses transmitted by
V. destructor, appears to have a much broader host range. Previous studies have detected DWV in a variety of insect groups that are not directly parasitized by the mite. In this study, we take advantage of the discrete distribution of the Varroa mite in the Hawaiian archipelago to compare
DWV prevalence on non-Apis flower visitors, and test whether Varroa presence is linked to a
“viral spillover”. We selected two islands with different viral landscapes: O‘ahu, where V. destructor has been present since 2007, and Maui, where the mite is absent. We sampled individuals of Apis mellifera, Ceratina smaragdula, Polistes aurifer, and Polistes exclamans, to assess and compare the DWV prevalence in the Hymenoptera community of the two islands. The results indicated that, as expected, honey bee colonies on O‘ahu have much higher incidence of
DWV compared to Maui. Correspondingly, DWV was detected on the non-Apis Hymenoptera collected from O‘ahu but was absent in the species examined on Maui. The study sites selected shared a similar geography, climate, and insect fauna, but differed in the presence of the Varroa mite, suggesting an indirect, but significant, increase on DWV prevalence in the Hymenoptera community on mite-infected islands.
Keywords: Varroa destructor, virus spillover, Deformed wing virus
1
1.1 Introduction
In the last two decades, emerging diseases have caused extensive damage to crops and livestock (Morens and Fauci, 2013; Voyles et al., 2014). Pathogens have been repeatedly shown to jump between species (Levitt et al., 2013; Li et al., 2011; Malmstrom and Alexander, 2016) and the Deformed wing virus (Iflaviridae; DWV) affecting honey bees is no exception
(Villalobos, 2016). Recent molecular studies have shown that the DWV may have co-evolved with the European honey bee (Apis mellifera), and the original virus may have been a low prevalence pathogen with many variants and low virulence (Martin et al., 2012; Wilfert et al.,
2016). Upon contact with the Asian honey bee (Apis cerana), a new mite vector, Varroa destructor, jumped species from A. cerana to A. mellifera and with this new transmission route the prevalence and virulence of DWV in A. mellifera was amplified (Martin et al., 2012; Wilfert et al., 2016). Recent studies by Yañez et al. (2015) on sympatric colonies of the Asian honey bee,
Apis cerana, and A. mellifera indicated that there are a large number of shared strains of DWV circulating in the Asian and the European honey bee populations, however the virus is more prevalent in the European honey bee colonies, suggesting a more efficient transmission route via the mite and/ or greater susceptibility of A. mellifera to infection to the virus or the vector. A similar situation has been reported for the native Japanese honey bee Apis cerana japonica, which shares DWV infections with sympatric A. mellifera but at a much lower prevalence
(Kojima et al., 2011).
While DWV evolved in close association with Apis bees, it also appears capable of infecting a broad range of non-Apis hosts (Genersch et al., 2006; Li et al., 2011; Melathopoulos et al., 2017). So far, DWV has been detected in 23 insect genera across Europe, North and South
America (Guzman-Novoa et al., 2015; Levitt et al., 2013; Reynaldi et al., 2013; Singh et al.,
2
2010; Lucia et al., 2014; Hoover, 2015), including social and non-social bees, wasps, ants, and a myriad of other insect groups. Not much is known about the impact of the virus in these host species (Tehel et al., 2016). Negative strands of DWV, suggestive of viral replication in the host, have been found only in 5 genera of non- Apis insects (Levitt et al., 2013; Tehel et al., 2016).
However, the discovery of DWV among a wide range of species has created concerns about a possible “viral spillover” from honey bee colonies to other insect species, especially economically important pollinators such as bumble bees (Graystock et al., 2015, 2016a,b; Ravoet et al., 2014). Work on viral spillover has been conducted, so far, in regions where V. destructor is present and DWV is prevalent in the honey bee population (Budge et al., 2015; Tehel et al.,
2016; Traynor et al., 2016). In fact, the presence of V. destructor in honey bee colonies has been linked to increased viral loads, virulence, and prevalence of DWV in honey bee populations
(Martin et al., 2012). Additionally, Varroa has also been associated with other viral diseases in honey bees including AKI, KBV, BQCV, and SBV (Francis et al., 2013; Martin, 2001; Shen et al., 2005).
The fragmented distribution of the Varroa mite on the Hawaiian archipelago makes for ideal study sites in which to examine pollinator communities with or without Varroa mites in the ecosystem. Honey bees first arrived to the Hawaiian archipelago in 1857 and became established across the eight islands by 1909 (Szalanski et al., 2016). In this study, we sampled local honey bees and non-Apis Hymenoptera species on the Varroa-positive island of O‘ahu and the Varroa- negative island of Maui. The selected study sites shared similar geography, floral resources, and insect communities; however, O‘ahu’s honey bees have been in contact with V. destructor since
2007 and have high DWV prevalence and increased viral loads. In contrast, Maui remains mite free to this date, and the honey bee populations on that island have a much lower incidence of
3
DWV (Martin, 2010; Martin et al., 2012). The non-Apis Hymenoptera species selected as representatives of the community were: Ceratina smaragdula, Polistes aurifer, and Polistes exclamans. C. smaragdula, commonly known as the small carpenter bee, is a mostly solitary bee abundant in garden environments in Hawai‘i, sharing nectar and pollen resources with honey bees. Polistes spp. Are common social wasps that hunt caterpillar prey, and visits flowers occasionally to feed on nectar.
Re-emerging viral diseases such as DWV represent one of the major threats to honey bee health, and the “spillover” of pathogens to wild bees and other insects may also contribute to the current global pollinator decline (Fürst et al., 2014; Genersch et al., 2006; Graystock et al.,
2013a; Graystock et al., 2013b; Manley et al., 2015; Tehel et al., 2016; vanEngelsdorp et al.,
2006; Steinhauer et al., 2015; Potts et al., 2010). Here we carry out a preliminary comparison of the incidence of DWV on non-Apis insects in areas with and without V. destructor.
1.2 Methods
1.2.1 Specimen collection
We selected three species within two different Hymenoptera genera as representatives of the local community of flower visitors: the introduced small carpenter bee Ceratina smaragdula
(Apidae) which was first recorded in Hawai‘i in 1999 (Magnacca and King, 2013), and introduced paper wasps Polistes aurifer and Polistes exclamans (Vespidae) first recorded in
Hawai‘i in the 19th century and in 1952 respectively (Beggs et al., 2011). All samples were collected from five sites on O‘ahu (Varroa-positive island), and four sites on Maui, (Varroa- negative island). Collection sites on both islands consisted of a mix of agricultural fields, parks, gardens, and beach edge vegetation strips. The selected insect species are all relatively abundant
4
and can be found in urban and agricultural environments, where they overlap in resource use with A. mellifera. Our selection of diverse habitats provided us with a preliminary bird’s eye view of the viral distribution on each island and represents the micro-climate diversity that characterizes the Hawaiian archipelago.
Polistes wasps collected on O‘ahu are P. aurifer and the specimens from Maui are P. exclamans. Consequently, the comparisons between the paper wasps were at the genus level.
Samples were collected from August 2014 to November 2015. Insects were collected while they were foraging in fields or flower patches, via a hand-held net. Paper wasp samples were also collected from around their nests. Each insect was stored individually and kept on ice in the field until transferred to a −80 °C freezer for long term storage.
1.2.2 DWV Detection
Each individual was transferred to a nuclease free 1.5 ml centrifuge tube, which was submerged in liquid nitrogen before the sample was crushed using a sterile mini pestle. Total
RNA was then extracted from the resulting powder using the RNeasy Mini Kit (Qiagen) following manufacturer’s conditions and resuspended in 30 μl of RNase-free water. RNA concentration was determined using a Nanodrop 2000c (Thermo Scientific) and samples were diluted to 25 ng/μl. Reverse Transcription-PCR (RT-PCR) protocols adapted from Martin et al.
(2012) were carried out to determine whether samples contained DWV. Endogenous control reactions were also carried out to ensure RNA was intact. RT-PCR reactions contained 50 ng
RNA, 1x OneStep RT-PCR Buffer (QIAGEN), 400 μM each dNTP, 10units RNase Inhibitor
(Applied Biosystems) and 0.6 μM each primer. DWVQ_F1 and DWVQ_R1 primers (Highfield et al., 2009) were used to amplify a conserved region of the RNA dependent RNA polymerase
5
(RdRp) gene. For the endogenous controls actin primers were used (Highfield et al., 2009).
Reactions were run using a T100 Thermocycler (Bio-Rad) starting with reverse transcription at
50 °C for 30 min, followed by an initial denaturation step at 94 °C for 30 s. This was followed by
35 cycles of denaturation at 94 °C for 30 s, annealing at 54 °C for DWVQ primers (58 °C for actin) for 30 s, extension at 72 °C for 1 min, and a final extension step at 72 °C for 10 min.
Agarose gel electrophoresis was used to determine the results. RT-PCR products were ran on a
2% agarose gel stained with SYBR Safe DNA gel stain (Invitrogen) with a 100 bp TrackIt ladder
(Invitrogen), and visualized under ultraviolet light. All samples were determined, via the detection of a bright band at 120 bp on an agarose gel, to contain sufficient intact RNA, confirming the absence of DWV in those samples that failed to amplify a DWV fragment.
1.2.3 Statistical analysis
To compare the DWV prevalence between species across islands, data was arranged across a contingency table and Fisher’s Exact Test was used to test for significance. Statistical test selection was based on the small sample size, and the large number of zeros in the data counts for Maui.
1.3 Results
We established via RT-PCR that DWV was present in the honey bee population on both islands; however, virus prevalence was significantly higher (p < .0001, Fisher’s Exact Test) among Apis mellifera from O‘ahu (83%, n =58) compared to individuals from Maui (7%, n =29)
(Figure 1.1). The RT-PCR results for the non-Apis insects showed a distinct dichotomy based on island; DWV was found on both of our non-Apis study species on O‘ahu, while the virus was
6
completely absent from both of the non-Apis Maui samples (Figure 1.1). Within the O‘ahu samples, the prevalence of DWV in Ceratina smaragdula and Polistes aurifer was 27% (n = 61) and 45% (n = 20) respectively (Figure 1.1).
1.4 Discussion
We confirmed, as expected, that the presence of the Varroa mite on O‘ahu greatly increased the prevalence of DWV in honey bees (Figure 1.1). In this study, eight out of 10 forager honey bees collected on O‘ahu were positive for DWV, compared to a DWV detection rate of 0.7 out 10 bees in Maui. The low prevalence of DWV in Maui’s bees concurs with a previous survey by Martin et al. (2012) in which four out of 33 Maui colonies tested positive for
DWV. The detection of DWV on Varroa negative islands also agrees with the theory that this virus arrived in Hawai‘i along with the European honey bee prior to the global spread of the mite, and that it remains present in the Varroa-negative honey bee population as a low prevalence pathogen (Martin et al., 2012; Ryabov et al., 2014; Wilfert et al., 2016).
According to the review by Tehel et al. (2016), 17 species of bees, including one species in the genus Ceratina, have been described as positive for DWV. In our study, detection of
DWV in C. smaragdula was associated only with Varroa-positive areas, where one out of four small carpenter bees sampled tested positive for the virus. Singh et al. (2010) reported DWV infection in Ceratina dupla, where two out of three individuals sampled were positive. DWV has also been detected in several wasp species, including yellow jackets (Vespula spp.) (Levitt et al.,
2013) and several Polistes spp. (Singh et al., 2010). Our study shows that, as with the small carpenter bees, the presence of DWV in paper wasps was limited to the samples from O‘ahu where 45% of the P. aurifer specimens collected were positive for DWV.
7
Our results suggest a possible DWV spillover from honey bees to flower visitors that is indirectly linked to Varroa presence in the region. However, there are still large gaps of knowledge with regard to cross species transfer of DWV, in particular: the routes of virus transmission, the range of species that are susceptible, and the potential impact, if any, of the virus on the non-Apis hosts. Tehel et al. (2016) argue that simple PCR detection of DWV at a single location does not provide enough information to make inferences about viral spillover from honey bees to the rest of the insect community. The confirmation of a higher prevalence of
DWV in non-Apis insects from a Varroa-positive island compared to a Varroa-free island suggests the need for more in-depth studies that include multiple locations, samples from a wide range of insect species, and confirmation of viral replication in the hosts. In addition, there is a need for comparative studies of the virulence of the different DWV genotypes and the susceptibility of honey bees and other potential insect hosts to each of these variants (McMahon et al., 2016). Nevertheless, the absence of the mite on Maui provided us with the opportunity to completely exclude the effects of Varroa parasitism from one site, while comparing the prevalence of the DWV on two geographically close regions. The information collected in this study can be considered preliminary evidence in support of directionality of transfer of DWV from O‘ahu’s honey bees to other insect species in this island, as mediated by the presence of
Varroa and the associated higher viral titers in A. mellifera.
One of the proposed routes of DWV transmission involves ingestion of contaminated hive products such as, pollen and honey, and/or consumption of larvae, pupae, or adult bees
(Chen et al., 2006; Genersch et al., 2006; Möckel et al., 2010; Singh et al., 2010; Ravoet et al.,
2014). Insects that rob colony resources, or those that feed directly on live or dead bees, may take in viral particles with the food they ingest. This mechanism of infection has been suggested
8
for yellow jackets, possibly ants, and for hive parasites (Evison et al., 2012; Sébastien et al.,
2015; Richter and Tisch, 1999). This transmission route, however, is not a likely explanation for our study species. Small carpenter bees feed solely on flowers, and, although carnivorous,
Polistes exclusively hunt caterpillars to feed their young and do not rob honey bee colonies. A more likely transmission route in our study is through the flowers shared by the insects. Floral resources have been identified as a potential contact point between species and viable DWV particles have been found in pollen (Mazzei et al., 2014; McArt et al., 2014; Singh, 2011;
Narbona and Dirzo, 2010). Both honey bees and C. smaragdula were found foraging on the same common garden herbs, crops, and ornamentals – such as Scaevola sericea (Naupaka) and
Heliotropium foertherianum – on both O‘ahu and Maui (pers. obs.). Bees require pollen and nectar to rear their young, and it is possible that either of those resources could have been contaminated with DWV. Polistes spp. are active foragers that move quickly among the vegetation looking for caterpillar prey, but they occasionally pause to feed on nectar from a variety of flowers during a foraging bout (pers. obs.). Consequently, the shared floral use could also be an alternative route of viral transmission in predatory or parasitic wasps.
