DOCSLIB.ORG

Glucokinase Regulatory Protein Is Essential for the Proper Subcellular Localisation of Liver Glucokinase

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Glucokinase Regulatory Protein Is Essential for the Proper Subcellular Localisation of Liver Glucokinase FEBS Letters 456 (1999) 332^338 FEBS 22420 Glucokinase regulatory protein is essential for the proper subcellular localisation of liver glucokinase Nu¨ria de la Iglesiaa, Maria Veiga-da-Cunhab, Emile Van Schaftingenb, Joan J. Guinovarta, Juan C. Ferrera;* aDepartament de Bioqu|¨mica i Biologia Molecular, Universitat de Barcelona, Mart|¨ i Franque©s, 1, E-08028 Barcelona, Spain bLaboratory of Physiological Chemistry, Christian de Duve Institute of Cellular Pathology and Universite¨ Catholique de Louvain, B-1200 Brussels, Belgium Received in revised form 24 June 1999 pressed by fructose 1-phosphate, both of which bind to Abstract Glucokinase (GK), a key enzyme in the glucose homeostatic responses of the liver, changes its intracellular GKRP and modify its a¤nity for GK [4]. This 68 kDa protein localisation depending on the metabolic status of the cell. Rat is only found in the livers of species that express GK and liver GK and Xenopus laevis GK, fused to the green fluorescent although there is some evidence for its presence in pancreatic protein (GFP), concentrated in the nucleus of cultured rat tissue [5,6], a direct demonstration is still not available. hepatocytes at low glucose and translocated to the cytoplasm at In in vitro assays, rat GKRP can inhibit human pancreatic high glucose. Three mutant forms of Xenopus GK with reduced GK, which shows a high degree of identity to the rat liver affinity for GK regulatory protein (GKRP) did not concentrate isoform [7], as well as Xenopus laevis liver GK [8], a more in the hepatocyte nuclei, even at low glucose. In COS-1 and distantly related protein. This suggests that the residues in- HeLa cells, a blue fluorescent protein (BFP)-tagged version of volved in the binding to GKRP are conserved among the rat liver GK was only able to accumulate in the nucleus when it members of the GK family. Through the analysis of several was co-expressed with GKRP-GFP. At low glucose, both proteins concentrated in the nuclear compartment and at high mutated forms of Xenopus GK and human L-cell GK, the glucose, BFP-GK translocated to the cytosol while GKRP-GFP domains involved in this interaction have been further de- remained in the nucleus. These findings indicate that the presence lineated [7,8]. of and binding to GKRP are necessary and sufficient for the Experiments with digitonin-permeabilised hepatocytes ¢rst proper intracellular localisation of GK and directly involve showed that fructose or elevated concentrations of glucose GKRP in the control of the GK subcellular distribution. cause GK, but not GKRP, to translocate from a Mg2-de- z 1999 Federation of European Biochemical Societies. pendent binding site to a site where it is more easily released by the detergent [9,10]. Immunostaining of GK and GKRP in Key words: Glucokinase regulatory protein; perfused rat livers [11,12] and in rat cultured hepatocytes [13], Protein-protein interaction; Fluorescence microscopy it revealed a nuclear localisation of both proteins in the pres- ence of low concentrations of glucose. Rat GK was reported to translocate to the cytoplasm upon incubation with fructose 1. Introduction [13] or high concentrations of glucose [11,13]. However, there is still controversy about the behaviour of GKRP, since it has Glucokinase (GK), one of the enzymes that catalyse glucose been reported to remain in the nucleus [13] or to accompany phosphorylation in liver and in pancreatic K- and L-cells, is a GK in its movement [12]. key piece of the glucose sensing machinery in mammals [1,2]. In the present study, using the green £uorescent protein It plays a fundamental role in the whole