DOCSLIB.ORG

Mouse Ssr2 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Ssr2 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Ssr2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Ssr2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Ssr2 gene (NCBI Reference Sequence: NM_025448 ; Ensembl: ENSMUSG00000041355 ) is located on Mouse chromosome 3. 5 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 5 (Transcript: ENSMUST00000035785). Exon 3 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Ssr2 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-174J9 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 3 starts from about 46.45% of the coding region. The knockout of Exon 3 will result in frameshift of the gene. The size of intron 2 for 5'-loxP site insertion: 2704 bp, and the size of intron 3 for 3'-loxP site insertion: 2979 bp. The size of effective cKO region: ~649 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 3 5 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Ssr2 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. It may be difficult to construct this targeting vector. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7109bp) | A(22.91% 1629) | C(23.35% 1660) | T(31.59% 2246) | G(22.14% 1574) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr3 + 88580528 88583527 3000 browser details YourSeq 329 1049 1698 3000 88.1% chr2 - 168714908 168715434 527 browser details YourSeq 296 1116 1698 3000 93.9% chr1 + 136694073 136755709 61637 browser details YourSeq 291 1008 1702 3000 92.7% chr11 + 120211272 120601529 390258 browser details YourSeq 282 1171 1702 3000 94.1% chr19 - 7010882 7011476 595 browser details YourSeq 280 1069 1662 3000 87.8% chr7 - 16292377 16292962 586 browser details YourSeq 280 1170 1698 3000 89.8% chr13 + 9404342 9404682 341 browser details YourSeq 279 1170 1698 3000 90.6% chr13 - 64130499 64130879 381 browser details YourSeq 270 1169 1690 3000 89.7% chr2 + 126654729 126655050 322 browser details YourSeq 268 1002 1378 3000 92.0% chr12 - 111635714 111636336 623 browser details YourSeq 267 1172 1702 3000 95.0% chr4 - 127001201 127001743 543 browser details YourSeq 259 1169 1690 3000 94.3% chr1 - 7046165 7046688 524 browser details YourSeq 258 1169 1698 3000 91.2% chr9 - 107677820 107678260 441 browser details YourSeq 243 1169 1684 3000 88.2% chr7 - 19930973 19931297 325 browser details YourSeq 243 1171 1689 3000 85.3% chr2 + 30087897 30088214 318 browser details YourSeq 239 1049 1358 3000 93.8% chr11 - 78312121 78312602 482 browser details YourSeq 238 1170 1686 3000 90.7% chr9 + 54584390 54584900 511 browser details YourSeq 236 1050 1358 3000 93.1% chr18 - 81002859 81003452 594 browser details YourSeq 236 1049 1350 3000 91.6% chr11 + 120601424 120601745 322 browser details YourSeq 233 1051 1358 3000 92.7% chr9 + 21526981 21527506 526 Note: The 3000 bp section upstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr3 + 88584137 88587136 3000 browser details YourSeq 1184 32 1457 3000 91.9% chr12 + 9144677 9146104 1428 browser details YourSeq 1163 29 1457 3000 91.7% chr1 - 181027955 181029383 1429 browser details YourSeq 1163 30 1457 3000 91.3% chr14 + 68160598 68162025 1428 browser details YourSeq 1158 30 1457 3000 90.8% chr13 - 103692984 103694405 1422 browser details YourSeq 1156 26 1457 3000 90.5% chr1 + 13757951 13759378 1428 browser details YourSeq 1154 31 1457 3000 91.6% chr15 + 59576299 59577745 1447 browser details YourSeq 1150 33 1454 3000 91.1% chr3 - 58824281 58825700 1420 browser details YourSeq 1150 26 1457 3000 90.3% chr15 + 34591702 34593126 1425 browser details YourSeq 1148 33 1460 3000 91.7% chr18 - 14560405 14561832 1428 browser details YourSeq 1148 33 1449 3000 92.3% chr12 + 52613398 52614823 1426 browser details YourSeq 1147 29 1455 3000 90.2% chrX + 166249378 166250801 1424 browser details YourSeq 1146 31 1457 3000 90.9% chr16 - 34522767 34524197 1431 browser details YourSeq 1145 31 1457 3000 91.4% chr14 - 66632522 66633965 1444 browser details YourSeq 1143 32 1570 3000 91.1% chr9 - 20420020 20421872 1853 browser details YourSeq 1143 30 1449 3000 90.9% chr11 - 5658352 5659775 1424 browser details YourSeq 1141 31 1457 3000 90.5% chr18 - 21443260 21444683 1424 browser details YourSeq 1141 31 1457 3000 91.1% chr3 + 157260876 157513530 252655 browser details YourSeq 1138 31 1457 3000 90.6% chr2 - 84327780 84329205 1426 browser details YourSeq 1137 29 1457 3000 90.9% chr17 + 55754020 55755451 1432 Note: The 3000 bp section downstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Ssr2 signal sequence receptor, beta [ Mus musculus (house mouse) ] Gene ID: 66256, updated on 24-Oct-2019 Gene summary Official Symbol Ssr2 provided by MGI Official Full Name signal sequence receptor, beta provided by MGI Primary source MGI:MGI:1913506 See related Ensembl:ENSMUSG00000041355 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as TLAP; TRAPB; AI315033; AU020133; SSR-beta; TRAPbeta; 1500032E05Rik Expression Ubiquitous expression in placenta adult (RPKM 192.7), large intestine adult (RPKM 147.0) and 28 other tissues See more Orthologs human all Genomic context Location: 3; 3 F1 See Ssr2 in Genome Data Viewer Exon count: 6 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 3 NC_000069.6 (88579608..88588420) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 3 NC_000069.5 (88383593..88392335) Chromosome 3 - NC_000069.6 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 7 transcripts Gene: Ssr2 ENSMUSG00000041355 Description signal sequence receptor, beta [Source:MGI Symbol;Acc:MGI:1913506] Gene Synonyms TRAPbeta Location Chromosome 3: 88,575,876-88,588,419 forward strand. GRCm38:CM000996.2 About this gene This gene has 7 transcripts (splice variants), 203 orthologues, is a member of 1 Ensembl protein family and is associated with 43 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Ssr2-201 ENSMUST00000035785.8 1189 183aa ENSMUSP00000045456.7 Protein coding CCDS17480 Q9CPW5 TSL:1 GENCODE basic APPRIS P1 Ssr2-207 ENSMUST00000195014.5 1059 183aa ENSMUSP00000141441.1 Protein coding CCDS17480 Q9CPW5 TSL:1 GENCODE basic APPRIS P1 Ssr2-202 ENSMUST00000192495.5 620 185aa ENSMUSP00000141922.1 Protein coding - A0A0A6YXB7 TSL:5 GENCODE basic Ssr2-205 ENSMUST00000193934.5 569 164aa ENSMUSP00000141325.1 Protein coding - A0A0A6YVZ1 TSL:3 GENCODE basic Ssr2-203 ENSMUST00000192688.5 560 117aa ENSMUSP00000141471.1 Protein coding - A0A0A6YWA8 CDS 3' incomplete TSL:3 Ssr2-204 ENSMUST00000193069.1 495 34aa ENSMUSP00000141389.1 Protein coding - A0A0A6YW45 CDS 3' incomplete TSL:3 Ssr2-206 ENSMUST00000194604.1 494 32aa ENSMUSP00000141591.1 Protein coding - A0A0A6YWL0 CDS 3' incomplete TSL:3 Page 6 of 8 https://www.alphaknockout.com 32.54 kb Forward strand 88.57Mb 88.58Mb 88.59Mb Genes (Comprehensive set... Ubqln4-201 >protein coding Ssr2-203 >protein coding Ssr2-204 >protein coding Ssr2-206 >protein coding Ssr2-207 >protein coding Ssr2-205 >protein coding Ssr2-202 >protein coding Ssr2-201 >protein coding Contigs AC145168.5 > Genes < Rtraf-ps-201processed pseudogene (Comprehensive set... Regulatory Build 88.57Mb 88.58Mb 88.59Mb Reverse strand 32.54 kb Regulation Legend CTCF Enhancer Promoter Promoter Flank Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding pseudogene Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000035785 8.75 kb Forward strand Ssr2-201 >protein coding ENSMUSP00000045... Transmembrane heli... Low complexity (Seg) Cleavage site (Sign... Pfam PF05753 PIRSF Translocon-associated protein subunit beta PANTHER PTHR12861 PTHR12861:SF3 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant splice region variant synonymous variant Scale bar 0 20 40 60 80 100 120 140 160 183 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • Chromosomal Aberrations in Head and Neck Squamous Cell Carcinomas in Norwegian and Sudanese Populations by Array Comparative Genomic Hybridization