The honey bee colonies on Maui, as well as those on other Varroa negative Hawaiian
Islands, showed a much lower DWV prevalence (Martin et al., 2012), thus the number of infected individuals, and the viral titer of the infected bees foraging in that community is expected to be much lower. In contrast, forager honey bees on O‘ahu are more likely to be DWV positive and to carry an elevated viral load, which could translate into a higher rate of floral contamination on this island and a higher prevalence of DWV in non-Apis flower visitors (Figure
1.1). The pathogenicity of DWV and the relationship between the virus, the mite, and the honey bee continue to be the focus of much research in honey bee pathology (Di Prisco et al., 2016;
9
Möckel et al., 2010; Ryabov et al., 2014; Ravoet et al., 2014). The known DWV strains (Type A,
B, and C), and recombinants thereof, may be linked to differences in DWV virulence in honey bee colonies (Martin et al., 2012; McMahon et al., 2016; Ryabov et al., 2014; Zioni et al., 2011;
Han et al., 2015), however, there is no evidence that strains may be specifically linked to wing deformities on bees, rather it appears that viral loads of DWV play a significant role in the expression of this phenotype in honey bees (Brettell et al., 2017). By comparison to the existing work on honey bees, our understanding about DWV transmissibility and its effect on the fitness of non-Apis bees, and other insects, is much more limited. Based on the summary presented by
Tehel et al. (2016) 17 species of non-Apis bees carry DWV, 7 species show evidence of DWV replication (via a negative RNA strand), and the pathogenicity of DWV has been confirmed for two species of bumble bee, Bombus terrestris, and Bombus pascuorum (Genersch et al., 2006;
Graystock et al., 2016b). DWV replication in non-bee species has also been reported; Levitt et al.
(2013) found evidence of RNA replication in paper wasps, Vespula spp., and Eyer et al. (2009) reported negative RNA strands in the small hive beetle, Aethina tumida. Research on alternative commercial pollinators such as, the alkali bee and the alfalfa leafcutter bee; have shown that food stores, eggs, and larvae, may be infected with numerous viruses shared with honey bees including DWV, IAPV, and BQCV (McArt et al., 2014; Singh, 2011; Lucia et al., 2014).
However, quantifying the impact of DWV infection on non-Apis insects can be difficult since for many species we only have access to the non-symptomatic adults. In depth research is needed to examine fitness impacts to non-Apis bees and to survey wild hosts that could become reservoirs of DWV leading to a complex web of infections.
10
1.5 Conclusion
1. In this study, a higher rate of DWV detection in non-Apis insects was associated to
Varroa-positive areas.
2. Across-species transmission of DWV in our study was likely the result of shared flower
resources (pollen and nectar) between honey bees and non-Apis insects.
3. The prevalence of DWV in C. smaragdula and P. aurifer in Hawai‘i is comparable to
that of other species of bees and wasps from the mainland US, where the mite has been
present for about 30 years.
11
Figure 1.1 Comparison of DWV prevalence in several species of Hymenoptera on O‘ahu,
(light blue bars) and Maui (purple bar). The Varroa mite is well established on O‘ahu, and the
DVW prevalence and viral load among honey bees is high compared to Maui where the mite is absent, and the prevalence and load of DWV is very low. Each column includes sample size for the group. Map shows the current distribution of V. destructor in the Hawaiian archipelago using mite icons and the same color-codes as the histogram bars; O‘ahu and Big Island, where the mite is present are light blue, and Varroa-free Kauai and Maui, purple.
12
References
Beggs, J. R., E. G Brockerhoff, J. C. Corley, M. Kenis, M. Masciocchi, F. Muller, Q. Rome,
and C. Villemant. 2011. Ecological effects and management of invasive alien Vespidae.
Biocontrol 56(4): 505–526. (doi:10.1007/s10526-011-9389-z).
Brettell, L., G. Mordecai, D. Schroeder, I. Jones, J. D. Silva, M. Vicente-Rubiano, and S.
Martin. 2017. A comparison of deformed wing virus in deformed and asymptomatic
honey bees. Insects 8(1): 28. (doi:10.3390/insects8010028).
Budge, G. E., S. Pietravalle, M. Brown, L. Laurenson, B. Jones, V. Tomkies, and K. S.
Delaplane. 2015. Pathogens as predictors of honey bee colony strength in England and
Wales. PLoS ONE 10(7): e0133228. (doi:10.1371/journal.pone.0133228).
Chen, Y., J. Evans, and M. Feldlaufer. 2006. Horizontal and vertical transmission of viruses in
the honey bee, Apis mellifera. Journal of Invertebrate Pathology 92(3): 152–159.
(doi:10.1016/j.jip.2006.03.010).
Di Prisco, G., D. Annoscia, M. Margiotta, R. Ferrara, P. Varricchio, V. Zanni, E. Caprio,
F. Nazzi, and F. Pennacchio. 2016. A mutualistic symbiosis between a parasitic mite
and a pathogenic virus undermines honey bee immunity and health. Proceedings of the
National Academy of Sciences of the United States of America 113(12): 3203–3208.
(doi:10.1073/pnas.1523515113).
Evison, S. E., K. E. Roberts, L. Laurenson, S. Pietravalle, J. Hui, J. C. Biesmeijer, and W.
O. Hughes. 2012. Pervasiveness of parasites in pollinators. PLoS ONE 7(1): e30641.
(doi:10.1371/journal.pone.0030641).
13
Eyer, M., Y. P. Chen, M. O. Schäfer, J. Pettis, and P. Neumann. 2009. Small hive beetle,
Aethina tumida, as a potential biological vector of honeybee viruses. Apidologie 40(4):
419–428. (doi:10.1051/apido:2008051).
Francis, R. M., S. L. Nielsen, and P. Kryger. 2013. Varroa-virus interaction in collapsing
honey bee colonies. PLoS ONE 8(3): e57540. (doi:10.1371/journal.pone.0057540).
Fürst, M., D. McMahon, J. Osborne, R. Paxton, and M. Brown. 2014. Disease associations
between honeybees and bumblebees as a threat to wild pollinators. Nature 506: 364–366.
(doi:10.1038/nature12977).
Genersch, E., C. Yue, I. Fries, and J. Miranda. 2006. Detection of deformed wing virus, a
honey bee viral pathogen, in bumble bees (Bombus terrestris and Bombus pascuorum)
with wing deformities. Journal of Invertebrate Pathology 91: 61–63.
(doi:10.1016/j.jip.2005.10.002).
Graystock, P., E. J. Blane, Q. S. Mcfrederick, D. Goulson, and W. O. Hughes. 2016a. Do
managed bees drive parasite spread and emergence in wild bees? The International
Journal for Parasitology: Parasites and Wildlife 5(1): 64–75.
(doi:10.1016/j.ijppaw.2015.10.001).
Graystock, P., I. Meesus, G. Smagghe, D. Goulson, and W. O. Hughes. 2016b. The effects of
single and mixed infections of Apicystis bombi and deformed wing virus in Bombus
terrestris. Parasitology 143(3): 358–365. (doi:10.1017/S0031182015001614).
Graystock, P., D. Goulson, and W. O. Hughes. 2015. Parasites in bloom: flowers aid dispersal
and transmission of pollinator parasites within and between bee species. Proceedings of
the Royal Society B: Biological Sciences 282(1813): 20151371.
(doi:10.1098/rspb.2015.1371).
14
Graystock, P., K. Yates, S. E. Evison, B. Darvill, D. Goulson, and W. O. Hughes. 2013a. The
Trojan hives: pollinator pathogens, imported and distributed in bumblebee colonies.
Journal of Applied Ecology 50(5): 1207–1215. (doi:10.1111/1365-2664.12134).
Graystock, P., K. Yates, B. Darvill, D. Goulson, and W. Hughes. 2013b. Emerging dangers:
deadly effects of an emergent parasite in a new pollinator host. Journal of Invertebrate
Pathology 114(2): 114–119. (doi:10.1016/j.jip.2013.06.005).
Guzman-Novoa, E., M. M. Hamiduzzaman, R. Anguiano-Baez, A. Correa-Benítez, E.
Castañeda-Cervantes, and N. I. Arnold. 2015. First detection of honey bee viruses in
stingless bees in North America. Journal of Apicultural Research 54(2): 93–95.
(doi:10.1080/00218839.2015.1100154.).
Han, Y., M. M. Oers, S. V. Houte, and V. I. Ros. 2015. Virus-induced behavioural changes in
insects. Host Manipulations by Parasites and Viruses Parasitology Research Monographs
7: 149–174. (doi:10.1007/978-3-319-22936-2_10).
Highfield, A. C., A. E. Nagar, L. C. Mackinder, L. M. Noel, M. J. Hall, S. J. Martin, and D.
C. Schroeder. 2009. Deformed wing virus implicated in overwintering honeybee colony
losses. Applied and Environmental Microbiology 75(22): 7212–7220.
(doi:10.1128/aem.02227-09).
Hoover, S. 2015. Preliminary Report: Detections of viruses in alfalfa leafcutter bees in southern
Alberta. Alberta Agriculture and Rural Development. Retrieved from:
http://www.alfalfaseedab.com/pdf/2015/12-
08/Hoover_2015_Leafcutter_viral_report_for_ASCA_AGM.pdf.
Kojima, Y., T. Toki, T. Morimoto, M. Yoshiyama, K. Kimura, and T. Kadowaki. 2011.
Infestation of Japanese native honey bees by tracheal mite and virus from non-native
15
European honey bees in Japan. Microbial Ecology 62(4): 895-906. (doi:10.1007/s00248-
011-9947-z.).
Levitt, A. L., R. Singh. D. L. Cox-Foster, E. Rajotte, K. Hoover, N. Ostiguy, and E. C.
Holmes. 2013. Cross-species transmission of honey bee viruses in associated arthropods.
Virus Research 176(1–2): 232–240. (doi:10.1016/j.virusres.2013.06.013).
Li, J., W. Peng, J. Wu, J. P. Strange, H. Boncristiani, and Y. Chen. 2011. Cross-species
infection of deformed wing virus poses a new threat to pollinator conservation. Journal of
Economic Entomology 104(3): 732–739. (doi:10.1603/ec10355).
Lucia, M., F. J. Reynaldi, G. H. Sguazza, and A. H. Abrahamovich. 2014. First detection of
deformed wing virus in Xylocopa augusti larvae (Hymenoptera: Apidae) in Argentina.
Journal of Apicultural Research 53(4): 466–468. (doi:10.3896/ibra.1.53.4.11).
Magnacca, K. N., and C. B. K. King. 2013. Assessing the presence and distribution of 23
Hawaiian yellow-faced bee species on lands adjacent to military installations on O‘ahu
and Hawai‘i Island. Technical Report No. 185. Pacific Cooperative Studies Unit,
University of Hawai‘i, Honolulu, Hawai‘i. Retrieved from:
http://scholarspace.manoa.hawaii.edu/bitstream/handle/10125/34064/v185.pdf.
Malmstrom, C. M., and H. M. Alexander. 2016. Effects of crop viruses on wild plants. Current
Opinion in Virology 19: 30–36. (doi:10.1016/j.coviro.2016.06.008).
Manley, R., M. Boots, and L. Wilfert. 2015. Emerging viral disease risk to pollinating insects:
ecological, evolutionary and anthropogenic factors. Journal of Applied Ecology 52(2):
331–340. (doi:10.1111/1365-2664.12385).
Martin, S. J. 2010. Trouble in paradise: Varroa spreads across Hawaii. The American Bee
Journal 150: 381–383.
16
Martin, S. J. 2001. The role of Varroa and viral pathogens in the collapse of honeybee colonies:
a modelling approach. Journal of Applied Ecology 35(5): 1082–1093.
(doi:10.1046/j.1365-2664.2001.00662.x).
Martin, S., A. Highfield, L. Brettell, E. Villalobos, G. Budge, M. Powell, and D. Schroeder.
2012. Global honey bee viral landscape altered by a parasitic mite. Science 336(6086):
1304–1306. (doi:10.1126/science.1220941).
Mazzei, M., M. Carrozza, E. Luisi, M. Forzan, M. Giusti, S. Sagona, A. Felicioli. 2014.
Infectivity of DWV associated to flower pollen: experimental evidence of a horizontal
transmission route. PLoS ONE 9(11): e113448. (doi:10.1371/journal.pone.0113448).
McArt, S. H., H. Koch, R. E. Irwin, and L. S. Adler. 2014. Arranging the bouquet of disease:
floral traits and the transmission of plant and animal pathogens. Ecology Letters 17(5):
624–636. (doi:10.1111/ele.12257).
McMahon, D. P., M. E. Natsopoulou, V. Doublet, M. Fürst, S. Weging, M. J. Brown, A.
Gogol-Döring, and R. J. Paxton. 2016. Elevated virulence of an emerging viral
genotype as a driver of honeybee loss. Proceedings of the Royal Society of London.
Series B, Biological sciences 283(1833): 20160811. (doi:10.1098/rspb.2016.0811).
Melathopoulos, A., L. Ovinge, P. Wolf Veiga, C. Castillo, D. Ostermann, and S. Hoover.
2017. Viruses of managed alfalfa leafcutting bees (Megachile rotundata Fabricius) and
honey 4 bees (Apis mellifera L.) in Western Canada: incidence, impacts, and prospects of
cross-species 5 viral transmission. Journal of Invertebrate Pathology 146: 24–30.
(doi:10.1016/j.jip.2017.04.003).
Möckel, N., S. Gisder, and E. Genersch. 2010. Horizontal transmission of deformed wing
virus: pathological consequences in adult bees (Apis mellifera) depend on the
17
transmission route. Journal of General Virology 92(2): 370–377.
(doi:10.1099/vir.0.025940-0).
Morens, D. M., and A. S. Fauci. 2013. Emerging infectious diseases: threats to human health
and global stability. PLOS 9(7): e1003467. (doi:10.1371/journal.ppat.1003467).
Narbona, E., and R. Dirzo. 2010. A reassessment of the function of floral nectar in Croton
suberosus (Euphorbiaceae): a reward for plant defenders and pollinators. American
Journal of Botany 97(4): 672–679. (doi:10.3732/ajb.0900259).
Potts, S. G., J. C. Biesmeijer, C. Kremen, P. Neumann, O. Schweiger, and W. E. Kunin.
2010. Global pollinator declines: trends, impacts and drivers. Trends in Ecology &
Evolution 25(6): 345–353. (doi:10.1016/j.tree.2010.01.007).
Ravoet, J., L. D. Smet, I. Meeus, G. Smagghe, T. Wenseleers, and D. C. Graaf. 2014.
Widespread occurrence of honey bee pathogens in solitary bees. Journal of Invertebrate
Pathology 122: 55–58. (doi:10.1016/j.jip.2014.08.007).
Reynaldi, F., G. Sguazza, F. Albicoro, M. Pecoraro, and C. Galosi. 2013. First molecular
detection of co-infection of honey bee viruses in asymptomatic Bombus atratus in South
America. Brazilian Journal of Biology 73(4): 797–800. (doi:10.1590/s1519-
69842013000400016).
Richter, M. R., and V. L Tisch. 1999. Resource choice of social wasps: influence of
presence,size and species of resident wasps. Insectes Sociaux 46(2): 131–136.
(doi:10.1007/s000400050123).
