Sequencing and Characterization of the FVB/NJ Mouse Genome
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Isyte: Integrated Systems Tool for Eye Gene Discovery
Lens iSyTE: Integrated Systems Tool for Eye Gene Discovery Salil A. Lachke,1,2,3,4 Joshua W. K. Ho,1,4,5 Gregory V. Kryukov,1,4,6 Daniel J. O’Connell,1 Anton Aboukhalil,1,7 Martha L. Bulyk,1,8,9 Peter J. Park,1,5,10 and Richard L. Maas1 PURPOSE. To facilitate the identification of genes associated ther investigation. Extension of this approach to other ocular with cataract and other ocular defects, the authors developed tissue components will facilitate eye disease gene discovery. and validated a computational tool termed iSyTE (integrated (Invest Ophthalmol Vis Sci. 2012;53:1617–1627) DOI: Systems Tool for Eye gene discovery; http://bioinformatics. 10.1167/iovs.11-8839 udel.edu/Research/iSyTE). iSyTE uses a mouse embryonic lens gene expression data set as a bioinformatics filter to select candidate genes from human or mouse genomic regions impli- ven with the advent of high-throughput sequencing, the cated in disease and to prioritize them for further mutational Ediscovery of genes associated with congenital birth defects and functional analyses. such as eye defects remains a challenge. We sought to develop METHODS. Microarray gene expression profiles were obtained a straightforward experimental approach that could facilitate for microdissected embryonic mouse lens at three key devel- the identification of candidate genes for developmental disor- opmental time points in the transition from the embryonic day ders, and, as proof-of-principle, we chose defects involving the (E)10.5 stage of lens placode invagination to E12.5 lens primary ocular lens. Opacification of the lens results in cataract, a leading cause of blindness that affects 77 million persons and fiber cell differentiation. -
A New Mutation in BFSP2 (G1091A) Causes Autosomal Dominant Congenital Lamellar Cataracts
Molecular Vision 2008; 14:1906-1911 <http://www.molvis.org/molvis/v14/a226> © 2008 Molecular Vision Received 17 August 2008 | Accepted 18 October 2008 | Published 24 October 2008 A new mutation in BFSP2 (G1091A) causes autosomal dominant congenital lamellar cataracts Xu Ma,1,2,3 Fei-Feng Li,1,2 Shu-Zhen Wang,4 Chang Gao,1,2 Meng Zhang,2 Si-Quan Zhu4 (The first three authors contributed equally to this work.) 1Graduate School, Peking Union Medical College, Beijing, China; 2Department of Genetics, National Research Institute for Family Planning, Beijing, China; 3WHO Collaborative Center for Research in Human Reproduction, Beijing, China; 4Beijing Tongren Eye Center, Capital Medical University, Beijing, China Purpose: We sought to identify the genetic defect in a four-generation Chinese family with autosomal dominant congenital lamellar cataracts and demonstrate the functional analysis with biosoftware of a candidate gene in the family. Methods: Family history data were recorded. Clinical and ophthalmologic examinations were performed on family members. All the members were genotyped with microsatellite markers at loci considered to be associated with cataracts. Two-point LOD scores were calculated by using the Linkage Software after genotyping. A mutation was detected by using gene-specific primers in direct sequencing. Wild type and mutant proteins were analyzed with Online Bio-Software. Results: Affected members of this family had lamellar cataracts. Linkage analysis was obtained at markers D3S2322 (LOD score [Z]=7.22, recombination fraction [θ]=0.0) and D3S1541 (Z=5.42, θ=0.0). Haplotype analysis indicated that the cataract gene was closely linked to these two markers. -
Establishing the Pathogenicity of Novel Mitochondrial DNA Sequence Variations: a Cell and Molecular Biology Approach