    825-843 12/9/08 15:31 Page 825 ONCOLOGY REPORTS 20: 825-843, 2008 825 Chromosomal aberrations in head and neck squamous cell carcinomas in Norwegian and Sudanese populations by array comparative genomic hybridization ERIC ROMAN1,2, LEONARDO A. MEZA-ZEPEDA3, STINE H. KRESSE3, OLA MYKLEBOST3,4, ENDRE N. VASSTRAND2 and SALAH O. IBRAHIM1,2 1Department of Biomedicine, Faculty of Medicine and Dentistry, University of Bergen, Jonas Lies vei 91; 2Department of Oral Sciences - Periodontology, Faculty of Medicine and Dentistry, University of Bergen, Årstadveien 17, 5009 Bergen; 3Department of Tumor Biology, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Center, Montebello, 0310 Oslo; 4Department of Molecular Biosciences, University of Oslo, Blindernveien 31, 0371 Oslo, Norway Received January 30, 2008; Accepted April 29, 2008 DOI: 10.3892/or_00000080 Abstract. We used microarray-based comparative genomic logical parameters showed little correlation, suggesting an hybridization to explore genome-wide profiles of chromosomal occurrence of gains/losses regardless of ethnic differences and aberrations in 26 samples of head and neck cancers compared clinicopathological status between the patients from the two to their pair-wise normal controls. The samples were obtained countries. Our findings indicate the existence of common from Sudanese (n=11) and Norwegian (n=15) patients. The gene-specific amplifications/deletions in these tumors, findings were correlated with clinicopathological variables. regardless of the source of the samples or attributed We identified the amplification of 41 common chromosomal carcinogenic risk factors. regions (harboring 149 candidate genes) and the deletion of 22 (28 candidate genes). Predominant chromosomal alterations Introduction that were observed included high-level amplification at 1q21 (harboring the S100A gene family) and 11q22 (including Head and neck squamous cell carcinoma (HNSCC), including several MMP family members).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • C14orf166 (RTRAF) Mouse Monoclonal Antibody [Clone ID: OTI1G8] Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA804052 C14orf166 (RTRAF) Mouse Monoclonal Antibody [Clone ID: OTI1G8] Product data: Product Type: Primary Antibodies Clone Name: OTI1G8 Applications: IHC, WB Recommended Dilution: WB 1:2000, IHC 1:150 Reactivity: Human Host: Mouse Isotype: IgG2a Clonality: Monoclonal Immunogen: Full length human recombinant protein of human C14orf166 (NP_057123) produced in E.coli. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 27.9 kDa Gene Name: chromosome 14 open reading frame 166 Database Link: NP_057123 Entrez Gene 51637 Human Q9Y224 Synonyms: CGI-99; CGI99; CLE; CLE7; hCLE1; LCRP369; RLLM1 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 C14orf166 (RTRAF) Mouse Monoclonal Antibody [Clone ID: OTI1G8] – TA804052 Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY C14orf166 ([RC200016], Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-C14orf166. Positive lysates [LY414235] (100ug) and [LC414235] (20ug) can be purchased separately from OriGene.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name signal sequence receptor, beta (translocon-associated protein beta) Gene Symbol SSR2 Organism Human Gene Summary The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits a 34-kD glycoprotein (alpha-SSR or SSR1) and a 22-kD glycoprotein (beta-SSR or SSR2). The human beta-signal sequence receptor gene (SSR2) maps to chromosome bands 1q21-q23. Gene Aliases DKFZp686F19123, TLAP, TRAP-BETA, TRAPB RefSeq Accession No. NC_000001.10, NT_004487.19 UniGene ID Hs.74564 Ensembl Gene ID ENSG00000163479 Entrez Gene ID 6746 Assay Information Unique Assay ID qHsaCID0014663 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000295702, ENST00000529008, ENST00000480567, ENST00000531917, ENST00000526212 Amplicon Context Sequence GGGGCAATCCGGTCCCATTTGACATTGAGCATTCCAGACACAATGCCAAAGTCT TCTGGAGGGAAGGAATCATCAGATAGTTCCACGTCTAATGCAGCACTTGAGCCA ACATTGTAGATGTTGTACTGCAAGGTCAGGTCTCGTCCC Amplicon Length (bp) 117 Chromosome Location 1:155988061-155989851 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9998 cDNA Cq 17.45 cDNA Tm (Celsius) 81.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report SSR2, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference
    [Show full text]
  • Variation in Protein Coding Genes Identifies Information
    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • A Catalogue of Stress Granules' Components