body glucose homeo- (GFP) and a blue variant (BFP) as tags for localisation of stasis and mutations of the GK gene are associated with GKRP and wild-type and mutated forms of GK, we show MODY 2, a form of maturity-onset diabetes of the young [3]. that the relative a¤nity of GK for GKRP is an absolute GK, a monomeric 50 kDa protein, exhibits kinetic proper- determinant of the nuclear localisation of GK. Furthermore, ties quite di¡erent from those of the other members of the by the co-expression of rat liver GK and GKRP, we have mammalian hexokinase family. It is not inhibited by its prod- been able to engineer a glucose sensing device in two cell lines uct, glucose 6-phosphate, and possesses a sigmoidal saturation unrelated to hepatocytes, COS-1 and HeLa, making that the curve and a relatively low a¤nity for glucose (Hill coe¤- intracellular distribution of GK in these cells is controlled by cient = 1.5^1.8, S0:5 = 2^8 mM, depending on the species), so the levels of glucose. that the £ux through GK is sensitively modulated by £uctua- tions in the concentration of its substrate in the physiological 2. Materials and methods range [1]. In the liver, the activity of GK is also modulated by a regulatory protein (GKRP) that binds and inhibits GK 2.1. Plasmid construction competitively with respect to glucose. The inhibitory e¡ect Standard molecular cloning techniques were used throughout. The full coding sequence of rat GK was ampli¢ed from rat liver mRNA by of GKRP is enhanced by fructose 6-phosphate and sup- PCR using the Superscript One-Step RT-PCR System (Gibco BRL) and the two oligonucleotides TCTCTACTTCCCCAACGACCCC (sense), corresponding to nucleotides 28^49 of the 5P untranslated *Corresponding author. Fax: (34) (93) 4021219. region of the rat liver GK cDNA (GeneBank number J04218), and E-mail: [email protected] TTTGTGGTGTGTGGAGTCCCC (antisense), complementary to nucleotides 1501^1521. It was then re-ampli¢ed with Pfu DNA poly- Abbreviations: GK, glucokinase; GKRP, glucokinase regulatory pro- merase following the supplier's instructions and using the sense primer tein; GFP, green £uorescent protein; BFP, blue £uorescent protein (Boehringer Mannheim) TACGTACCCCATGGCTATGGATACTA- 0014-5793 / 99 / $20.00 ß 1999 Federation of European Biochemical Societies. All rights reserved. PII: S0014-5793(99)00971-0 FEBS 22420 29-7-99 Cyaan Magenta Geel Zwart N. de la Iglesia et al./FEBS Letters 456 (1999) 332^338 333 CAAG, which contains a NcoI site (underlined) at the start codon, On the day of the experiment, cells were washed in PBS and in- and the antisense primer TAGCTACGTCGACCTGGATTTCACT- cubated in plain DMEM with 5.5 mM glucose for 2 h (controls), GGGCC, which introduces a SalI site (underlined) and is complemen- followed by a 2 h incubation with plain DMEM with 30 mM glucose. tary to nucleotides 1456^1475. The fragment obtained was cloned into At the end of the incubations, cells were washed twice with PBS, ¢xed the blunt-ended and dephosphorylated plasmid pUC18 SmaI/BAP for 20 min in PBS containing 4% paraformaldehyde and were washed using the SureClone Ligation kit (Pharmacia Biotech). The resulting several times with PBS. plasmid was digested with NcoI and blunt-ended with the Klenow fragment of Escherichia coli DNA polymerase I, followed by digestion 2.3. Immuno£uorescence analyses with SalI. The fragment was ligated into pEGFP-C1 (Clontech) which Following ¢xation, cells were incubated with NaBH4 (1 mg/ml), previously had been digested with BglII, Klenow-¢lled and digested permeabilised with 0.2% (v/v) Triton X-100 in PBS and blocked in with SalI. This ensured the in-frame fusion of rat liver GK at the C- 3% bovine serum albumin-PBS (w/v). The cells were then incubated terminus of the GFP coding sequence plus a linker of ¢ve amino acids with antibodies directed against rat liver GK [17] or GKRP [18] for 45 under the control of the constitutive immediate