Ryabov, E. V., G. R. Wood, J. M. Fannon, J. D. Moore, J. C. Bull, D. Chandler, A. Mead,
N. Burroughs, and D. J. Evans. 2014. A virulent strain of deformed wing virus (DWV)
18
of honeybees (Apis mellifera) prevails after Varroa destructor-mediated, or in vitro,
transmission. PLoS Pathogens 10(6): e1004230. (doi:10.1371/journal.ppat.1004230).
Sébastien, A., P. J. Lester, R. J. Hall, J. Wang, N. E. Moore, and M. A. Gruber. 2015.
Invasive ants carry novel viruses in their new range and form reservoirs for a honeybee
pathogen. Biology Letters 11(9): 20150610. (doi:10.1098/rsbl.2015.0610).
Shen, M., L. Cui, N. Ostiguy, and D. Cox-Foster. 2005. Intricate transmission routes and
interactions between picorna-like viruses (Kashmir bee virus and sacbrood virus) with the
honeybee host and the parasitic varroa mite. Journal of General Virology 86: 2281–2289.
(doi:10.1099/vir.0.80824-0.).
Singh, R. 2011. Ecology and epidemiology of RNA viruses in hymenopteran pollinators
(Doctoral dissertation). Retrieved from: https://etda.libraries.psu.edu/catalog/12564.
Singh, R., A. Levitt, E. Rajotte, E. Holmes, N. Ostiguy, D. vanEngelsdorp, W. I. Lipkin, C.
W. dePamphilis, A. L. Toth, and D. Cox-Foster. 2010. RNA viruses in hymenopteran
pollinators: evidence of inter-taxa virus transmission via pollen and potential impact on
non-Apis hymenopteran species. PLoS ONE 5(12): 1–16.
(doi:10.1371/journal.pone.0014357).
Steinhauer, N., K. Rennich, K. Lee, J. Pettis, D. R. Tarpy, J. Rangel, D. Caron, R. Sagili, J.
A. Skinner, M. E. Wilson, J. T. Wilkes, K. S. Delaplane, R. Rose, and D.
vanEngelsdorp. 2015. Colony Loss 2014–2015: Preliminary Results. Retrieved from:
https://beeinformed.org/results/colony-loss-2014-2015-preliminaryresults/.
Szalanski, A. L., A. D. Tripodi, C. E. Trammel, and D. Downey. 2016. Mitochondrial DNA
genetic diversity of honey bees, Apis mellifera in Hawaii. Apidologie 47(5): 679–687.
(doi:10.1007/s13592-015-0416-4).
19
Tehel, A., M. J. Brown, and R. J. Paxton. 2016. Impact of managed honey bee viruses on wild
bees. Current Opinion in Virology 19: 16–22. (doi:10.1016/j.coviro.2016.06.006.).
Traynor, K. S., K. Rennich, E. Forsgren, R. Rose, J. Pettis, G. Kunkel, S. Mandella, J.
Evans, D. Lopez, and D. vanEngelsdorp. 2016. Multiyear survey targeting disease
incidence in US honey bees. Apidologie 47(3): 325–347. (doi:10.1007/s13592-016-0431-
0). vanEngelsdorp, D., D. Cox-Foster, M. Frazier, N. Ostiguy, and J. Hayes. 2006. Colony
collapse disorder preliminary report. Mid-Atlantic Apiculture Research and Extension
Consortium (MAAREC)–CCD Working Group. Retrieved from:
http://www.beekeeping.com/articles/us/ccd.pdf.
Villalobos, E. M. 2016. The mite that jumped, the bee that traveled, the disease that followed.
Science 351(6273): 554–556. (doi:10.1126/science.aaf0938).
Voyles, J., A. M. Kilpatrick, J. P. Collins, M. C. Fisher, W. F. Frick, H. McCallum, C. K. R.
Willis, D. S. Blehert, K. A. Murray, R. Puschendorf, E. B. Rosenblum, B. M. Bolker,
T. L. Cheng, K. E. Langwig, D. L. Lindner, M. Toothman, M. Q. Wilber, and C. J.
Briggs. 2015. Moving beyond too little, too late: managing emerging infectious diseases
in wild populations requires international policy and partnerships. EcoHealth 12(3): 404–
407. (doi:10.1007/s10393-014-0980-5).
Wilfert, L., G. Long, H. C. Leggett, P. Schmid-Hempel, R. Butlin, S. J. Martin, and M.
Boots. 2016. Deformed wing virus is a recent global epidemic in honeybees driven by
Varroa mites. Science 351(6273): 594–597. (doi:10.1126/science.aac9976).
20
Yañez, O., H. Zheng, X. Su, F. Hu, P. Neumann, and V. Dietemann. 2015. Potential for virus
transfer between the honey bees Apis mellifera and A. cerana. Journal of Apicultural
Research 54(3): 179–191. (doi:10.1080/00218839.2015.1128145).
Zioni, N., V. Soroker, and N. Chejanovsky. 2011. Replication of Varroa destructor virus 1
(VDV-1) and a Varroa destructor virus 1–deformed wing virus recombinant (VDV-1–
DWV) in the head of the honey bee. Virology 417(1): 106–112.
(doi:10.1016/j.virol.2011.05.009).
21
CHAPTER 2
MOUTHFUL OF VIRUS: DEFORMED WING VIRUS PRESENCE IN HYLAEUS
(HYMENOPTERA: COLLETIDAE)
Abstract
Deformed wing virus (DWV), once thought to be a novel pathogen intimately linked to the European honey bee, (Apis mellifera), is now considered a multi-host +ss-RNA virus with a global distribution, and has been detected in 78 species, 62 of which are in the order
Hymenoptera. In the European honey bee, a shift in the virulence of DWV strains has been mediated by the mite, Varroa destructor. Prior to the spread of Varroa, the spread of the virus relied on vertical transmission, mother to offspring, and horizontal, through the sharing of contaminated oral secretions or food products between members of the colony. The Varroa mite allowed a third route to open: horizontal transmission between the ectoparasite mite and the hemolymph of the host bee. The presence of the mite also facilitated the reduction in the DWV viral diversity, resulting in the bottlenecking of the virulent master variant, DWV-A, in honey bee populations. It was previously believed that the master variant dominant in a managed honey bee population was indicative of the DWV master variant found in the surrounding pollinator community. New research indicates that different DWV strain types can exist in outside of the influence of honey bee populations, which signifies a renewed importance in identify DWV strain types present in pollinator communities. Identifying the DWV strain variants present in local insect populations, native and managed, is critical to our understanding of the interplay of human introductions of pollinators in the community. The role of honey bees as a potential driver of viral spillover, the rates of DWV recombination, and anthropogenic transport and introductions may all contribute to the health of the insect communities. In this study, we report
22
for the first time on the DWV prevalence in non-native Hylaeus species in Hawai‘i. DWV viral levels of combined Hylaeus species were comparable to those of Hymenoptera in previous
Hawai‘i studies. However, when divided across the two species, H. albonitens had almost twice the DWV prevalence when compared to H. strenuus. These results may indicate that despite being ecologically and evolutionarily closely related, DWV prevalence can still have great variability within a genus.
Keywords: Hylaeus, yellow-faced bee, virus spillover, DWV strain
2.1 Introduction
There are roughly 18 known viruses that infect Apis mellifera (Hymenoptera: Apidae) and more than half of these viruses have also been detected in non-Apis social and solitary bees – with current studies estimating 80% of wild bees harboring at least one virus species (Dolezal et al., 2016; Grozinger and Flenniken, 2019; McMahon et al., 2018). Among the viruses that infect honey bees, the Deformed wing virus (Iflaviridae; DWV) has been linked with large colony losses in A. mellifera (Bruckner et al., 2018; Highfield et al., 2009; Martin et al., 2012).
Deformed wing virus has been widely documented in other economically important
Hymenopteran species, both in managed and wild populations (Forzan, 2017; Fürst et al., 2014;
Manley et al., 2019; Martin and Brettell, 2019; Radzevičiūtė et al., 2017). One of the most notable examples is the presence and increasing prevalence of DWV in bumblebees, Bombus spp. (Fürst et al., 2014; Graystock et al., 2013a, Manley et al., 2019). Viral spillover from Varroa infected honey bee colonies has been proposed as a likely explanation for the emerging DWV levels in many of these species (Genersch et al., 2006, Manley et al., 2015, Manley et al., 2019;
Singh et al., 2010).
23
In the case of the honey bee, DWV can be transmitted in three different ways; 1) vertically from parents to offspring, 2) horizontally via shared food, oral secretions, feces, and 3) vectored by Varroa destructor (Parasitiformes: Varroidae) mites, directly into the hemolymph of host bees. It is this third transmission route that has allowed DWV to go from a minor pathogen of honey bees, to a major problem in recent years (Kevill et al., 2019; Martin and Brettell, 2019;
Ryabov et al., 2014; Yañez et al., 2020). The DWV, prior to its rise in virulence, had a broad diversity of viral strains within honey bee colonies, but the rise of the Varroa mite as a global pest of bees resulted in the development of an interaction where horizontal transmission of the virus by the mites resulted in reduced viral diversity (Martin et al., 2012; Martin and Brettell,
2019; Möckel et al., 2011; Ryabov et al., 2014). Over time, this change facilitated the predominance of the common virulent master variant, DWV-A. Currently, three master variants have been characterized, DWV-A, DWV-B, and DWV-C (Kevill et al., 2017; Kevill et al., 2019;
Martin and Brettell, 2019).
The prevalence of these variants appears to be changing among honey bee hosts and recent studies demonstrate competition among these master variants across honey bee and non-
Apis populations (McMahon et al., 2016; Norton et al., 2020). Earlier, DWV-A was the reigning variant in the United States and Europe (Ryabov et al., 2017), yet current studies are starting to demonstrate a shift towards DWV- B. On an organismal level, studies are finding that in coinfected individual adult honey bees, master variant DWV-B outcompetes DWV-A
(McMahon et al., 2016; Norton et al., 2020). This competition is also being seen at a larger scale, across honey bee populations. Radzevičiūtė et al. (2017) demonstrated a rise in the prevalence of
DWV-B in honey bee populations where DWV-A is also present. Master variant DWV-C, while more elusive in honey bee populations (Kevill et al., 2017), has been shown to be the dominant
24
variant in stingless bees, Melipona subnitida (Hymenoptera: Apidae) from Brazil (de Souza et al., 2019), suggesting that dominance of variants vary across host Hymenoptera taxa. The competition of master variants may also be driven by DWV strain reservoirs in these non-Apis communities, which harks back to the importance of testing non-Apis species to better understand the prevalence and potential impacts of DWV variants in ecosystems (Morens and
Fauci, 2013; Ryabov et al., 2017; Voyles et al., 2015).
The ubiquitous presence of the DWV among a diversity of Hymenoptera species suggests that it is a generalist virus (Evison et al., 2012, Levitt et al., 2013; Singh et al., 2010). There is, however, relatively little information about the impact that the virus may have on the health of solitary bees or other Hymenoptera species. In Hawai‘i, we are just now starting to explore the prevalence of DWV in pollinator communities (Loope et al., 2019; Martin et al., 2012;
Santamaria et al., 2018). Documenting the prevalence of DWV+ in a diversity of Hymenoptera species and examining the exposure routes is a critical step in understanding if, and how, non-
Apis species are being affected (Morens and Fauci, 2013; Tehel et al., 2016; Voyles et al., 2015).
This is especially true for the State of Hawai‘i, sometimes referred to as the “Endangered Species
Capital of the World” (Magnacca and King, 2013), where the endemic native pollinators,
Hylaeus spp. (Hymenoptera: Colletidae) are already highly threatened by habitat destruction and the introduction of invasive ants and predatory wasps (FWS, 2016; Magnacca and King, 2013), and a number of species are listed as endangered species. Pathogens and disease have also been suspected to be a contributing factor in the decline of native bees in Hawai‘i, but this has yet to be confirmed (FWS, 2016; Xerces Society, 2009).
Two introduced species of Hylaeus, H. strenuus and H. albonitens, are now abundant throughout O‘ahu, a major island in the Hawaiian archipelago, and can be found in a variety of
25
environments, from urban settings to sandy-coastal ranges. These introduced Hylaeus spp. provide unique opportunities to examine how foraging and nesting behaviors may impact DWV acquisition and subsequent infection in the new host. Hylaeus females, unlike other bee species, do not collect pollen via branched body hairs, nor do they have a specialized pollen carrying structure on their exoskeleton. Instead, the bees in this genus ingest the pollen they transport to their nest and then regurgitate it there as food for the larvae (Snelling, 2003). This foraging strategy may potentially increase direct exposure of the adult bees to DWV contaminated pollen compared to other bee groups, due to the direct oral and internal exposure involved (Pisa et al.,
2015). In addition, Hylaeus females dehydrate nectar before consuming it; they can often be observed perched on flowers with a large liquid drop hanging in and out of their mouthparts (see
Figure 2.1). This foraging behavior of Hylaeus, although the norm for their taxon, may increase their contact with nectar borne pathogens including viruses, especially when compared to other bee genera present in Hawai‘i, such as Megachile (Hymenoptera: Megachilidae) and Ceratina
(Hymenoptera: Apidae), which have not been observed dehydrating nectar (pers. obs.). Finally, the Hylaeus females tend to use their glossa to spread the silky lining in their nest cells, thus potentially increasing contact with food-borne pathogens that could be in their mouthparts to their larvae. Their overall foraging and nesting behaviours may be provide alternative DWV transmission routes for this genus.
In this study, we utilized the two invasive Hylaeus spp. which are phylogenetic close relatives of the endemic Hawaiian bees, to document and quantify the prevalence of DWV in solitary Hylaeus species that co-exist with Varroa mite infested honey bee colonies in Hawai‘i.
Previous studies (Santamaria et al. 2018) have already document the prevalence of three
Hymenopteran species on O‘ahu, but these species have arguably less contact with contaminated
26
floral byproducts than Hylaeus species. We test the hypothesis that solitary bees, in this case
Hylaeus, will have higher rates of prevalence of DWV when compared to other solitary species in Hawai‘i.
2.2 Methods
2.2.1 Specimen Collection
We focused on two species of Hylaeus that are non-native to the Hawaiian archipelago,
H. strenuus and H. albonitens; native to east Asia and Australia respectively (Magnacca, 2011;
Magnacca and King, 2013). These introduced species were chosen because they are easy to find in urban and agricultural settings when compared to their endemic counterparts. All the individuals in this study were captured in the University of Hawai‘i Urban Garden Center in
Pearl City, Honolulu, Hawai‘i from bottle brush trees, Callistemon sp. (Myrtales: Myrtaceae). In addition to Hylaeus, individual honey bees (A. mellifera) were captured if they were found feeding on the same plant. These honey bees were used to establish a comparative reference for
DWV prevalence in A. mellifera, and to determine the DWV strains found in that area during the sampling period. Specimens were collected in April in 2016 and in July 2018. Individuals were captured via hand-nets and stored in a -80C freezer until the RNA extraction step.