    Catarina Rodrigues Nunes A Catalogue of Stress Granules’ Components: Implications for Neurodegeneration UNIVERSIDADE DO ALGARVE Departamento de Ciências Biomédicas e Medicina 2019 Catarina Rodrigues Nunes A Catalogue of Stress Granules’ Components: Implications for Neurodegeneration Master in Oncobiology – Molecular Mechanisms of Cancer This work was done under the supervision of: Clévio Nóbrega, Ph.D UNIVERSIDADE DO ALGARVE Departamento de Ciências Biomédicas e Medicina 2019 i ii A catalogue of Stress Granules’ Components: Implications for neurodegeneration Declaração de autoria de trabalho Declaro ser a autora deste trabalho, que é original e inédito. Autores e trabalhos consultados estão devidamente citados no texto e constam na listagem de referências incluída. I declare that I am the author of this work, that is original and unpublished. Authors and works consulted are properly cited in the text and included in the list of references. _______________________________ (Catarina Nunes) iii Copyright © 2019 Catarina Nunes A Universidade do Algarve reserva para si o direito, em conformidade com o disposto no Código do Direito de Autor e dos Direitos Conexos, de arquivar, reproduzir e publicar a obra, independentemente do meio utilizado, bem como de a divulgar através de repositórios científicos e de admitir a sua cópia e distribuição para fins meramente educacionais ou de investigação e não comerciais, conquanto seja dado o devido crédito ao autor e editor respetivos. iv Part of the results of this thesis were published in Nunes,C.; Mestre,I.; Marcelo,A. et al. MSGP: the first database of the protein components of the mammalian stress granules. Database (2019) Vol. 2019. (In annex A). v vi ACKNOWLEDGEMENTS A realização desta tese marca o final de uma etapa académica muito especial e que jamais irei esquecer.
    [Show full text]
  • C14orf166 (RTRAF) Mouse Monoclonal Antibody [Clone ID: OTI1E5] Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA804051 C14orf166 (RTRAF) Mouse Monoclonal Antibody [Clone ID: OTI1E5] Product data: Product Type: Primary Antibodies Clone Name: OTI1E5 Applications: IHC, WB Recommended Dilution: WB 1:2000, IHC 1:150 Reactivity: Human Host: Mouse Isotype: IgG2b Clonality: Monoclonal Immunogen: Full length human recombinant protein of human C14orf166 (NP_057123) produced in E.coli. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 27.9 kDa Gene Name: chromosome 14 open reading frame 166 Database Link: NP_057123 Entrez Gene 51637 Human Q9Y224 Synonyms: CGI-99; CGI99; CLE; CLE7; hCLE1; LCRP369; RLLM1 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 7 C14orf166 (RTRAF) Mouse Monoclonal Antibody [Clone ID: OTI1E5] – TA804051 Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY C14orf166 ([RC200016], Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-C14orf166. Positive lysates [LY414235] (100ug) and [LC414235] (20ug) can be purchased separately from OriGene.
    [Show full text]
  • Human Protein Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for AR50810PU-N SSR2 / TRAPB (18-149, His-tag) Human Protein Product data: Product Type: Recombinant Proteins Description: SSR2 / TRAPB (18-149, His-tag) human recombinant protein, 0.5 mg Species: Human Expression Host: E. coli Tag: His-tag Predicted MW: 16.8 kDa Concentration: lot specific Purity: >90% by SDS - PAGE Buffer: Presentation State: Purified State: Liquid purified protein Buffer System: 20 mM Tris-HCl buffer (pH8.0) containing 10% glycerol 0.1M NaCl Preparation: Liquid purified protein Protein Description: Recombinant human SSR2 protein, fused to His-tag at N-terminus, was expressed in E.coli and purified by using conventional chromatography techniques. Storage: Store undiluted at 2-8°C for one week or (in aliquots) at -20°C to -80°C for longer. Avoid repeated freezing and thawing. Stability: Shelf life: one year from despatch. RefSeq: NP_003136 Locus ID: 6746 UniProt ID: P43308 Cytogenetics: 1q22 Synonyms: HSD25; TLAP; TRAP-BETA; TRAPB Summary: The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein (alpha-SSR or SSR1) and a 22-kD glycoprotein (beta-SSR or SSR2). The human beta-signal sequence receptor gene (SSR2) maps to chromosome bands 1q21-q23. [provided by RefSeq, Jul 2008] This product is to be used for laboratory only. Not for diagnostic or therapeutic use.