Mafalda Rita Avó Bacalhau Establishing the Pathogenicity of Novel Mitochondrial DNA Sequence Variations: a Cell and Molecular Biology Approach Tese de doutoramento do Programa de Doutoramento em Ciências da Saúde, ramo de Ciências Biomédicas, orientada pela Professora Doutora Maria Manuela Monteiro Grazina e co-orientada pelo Professor Doutor Henrique Manuel Paixão dos Santos Girão e pela Professora Doutora Lee-Jun C. Wong e apresentada à Faculdade de Medicina da Universidade de Coimbra Julho 2017 Faculty of Medicine Establishing the pathogenicity of novel mitochondrial DNA sequence variations: a cell and molecular biology approach Mafalda Rita Avó Bacalhau Tese de doutoramento do programa em Ciências da Saúde, ramo de Ciências Biomédicas, realizada sob a orientação científica da Professora Doutora Maria Manuela Monteiro Grazina; e co-orientação do Professor Doutor Henrique Manuel Paixão dos Santos Girão e da Professora Doutora Lee-Jun C. Wong, apresentada à Faculdade de Medicina da Universidade de Coimbra. Julho, 2017 Copyright© Mafalda Bacalhau e Manuela Grazina, 2017 Esta cópia da tese é fornecida na condição de que quem a consulta reconhece que os direitos de autor são pertença do autor da tese e do orientador científico e que nenhuma citação ou informação obtida a partir dela pode ser publicada sem a referência apropriada e autorização. This copy of the thesis has been supplied on the condition that anyone who consults it recognizes that its copyright belongs to its author and scientific supervisor and that no quotation from the -
Frontiers in Integrative Genomics and Translational Bioinformatics
BioMed Research International Frontiers in Integrative Genomics and Translational Bioinformatics Guest Editors: Zhongming Zhao, Victor X. Jin, Yufei Huang, Chittibabu Guda, and Jianhua Ruan Frontiers in Integrative Genomics and Translational Bioinformatics BioMed Research International Frontiers in Integrative Genomics and Translational Bioinformatics Guest Editors: Zhongming Zhao, Victor X. Jin, Yufei Huang, Chittibabu Guda, and Jianhua Ruan Copyright © òýÔ Hindawi Publishing Corporation. All rights reserved. is is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Contents Frontiers in Integrative Genomics and Translational Bioinformatics, Zhongming Zhao, Victor X. Jin, Yufei Huang, Chittibabu Guda, and Jianhua Ruan Volume òýÔ , Article ID Þò ¥ÀÔ, ç pages Building Integrated Ontological Knowledge Structures with Ecient Approximation Algorithms, Yang Xiang and Sarath Chandra Janga Volume òýÔ , Article ID ýÔ ò, Ô¥ pages Predicting Drug-Target Interactions via Within-Score and Between-Score, Jian-Yu Shi, Zun Liu, Hui Yu, and Yong-Jun Li Volume òýÔ , Article ID ç ýÀç, À pages RNAseq by Total RNA Library Identies Additional RNAs Compared to Poly(A) RNA Library, Yan Guo, Shilin Zhao, Quanhu Sheng, Mingsheng Guo, Brian Lehmann, Jennifer Pietenpol, David C. Samuels, and Yu Shyr Volume òýÔ , Article ID âòÔçý, À pages Construction of Pancreatic Cancer Classier Based on SVM Optimized by Improved FOA, Huiyan Jiang, Di Zhao, Ruiping Zheng, and Xiaoqi Ma Volume òýÔ , Article ID ÞÔýòç, Ôò pages OperomeDB: A Database of Condition-Specic Transcription Units in Prokaryotic Genomes, Kashish Chetal and Sarath Chandra Janga Volume òýÔ , Article ID çÔòÔÞ, Ôý pages How to Choose In Vitro Systems to Predict In Vivo Drug Clearance: A System Pharmacology Perspective, Lei Wang, ChienWei Chiang, Hong Liang, Hengyi Wu, Weixing Feng, Sara K. -
Supplemental Figure 1. Vimentin
Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672 -
ATAP00021-Recombinant Human ALDH1A1 Protein
ATAGENIX LABORATORIES Catalog Number:ATAP00021 Recombinant Human ALDH1A1 protein Product Details Summary English name Recombinant Human ALDH1A1 protein Purity >90% as determined by SDS-PAGE Endotoxin level Please contact with the lab for this information. Construction A DNA sequence encoding the human ALDH1A1 (Met1-Ser501) was fused with His tag Accession # P00352 Host E.coli Species Homo sapiens (Human) Predicted Molecular Mass 52.58 kDa Formulation Supplied as solution form in PBS pH 7.5 or lyophilized from PBS pH 7.5. Shipping In general, proteins are provided as lyophilized powder/frozen liquid. They are shipped out with dry ice/blue ice unless customers require otherwise. Stability &Storage Use a manual defrost freezer and avoid repeated freeze thaw cycles. Store at 2 to 8 °C for one week . Store at -20 to -80 °C for twelve months from the date of receipt. Reconstitution Reconstitute in sterile water for a stock solution.A copy of datasheet will be provided with the products, please refer to it for details. Background Background Aldehyde dehydrogenase 1 family, member A1 (ALDH1A1), also known as Aldehyde dehydrogenase 1 (ALDH1), or Retinaldehyde Dehydrogenase 1 (RALDH1), is an enzyme that is expressed at high levels in stem cells and that has been suggested to regulate stem cell function. The retinaldehyde dehydrogenase (RALDH) subfamily of ALDHs, composed of ALDH1A1, ALDH1A2, ALDH1A3, and ALDH8A1, regulate development by catalyzing retinoic acid biosynthesis. The ALDH1A1 protein belongs to the aldehyde dehydrogenases family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. ALDH1A1 also belongs to the group of corneal crystallins that Web:www.atagenix.com E-mail: [email protected] Tel: 027-87433958 ATAGENIX LABORATORIES Catalog Number:ATAP00021 Recombinant Human ALDH1A1 protein help maintain the transparency of the cornea. -