2.2.2 DWV Detection
Bees were tested individually for the presence or absence of DWV following the same protocol described in previous publications (Martin et al., 2012; Santamaria et al., 2018). Each bee sample was transferred to a nuclease free 1.5 ml centrifuge tube, which was submerged in liquid nitrogen before being crushed using a sterile mini pestle. Total RNA was then extracted
27
from the resulting powder using the RNeasy Mini Kit (Qiagen) following manufacturer’s conditions and resuspended in 30 μl of RNase-free water. RNA concentration was determined using a Nanodrop 2000c (Thermo Scientific) and samples were diluted to 25 ng/μl. Reverse
Transcription-PCR (RT-PCR) protocols adapted from Martin et al. (2012) were carried out to determine whether samples contained DWV. RT-PCR reactions contained 50 ng RNA, 1x
OneStep RT-PCR Buffer (QIAGEN), 400 μM each dNTP, 10units RNase Inhibitor (Applied
Biosystems) and 0.6 μM each primer. DWVQ_F1 and DWVQ_R1 primers (Highfield et al.,
2009) were used to amplify a conserved region of the RNA dependent RNA polymerase (RdRp) gene (Table 2). Reactions were run using a T100 Thermocycler (Bio-Rad) starting with reverse transcription at 50°C for 30 min, followed by an initial denaturation step at 94°C for 30 s. This was followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 54°C for DWVQ primers (58°C for actin) for 30 s, extension at 72°C for 1 min, and a final extension step at 72°C for 10 min. Agarose gel electrophoresis was used to determine the results. RT-PCR products were separated on a 2% agarose gel stained with SYBR Safe DNA gel stain (Invitrogen) with a
100 bp TrackIt ladder (Invitrogen), and visualized with ultraviolet light. All samples were determined, via the detection of a bright band at 120 bp on an agarose gel, to contain sufficient intact RNA, and in turn, confirm the presence of DWV, or the absence in samples that failed to amplify a DWV fragment.
After assessing the prevalence of DWV in each bee species, positive samples were then tested for master virus variants. DWVQ_F1 and DWVQ_R1 primers (Highfield et al., 2009) were used to amplify a conserved region of the RNA dependent RNA polymerase (RdRp) gene for DWV absence / presence testing. DWV-A, DWV-B, and DWV-C primers (Kevill et al.,
2017) were used to detect master virus variants (Table 1).
28
Due to the limitation in research funding and lab supplies, only a small random subset of the DWV positive individuals were used for DWV strain testing. For the DWV strain testing, reactions were also run using a T100 Thermocycler (Bio-Rad) starting with reverse transcription at 50°C for 30 min, followed by an initial denaturation step at 94°C for 30 s. This was followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 61.5°C for DWV-A, DWV-B, and
DWV-C primers (Kevill et al., 2017) for 30 s, extension at 72°C for 1 min, and a final extension step at 72°C for 10 min.
2.2.3 Statistical Analysis
Fisher’s Exact Test was used to compare the DWV proportion of individuals infected between species and between collection years. Statistical test selection was based on the small sample size, and the large proportion of negative samples (absence of DWV) (JMP Pro).
2.3 Results
All honey bee samples tested positive, via RT-RCP, for DWV in 2015 and 2018 (Table
2). Both species of Hylaeus also tested positive for the presence of DWV during both years but the prevalence of DWV in this genus was lower than for honey bees (Table 2). The average
DWV prevalence (2016 and 2018) found in H. albonitens was twice as high as in H. strenuus; roughly 46 % compared to 21% respectively. The observed difference in DWV prevalence between the Hylaeus species however was not statistically significant, (P = 0.083), possibly due to the small sample size for H. albonitens in both years.
There was no significant difference (p > 0.05, Fisher’s Exact Test) in the DWV prevalence across 2016 and 2018 when the 2 species of Hylaeus results were pooled; 37%, n =
29
19, and 23%, n = 50, respectively (Table 2). There was also no significant difference (p > 0.05) when the data was analyzed by species, H. albonitens and H. strenuus, between the two years.
The negative-strand testing returned negative results for all the prevalence-positive samples tested, suggesting no active viral replication was occurring in Hylaeus bees.
The Hylaeus tested for DWV master variants were all positive for DWV-A (2016, n = 6;
2018, n = 6). The Apis individuals showed a greater diversity of DWV variants, testing positive for DWV-A and DWV-B (2016, 2018, n = 5 and n = 4, respectively).
2.4 Discussion
In the early 1900s, the yellow-faced bee (Hylaeus spp.) was considered the most ubiquitous among the insects of Hawai‘i (Perkins, 1913), but in 2007 those historical observation sites were revisited to reveal that the populations had severely declined and many native
Hawaiian yellow-faced bee species are believed to be extinct (Magnacca, 2007). In 2016, the US
Fish and Wildlife Services listed seven Hawaiian Hylaeus species as endangered and they are now protected by the US Endangered Species Act - the first-time bees have been added to that list (FWS, 2016). Populations of Hylaeus spp., the only genus of endemic bee pollinators of the
Hawaiian Islands, are already threatened by habitat destruction and by the introduction of invasive ants and predatory wasps (FWS, 2016; Magnacca and King, 2013). For years, pathogens and diseases have been suspected to be impacting their populations (FWS, 2016;
Xerces Society, 2009), and our results confirm for the first time that this is likely true, albeit using data from surrogate species.
In 2017 (Santamaria et al., 2018), provided evidence of DWV spillover between flower visiting species for the first time in Hawai‘i. Ceratina smaragdula and Polistes spp.
30
(Hymenoptera: Vespidae), had DWV prevalence rates of 27% and 45%, respectively. The pollen-ingesting strategy of Hylaeus is functionally similar to Polistes spp. – where the presumed
DWV infection routes are overlapping nectar sources with A. mellifera, and predation upon infected bees - yet Hylaeus DWV prevalence rates were closer to that of Ceratina. This would initially lead us to believe that their foraging strategy does not subject them to an increased risk of infection, but this assumption does not hold when the prevalence rates are looked at across the two Hylaeus species individually; H. albonitens had a prevalence rate of 50% and 40% in 2016 and 2018, respectively, higher than that of H. strenuus (Table 2.2). These rates are apparently much higher than that of the Polistes infection rates reported in Santamaria et al. (2018). From these data sets, we can propose that 1) native Hylaeus species are coming into contact with
DWV, and 2) the rate of prevalence may vary drastically across the species. The differences in these hypothesized rates of infection could be species-specific physiological factors, but more likely a case of which floral communities are visited by each Hylaeus species and honey bees – it is possible that H. albonitens overlap more often with honey bees at shared foraging sites, resulting in these higher levels of DWV prevalence.
While the rates of DWV prevalence for each Hylaeus species also differed over time, these differences were not significantly different. For this study, samples taken for honey bees were only reported for the year 2018, although we have evidence from prior studies that indicate that DWV prevalence has remained steady in honey bee populations on O‘ahu – roughly 80% of individual foragers can be expected to be positive for this virus (Brettell et al., 2020; Santamaria et al., 2018).
In this study, we found that the honey bees tested positive for co-infections of DWV-A and DWV-B; however, only DWV-A was detected in any of the Hylaeus samples. Previous
31
studies have suggested that the dominant DWV strain type identified in a managed honey bee colony, would be indicative of which strain type would be present in the surrounding insect community (Bailes et al., 2018; Brettell et al., 2020; Graystock et al., 2014; Levitt et al., 2013).
However, there is emerging evidence that this is not necessarily always the case (de Souza et al.,
2019). Additionally, the dominant DWV master variants that are found within a honey bee community have recently been shown to be dynamic and changing, suggesting the need for continued monitoring of DWV strains (Manley et al., 2019; Norton et al., 2020). The rates of prevalence and, more importantly, DWV master variants in these pollinator communities should continue to be monitored as the dominant DWV variants shift in our commercial pollinators
(Manley et al., 2019).
Around the globe, similar findings are becoming increasingly commonplace in non-Apis bee species as new studies are now looking more closely at their DWV status. To date, this emerging infectious disease (EID) has been found in 78 species, including insects and arachnids
(Bailes et al., 2018; de Souza et al., 2019; Evison et al., 2012; Guzman-Novoa et al., 2015;
Hoover, 2015; Levitt et al., 2013; Loope et al., 2019; Martin and Brettell, 2019). Of the 78 species identified to be contaminated with DWV, 62 of were hymenopterans, comprising almost
80% of the DWV positive species (Table 2.3).
DWV is considered a quasi-species, which are species with a range of variants, genetically linked through mutation and organized around a master sequence or variant; currently
DWV has three master variants recognized - DWV-A, DWV-B, and DWV-C (Kevill et al.,
2017). Of the three master variants, only two have been previously found in Hawai‘i (Brettell et al., 2020). It was previously proposed that the dominant master variant type in managed honey bee colonies in locality could be used as a predictor for which DWV strain would be found in the
32
surrounding wild pollinator community (Bailes et al., 2018; Santamaria et al., 2018). However, as previously mentioned, the shift occurring from DWV-A to DWV-B in some areas is challenging this hypothesis. In Hawai‘i DWV-A appears to be the dominant strain type (Martin et al., 2012; Santamaria et al., 2018). In Chile, DWV-A is still the dominant strain in honey bee colonies, with DWV-B only comprising 3% of the viral prevalence (Riveros et al, 2020).
Another study in Buenos Aires, Argentina found 90% of their honey bee samples were infected with DWV-A and 47% had co-infections of DWV-B (Brasesco et al., 2020). In Brazil, de Souza et al. (2019), found that DWV-A and DWV-C where equally prevalent in Melipona subnitida colonies, while the dominant variant in surrounding honey bee colonies was limited to DWV-A, indicating that that variety of variants can still exist in other pollinators in a community.
Currently, the DWV variants have only been documented to negatively impact honey bee colonies, and in some cases bumble bees (Fürst et al. 2014; Genersch et al., 2006; Graystock et al., 2016). Despite the lack of evidence of DWV negatively affecting other pollinator species, researchers agree that it is still important to sample the general pollinator population for evidence of DWV prevalence since it is still unknown what effects, if any, it has on bees other than Apis
(Ghazoul, 2005; Potts et al., 2010; Tehel, 2016). Additionally, it is important to determine the directionality of transmission, and whether that transmission follows a source-sink dynamic, where one population acts as the source for all other viral infections in the community, or a more interactive back-and-forth (Cameron et al., 2011; Graystock, 2013b; Tehel, 2016). Lastly, the rise of multiple DWV variants in honey bees creates the potential for viral recombination, and the feared potential of a more deadly virulent variant emerges (Kevill et al., 2017; Kevill et al.,
2019; Martin and Brettell, 2019; Norton et al., 2020). Asymptomatic non-Apis populations could act as carriers or disease reservoirs - reservoirs which can create the potential for spillover effects
33
back into honey bee populations (Haydon et al., 2002; Power and Mitchell, 2004), and those potential recombinant DWV strains found in surrounding pollinator communities could then re- infect managed honey bee population with devasting effects (Ryabov et al., 2017). More studies like ours are crucial in elucidating the complex disease spread occurring every day in the ecosystem. As determined by previous studies, the viral landscape is not static, and ss-RNA virus are quick to mutate. Since the effects of these DWV variants on the health of non-Apis species has yet to be determined, it is wise to have historical documentation of what is present in local populations of Hymenoptera species.
34
a)
b)
Figure 2.1 a) Hylaeus female dehydrating nectar (image Karl Magnacca); b) Hylaeus with nectar collected from bottlebrush, Callistemon sp. (image Ethel M. Villalobos).
35
Figure 2.2 Honey bee (Apis mellifera) foraging on bottlebrush, Callistemon sp. Picture taken
August 19th, 2019 at the Urban Garden Centre, Pearl City, HI (image Ethel M. Villalobos).
36
Table 2.1 A list of all primers used in this study. All three known Deformed wing virus
(DWV) master variants were tested to determine presence or absence in our bee samples.
Primers sequences were obtained from previously published studies.
Target Primer Name Sequence (5’-3’) Reference
DWV DWVQ-F1 Highfield et al. 2009 TAGTGCTGGTTTTCCTTTGTC
DWV DWVQ-R1 Highfield et al. 2009 CTGTGTCGTTGATAATTGAATCTC
DWV-A DWVA-R1 CTCATTAACTGTGTCGTTGAT Kevill et al. 2017
DWV-B DWVB-R1 CTCATTAACTGAGTTGTTGTC Kevill et al. 2017
DWV-C DWVC-R1 ATAAGTTGCGTGGTTGAC Kevill et al. 2017
37
Table 2.2 Deformed wing virus (DWV) strain prevalence in Apis and Hylaeus spp. in 2016 and in 2018 in Hawai‘i.
DWV % DWV Strain Positive and total sample Year Host Species size
2016 Hylaeus albonitens 50% (n = 8) DWV-A (n = 3)
2018 Hylaeus albonitens 40% (n = 5) DWV-A (n = 2)
2016 Hylaeus strenuus 27.3% (n = 11) DWV-A (n = 3)
2018 Hylaeus strenuus 19.2% (n = 26) DWV-A (n = 4)
Hylaeus spp. 37% (n = 19) 2016
Hylaeus spp. 23% (n = 31) 2018
Total DWV prev. in Hylaeus 28% (n = 50)
Total DWV prev. in Apis DWV-A (n = 5) 100% (n = 5) mellifera DWV-B (n = 4)
38
Table 2.3 Deformed wing virus (DWV) positive Hymenoptera species from studies in different countries.