early promoter of the min at room temperature, washed in PBS and treated with a £uores- human cytomegalovirus. cein isothiocyanate (FITC)-conjugated anti-sheep or anti-rabbit im- The full coding sequence of rat liver GKRP was ampli¢ed from the munoglobulin (Chemicon and Molecular Probes, respectively) for 30 pBluescript/GKRP plasmid [14] by PCR using Pfu DNA polymerase min. Finally, cells were washed in PBS. Controls included examina- and the oligonucleotides GAAGATCTCGCCACCATGCCAGGCA- tion of cultures for auto£uorescence and speci¢city of antibodies, after CCAAACGATATCAGC (sense) and GCAGGATCCAATTCAGG- incubating the ¢xed cells with only the labelled secondary antibody. GTCCCACAGGCGGG (antisense). The sense oligonucleotide intro- For nuclei staining in red, coverslips were treated with 1 Wg/ml duces the BglII restriction site at its 5P end followed by a Kozak RNAse (DNAse free) in PBS for 30 min and with 0.2 Wg/ml propi- consensus translation initiation site, to further increase the translation dium iodide for 10 min, followed by washing in PBS. Finally, cover- e¤ciency in eukaryotic cells, and nucleotides 22^46 of the rat GKRP slips were air-dried and mounted on glass microscope slides in Immu- cDNA (GeneBank number X68497). The antisense oligonucleotide, no Fluore Mounting Medium (ICN). which is complementary to nucleotides 1882^1904, was designed to eliminate the GKRP stop codon and to introduce a BamHI restriction 2.4. Confocal and epi£uorescence microscopy site at its 3P end. The PCR product was digested with BamHI, Kle- Confocal £uorescent images were obtained with a Leica TCS 4D now-¢lled, digested with BglII and then ligated into pEGFP-N1 (Leica Lasertechnik, Heidelberg, Germany) confocal scanning laser (Clontech), which had previously been digested with SalI, Klenow- microscope adapted to an inverted Leitz DMIRBE microscope and ¢lled and digested with BglII. This ensured the in-frame fusion of 63U/1.4 oil Plan-Apo objective. The light source was an argon/kryp- GFP to the C-terminus of the GKRP coding sequence plus a linker ton laser (75 mW). Green £uorescence (from GFP recombinants or of 15 amino acids.
Load more

Recommended publications
  • Copyright by Young-Sam Lee 2010
    Copyright by Young-Sam Lee 2010 The Dissertation Committee for Young-Sam Lee Certifies that this is the approved version of the following dissertation: Structural and Functional Studies of the Human Mitochondrial DNA Polymerase Committee: Whitney Yin, Supervisor Ian Molineux Kenneth Johnson Tanya Paull Jon Robertus Structural and Functional Studies of the Human Mitochondrial DNA Polymerase by Young-Sam Lee, B.S, M.S. Dissertation Presented to the Faculty of the Graduate School of The University of Texas at Austin in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy The University of Texas at Austin August, 2010 Dedication For my wife, In-Sook Jung. Acknowledgements I would like to appreciate Dr. Whitney Yin for giving me chance to working in her lab and mentoring me through my graduate program. Not only the scientific insights, also the warmness that she gave me and my family encouraged me to pursue my Ph. D. degree in the foreign country. I also would like to thank “a guru of molecular biology” Dr. Ian Molineux and “a guru of enzyme kinetics” Dr. Kenneth Johnson. Without their critical advice, I would not be accomplished my publication. I hope to be a respectable expert in my research field like them. I also should remember friendship and generosity given by many current and former Yin lab members: Hey-Ryung Chang, Qingchao “Eric” Meng, Xu Yang, Jeff Knight, Dr. Michio Matsunaga, Dr. He “River” Quan, Taewung Lee, Xin “Ella” Wang, Jamila Momand, and Max Shay. Most of all, I really appreciate my parents for their endless love and support, and my wife, In-Sook Jung, and my son, Jason Seung-Hyeon Lee who always stand by me with patients during my graduate carrier.