9. Atypical Dusps: 19 Phosphatases in Search of a Role
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Digital.CSIC Transworld Research Network 37/661 (2), Fort P.O. Trivandrum-695 023 Kerala, India Emerging Signaling Pathways in Tumor Biology, 2010: 185-208 ISBN: 978-81-7895-477-6 Editor: Pedro A. Lazo 9. Atypical DUSPs: 19 phosphatases in search of a role Yolanda Bayón and Andrés Alonso Instituto de Biología y Genética Molecular, CSIC-Universidad de Valladolid c/ Sanz y Forés s/n, 47003 Valladolid, Spain Abstract. Atypical Dual Specificity Phosphatases (A-DUSPs) are a group of 19 phosphatases poorly characterized. They are included among the Class I Cys-based PTPs and contain the active site motif HCXXGXXR conserved in the Class I PTPs. These enzymes present a phosphatase domain similar to MKPs, but lack any substrate targeting domain similar to the CH2 present in this group. Although most of these phosphatases have no more than 250 amino acids, their size ranges from the 150 residues of the smallest A-DUSP, VHZ/DUSP23, to the 1158 residues of the putative PTP DUSP27. The substrates of this family include MAPK, but, in general terms, it does not look that MAPK are the general substrates for the whole group. In fact, other substrates have been described for some of these phosphatases, like the 5’CAP structure of mRNA, glycogen, or STATs and still the substrates of many A-DUSPs have not been identified. In addition to the PTP domain, most of these enzymes present no additional recognizable domains in their sequence, with the exception of CBM-20 in laforin, GTase in HCE1 and a Zn binding domain in DUSP12. -
The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid
The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid Leukemia Cells Supported Only by Exogenous Cytokines Is Associated with a Patient Subset with Adverse Outcome Annette K. Brenner, Elise Aasebø, Maria Hernandez-Valladares, Frode Selheim, Frode Berven, Ida-Sofie Grønningsæter, Sushma Bartaula-Brevik and Øystein Bruserud Supplementary Material S2 of S31 Table S1. Detailed information about the 68 AML patients included in the study. # of blasts Viability Proliferation Cytokine Viable cells Change in ID Gender Age Etiology FAB Cytogenetics Mutations CD34 Colonies (109/L) (%) 48 h (cpm) secretion (106) 5 weeks phenotype 1 M 42 de novo 241 M2 normal Flt3 pos 31.0 3848 low 0.24 7 yes 2 M 82 MF 12.4 M2 t(9;22) wt pos 81.6 74,686 low 1.43 969 yes 3 F 49 CML/relapse 149 M2 complex n.d. pos 26.2 3472 low 0.08 n.d. no 4 M 33 de novo 62.0 M2 normal wt pos 67.5 6206 low 0.08 6.5 no 5 M 71 relapse 91.0 M4 normal NPM1 pos 63.5 21,331 low 0.17 n.d. yes 6 M 83 de novo 109 M1 n.d. wt pos 19.1 8764 low 1.65 693 no 7 F 77 MDS 26.4 M1 normal wt pos 89.4 53,799 high 3.43 2746 no 8 M 46 de novo 26.9 M1 normal NPM1 n.d. n.d. 3472 low 1.56 n.d. no 9 M 68 MF 50.8 M4 normal D835 pos 69.4 1640 low 0.08 n.d. -
Comparison of Orthologs Across Multiple Species by Various Strategies
COMPARISON OF ORTHOLOGS ACROSS MULTIPLE SPECIES BY VARIOUS STRATEGIES BY HUI LIU DISSERTATION Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biophysics and Computational Biology in the Graduate College of the University of Illinois at Urbana-Champaign, 2014 Urbana, Illinois Doctoral Committee: Professor Eric Jakobsson, Chair, Director of Research Professor Gene E. Robinson Associate Professor Saurabh Sinha Assistant Professor Jian Ma Abstract Thanks to the improvement of genome sequencing technology, abundant multi-species genomic data now became available and comparative genomics continues to be a fast prospering filed of biological research. Through the comparison of genomes of different organisms, we can