Country Species Sources
China Agapostemon viriscens Shi et al., 2016
Germany, Georgia Andrena bicolor Radzevičiūtė et al., 2017
Germany Andrena haemorrhoa Radzevičiūtė et al., 2017
Germany Andrena helvola Radzevičiūtė et al., 2017
United States Andrena sp. Singh et al., 2010
Kyrgyzstan Andrena thoracica Radzevičiūtė et al., 2017
Georgia Andrena trimmerana Radzevičiūtė et al., 2017
Germany, Georgia Anthophora plumipes Radzevičiūtė et al., 2017
Georgia, Kyrgyzstan Anthophora sp. Radzevičiūtė et al., 2017
United States Apis mellifera Santamaria et al., 2018
United States Apis cerana Levitt et al., 2013
United States Apis florea Amiri et al., 2018
United States Apis dorsata Amiri et al., 2018
United States Augochlora pura Singh et al., 2010
China Augochlorella sp. Shi et al., 2016
United States Bembix sp. Singh et al., 2010
United States Bombus impatiens Singh et al., 2010
Georgia, Kyrgyzstan Bombus lucorum Radzevičiūtė et al., 2017
United Kingdom Bombus pascuorum Evison et al., 2012
Georgia, Kyrgyzstan Bombus sp. Radzevičiūtė et al., 2017
Georgia Bombus sylvarum Radzevičiūtė et al., 2017
United States Bombus ternarius Singh et al., 2010
United Kingdom Bombus terrestris Evison et al., 2012
39
United States Bombus vagans Singh et al., 2010
United States Bombus huntii Li et al. 2011
Argentina Bombus atratus Reynaldi et al., 2013
United Kingdom Bombus lapidarius Fürst et al., 2014
United Kingdom Bombus monticola Fürst et al., 2014
United States Bombus griseocollis Olgun et al., 2020
United States Brachymyrmex sp. Payne, et al., 2020
United States Camponotus sp. Levitt et al., 2013
United States Ceratina dupla Singh et al., 2010
United States Ceratina smaragdula Santamaria et al., 2018
United States Crematogaster sp. Payne et al., 2020
United States Forelius sp. Payne et al., 2020
United States Halictidae sp. Levitt et al., 2013
United States Halictus ligatus Olgun et al., 2020
Georgia, Kyrgyzstan Lasioglossum sp. Radzevičiūtė et al., 2017
New Zealand Linepithema humile Sebastien et al., 2015
Canada Megachile rotundata Hoover, 2015
China Megachile brevis Shi et al., 2016
Brazil Melipona subnitida de Souza et al., 2019
China Melissodes bimaculata Shi et al., 2016
Brazil Myrmica rubra Guimarães-Cestaro et al., 2020 Brazil Nannotrigona Guimarães-Cestaro et al., testaceicornis 2020 Germany, Georgia, Kyrgyzstan Osmia bicornis Radzevičiūtė et al., 2017
Georgia Osmia cornuta Radzevičiūtė et al., 2017
United States Pheidole sp. Payne et al., 2020
United States Polistes fuscatus Singh et al., 2010
40
United States Polistes metricus Singh et al., 2010
United States Polistes aurifer Santamaria et al., 2018
United States Pseudomyrmex gracilis Payne et al., 2020
Mexico Scaptotrigona mexicana Guzman-Novoa et al., 2017
United States Solenopsis invicta Payne et al., 2020
Argentina Tetragonisca fiebrigi Alvarez et al., 2018
Brazil Tetragonisca angustula Guimarães-Cestaro et al., 2020 Italy Vespa crabro Forzan et al. 2017
United States Vespula pensylvanica Loope et al., 2019
United States Vespula sp. Levitt et al., 2013
United States Vespula vulgaris Singh et al., 2010
United States Xylocopa virginica Singh et al., 2010
Argentina Xylocopa augusti Lucia et al., 2014
41
References
Alvarez, L. J., F. J. Reynaldi, P. J. Ramello, M. L. G. Garcia, G. H. Sguazza, A. H.
Abrahamovich, and M. Lucia. 2018. Detection of honey bee viruses in Argentinian
stingless bees (Hymenoptera: Apidae). Insectes Sociaux 65: 191-197.
(doi:10.1007/s00040-017-0587-2).
Amiri, E., P. Kryger, M. D. Meixner, M. K. Strand, D. R. Tarpy, and O. Rueppell. 2018.
Quantitative patterns of vertical transmission of deformed wing virus in honey bees.
PLoS ONE 13:e0195283. (doi:10.1371/journal.pone.0195283).
Bailes E. J., K. R. Deutsch, J. Bagi, L. Rondissone, M. J. F. Brown, and O. T. Lewis. 2018
First detection of bee viruses in hoverfly (syrphid) pollinators. Biology Letters 14:
20180001. (doi:10.1098/rsbl.2018.0001).
Brasesco, C., S. Quintana, V. Di Gerónimo, M. L. Genchi García, G. Sguazza, M. E. Bravi,
L. Fargnoli, F. J. Reynaldi, M. Eguaras, and M. Maggi. 2020. Deformed wing virus
type a and b in managed honeybee colonies of Argentina. Bulletin of Entomological
Research 29: 1-11. (doi:10.1017/S000748532000036X).
Brettell, L. E., D. C. Schroeder, and S. J. Martin. 2020. RNAseq of deformed wing virus and
other honey bee-associated viruses in eight insect taxa with or without Varroa infestation.
Viruses 12(11): 1229. (doi: 10.3390/v12111229).
Bruckner, S., N. Steinhauer, K. Rennich, S. D. Aurell, D. M. Caron, J. D. Ellis, A. M.
Fauvel, K. Kulhanek, K. C. Nelson, J. Rangel, R. Rose, R. Sagil, G. P. Slater, R.
Snyder, C. A. Thoms, J. T. Wilkes, M. E. Wilson, D. vanEngelsdorp, G. R. Williams.
2018. Honey bee colony losses 2017-2018: preliminary results. Bee Informed. Retrieved
42
from: https://beeinformed.org/results/honey-bee-colony-losses-2017-2018-preliminary-
results/.
Cameron, S. A., J. D. Lozier, J. P. Strange, J. B. Koch, N. Cordes, L. F. Solter, T. L.
Griswold, and G. E. Robinson. 2011. Patterns of widespread decline in North American
bumble bees. Proceedings of the National Academy of Sciences of the United States of
America 108(2): 662-667. (doi:10.1073/pnas.1014743108) de Souza, F. S., J. L. Kevill, M. E. Correia-Oliveira, C. A. L. de Carvalho, and S. J. Martin.
2019. Occurrence of deformed wing virus variants in the stingless bee Melipona
subnitida and honey bee Apis mellifera populations in Brazil. Journal of General
Virology 100(2): 1- 6. (doi:10.1099/jgv.0.001206).
Dolezal, A. G., S. D. Hendrix, N. A. Scavo, J. Carrillo-Tripp, M. A. Harris, M. J. Wheelock,
M. E. O'Neal, and A. L. Toth. 2016. Honey bee viruses in wild bees: Viral prevalence,
loads, and experimental inoculation. PLoS ONE 11(11): e0166190.
(doi:10.1371/journal.pone.0166190).
Evison, S. E. F., K. E. Roberts, L. Laurenson, S. Pietravelle, J. Hui, J. C. Biesmeijer, J. E.
Smith, G. Budge, and W. O. H. Hughes. 2012. Pervasiveness of Parasites in
Pollinators. PLoS ONE 7(1): e30641. (doi:10.1371/journal.pone.0030641).
Forzan, M., S. Sagona, M. Mazzei, and A. Felicioli. 2017. Detection of deformed wing virus in
Vespa crabro. Bulletin of Insectology 70(2): 261-265.
Fürst, M., D. McMahon, J. Osborne, R. Paxton, and M. Brown. 2014. Disease associations
between honeybees and bumblebees as a threat to wild pollinators. Nature 506: 364–366.
(doi:10.1038/nature12977).
43
FWS. 2016. Endangered and threatened wildlife and plants: endangered status for 49 species
from the Hawaiian islands. Department of the Interior, Fish and Wildlife Service,
81(190): 67786-67860. Available online: https://www.gpo.gov/fdsys/pkg/FR-2016-09-
30/pdf/2016-23112.pdf.
Genersch, E., C. Yue, I. Fries, and J. Miranda. 2006. Detection of deformed wing virus, a
honey bee viral pathogen, in bumble bees (Bombus terrestris and Bombus pascuorum)
with wing deformities. Journal of Invertebrate Pathology 91: 61–63.
(doi:10.1016/j.jip.2005.10.002).
Ghazoul, J. 2005. Buzziness as usual? Questioning the global pollination crisis. Trends in
Ecology and Evolution 20(7): 367-373. (doi:10.1016/j.tree.2005.04.026).
Gisder, S., P. Aumeier, and E. Genersch. 2009. Deformed wing virus: Replication and viral
load in mites (Varroa destructor). Journal of General Virology 90(2): 463-467.
(doi:10.1099/vir.0.005579-0).
Graystock, P., D. Goulson, and W. O. H. Hughes. 2014. The relationship between managed
bees and the prevalence of parasites in bumblebees. Peer J 2: e522. (doi:
10.7717/peerj.522).
Graystock, P., I. Meeus, G. Smagghe, D. Goulson, and W. O. Hughes. 2016. The effects of
single and mixed infections of Apicystis bombi and deformed wing virus in Bombus
terrestris. Parasitology 143: 358–365. (doi:10.1017/S0031182015001614).
Graystock, P., K. Yates, S. E. Evison, B. Darvill, D. Goulson, and W. O. Hughes. 2013a. The
Trojan hives: pollinator pathogens, imported and distributed in bumblebee colonies.
Journal of Applied Ecology 50(5): 1207–1215. (doi:10.1111/1365-2664.12134).
44
Graystock, P., K. Yates, B. Darvill, D. Goulson, and W. Hughes. 2013b. Emerging dangers:
deadly effects of an emergent parasite in a new pollinator host. Journal of Invertebrate
Pathology 114(2): 114–119. (doi:10.1016/j.jip.2013.06.005).
Grozinger, C. M., and M. L. Flenniken. 2019. Bee viruses: ecology, pathogenicity, and
impacts. Annual Review of Entomology 64: 205-226. (doi:10.1146/annurev-ento-
011118-111942).
Guimarães-Cestaro, L., M. Fonseca Martins, L. C. Martínez, M. L. Teles Marques
Florêncio Alves, K. R. Guidugli-Lazzarini, R. C. Ferreira Nocelli, O. Malaspina, J.
E. Serrão, and E. Weinstein Teixeira. 2020. Occurrence of virus, microsporidia, and
pesticide residues in three species of stingless bees (Apidae: Meliponini) in the field. The
Science of Nature 107(16): 1-14. (doi:10.1007/s00114-020-1670-5).
Guzman-Novoa, E., M. M. Hamiduzzaman, R. Anguiano-Baez, A. Correa-Benítez, E.
Castañeda-Cervantes, and N. Arnold. 2015. First detection of honey bee viruses in
stingless bees in North America. Journal of Apicultural Research 54(2): 93-95.
(doi:10.1080/00218839.2015.1100154).
Haydon, D. T., S. Cleaveland, L. H. Taylor, and M. K. Laurenson. 2002. Identifying
reservoirs of infection: a conceptual and practical challenge. Emerging Infectious
Diseases 8(12): 1468-1473. (doi: 10.3201/eid0812.010317).
Highfield, A. C., A. El Nagar, L. C. M. Mackinder, L. M.-L. J. Noel, M. J. Hall, S. J.
Martin, and D. C. Schroeder. 2009. Deformed wing virus implicated in overwintering
honeybee colony losses. Applied Environmental Microbiology 75(22): 7212–7220.
(doi:10.1128/AEM.02227-09).
45
Hoover, S. 2015. Preliminary Report: Detections of viruses in alfalfa leafcutter bees in
southern Alberta. Alberta Agriculture and Rural Development. Retrieved from:
http://www.alfalfaseedab.com/pdf/2015/12-08/Hoover_2015_Leafcutter_viral_
report_for_ASCA_AGM.pdf.
Kevill, J. L., A. Highfield, G. J. Mordecai, S. J. Martin, and D. C. Schroeder. 2017. ABC
assay: method development and application to quantify the role of three DWV master
variants in overwinter colony losses of European honey bees. Viruses 9(314): 1-14.
(doi:10.3390/v9110314).
Kevill, J. K., F. S. de Souza, C. Sharples, R. Oliver, D. C. Schroeder, and S. J. Martin. 2019.
DWV-A lethal to honey bees (Apis mellifera): A colony level survey of DWV variants
(A, B, and C) in England, Wales, and 32 States across the US. Viruses 11(5): 426.
(doi:10.3390/v11050426).
Levitt, A. L., R. Singh, D. L. Cox-Foster, E. Rajotte, K. Hoover, N. Ostiguy, and E. C.
Holmes. 2013. Cross-species transmission of honey bee viruses in associated arthropods.
Virus research 176: 232-240. (doi:10.1016/j.virusres.2013.06.013).
Li, J., W. Peng, J. Wu, J. P. Strange, H. Boncristiani, and Y. Chen. 2011. Cross-species
infection of deformed wing virus poses a new threat to pollinator conservation. Journal of
Economic Entomology 104(3): 732-739. (doi: 10.1603/EC10355).
Loope, K. J., J. W. Baty, P. J. Lester, and E. E. Wilson Rankin. 2019. Pathogen shifts in a
honeybee predator following the arrival of the Varroa mite. Proceedings of the Royal
Society B: Biological Sciences 286(1894): 20182499.
46
Lucia, M., F. J. Reynaldi, G. H. Sguazza, and A. H. Abrahamovich. 2014. First detection of
deformed wing virus in Xylocopa augusti larvae (Hymenoptera: Apidae) in Argentina.
Journal of Apicultural Research 53(4): 466-468. (doi:10.3896/IBRA.1.53.4.11).
Magnacca, K. M. n.d. Hawaii's native Bees - Nalo meli maoli. University of Hawai‘i Master
Gardener Program, Honolulu, HI. 3p. Available online at:
https://www.ctahr.hawaii.edu/uhmg/news/V9-Magnacca-NativeBee.pdf
Magnacca, K. M. 2007. Conservation status of the endemic bees of Hawaii, Hylaeus
(Nesoprosopis) (Hymenoptera: Colletidae). Pacific Science 61(2): 173-190.
Magnacca, K. N. 2011. Hylaeus strenuus (Hymenoptera: Colletidae), a new alien bee on O'ahu.
Bishop Museum Occasional Papers 109: 23-24.
Magnacca, K. N., and C. B. A. King. 2013. Assessing the presence and distribution of 23
Hawaiian yellow- faced bee species on lands adjacent to military installations on O‘ahu
and Hawai‘i Island. Technical Report No. 185. Pacific Cooperative Studies Unit,
University of Hawai‘i, Honolulu, Hawai‘i. 39 pp.
Manley, R., M. Boots, and L. Wilfert. 2015. Emerging viral disease risk to pollinating insects:
ecological, evolutionary and anthropogenic factors. Journal of Applied Ecology 52(2):
331–340. (doi:10.1111/1365-2664.12385).
Manley, R., B. Temperton, T. Doyle, D. Gates, S. Hedges, M. Boots, and L. Wilfert. 2019.
Knock-on community impacts of a novel vector: spillover of emerging DWV-B from
Varroa-infested honeybees to wild bumblebees. Ecology Letters 22: 1306-1315.
Martin, S., A. Highfield, L. Brettell, E. Villalobos, S. Nikaido, G. Budge, M, Powell, and D.
Schroeder. 2012. Global honey bee viral landscape altered by a parasitic mite. Science
336(6086): 1304–1306. (doi:10.1126/science.1220941).
47
Martin, S. J., and L. E. Brettell. 2019. Deformed wing virus in honeybees and other insects.
Annual Review of Virology 6:49-69 (doi:10.1146/annurev-virology-092818-015700).
McMahon, D. P., L. Wilfert, R. J. Paxton, and M. J. F. Brown. 2018. Chapter Eight -
Emerging viruses in bees: From molecules to ecology. Advances in Virus Research 101:
251-291. (doi:10.1016/bs.aivir.2018.02.008).