    [Show full text]
  • PURIFIED THERMOSTABLE NUCLEIC ACID POLYMERASE ENZYME from $I(TERMOTOGA MARITIMA)
    Europäisches Patentamt *EP000544789B1* (19) European Patent Office Office européen des brevets (11) EP 0 544 789 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.7: C12N 15/54, C12N 9/12 of the grant of the patent: 05.03.2003 Bulletin 2003/10 (86) International application number: PCT/US91/05753 (21) Application number: 91915802.2 (87) International publication number: (22) Date of filing: 13.08.1991 WO 92/003556 (05.03.1992 Gazette 1992/06) (54) PURIFIED THERMOSTABLE NUCLEIC ACID POLYMERASE ENZYME FROM $i(TERMOTOGA MARITIMA) GEREINIGTES THERMOSTABILES NUKLEINSÄURE-POLYMERASEENZYM AUS THERMOTOGA MARITIMA ENZYME D’ACIDE NUCLEIQUE THERMOSTABLE PURIFIEE PROVENANT DE L’EUBACTERIE $i(THERMOTOGA MARITIMA) (84) Designated Contracting States: (74) Representative: Poredda, Andreas et al AT BE CH DE DK ES FR GB GR IT LI LU NL SE Roche Diagnostics GmbH, Patentabteilung, (30) Priority: 13.08.1990 US 567244 Sandhofer Strasse 116 68305 Mannheim (DE) (43) Date of publication of application: 09.06.1993 Bulletin 1993/23 (56) References cited: • CHEMICAL ABSTRACTS, vol. 105, no. 5, 04 (73) Proprietor: F. HOFFMANN-LA ROCHE AG August 1986, Columbus, OH (US); R. HUBER et 4002 Basel (CH) al., p. 386, AN 38901u • JOURNAL OF BIOLOGICAL CHEMISTRY, vol. (72) Inventors: 264, no. 11, 15 April 1989, American Society for • GELFAND, David, H. Biochemistry & Molecular Biology Inc., Oakland, CA 94611 (US) Baltimore, MD (US); F.C. LAWYER et al., pp. • LAWYER, Frances, C. 6427-6437 Oakland, CA 94611 (US) • STOFFEL, Susanne El Cerrito, CA 94530 (US) Note: Within nine months from the publication of the mention of the grant of the European patent, any person may give notice to the European Patent Office of opposition to the European patent granted.
    [Show full text]
  • Arthur Kornberg Discovered (The First) DNA Polymerase Four
    Arthur Kornberg discovered (the first) DNA polymerase Using an “in vitro” system for DNA polymerase activity: 1. Grow E. coli 2. Break open cells 3. Prepare soluble extract 4. Fractionate extract to resolve different proteins from each other; repeat; repeat 5. Search for DNA polymerase activity using an biochemical assay: incorporate radioactive building blocks into DNA chains Four requirements of DNA-templated (DNA-dependent) DNA polymerases • single-stranded template • deoxyribonucleotides with 5’ triphosphate (dNTPs) • magnesium ions • annealed primer with 3’ OH Synthesis ONLY occurs in the 5’-3’ direction Fig 4-1 E. coli DNA polymerase I 5’-3’ polymerase activity Primer has a 3’-OH Incoming dNTP has a 5’ triphosphate Pyrophosphate (PP) is lost when dNMP adds to the chain E. coli DNA polymerase I: 3 separable enzyme activities in 3 protein domains 5’-3’ polymerase + 3’-5’ exonuclease = Klenow fragment N C 5’-3’ exonuclease Fig 4-3 E. coli DNA polymerase I 3’-5’ exonuclease Opposite polarity compared to polymerase: polymerase activity must stop to allow 3’-5’ exonuclease activity No dNTP can be re-made in reversed 3’-5’ direction: dNMP released by hydrolysis of phosphodiester backboneFig 4-4 Proof-reading (editing) of misincorporated 3’ dNMP by the 3’-5’ exonuclease Fidelity is accuracy of template-cognate dNTP selection. It depends on the polymerase active site structure and the balance of competing polymerase and exonuclease activities. A mismatch disfavors extension and favors the exonuclease.Fig 4-5 Superimposed structure of the Klenow fragment of DNA pol I with two different DNAs “Fingers” “Thumb” “Palm” red/orange helix: 3’ in red is elongating blue/cyan helix: 3’ in blue is getting edited Fig 4-6 E.