    [Show full text]
  • RTRAF Mouse Monoclonal Antibody [Clone ID: OTI1B2] Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA804058 RTRAF Mouse Monoclonal Antibody [Clone ID: OTI1B2] Product data: Product Type: Primary Antibodies Clone Name: OTI1B2 Applications: IHC, WB Recommend Dilution: WB 1:2000, IHC 1:150 Reactivity: Human Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Full length human recombinant protein of human C14orf166 (NP_057123) produced in E.coli. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Predicted Protein Size: 27.9 kDa Gene Name: chromosome 14 open reading frame 166 Database Link: NP_057123 Entrez Gene 51637 Human Synonyms: CGI-99; CGI99; CLE; CLE7; hCLE1; LCRP369; RLLM1 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2020 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 RTRAF Mouse Monoclonal Antibody [Clone ID: OTI1B2] – TA804058 Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY C14orf166 ([RC200016], Right lane) cDNA for 48 hrs and lysed. Equivalent amounts of cell lysates (5 ug per lane) were separated by SDS-PAGE and immunoblotted with anti-C14orf166. Positive lysates [LY414235] (100ug) and [LC414235] (20ug) can be purchased separately from OriGene. Immunohistochemical staining of paraffin- embedded Adenocarcinoma of Human breast tissue using anti-C14orf166 mouse monoclonal antibody.
    [Show full text]
  • In-Depth Proteomic Pro Ling Captures Subtype- Speci C Features Of
    In-depth Proteomic Proling Captures Subtype- specic Features of Craniopharyngiomas Jung Hee Kim Seoul National University Hospital Hyeyoon Kim Biomedical Research Institute, Seoul National University Hospital Kisoon Dan Biomedical Research Institute, Seoul National University Hospital Seong-Ik Kim Seoul National University Hospital Sung-Hye Park Seoul National University Hospital Dohyun Han Biomedical Research Institute, Seoul National University Hospital Yong Hwy Kim ( [email protected] ) Seoul National University Hospital Research Article Keywords: craniopharyngioma, proteomics, bioinformatics Posted Date: July 7th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-666783/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/24 Abstract Purpose: Craniopharyngiomas are rare epithelial tumors derived from pituitary gland embryonic tissue. This epithelial tumor can be categorized as an adamantinomatous craniopharyngioma (ACP) or papillary craniopharyngioma (PCP) subtype with histopathological and genetic differences. Genomic and transcriptomic proles of craniopharyngiomas have been investigated; however, the proteomic prole has yet to be elucidated and added to these proles. Recent improvements in high-throughput quantitative proteomic approaches have introduced new opportunities for a better understanding of these diseases and the ecient discovery of biomarkers. We aimed to conrm subtype-associated proteomic changes between ACP and PCP specimens. Methods: We performed a system-level proteomic study using an integrated approach that combines mass spectrometry-based quantitative proteomic, statistical, and bioinformatics analyses. Results: The bioinformatics analysis showed that differentially expressed proteins between ACP and PCP were signicantly involved in mitochondrial organization, fatty acid metabolic processes, exocytosis, the inammatory response, the cell cycle, RNA splicing, cell migration, and neuron development.
    [Show full text]
  • A Comparative Analysis of the Transcriptome Profiles of Liver and Muscle Tissue in Pigs Divergent for Feed Efficiency Stafford Vigors1, John V
    Vigors et al. BMC Genomics (2019) 20:461 https://doi.org/10.1186/s12864-019-5740-z RESEARCH ARTICLE Open Access A comparative analysis of the transcriptome profiles of liver and muscle tissue in pigs divergent for feed efficiency Stafford Vigors1, John V. O’Doherty2, Kenneth Bryan2 and Torres Sweeney1* Abstract Background: The improvement of feed efficiency is a key economic goal within the pig production industry. The objective of this study was to examine transcriptomic differences in both the liver and muscle of pigs divergent for feed efficiency, thus improving our understanding of the molecular mechanisms influencing feed efficiency and enabling the identification of candidate biomarkers. Residual feed intake (RFI) was calculated for two populations of pigs from two different farms of origin/genotype. The 6 most efficient (LRFI) and 6 least efficient (HRFI) animals from each population were selected for further analysis of Longissimus Dorsi muscle (n = 22) and liver (n = 23). Transcriptomic data were generated from liver and muscle collected post-slaughter. Results: The transcriptomic data segregated based on the RFI value of the pig rather than genotype/farm of origin. A total of 6463 genes were identified as being differentially expressed (DE) in muscle, while 964 genes were identified as being DE in liver. Genes that were commonly DE between muscle and liver (n = 526) were used for the multi-tissue analysis. These 526 genes were associated with protein targeting to membrane, extracellular matrix organisation and immune function. In the muscle-only analysis, genes associated with RNA processing, protein synthesis and energy metabolism were down regulated in the LRFI animals while in the liver-only analysis, genes associated with cell signalling and lipid homeostasis were up regulated in the LRFI animals.
    [Show full text]