Möckel, N., S. Gisder, and E. Genersch. 2011. Horizontal transmission of deformed wing
virus: pathological consequences in adult bees (Apis mellifera) depend on the
transmission route. Journal of General Virology 92: 370–377.
Morens, D. M., and A. S. Fauci. 2013. Emerging infectious diseases: threats to human health
and global stability. PLoS 9(7): e1003467. (doi:10.1371/journal.ppat. 1003467).
Norton, A. M., E. J. Remnant, G. Buchmann, and M. Beekman. 2020. Deformed wing virus
genotypes in naïve Australian honeybees provides insight into the increasing global
prevalence of genotype B. Frontiers in Microbiology 11:620.
(doi:10.3389/fmicb.2020.00620).
Olgun, T., S. E. Everhart, T. Anderson, and J. Wu-Smart. 2020. Comparative analysis of
viruses in four bee species collected from agricultural, urban, and natural landscapes.
PloS ONE 15(5): e0234431. (doi:10.1371/journal.pone.0234431).
Payne, A. N., T. F. Shepherd, and J. Rangel. 2020. The detection of honey bee (Apis
mellifera)-associated viruses in ants. Scientific Reports 10: 2923. (doi:10.1038/s41598-
020-59712-x).
Perkins, R. C. L. 1913. Introduction. Pages i–ccxxvii In D. Sharp (Ed.) Fauna Hawaiiensis. Vol.
1. Cambridge University Press, London.
48
Pisa, L. W. , V. Amaral-Rogers, L. P. Belzunces, J. M. Bonmatin, C. A. Downs, D. Goulson,
D. P. Kreutzweiser, C. Krupke, M. Liess, M. McField, C. A. Morrissey, D. A.
Noome, J. Settele, N. Simon-Delso, J. D. Stark, J. P. Van der Sluijs, H. Van Dyck,
and M. Wiemers. 2015. Effects of neonicotinoids and fipronil on non-target
invertebrates. Environmental Science and Pollution Research 22(1): 68-102.
(doi:10.1007/s11356-014-3471-x).
Potts, S. G., J. C. Biesmeijer, C. Kremen, P. Neumann, O. Schweiger, and W. E. Kunin.
2010. Global pollinator declines: trends, impacts and drivers. Trends in Ecology and
Evolution 25(6): 345–353. (doi:10.1016/j.tree.2010.01.007).
Power, A. G., and C. E. Mitchell. 2004. Pathogen spillover in disease epidemics. The American
Naturalist 164(S5): S79-S89.
Radzevičiūtė, R., P. Theodorou, M. Husemann, G. Japoshvili, G. Kirkitadze, A.
Zhusupbaeva, and R. J. Paxton. 2017. Replication of honey bee-associated RNA
viruses across multiple bee species in apple orchards of Georgia, Germany and
Kyrgyzstan. Journal of Invertebrate Pathology 146: 14-23.
(doi:10.1016/j.jip.2017.04.002).
Reynaldi, F. J., G. H. Sguazza, F. J. Albicoro, M. R. Pecoraro, and C. M. Galosi. 2013. First
molecular detection of co-infection of honey bee viruses in asymptomatic Bombus
atratus in South America. Brazilian Journal of Biology 73(4): 797-800.
(doi:10.1590/S1519-69842013000400016).
Riveros, G., N. Arismendi, N. Zapata, D. Evans, I. Pérez, P. Aldea, and M. Vargas. 2020.
Occurrence, prevalence and viral load of deformed wing virus variants in Apis mellifera
49
colonies in Chile. Journal of Apicultural Research 59(1): 63-68.
(doi:10.1080/00218839.2019.1670993).
Ryabov, E. V., G. R. Wood, J. M. Fannon, J. D. Moore, J. C. Bull, D. Chandler, A. Mead,
N. Burroughs, and D. J. Evans. 2014. A virulent strain of deformed wing virus (DWV)
of honeybees (Apis mellifera) prevails after Varroa destructor-mediated, or in vitro,
transmission. PLoS Pathogens 10: e1004230. (doi:10.1371/journal.ppat.1004230).
Ryabov, E. V., A. K. Childers, Y. Chen, S. Madella, A. Nessa, D. vanEngelsdorp, and J. D.
Evans. 2017. Recent spread of Varroa destructor virus-1, a honey bee pathogen, in the
United States. Scientific Reports 7(1): 17447. (doi:10.1038/s41598-017-17802-3)
Santamaria, J., E. M. Villalobos, L. E. Brettell, S. Nikaido, J. R. Graham, and S. Martin.
2018. Evidence of Varroa-mediated deformed wing virus spillover in Hawaii. Journal of
Invertebrate Pathology 151: 126-130. (doi:10.1016/j.jip.2017.11.008).
Sebastien, A., P. J. Lester, R. J. Hall, J. Wang, N. E. Moore, M. A. M. Gruber. 2015.
Invasive ants carry novel viruses in their new range and form reservoir for a honeybee
pathogen. Biology Letters 11: 20150610. (doi:10.1098/rsbl.2015.0610).
Shi, M., X.-D. Lin, J.-H. Tian, L.-J. Chen, X. Chen, C.-X. Li, X.-C. Quin, J. Li, J.-P. Cao,
J.-S. Eden, J. Buchmann, W. Wang, J. Xu, E. C. Holmes, and Y.-Z. Zhang. 2016.
Redefining the invertebrate RNA virosphere. Nature 540: 539–543.
(doi:10.1038/nature20167).
Singh, R., A. Levitt, E. Rajotte, E. Holmes, N. Ostiguy, D. vanEngelsdorp, W. I. Lipkin, C.
W. dePamphilis, A. L. Toth, and D. Cox-Foster. 2010. RNA viruses in hymenopteran
pollinators: evidence of inter-taxa virus transmission via pollen and potential impact on
50
non-Apis hymenopteran species. PLoS ONE 5(12): 1–16.
(doi:10.1371/journal.pone.0014357).
Snelling, R. S. 2003. Bees of the Hawaiian Islands, exclusive of Hylaeus (Nesoprosopis)
(Hymenoptera: Apoidea). Journal of the Kansas Entomological Society 76(2): 342-356.
Available online: http://www.jstor.org/stable/25086121.
Tehel, A., M. J. Brown, and R. J. Paxton. 2016. Impact of managed honey bee viruses on wild
bees. Current Opinion in Virology 19: 16–22. (doi:10.1016/j.coviro.2016.06.006).
Voyles, J., A. M. Kilpatrick, J. P. Collins, M. C. Fisher, W. F. Frick, H. McCallum, C. K. R.
Willis, D. S. Blehert, K. A. Murray, R. Puschendorf, E. B. Rosenblum, B. M. Bolker,
T. L. Cheng, K. E. Langwig, D. L. Lindner, M. Toothman, M. Q. Wilber, and C. J.
Briggs. 2015. Moving beyond too little, too late: managing emerging infectious diseases
in wild populations requires international policy and partnerships. EcoHealth 12(3): 404–
407. (doi:10.1007/s10393-014-0980-5).
Xerces Society. 2009. Petition to list one species of Hawaiian yellow-faced bee (Hylaeus hilaris)
as an endangered species under the U.S. endangered species act. The Xerces Society for
Invertebrate Conservation, 23p.
Yañez, O., J. Chávez-Galarza, C. Tellgren-Roth, M. A. Pinto, P. Neumann, and J. R. de
Miranda. 2020. The honeybee (Apis mellifera) developmental state shapes the genetic
composition of the deformed wing virus-A quasispecies during serial transmission.
Scientific Reports 10: 5956. (doi:10.1038/s41598-020-62673-w).
51
CHAPTER 3
FLOWERS ARE DIRTY DOORKNOBS: POSSIBLE DWV TRANSMISSION ROUTES
ACROSS THE POLLINATORS OF O‘AHU
Abstract
Pollinators, much like other organisms, have to overcome interactions with pathogens for survival. The microbial world is fraught with a wide array of organisms which can either benefit or disadvantage insect pollinators. Unfortunately for pollinators, a major source of microbial exchange happens at the very food sources they rely on, at flowers. Yet despite the reliability by which pollinators will encounter microbes, the specific type of microbes they will encounter at flowers is unreliable. Determining whether a pollinator will encounter a specific pathogen during a flower visit is a difficult task. The disease interactions between flower visiting insects is a diverse and complex web, made up of many variables and factors. Ranging from biotic to abiotic, the microbial makeup of flower-heads varies within and across species, due to variables such as flower morphology, nectar sweetness, season, and more. Due to the unpredictability of these microbial communities, and the lack of research dedicated to mapping these interactions, understanding the spread of diseases between pollinator communities at these sites remains an important question. When Deformed wing virus (DWV) is added to the equation, the importance is further amplified when the impact of this disease is taken into consideration; Apis and Bombus species are known to suffer detrimental effects from this prominent virulent virus, with the pathogenicity in other bee species still undetermined. This survey, conducted over a period of 4 years, across various sites on the island of O‘ahu, explores the prevalence of DWV in different flower-visiting insects, and how these viral rates differ over time and across species. Apis mellifera infection rates were relatively constant, ranging between 86% and 88% across the
52
sampling years. Ceratina smaragdula ranked second highest in DWV prevalence, but with greater variation across the years, ranging from 3% to 50%. The remaining groups sampled,
Hylaeus spp., grouped non-Apis bees, paper wasps, grouped Dipterans, and grouped
Lepidopterans, ranged between 12% to 43%. Findings mirror those in similar studies performed on the Hawaiian Islands.
Keywords: Deformed wing virus, spillover, viral mapping, pollinator webs
3.1 Introduction
Deformed wing virus (DWV; Picornavirales: Iflaviridae), once a nondescript, general hymenopteran virus, has become a main suspect contributing to the decline of honey bees globally. Honey bees, Apis mellifera (Hymenoptera: Apidae), have been declining in numbers for the past 30 years (de Miranda and Genersch, 2010; Villalobos, 2016), but only recently has research been able to identify the intermingled factors that play a role in this decline (Evison et al., 2012; Fürst et al., 2014; Highfield et al., 2009; Tehel et al., 2016).
The Varroa mite, Varroa destructor (Mesostigmata: Varroidae) is the main driver of viral prevalence (Villalobos, 2016) and increased virulence of DWV (Martin et al., 2012). The arrival of the Varroa mite to the state of Hawai‘i in 2008 was linked to a dramatic reduction of the viral genetic diversity of the originally innocuous DWV (Martin et al., 2012). The mites’ presence reduced not only the strain diversity of DWV but was also involved in the selection of deadlier strains over less virulent genetic variants (Brettell et al., 2020; Martin et al., 2012; Santamaria et al., 2018). The negative effects of these dominant master variants have been described in depth for honey bees, and include, but are not limited to, a shortened life span, crippling morphological deformities, immune deficiencies, overwintering colony losses, and impaired learning behavior
53
(Bruckner et al., 2018; Erbain et al., 2015; Gisder et al., 2009; Highfield et al. 2009; Kevill et al.,
2019), yet the effects of DWV, if any, are poorly understood in non-Apis species. We know that other Apis-native pathogens can have detrimental effects on bumble bees, Bombus spp.
(Hymenoptera: Apidae) (Fürst et al. 2014; Genersch et al. 2006; Graystock et al. 2013), but our understanding of bumble bee health and disease overlap with A. mellifera, has been fueled by the research interest these commercially significant pollinators generate.
Social pollinators not only seem to attract more research but may also constitute better study organisms when it comes to disease dynamics. Each colony, or hive, houses many individuals of variable ages and at different life stages. A recent study in Australia tracked the spread of Nosema, a microsporidium that infects A. mellifera, via resource sharing among two species of bees (Purkiss and Lach, 2019). In comparison, with regards to the question of pathogen overlap and the effect of DWV on solitary pollinators species, the jury is still out.
In 2018, Santamaria et al., reported that the introduction of the Varroa mite to a honey bee population, will cause DWV spillover into the surrounding insect population. The DWV viral prevalence can vary greatly across species, even within the same genus, (Santamaria, 2020).
It has been suggested that the DWV strain composition within a honey bee population is not strongly correlated with the DWV diversity in the surrounding insect population (Brettell et al.,
2020; de Souza et al., 2019), but without further studies, it is too soon to make a definite statement considering how complex these disease interactions can be and what are typical prevalence patterns across taxonomic groups (Alder et al., 2018; Alder et al., 2020).
The transmission routes of DWV in honey bees include vertical and horizontal transmission between individuals of the colony. Vertical transmission can occur via both maternal and paternal lines; however, the role of queen bees in transmission of DWV may be
54
less significant than previously thought (Martin and Brettell, 2019). The most effective horizontal transmission of DWV within the colony is linked to the Varroa mite. Nevertheless, food sharing between adult bees and larval feeding by nurse bees, could contribute to covert
DWV transmission, but is unlikely to result in wing deformities; this unreliability to result in covert infections via nestmates is still not well understood (Martin and Brettell, 2019). Finally, another transmission route is via food collection on flowers. In 2014, Mazzei et al., showed that
DWV particles remained viable on infected pollen and could result on infections, thus flowers can be included as potential DWV infection sites.
The majority of plant species are visited by a diversity of insect pollinators and flowers are known to harbor a large collection of microorganisms in the nectar and on the pollen (Alder et al., 2020; Alder et al., 2018; Alger et al., 2019). The type of microbes (beneficial or detrimental) that colonize a flower can be dependent on nectar sugar content, order of arrival of organisms at a flower-head, seasonality, sun/shade dynamics, UV exposure, and more (Alder et al., 2020; Alger et al., 2019). Disease sharing across pollinators on floral parts has long been suspected, and several studies have now confirmed the presence and survivability of DWV on flowers and pollen (Mazzei et al., 2014; McArt et al., 2014; Singh et al., 2010).
All of these factors and variables revert to the original question of location. If honey bees are known to have preferred floral hosts (Graystock et al., 2020), how do these floral sites play a role in the transmission of DWV to the surrounding pollinator community? Could these sites be used as predictors for which non-Apis visitors carry DWV strains? As seen in previous Hawai‘i studies (Brettell et al., 2020; Santamaria et al., 2018; Santamaria, 2020), there is a wide range in the DWV prevalence found across species. Reconstructing a network of which species carry
DWV and in what habitats, is the foundation on which these questions will begin to be answered.
55
In this chapter, I present a survey of insect flower visitors that share resources and examine the prevalence of DWV on different groups. The results are presented per species, when adequate sample sizes were obtained, and arranged in large taxonomic groups when individual species were not abundant. This work contributes to the “mapping” of DWV detection on O‘ahu and complements a recent study published by Martin and Brettell (2019) and Brettell et al.
(2020) on DWV in the Hawaiian Islands.
3.2 Methods
3.2.1 Specimen collection
A broad sweep of incidental flower visiting insect fauna were collected across eight sites
(Pearl City, Kāneʻohe, Kunia, Mānoa, Sandy Beach, Waimānalo, Kaʻena Point, and Moanalua
Valley) on the island of O‘ahu, Hawai‘i, between the years 2014 and 2018. Specimens were collected using hand-nets and stored in a -80C freezer until RNA extraction for virus detection.