    [Show full text]
  • T5 DNA Polymerase: Structural-Functional Relationships to Other DNA Polymerases (DNA Polymerase I/Proofreading/Processivity/Evolution) MARK C
    Proc. Nati. Acad. Sci. USA Vol. 86, pp. 4465-4469, June 1989 Biochemistry T5 DNA polymerase: Structural-functional relationships to other DNA polymerases (DNA polymerase I/proofreading/processivity/evolution) MARK C. LEAVITT AND JUNETSU ITO Department of Microbiology and Immunology, University of Arizona Health Sciences Center, Tucson, AZ 85724 Communicated by Lester 0. Krampitz, April 10, 1989 (receivedfor review February 1, 1989) ABSTRACT T5 DNA polymerase, a highly processive sin- proceed through double-stranded regions in template sec- gle-polypeptide enzyme, has been analyzed for its primary ondary structures or supercoiled plasmid templates. structural features. The amino acid sequence of T5 DNA We present here the DNA sequence of the T5 DNA polymerase has a high degree of homology with that of DNA polymerase gene* and the deduced amino acid sequence ofits polymerase I from Escherichia coli and retains many of the product. Comparisons of the primary structure of this en- amino acid residues that have been implicated in the 3' -* 5' zyme with other DNA polymerases suggest differences that exonuclease and DNA polymerase activities of that enzyme. may account for the high processivity of this enzyme. We Alignment with sequences of polymerase I and T7 DNA poly- also demonstrate the conservation of residues thought to be merase was used to identify regions possibly involved in the intimately involved in 3' -* 5' exonuclease and polymerase high processivity of this enzyme. Further, amino acid sequence activities. Finally, two amino acid sequence segments, which comparisons ofT5 DNA polymerase with a large group ofDNA may be involved in the 3' -*5' exonuclease function of these polymerases previously shown to exhibit little similarity to enzymes, appear to be highly conserved among a wide polymerase I indicate certain sequence segments are shared variety of DNA polymerases.
    [Show full text]
  • Reverse Transcriptase Activity Innate to DNA Polymerase I and DNA
    Reverse transcriptase activity innate to DNA SEE COMMENTARY polymerase I and DNA topoisomerase I proteins of Streptomyces telomere complex Kai Bao*† and Stanley N. Cohen*‡§ Departments of *Genetics and ‡Medicine, Stanford University School of Medicine, Stanford, CA 94305-5120 Edited by Nicholas R. Cozzarelli, University of California, Berkeley, CA, and approved August 10, 2004 (received for review June 18, 2004) Replication of Streptomyces linear chromosomes and plasmids gation and, remarkably, that both of these eubacterial enzymes -proceeds bidirectionally from a central origin, leaving recessed 5؅ can function efficiently as RTs in addition to having the bio termini that are extended by a telomere binding complex. This chemical properties predicted from their sequences. We further complex contains both a telomere-protecting terminal protein show that the Streptomyces coelicolor and Streptomyces lividans (Tpg) and a telomere-associated protein that interacts with Tpg TopA proteins are prototypes for a subfamily of bacterial and the DNA ends of linear Streptomyces replicons. By using topoisomerases whose catalytic domains contain a unique Asp– histidine-tagged telomere-associated protein (Tap) as a scaffold, Asp doublet motif that is required for their RT activity and which we identified DNA polymerase (PolA) and topoisomerase I (TopA) is essential also to the RNA-dependent DNA polymerase func- proteins as other components of the Streptomyces telomere com- tions of HIV RT and eukaryotic cell telomerases (16, 17). plex. Biochemical characterization of these proteins indicated that both PolA and TopA exhibit highly efficient reverse transcriptase Materials and Methods (RT) activity in addition to their predicted functions. Although RT Plasmid and Bacterial Strains.
    [Show full text]
  • Molecular Insights Into Mitochondrial Transcription and Its Role in DNA Replication
    Molecular insights into mitochondrial transcription and its role in DNA replication Viktor Posse Department of Medical Biochemistry and Cell Biology Institute of Biomedicine Sahlgrenska Academy University of Gothenburg Gothenburg, Sweden, 2017 Molecular insights into mitochondrial transcription and its role in DNA replication © 2016 Viktor Posse [email protected] ISBN 978-91-629-0024-3 (PRINT) ISBN 978-91-629-0023-6 (PDF) http://hdl.handle.net/2077/48657 Printed in Gothenburg, Sweden 2016 Ineko AB Abstract The mitochondrion is an organelle of the eukaryotic cell responsible for the production of most of the cellular energy-carrying molecule adenosine triphosphate (ATP), through the process of oxidative phosphorylation. The mitochondrion contains its own genome, a small circular DNA molecule (mtDNA), encoding essential subunits of the oxidative phosphorylation system. Initiation of mitochondrial transcription involves three proteins, the mitochondrial RNA polymerase, POLRMT, and its two transcription factors, TFAM and TFB2M. Even though the process of transcription has been reconstituted in vitro, a full molecular understanding is still missing. Initiation of mitochondrial DNA replication is believed to be primed by transcription prematurely terminated at a sequence known as CSBII. The mechanisms of replication initiation have however not been fully defined. In this thesis we have studied transcription and replication of mtDNA. In the first part of this thesis we demonstrate that the transcription initiation machinery is recruited in discrete steps. Furthermore, we find that a large domain of POLRMT known as the N-terminal extension is dispensable for transcription initiation, and instead functions in suppressing initiation events from non-promoter DNA. Additionally we demonstrate that TFB2M is the last factor that is recruited to the initiation complex and that it induces melting of the mitochondrial promoters.