understand what, at the molecular level, distinguishes different life forms from each other. It shed light on revealing the evolution of biology. And it also helps to refine the annotations and functions of individual genomes. For example, through comparisons across mammalian genomes, we can give an estimate of the conserved set of genes across mammals and correspondingly, find the species-specific sets of genes or functions. However, comparative genomics can be feasible only if a meaningful classification of genes exists. A natural way to do so is to delineate sets of orthologous genes. However, debates exist about the appropriate way to define orthologs. It is originally defined as genes in different species which derive from speciation events. But such definition is not sufficient to derive orthologous genes due to the complexity of evolutionary events such as gene duplication and gene loss. While it is possible to correctly figure out all the evolutionary events with the true phylogenetic tree, the true phylogenetic tree itself is impractical to be inferred. -
The Mammalian Adult Neurogenesis Gene Ontology (MANGO) Provides a Structural Framework for Published Information on Genes Regulating Adult Hippocampal Neurogenesis
The Mammalian Adult Neurogenesis Gene Ontology (MANGO) Provides a Structural Framework for Published Information on Genes Regulating Adult Hippocampal Neurogenesis Rupert W. Overall1, Maciej Paszkowski-Rogacz2, Gerd Kempermann1,3* 1 CRTD – Center for Regenerative Therapies Dresden, Technische Universita¨t Dresden, Dresden, Germany, 2 UCC – University Cancer Center, Medical Faculty, Technische Universita¨t Dresden, Dresden, Germany, 3 DZNE, German Center for Neurodegenerative Diseases, Dresden, Germany Abstract Background: Adult hippocampal neurogenesis is not a single phenotype, but consists of a number of sub-processes, each of which is under complex genetic control. Interpretation of gene expression studies using existing resources often does not lead to results that address the interrelatedness of these processes. Formal structure, such as provided by ontologies, is essential in any field for comprehensive interpretation of existing knowledge but, until now, such a structure has been lacking for adult neurogenesis. Methodology/Principal Findings: We have created a resource with three components 1. A structured ontology describing the key stages in the development of adult hippocampal neural stem cells into functional granule cell neurons. 2. A comprehensive survey of the literature to annotate the results of all published reports on gene function in adult hippocampal neurogenesis (257 manuscripts covering 228 genes) to the appropriate terms in our ontology. 3. An easy-to- use searchable interface to the resulting database made freely available online. The manuscript presents an overview of the database highlighting global trends such as the current bias towards research on early proliferative stages, and an example gene set enrichment analysis. A limitation of the resource is the current scope of the literature which, however, is growing by around 100 publications per year. -
The Amyloid-Β Precursor Protein (App)-Binding Protein Fe65 and App Processing
! !"#$ #"%"" & '( ) ' *#+,% - . /0 - 1 2 /20 %2 3 2 /02 4 % 5 ' 64 ' 6% 7 1 +8 % +8 ' - /790' 4 %5 ': +8 ' 79: +8 1 %; +8 +<8 % = +8% ' +8 / 70' +8 - / 770% ' ;,! +8' == ' - +8/ 770%7 ' !!$ +8 : +8 / 7770%; ' 64 +8 - ' 6 +8 - / 777770%> ' 7? +<8 ' 6%; ' +<8 ' +<8 6 2% 7 +8 ' % ! !"#$ @:: %% : A B @@ @ @ #CDD"+ 7,D<$D#<<D<##!! 7,D<$D#<<D<##ED " # '#"+D# THE AMYLOID-Β PRECURSOR PROTEIN (APP)-BINDING PROTEIN FE65 AND APP PROCESSING Niina Koistinen The amyloid-β precursor protein (APP)-binding protein Fe65 and APP processing Niina Koistinen ©Niina Koistinen, Stockholm University 2018 ISBN print 978-91-7797-112-2 ISBN PDF 978-91-7797-113-9 Cover: An healthy and AD diseased brain half freely interpreted by Conrad, aged 9, and Cleo, aged 6 Printed in Sweden by Universitetsservice US-AB, Stockholm 2017 Distributor: Department of Neurochemistry, Stockholm University Till min familj List of Publications I. Koistinen NA, Bacanu S, Iverfeldt K Phosporylation of Fe65 amyloid precursor protein-binding protein in respons to neuronal differentiation Neuroscience Letters, 2016, Feb2;613:54-9