While the emphasis was on Hymenopteran flower visitors, other insect orders were also considered for this study. In total, 15 families, across three different insect orders (Hymenoptera,
Lepidoptera and Diptera) were collected. All species were introduced and established species in the environment. We focused on species foraging on floral structures rather than incidental species found on stems, leaves, roots, or other plant parts. We also targeted floral structures that were visited by multiple species.
Collection sites consisted of a mix of agricultural fields, parks, gardens, and beach edge vegetation strips. The selected insect species are all relatively abundant and can be found in urban and agricultural environments, where they overlap in resource use with A. mellifera (pers. obs). Our selection of diverse habitats provided us with a preliminary broad perspective of the
56
viral distribution across the island and represents the micro-climate diversity that characterizes the Hawaiian archipelago.
3.2.2 DWV Detection
Insects were tested individually for the presence or absence of DWV following the same protocol described in previous publications (Martin et al., 2012; Santamaria et al., 2018). Each insect sample was transferred to a nuclease free 1.5 ml centrifuge tube, which was submerged in liquid nitrogen before being crushed using a sterile mini pestle. Total RNA was then extracted from the resulting powder using the RNeasy Mini Kit (Qiagen) following manufacturer’s conditions and resuspended in 30 μl of RNase-free water. RNA concentration was determined using a Nanodrop 2000c (Thermo Scientific) and samples were diluted to 25 ng/μl. Reverse
Transcription-PCR (RT-PCR) protocols adapted from Martin et al. (2012) were carried out to determine whether samples contained DWV. RT-PCR reactions contained 50 ng RNA, 1x
OneStep RT-PCR Buffer (QIAGEN), 400 μM each dNTP, 10units RNase Inhibitor (Applied
Biosystems) and 0.6 μM each primer. DWVQ_F1 and DWVQ_R1 primers (Highfield et al.,
2009) were used to amplify a conserved region of the RNA dependent RNA polymerase (RdRp) gene (Table 3.2). Reactions were run using a T100 Thermocycler (Bio-Rad) starting with reverse transcription at 50°C for 30 min, followed by an initial denaturation step at 94°C for 30 s. This was followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 54°C for DWVQ primers (58°C for actin) for 30 s, extension at 72°C for 1 min, and a final extension step at 72°C for 10 min. Agarose gel electrophoresis was used to determine the results. RT-PCR products were separated on a 2% agarose gel stained with SYBR Safe DNA gel stain (Invitrogen) with a
100 bp TrackIt ladder (Invitrogen), and visualized with ultraviolet light. All samples were
57
determined, via the detection of a bright band at 120 bp on an agarose gel, to contain sufficient intact RNA, and in turn, confirm the presence of DWV, or the absence in any samples that failed to amplify a DWV fragment.
3.3 Results
The results showed that of the 8 species of bees included in this study seven (A. mellifera,
Xylocopa sonorina, Megachile umbripennis, Ceratina smaragdula, Lasioglossum sp. Hylaeus strenuus, and Hylaeus albonitens), tested positive for DWV at least once; only Ceratina dentipes
(n = 1) was negative for DWV (Table 3.1). A total of 217 bee samples were analyzed as a taxonomic group, including honey bees, the infection rate for bees is 43%. However, about 80% of the samples were 2 species: A. mellifera (n = 70) and C. smaragdula (n = 104). Because of the disparity in sample sizes, the remaining bee species were lumped into one group, in the rest of the results.
The data showed that by far the highest prevalence of DWV was in honey bees; roughly
84% (59/70) of the individuals tested positive for the virus. In contrast, when viral results for C. smaragdula were pooled over the years, the DWV prevalence is much lower than that of honey bees; with 21% of the samples (22/104) testing positive for DWV (Figure 3.1). When the viral prevalence data of other species of bees are examined (excluding the 2 more abundant species noted above), the data shows that roughly 28% (12/43) of the samples are positive for DWV.
Hylaeus strenuus, an introduced species in the same genus of the native yellow-faced bees, were found to be positive for DWV (33% (5/15)), which is slightly higher prevalence than observed in C. smaragdula. Additionally, a small number of H. albonitens individuals (n = 8)
58
were tested and 50% were found positive for DWV. The prevalence of DWV in the genus
Hylaeus, based on pooled data for the 2 species was 39% (n = 23).
Wasps are known to visit flowers to consume nectar, and in this study, we concentrated on Polistes aurifer, an invasive paper wasp. The prevalence of DWV on this species was 43%
(9/20), which is higher than the non-Apis bees. The prevalence of the virus in non-Hymenopteran species appeared to be much lower: among the Diptera samples examined only 12% (3/25) tested positive for DWV, and in Lepidoptera 13% (2/15) tested positive for the virus.
Sampling over time showed that the DWV infection rates of A. mellifera were relatively constant; the prevalence of the virus in honey bees in 2015 and 2018 was 88% (n = 26) and 85%
(n = 27) respectively (Figure 3.4). In contrast, the prevalence of DWV among C. smaragdula was much more variable across the years, ranging from 3% to 50% (Figure 3.5) The number of sites from which species were collected varied across the years; in 2014, bees were collected from four sites on O‘ahu, in year 2015 three sites were visited, and in year 2017 only two sites were sampled. There was some overlap of sites across the years, however, there were some sites that were unique to each year; in other words, some sites were visited multiple years and some only once.
59
Table 3.1 Summary of Deformed wing virus (DWV) positive prevalence among insects sharing floral resources in the field (O‘ahu, HI). Specific details of site collections and year, plus additional species with low captures rates, are included in the
Appendix.
Taxonomic group or species DWV + Prevalence Sample size
Hymenoptera
Anthophila Apis mellifera 84% 70
Ceratina 21% 104
smaragdula
Hylaeus strenuus 33% 15
Mix non-Apis bees 28% 43
species
Vespidae Polistes aurifer 43% 25
Diptera Mix of species 12% 25
Lepidoptera Mix of species 13% 15
60
Apis mellifera Other bee species C. smaragdula
DWV +
DWV -
Figure 3.1 Relative prevalence of Deformed wing virus (DWV) for common bee species, Apis mellifera (n = 70), Ceratina smaragdula (n = 104), and 6 other species of bees combined
(Xylocopa sonorina, Megachile umbripennis, Ceratina dentipes, Lasioglossum sp., Hylaeus strenuus, and Hylaeus albonitens) (n = 43).
61
Polistes aurifer Hylaeus strenuus
DWV +
DWV -
Figure 3.2 Prevalence of DWV in the paper wasp Polistes aurifer (n = 20) and the solitary bee
Hylaeus strenuus (n = 15) sharing flower use with honey bees.
62
Diptera Lepidoptera
DWV +
DWV -
Figure 3.3 Prevalence of DWV in combined Diptera and Lepidoptera species that share floral resources with honey bees: Diptera 12% (n = 25) and in Lepidoptera 13% (n =15).
63
2015 (n = 26) 2018 (n = 27)
DWV +
DWV -
Figure 3.4 The relative prevalence of DWV in Apis mellifera during the years of 2015 and
2018; sample sizes for those year were similar. The number of sites visited were two for 2015 and three for 2018; there was no overlap on the sites between the 2 years.
64
2014 (n = 61) 2015 (n = 33) 2017 (n = 10)
DWV +
DWV -
Figure 3.5 The high variability across the years for DWV in Ceratina smaragdula on O‘ahu.
The number of sites samples varied from four, to three, to two, in 2014, 2015, and 2018, respectively.
65
3.4 Discussion
The genomic virome of honey bees in Hawai‘i has been dramatically altered by the recent advent of V. destructor (Martin et al., 2012; Brettell et al., 2020). Since the introduction of the mite to O‘ahu and Hawai‘i (known colloquially as the “Big Island”) the viral levels have greatly increased in A. mellifera, and the diversity of DWV strains has been reduced. In Hawai‘i, master variant DWV-A is still the most common variant, but DWV-B is becoming increasingly frequent. In our study, we simply noted presence (PCR detection) or absence (no detection) of
DWV in the samples, but not the strains or levels of the virus. Nevertheless, our study confirms that DWV is ubiquitous (80% incidence consistently) among honey bees as has been reported previously (Martin et al., 2012, Santamaria et al. 2018).
The possible routes of DWV transmission from Apis to non-Apis flower visitors is suspected to be contact with residues on the flower structures or food based. Field studies of pathogen transmission via flowers are scarce; however, studies correlating laboratory experiments and field observations are increasing. Crithidia bombi (Trypanosomatidae) is a pollinator pathogen that has been experimentally shown to be consistently transmitted across bumble bee species via feces left behind during floral visits, so consistently that floral visitations are a good indicator of transmission of this disease for this genus (McArt et al., 2014; Salathe and Schmid-Hempel,
2011). In fact, floral sites are such dense areas of visitation, often sites where insects visit to feed and to defecate, that fecal composition may play as important a role as nectar (Alder et al.,
2020).
Nectar itself is a well-studied variable in microbial composition of flowers; it can be a direct factor determining which microbes survive, depending on the sugar concentrations present and which microbes can continue to grow on them (Herrera et al., 2010; Pozol et al., 2012). These
66
floral rewards, in turn, affect which insect species visit and the length of the visits. Bees acquire about 1% of the microbial volume found on a flower during a nectar visit (Russel et al., 2019), but more during a pollen visit. These are just some of the features of floral attractiveness which can drive which species of pollinator will visit, and also the length of foraging visits (Alger et al.,
2019; Graystock et al., 2015). In contrast, there are features which can result in floral un- attractiveness; in a 2019 study, visitations by honey bees were lowest on blooms with the highest viral loads, although the reason behind these reduced visits was not addressed (Alger et al. 2019).
Identifying the factors that can drive increased or decreased pollination is important when discussing how diseases can play a role in the effectiveness of pollination for honey bees and bumble bees, which are considered agriculturally important species (Alger et al., 2019;
Graystock et al., 2016).
Floral morphology adds another variable in microbial transmission; Figueroa et al., (2019) showed that Bombus species had different rates of defecation depending on the shape of the flower they visited, in this case, preferring large composite flowers. Pests which vector disease also appear to have preferences to floral shapes, like in the case of the Varroa mite which has difficulty moving on the surface of echinacea flowers for example, thus lowering the incidence of the mite phoresy when honey bees visit these flowers (Peck et al., 2016).
Nevertheless, pollination webs are extraordinarily complex and vary depending on the local species composition (both that of the pollinators and the microbes) among sites. For this reason, this survey focuses only on the presence or absence of DWV in areas where insects were observed sharing floral resources with honey bees. However, floral diversity was not included in the analysis of the results, due to the lack of expertise of the identification of flower species. Our results indicate that DWV can be detected in seven of the eight non-Apis bees on O‘ahu. The
67
only species from which DWV was not detected, C. dentipes, was represented by only one individual and likely does not truly accurately indicate DWV absence on that particular species
(Appendix). In fact, roughly one out three C. smaragdula tested for this study were DWV+.
Previous work with larger samples showed that DWV incidence on C. smaragdula was 45%
(Santamaria et al., 2018). It is also worth noting that the DWV prevalence in C. smaragdula
(21% positive) was similar to that of the combined mixed-bee group (28% positive), which may indicate that the DWV prevalence among non-Apis bee groups on O‘ahu have similar DWV prevalence (Figure 3.1). The DWV prevalence of the other combined groups, the Diptera and
Lepidoptera group, showed much lower levels (Figure 3.3), possibly indicating fewer opportunities for contact with DWV particles. Morphological differences in their foraging abilities could indicate the reason for these levels; Lepidoptera have longer mouthparts and do not need to come into such close contact with flower parts when compared to bee species.
Bombus species have been noted to exhibit a “hovering” behaviour when foraging on a flower that has been contaminated with feces (Alger et al., 2019) which may be unintentionally the case with these other pollinator groups.
The current survey also shows that DWV prevalence levels have remained steady in honey bee populations in Hawai‘i (Figure 3.4); these results are also supported by previous research which reflect similar levels (Brettell et al., 2020; Santamaria et al., 2018). However, DWV detection rates appear to vary greatly by year and collection site in the case of C. smaragdula
(Figure 3.5); which might be indicative that the DWV composition in non-Apis populations fluctuates more; and may result in differences in the DWV master variants found in these populations. In addition, detection could be influenced by other factors including flower
68
morphology, resources exploited by the insect, sample size, and proximity to managed or wild hives (Alger et al., 2019; Brettell et al., 2020; Graystock et al., 2014).
The bee genus Hylaeus (Colletidae) is globally distributed, but the genus has undergone an adaptive radiation in Hawai‘i. There are introduced species in the same genus that are now widespread on O‘ahu, among these are H. strenuus and H. dentipes, both of which tested positive for DWV in this study. The majority of the samples collected in this study were H. strenuus, and the prevalence of the virus in these bees was 33% (n = 15). Although the sample size is relatively modest, the detection rate was higher in these bees than for C. smaragdula, which had over 100 specimens examined, consequently, it seems that H. strenuus may come into contact with and acquire DWV more often (Figure 3.2). One possible explanation is that because Hylaeus ingest pollen while on the flower, instead of transporting it to the nest using specialized body hairs like most bees, the positive detections may originate from gut contents filled with infected pollen.
The idea that some detections of viruses on bees is due to food contamination, not true tissue infections, is something that needs to be clarified in future studies. However, irrespective of whether true replication is occurring in these species, it is still important to track which non-Apis populations contain high levels of DWV prevalence, as it is feared that these populations have the potential to become disease reservoirs that spill back into managed honey bee populations
(Morens and Fauci, 2013; Ryabov et al., 2017; Voyles et al., 2015).
It has been noted that DWV is more often detected among Hymenoptera, compared to other taxonomic groups of insects, this is especially true for social wasps, where DWV has been confirmed in at least 7 species (Martin & Brettell, 2019). In this study, the overall prevalence of
DWV in the paper wasp, P. aurifer, was the second highest, following honey bees; nine out twenty wasps examined were positive for DWV (45%; Figure 3.2). Detection of the DWV in two
69
genera of wasps, Vespula and Vespa, has been linked to their predation habits. Yellow jackets
(Vespula) have been documented in Hawai‘i to invade honey bee nests and consume adults, larvae, and pupae, possibly ingesting DWV in large amounts. Polistes however, are Lepidopteran specialists, that search plants looking for larvae, and consequently, the most likely site for contact with DWV is on the flowers they visit to drink nectar.
70
References
Adler, L. A., K. M. Michaud, S. P. Ellner, S. H. McArt, P. C. Stevenson, and R. E. Irwin.
2018. Disease where you dine: plant species and floral traits associated with pathogen
transmission in bumble bees. Ecology 99(11): 2535-2545. (doi:10.1002/ecy.2503)
Adler, L. S., R. E. Irwin, S. H. McArt, and R. L. Vannette. 2020. Floral traits affecting the
transmission of beneficial and pathogenic pollinator-associated microbes. Current
Opinion in Insect Science 44: 1-7. (doi:10.1016/j.cois.2020.08.006).