    [Show full text]
  • DNA Polymerase I, a Template-Dependent DNA Polymerase, Catalyzes 5'3' Synthesis of DNA
    Description DNA Polymerase I, a template-dependent DNA polymerase, catalyzes 5'3' synthesis of DNA. The enzyme also exhibits 3'5' exonuclease (proofreading) activity, 5'3' exonuclease activity and ribonuclease H PRODUCT INFORMATION activity. DNA Polymerase I Applications DNA labeling by nick-translation in conjunction with Pub. No. MAN0013723 DNase I (1-3). Rev. Date 03 May 2016 (B.00) Second-strand cDNA synthesis in conjunction with RNase H (4). Source E.coli cells with a cloned polA gene from E.coli. Lot: _ Expiry Date: _ Molecular Weight 103 kDa monomer. Definition of Activity Unit One unit of the enzyme catalyzes the incorporation #EP0041 #EP0042 Components of 10 nmol of deoxyribonucleotides into a polynucleotide 500 U 2500 U fraction 30 min at 37 °C. Concentration 10 U/µL 10 U/µL 10X Reaction Buffer 1 mL 5 x 1 mL Store at -20 °C www.thermofisher.com For Research Use Only. Not for use in diagnostic procedures. Storage Buffer CERTIFICATE OF ANALYSIS The enzyme is supplied in: 25 mM Tris-HCl (pH 7.5), Endodeoxyribonuclease Assay 0.1 mM EDTA, 1 mM DTT and 50% (v/v) glycerol. 10X Reaction Buffer Incubation of supercoiled plasmid DNA with 500 mM Tris-HCl (pH 7.5 at 25 °C), 100 mM MgCl2, polymerase. 10 mM DTT. Quality authorized by: Jurgita Zilinskiene Inhibition and Inactivation Inhibitors: metal chelators, PPi, Pi (at high concentra- tions) (5). Inactivated by heating at 75 °C for 10 min or by addition of EDTA. Note DNA Polymerase I accepts modified nucleotides (e.g. biotin-, digoxigenin-, fluorescent-labeled nucleotides) as substrates for the DNA synthesis.
    [Show full text]
  • Arthur Kornberg 1 9 1 8 – 2 0 0 7
    NATIONAL ACADEMY OF SCIENCES ARTHUR KORNBERG 1 9 1 8 – 2 0 0 7 A Biographical Memoir by I. ROBERT LEHMAN Any opinions expressed in this memoir are those of the author and do not necessarily reflect the views of the National Academy of Sciences. Biographical Memoir 2010 NATIONAL ACADEMY OF SCIENCES WASHINGTON, D.C. Photo courtesty of Staford University Visual Arts. ARTHUR KORNBERG March 3, 1918–October 26, 2007 BY I . ROBERT LEHMAN ITH THE DEATH OF ARTHUR KORNBERG on October 26, W2007, one of the giants of 20th-century biochemistry was lost. Arthur Kornberg was born in Brooklyn, New York, on March , 1918. The son of Joseph and Lena Kornberg, both Eastern European immigrants, he grew up in Brooklyn and attended the City College of New York (CCNY), which was then—and still is—tuition free, and can count several Nobel laureates among its graduates. A precocious student, Korn- berg skipped three years of school and entered CCNY at the age of 15 and graduated at 19 with a B.S. in chemistry and biology. The United States was then deep in the Great Depression, and Kornberg worked to help support the family while in high school and college, first in his parents’ small hardware store and then at a men’s clothing shop. With virtually no jobs to be had for a newly minted graduate of CCNY, Kornberg was fortunate in being accepted in 197 to the University of Rochester School of Medicine, where his ambition was eventually to practice internal medicine. As a sign of the times, of the 200 premedical students in his class at CCNY only five managed to gain acceptance to a medical school.
    [Show full text]
  • DNA Polymerase I- Dependent Replication (Temperature-Sensitive Dna Mutants/Extragenic Suppression) OSAMI NIWA*, SHARON K
    Proc. Nati Acad. Sci. USA Vol. 78, No. 11, pp. 7024-7027, November 1981 Genetics Alternate pathways of DNA replication: DNA polymerase I- dependent replication (temperature-sensitive dna mutants/extragenic suppression) OSAMI NIWA*, SHARON K. BRYAN, AND ROBB E. MOSES Department ofCell Biology, Baylor College of Medicine, Houston, Texas 77030 Communicated by D. Nathans, July 10, 1981 ABSTRACT We have previously shown that someEscherichia proceed in the presence of a functional DNA polymerase I ac- coli [derivatives of strain HS432 (polAl, polB100, polC1026)] can tivity, despite a ts DNA polymerase III (6). replicate DNA at a restrictive temperature in the presence of a We report here that DNA replication in the parent strain polCts mutation and that such revertants contain apparent DNA becomes temperature-resistant with introduction ofDNA poly- polymerase I activity. We demonstrate here that this strain ofE. merase I activity but is ts in the absence of DNA polymerase colibecomes temperature-resistant upon the introduction ofa nor- I or presence of a ts DNA polymerase I activity. We conclude mal gene for DNA polymerase I or suppression of the polAl non- that this strain contains a sense mutation. Such temperature-resistant phenocopies become mutation (pcbA-) that allows repli- temperature-sensitive upon introduction of a temperature-sensi- cation to be dependent on DNA polymerase I polymerizing tive DNA polymerase I gene. Our results confirm that DNA rep- activity. This locus can be transduced to other E. coli strains and lication is DNA polymerase I-dependent in the temperature-re- again exerts phenotypic suppression of the polCts mutation in sistant revertants, indicating that an alternative pathway of the presence of DNA polymerase I.
    [Show full text]
  • And Exonuclease-Deficient Mitochondrial DNA Polymerase Mutants in Genomically Engineered
    ARTICLE Received 8 Jul 2015 | Accepted 6 Oct 2015 | Published 10 Nov 2015 DOI: 10.1038/ncomms9808 OPEN Complementation between polymerase- and exonuclease-deficient mitochondrial DNA polymerase mutants in genomically engineered flies Ana Bratic1,*, Timo E.S. Kauppila1,*, Bertil Macao2, Sebastian Gro¨nke3, Triinu Siibak2, James B. Stewart1, Francesca Baggio1, Jacqueline Dols3, Linda Partridge3, Maria Falkenberg2, Anna Wredenberg4 & Nils-Go¨ran Larsson1,4 Replication errors are the main cause of mitochondrial DNA (mtDNA) mutations and a compelling approach to decrease mutation levels would therefore be to increase the fidelity of the catalytic subunit (POLgA) of the mtDNA polymerase. Here we genomically engineer the tamas locus, encoding fly POLgA, and introduce alleles expressing exonuclease- (exoÀ ) and polymerase-deficient (polÀ ) POLgA versions. The exoÀ mutant leads to accumulation of point mutations and linear deletions of mtDNA, whereas polÀ mutants cause mtDNA depletion. The mutant tamas alleles are developmentally lethal but can complement each other in trans resulting in viable flies with clonally expanded mtDNA mutations. Recon- stitution of human mtDNA replication in vitro confirms that replication is a highly dynamic process where POLgA goes on and off the template to allow complementation during proofreading and elongation. The created fly models are valuable tools to study germ line transmission of mtDNA and the pathophysiology of POLgA mutation disease. 1 Department of Mitochondrial Biology, Max Planck Institute for Biology of Ageing, Joseph-Stelzmann-Strasse 9b, Cologne D-50931, Germany. 2 Department of Medical Biochemistry and Cell Biology, Institute of Biomedicine, University of Gothenburg, Medicinaregatan 9A, Gothenburg SE-40530, Sweden. 3 Department of Biological Mechanisms of Ageing, Max Planck Institute for Biology of Ageing, Joseph-Stelzmann-Strasse 9b, Cologne D-50931, Germany.