Alger, S. A., P. A. Burnham, and A. K. Brody. 2019. Flowers as viral hot spots: Honey bees
(Apis mellifera) unevenly deposit viruses across plant species. Plos ONE 14(11):
e0225295. (doi:10.1371/journal.pone.0221800).
Bruckner, S., N. Steinhauer, K. Rennich, S. D. Aurell, D. M. Caron, J. D. Ellis, A. M.
Fauvel, K. Kulhanek, K. C. Nelson, J. Rangel, R. Rose, R. Sagil, G. P. Slater, R.
Snyder, C. A. Thoms, J. T. Wilkes, M. E. Wilson, D. vanEngelsdorp, and G. R.
Williams. 2018. Honey bee colony losses 2017-2018: preliminary results. Bee Informed.
Retrieved from preliminary-results/>. de Miranda, J. R., and E. Genersch. 2010. Deformed wing virus. Journal of Invertebrate Pathology 103: S48-S61. (doi: 10.1016/j.jip.2009.06.012). de Souza, F. S., J. L. Kevill, M. E. Correia-Oliveira, C. A. L. de Carvalho, and S. J. Martin. 2019. Occurrence of deformed wing virus variants in the stingless bee Melipona subnitida and honey bee Apis mellifera populations in Brazil. Journal of General Virology 0: 1- 6. (doi: 10.1099/jgv.0.001206). 71 Erban, T., K. Harant, M. Hubalek, P. Vitamvas, M. Kamler, P. Poltronieri, J. Tyl, M. Markovic, and D. Titera. 2015. In-depth proteomic analysis of Varroa destructor: Detection of DWV-complex, ABPV, VdMLV and honeybee proteins in the mite. Scientific Reports 5: 13907. (doi: 10.1038/srep13907). Evison, S. E. F., K. E. Roberts, L. Laurenson, S. Pietravelle, J. Hui, J. C. Biesmeijer, J. E. Smith, G. Budge, and W. O. H. Hughes. 2012. Pervasiveness of Parasites in Pollinators. PLoS ONE 7(1): e30641. (doi: 10.1371/journal.pone.0030641). Figueroa, L. L., M. Blinder, C. Grincavitch, A. Jelinek, E. K. Mann, L. A. Merva, L. E. Metz, A. Y. Zhao, R. E. Irwin, S. H. McArt, and L. S. Adler. 2019. Bee pathogen transmission dynamics: deposition, persistence and acquisition on flowers. Proceedings of the Royal Society B Biological Sciences 286(1903): 20190603. (doi: 10.1098/rspb.2019.0603). Fürst, M., D. McMahon, J. Osborne, R. Paxton, and M. Brown. 2014. Disease associations between honeybees and bumblebees as a threat to wild pollinators. Nature 506: 364–366. (doi:10.1038/nature12977). Genersch, E., C. Yue, I. Fries, and J. Miranda. 2006. Detection of deformed wing virus, a honey bee viral pathogen, in bumble bees (Bombus terrestris and Bombus pascuorum) with wing deformities. Journal of Invertebrate Pathology 91: 61–63. (doi: 10.1016/j.jip.2005.10.002). Gisder, S., P. Aumeier, and E. Genersch. 2009. Deformed wing virus: Replication and viral load in mites (Varroa destructor). Journal of General Virology 90(Pt 2): 463-467. (doi:10.1099/vir.0.005579-0). 72 Graystock, P., D. Goulson, and W. O. H. Hughes. 2014. The relationship between managed bees and the prevalence of parasites in bumblebees. Peer J 2: e522. (doi: 10.7717/peerj.522). Graystock, P., I. Meeus, G. Smagghe, D. Goulson, and W. O. Hughes. 2016. The effects of single and mixed infections of Apicystis bombi and deformed wing virus in Bombus terrestris. Parasitology 143:358–365. (doi:10.1017/S0031182015001614). Graystock, P., K. Yates, B. Darvill, D. Goulson, and W. Hughes. 2013. Emerging dangers: deadly effects of an emergent parasite in a new pollinator host. Journal of Invertebrate Pathology 114(2): 114–119. (doi: 10.1016/j.jip.2013.06.005). Graystock, P., W. H. Ng, K. Parks, A. D. Tripodi, P.e A. Muñiz, A. A. Fersch, C. R. Myers, Q. S. McFrederick, and S. H. McArt. 2020. Dominant bee species and floral abundance drive parasite temporal dynamics in plant-pollinator communities. Nature Ecology and Evolution. (doi:10.1038/s41559-020-1247-x). Herrera, C. M., A. Canto, M. I. Pozo, and P. Bazaga. 2010. Inhospitable sweetness: nectar filtering of pollinator-borne inocula leads to impoverished, phylogenetically clustered yeast communities. Proceedings of the Royal Society B Biological Sciences 277(1682): 747-754. (doi: 10.1098/rspb.2009.1485). Highfield, A. C., A. El Nagar, L. C. M. Mackinder, L. M.-L. J. Noel, M. J. Hall, S. J. Martin, and D. C. Schroeder. 2009. Deformed wing virus implicated in overwintering honeybee colony losses. Applied Environmental Microbiology 75(22): 7212–7220. (doi:10.1128/AEM.02227-09). Kevill, J. K., F. S. de Souza, C. Sharples, R. Oliver, D. C. Schroeder, and S. J. Martin. 2019. DWV-A lethal to honey bees (Apis mellifera): A colony level survey of DWV variants 73 (A, B, and C) in England, Wales, and 32 States across the US. Viruses 11(5): 426. (doi:10.3390/v11050426). Martin, S. J., and L. E. Brettell. 2019. Deformed wing virus in honeybees and other insects. Annual Review of Virology 6:49-69 (doi:10.1146/annurev-virology-092818-015700). Martin, S., A. Highfield, L. Brettell, E. Villalobos, S. Nikaido, G. Budge, M, Powell, and D. Schroeder. 2012. Global honey bee viral landscape altered by a parasitic mite. Science 336(6086): 1304–1306. (doi:10.1126/science.1220941). Mazzei, M., M. Carrozza, E. Luisi, M. Forzan, M. Giusti, S. Sagona, and A. Felicioli. 2014. Infectivity of DWV associated to flower pollen: experimental evidence of a horizontal transmission route. PLoS ONE 9(11): e113448. (doi:10.1371/journal.pone.0113448.). McArt, S. H., H. Koch, R. E. Irwin, and L. S. Adler. 2014. Arranging the bouquet of disease: floral traits and the transmission of plant and animal pathogens. Ecology Letters 17 (5): 624–636. (doi: 10.1111/ele.12257). Peck, D. T., M. L. Smith, and T. D. Seeley. 2016. Varroa destructor mites can nimbly climb from flowers onto foraging honey bees. PLoS One 11(12):e0167798. (doi: 10.1371/journal.pone.0167798). Pozo, M. I., M. A. Lachance, and C. M. Herrera. 2012. Nectar yeasts of two southern Spanish plants: the roles of immigration and physiological traits in community assembly. FEMS Microbiology Ecology 80(2): 281-293. (doi: 10.1111/j.1574-6941.2011.01286.x). Purkiss, T., and L. Lach, 2019. Pathogen spillover from Apis mellifera to a singles bee to a stingless bee. Proceedings of the Royal Society B 286(1908): 20191071. (doi: 10.1098/rspb.2019.1071). 74 Russell, A. L., M. Rebolleda-Gomez, T. M. Shaible, T. L. Ashman. 2019. Movers and shakers: bumble bee foraging behavior shapes the dispersal of microbes among and within flowers. Ecosphere 10(5): e02714. (doi: 10.1002/ecs2.2714). Santamaria, J. 2020. Deformed wing virus (DWV) transmission across pollinators of Hawai‘i. Master of Science thesis, Entomology. University of Hawai‘i at Mānoa. Santamaria, J., E. M. Villalobos, L. E. Brettell, S. Nikaido, J. R. Graham, and S. Martin. 2018. Evidence of Varroa-mediated deformed wing virus spillover in Hawaii. Journal of Invertebrate Pathology 151: 126-130. (doi:10.1016/j.jip.2017.11.008). Singh, R., A. Levitt, E. Rajotte, E. Holmes, N. Ostiguy, D. vanEngelsdorp, W. I. Lipkin, C. W. dePamphilis, A. L. Toth, and D. Cox-Foster. 2010. RNA viruses in hymenopteran pollinators: evidence of inter-taxa virus transmission via pollen and potential impact on non-apis hymenopteran species. PLoS ONE 5 (12), 1–16. (doi: 10.1371/journal.pone.0014357). Villalobos, E. M. 2016. The mite that jumped, the bee that traveled, the disease that followed. Science 351(6273): 554-556. (doi: 10.1126/science.aaf0938). 75 RECOMMENDATIONS FOR FUTURE WORKS 1. These studies, due to the limited nature of the funding and laboratory supplies, was not able to fully map the DWV strain types in the local non-Apis communities. Further exploration of DWV strain types in these flower-visiting insects is recommended and encouraged. 2. Building a more robust database of which species of pollinators visit which plant species, and during which seasons, would further allow researchers to possibly predict sources of DWV and the directionality its spread. Samples of these plant communities should also be preserved to ensure accuracy in their identification. 3. As researchers are seeing an ongoing shift in the dominant DWV strain type found within honey bees and within honey bee population, it would be sensible to see, if and how, the DWV strain diversity shifts within non-Apis insects. 4. While floral routes are the most straightforward routes to explore when mapping DWV transmission across insect species, other likely routes exist that remain unexplored and merit further examination. a. Feces has already been studied in the role of transmitting different pathogens across Bombus populations, so it is likely that this may also be a route for DWV spread. b. Predation is the suspected route of DWV spread in the honey bee predator, Vespula; a natural next step would be to find other predators and compare their prevalence to this wasp genus. c. Fruit nectar feeding may be a random incidental place of contact for juice-feeding insects but remains a route of potential contact of disease spread. 76 d. Resin is commonly used by certain bee groups for nest building, which may expose adults and developing larvae to additional routes of contact with viral particles, potentially raising their levels of DWV prevalence. 77 APPENDIX Insect species collected across eight different sites on the island of O‘ahu between the years 2014 to 2018. Insects are listed alongside which season they were captured in, year, site, taxonomic identification (when possible), plant species collected from (when possible), and Deformed wing virus (DWV) prevalence. DWV Flower – if Season Year Location Species Prevalence % identified (n) Kaʻena Ceratina Summer 2014 N/A 100% (n = 10) Point smaragdula Autumn 2014 Kāneʻohe Apis mellifera N/A 70% (n = 10) Ceratina Autumn 2014 Kāneʻohe N/A 30% (n = 10) smaragdula Ceratina Summer 2014 Pearl City N/A 27.3% (n = 11) smaragdula Autumn 2014 Waimānalo Polistes aurifer N/A 100% (n = 9) Xylocopa Summer 2015 Honolulu N/A 0% (n = 1) sonorina Spring 2015 Mānoa Apis mellifera N/A 100% (n = 5) Ceratina Spring 2015 Mānoa N/A 0% (n = 14) smaragdula Ceratina Winter 2015 Mānoa N/A 100% (n = 1) smaragdula 78 Winter 2015 Pearl City Apis mellifera N/A 100% (n = 5) Ceratina Autumn 2015 Pearl City N/A 0% (n = 5) smaragdula Xylocopa Autumn 2015 Pearl City N/A 100% (n = 1) sonorina Sandy Spring 2015 Apis mellifera N/A 66.7% (n = 6) Beach Sandy Winter 2015 Apis mellifera N/A 90% (n = 10) Beach Sandy Ceratina Spring 2015 N/A 0% (n = 1) Beach dentipes Sandy Ceratina Spring 2015 N/A 0% (n = 3) Beach smaragdula Sandy Ceratina Winter 2015 N/A 0% (n = 10) Beach smaragdula Sandy Xylocopa Winter 2015 N/A 0% (n = 1) Beach sonorina Spring 2015 Waianae Allograpta sp. N/A 0% (n = 1) Spring 2015 Waianae Lasioglossum sp. N/A 11.1% (n = 9) Xylocopa Spring 2015 Waianae N/A 0% (n = 3) sonorina Hylaeus Spring 2016 Pearl City N/A 50% (n = 8) albonitens 79 Spring 2016 Pearl City Hylaeus strenuus N/A 42.8% (n = 7) Winter 2017 Kunia Pieridae N/A 0% (n = 3) Spring 2017 Pearl City Aphididae Tabebuia sp. 0% (n = 5) Autumn 2017 Pearl City Apis mellifera N/A 100% (n = 4) Spring 2017 Pearl City Apis mellifera Tabebuia sp. 100% (n = 2) Ceratina Asystasia Autumn 2017 Pearl City 50% (n = 8) smaragdula gangetica Spring 2017 Pearl City Formicidae Tabebuia sp. 0% (n = 5) Spring 2017 Pearl City Hylaeus strenuus N/A 0% (n = 4) Autumn 2017 Pearl City Hylaeus strenuus Callistemon sp. 50% (n = 4) Asystasia Autumn 2017 Pearl City Lycanidae 66.7% (n = 3) gangetica Winter 2017 Pearl City Lycanidae N/A 0% (n = 2) Asystasia Megachile Autumn 2017 Pearl City gangetica, Sida 33.3% (n = 3) umbripennis fallax Asystasia Autumn 2017 Pearl City Tinidae 0% (n = 1) gangetica Sandy Winter 2017 Apis mellifera Scaevola taccada 0% (n = 1) Beach Sandy Ceratina Winter 2017 Scaevola taccada 50% (n = 2) Beach smaragdula Winter 2017 Waimānalo Apis mellifera Macadamia sp. 100% (n = 10) 80 Autumn 2017 Waimānalo Polistes aurifer N/A 0% (n = 11) Cucurbita pepo, Winter 2018 Kunia Apis mellifera 86.7% (n = 15) Verbesina sp. Winter 2018 Kunia Brown Fly Cucurbita pepo 0% (n = 1) Winter 2018 Kunia Drosophilae Cucurbita pepo 16.7% (n = 6) Danaus Winter 2018 Pearl City N/A 0% (n = 2) plexippus Winter 2018 Waimānalo Agraulis vanillae N/A 0% (n = 1) Winter 2018 Waimānalo Allograpta sp. N/A 0% (n = 5) Winter 2018 Waimānalo Apis mellifera Macadamia sp. 0% (n = 2) Winter 2018 Waimānalo Hesperiidae N/A 0% (n = 2) Winter 2018 Waimānalo Lycanidae N/A 0% (n = 2) Winter 2018 Waimānalo Ornidia obesa Macadamia sp. 8.3% (n = 12) Winter 2018 Waimānalo Syrphidae N/A 0% (n = 1) 81