    [Show full text]
  • A Review of Isozymes in Cancer1
    Cancer Research VOLUME31 NOVEMBER 1971 NUMBER11 [CANCER RESEARCH 31, 1523-1542, November 1971] A Review of Isozymes in Cancer1 Wayne E. Criss Department of Obstetrics and Gynecology, University of Florida College of Medicine, Gainesville, Florida 32601 TABLE OF CONTENTS postulated role for that particular isozymic system in cellular metabolism. Summary 1523 Introduction 1523 Normal enzyme differentiation 1523 INTRODUCTION Tumor enzyme differentiation 1524 Isozymes 1524 Normal Enzyme Differentiation DNA polymerase 1524 Enzyme differentiation is the process whereby, during the Hexokinase 1525 Fructose 1,6-diphosphatase 1525 development of an organ in an animal, the organ acquires the quantitative and qualitative adult enzyme patterns (122). Key Aldolase 1526 pathway enzymes in several metabolic processes have been Pyruvate kinase 1527 found to undergo enzymatic differentiation. The enzymes Láclatedehydrogenase 1527 Isocitrate dehydrogenase 1527 involved in nitrogen metabolism, and also in urea cycle Malate dehydrogenase 1528 metabolism (180), are tyrosine aminotransferase (123, 151, Glycerol phosphate dehydrogenase 1529 330, 410), tryptophan pyrrolase (261), serine dehydratase Glutaminase 1529 (123, 410), histidine ammonia lyase (11), and aspartate Aspartate aminotransferase 1530 aminotransferase (337, 388). The enzymes involved in nucleic Adenylate kinase 1531 acid metabolism are DNA polymerase (156, 277) and RNase (52). In glycolysis the enzymes are hexokinase-glucokinase Carbamyl phosphate synthetase 1531 Lactose synthetase 1533 (98, 389), galactokinase 30, aldolase (267, 315), pyruvate Discussion 1533 kinase (73, 386), and lactate dehydrogenase (67, 69). In References 1533 mitochondrial oxidation they are NADH oxidase, succinic oxidase, a-glycero-P oxidase, ATPase, cytochrome oxidase, and flavin content (84, 296). In glycogen metabolism the SUMMARY enzymes involved are UDPG pyrophosphorylase and UDPG glucosyltransferase (19).
    [Show full text]
  • RECOMBINANT EXPRESSION VECTORS and PURIFICATION METHODS for $I(THERMUS THERMOPHILUS) DNA POLYMERASE
    Europaisches Patentamt (19) European Patent Office Office europeenpeen des brevets EP 0 506 825 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) intci.6: C12N 15/54, C12N 9/12, of the grant of the patent: C12N 1/21 05.08.1998 Bulletin 1998/32 (86) International application number: (21) Application number: 91902036.2 PCT/US90/07639 Date of 21.12.1990 (22) filing: (87) International publication number: WO 91/09950 (11.07.1991 Gazette 1991/15) (54) RECOMBINANT EXPRESSION VECTORS AND PURIFICATION METHODS FOR $i(THERMUS THERMOPHILUS) DNA POLYMERASE REKOMBINANTE EXPRESSIONSVEKTOREN UND REINIGUNGSVERFAHREN FUR DNS-POLYMERASE AUS THERMUS THERMOPHILUS VECTEURS D'EXPRESSION COMBINES ET PROCEDES DE PURIFICATION DE POLYMERASE D'ADN DE THERMUS THERMOPHILUS (84) Designated Contracting States: (74) Representative: Wachter, Dieter Ernst, Dr. et al AT BE CH DE DK ES FR GB GR IT LI LU NL SE F.Hoffmann-La Roche AG Patent Department (PLP), (30) Priority: 22.12.1989 US 455967 124 Grenzacherstrasse 4070 Basel (CH) (43) Date of publication of application: 07.10.1992 Bulletin 1992/41 (56) References cited: EP-A-0 258 017 EP-A- 0 359 006 (73) Proprietor: F. HOFFMANN-LA ROCHE AG EP-A- 0 373 962 WO-A-89/06691 4002 Basel (CH) • EUROPEAN JOURNAL OF BIOCHEMISTRY, vol. (72) Inventors: 149, no. 1, May 1985, FEBS; C. RUTTIMANN et • GELFAND, David, H. al., pp. 41-46 Oakland, CA 94611 (US) • PCR STRATEGIES, MA. Innis et al., (editors), • LAWYER, Frances, C. 1995, Academic Press Inc., San Diego, CA(US); Oakland, CA 94611 (US) table I, pp.
    [Show full text]