DOCSLIB.ORG

Curriculum Vitae

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Curriculum Vitae Cachel CV 1 CURRICULUM VITAE SUSAN MARIE CACHEL December, 2009 BIRTHPLACE: Chicago, Illinois, U.S.A. (American citizenship) PRESENT POSITION: Associate Professor, Physical Anthropology Rutgers University Department of Anthropology Douglass College, 131 George Street New Brunswick, New Jersey 08901-1414 Member, Graduate Faculty Member, Graduate Quaternary Studies Program Member, Center for Human Evolutionary Studies Researcher/Instructor at the Koobi Fora Field School (Rutgers University/Kenya National Museums), east of Lake Turkana, northern Kenya. Research Associate of the Kenya National Museums Fellow, Rutgers College, Rutgers University Fellow, Douglass College, Rutgers University TELEPHONE: 732/932-9886 (departmental phone) FAX: 732/932-1564 (department) e-mail: [email protected] 732/545-7512 (home phone) SPECIALIZATION: Primate Evolution, Palaeoanthropology, Evolutionary Theory, Primatology, Vertebrate Palaeontology EDUCATION: B.A., University of Chicago--June 13, 1970 M.A., University of Chicago--December 17, 1971 (Master's Thesis: "The Beginnings of Catarrhine Primates") Ph.D., University of Chicago--December 10, 1976 (Dissertation: "The Origins of the Anthropoid Grade") Dissertation Committee Members: Dr. R.H. Tuttle (thesis advisor), Dr. K.W. Butzer, Dr. A.A. Dahlberg, Dr. L.G. Freeman EMPLOYMENT RECORD: 1983-present. Associate Professor, Physical Anthropology, Department of Anthropology, Douglass College, Rutgers University Cachel CV 2 1977-1983 Assistant Professor, Physical Anthropology, Department of Anthropology, Douglass College, Rutgers University 1975-1976 Instructor, Physical Anthropology, Loyola University, Chicago 1974-1975 Graduate Teaching Assistant, departments of anthropology and biology, University of Chicago HONORS AND GRANTS: Elected a Fellow of the American Association for the Advancement of Science, December 2009 Kenyan National Museums/Ministry of National Heritage, Government of Kenya: “Limb-deformities among the El-Molo community of North Kenya.” $75,000 [money allocated, but not yet released]. 2010-2011 (Co-PI, E. Mbua, P. Kiura, & S. Cachel) Rutgers Center for Human Evolutionary Studies (CHES) grant 2007- 2008, $4,250. CHES grant 2006-2007, $4,025. CHES grant 2005-2006, $2,100. Plenary Session Member Prize, 75th Anniversary of the founding of the American Association of Physical Anthropologists, 2005 CHES grant 2004-2005, $3,500. CHES grant 2003-2004, $4,000. ACIC Instructional Computing Initiative: “Innovations in computer- based instruction in anthropology”, 2002-2003 (with L. Cronk and A. Haugerud) National Science Foundation: “A fresh perspective: Isotopic evidence for prehistoric diet in the Mississippi River Valley of West-Central Illinois”, 2002-2003 (PI on dissertation improvement grant) Rutgers Global Programs Grant for equipment and computer labs at research Stations at the National Museum of Kenya, Nairobi and the Koobi Fora Field Station, northern Kenya, 2001 (with J.W.K. Harris) ACIC grant to Department of Anthropology for software and computer equipment, 2001 (with L. Cronk and A. Haugeraud). Rutgers University Faculty Merit Award 2006, 2005, 2002, 2001, 2000, 1994, 1989, 1984 New Jersey Equipment Leasing Fund Grant to Department of Anthropology, 1994 (with R.J. Blumenschine and J.W.K. Harris) Douglass Fellows Research Award, 1993-1994 Teaching Excellence Center Grant, Rutgers University (1993-1994) with R.J. Blumenschine and J.W.K. Harris) Rutgers University Research Council Award for "Taxonomic Diagnosis of Early Fossil Humans," (1992-1993) Cachel CV 3 Rutgers Faculty Academic Service Award, 1991 American Association of University Women: "Genetic Variation, Fitness, and Inbreeding Statistics in the Black Howler Monkey (Alouatta pigra) of Belize" 1990-1991 Principal Investigator, dissertation research) National Geographic Society: "Etho-Archaeology of Chimpanzees in a Gallery Forest, Eastern Zaire" 1990 (Co-Principal Investigator) Douglass Fellow Research Award, 1989 Rutgers University Research Council Award for the Interdisciplinary Colloquium "Population Growth, Disease, and the Origin of Agriculture" (1988-1989) Rutgers University Research Council Award for the Interdisciplinary Colloquium "Taphonomy, Paleoecology, and Fossil Man" (1983-1984) Rutgers University Research Council Award (1981-1982) Rutgers University Council for Instructional Development grant (1979-1980) Rutgers University Research Council Award (1978-1979) Henry H. Hinds Fund grant for Evolutionary Research (1975-1976) William Rainey Harper Fellowship (1973-1974) Organization for Tropical Studies grant (Costa Rica, 1972) Woodrow Wilson Fellowship National Science Foundation Graduate Research Fellowship (1970-1973) Phi Beta Kappa Shinner Scholar, Field Museum of Natural History, 1969 Student Aide to University Marshall, Univ. of Chicago, 1968-1970 Goethe Prize, 1968 Academy of American Poets Award, first prize, 1967 FIELD AND LAB EXPERIENCE: Attended the 150th anniversary of the discovery of the original Neanderthal fossils, Bonn, Germany, with site visits, and exhibition of original European fossils at the Rheinisches LandesMuseum, Bonn, July, 2006. Site visits to La Selva and Palo Verde tropical biology research stations, Costa Rica, as part of the NSF “Professor Preview” Program in teaching Field biology courses, July, 2005 Research/instruction at paleoanthropological sites in the Koobi Fora region, East of Lake Turkana, northern Kenya, summer 1997-2002; Instruction in tropical ecology at habitats near Lake Naivasha and Laikipia District, Kenya, summer 1997-2002 Cachel CV 4 field-trips to rock-art sites in the Matopos Hills, Zimbabwe, 1995 field-trips to Cretaceous, Paleocene, and Eocene fossil mammal sites in the San Juan Basin, northern New Mexico, 1993 field-trips to Ngorongoro Conservation Area, and fossil and archaeological sites at Laetoli and Olduvai Gorge, Tanzania, 1993 Study of African Plio-Pleistocene hominid material at the Palaeo-Anthropology Research Unit, University of the Witwatersrand, Johannesburg, South Africa, and the Transvaal Museum, South Africa, 1993; visit to the sites of Sterkfontein and Swartkrans, the Transvaal, South Africa, 1993 Study of African Plio-Pleistocene hominid material at the Kenya National Museums, Nairobi, 1991 Member of Rutgers University project studying the ecology and etho-archaeology of chimpanzees in the Parc National des Virunga, eastern Zaire (the Congo), 1990 Study of African Miocene hominoid material at the Kenya National Museums, Nairobi, 1990 Study of fossil hominid and archaeological sites at Koobi Fora and the Karari Escarpment, East Turkana, northern Kenya, 1989 Study of Senga and Ishango palaeontological and archaeological sites in the Upper Semliki River region, eastern Zaire, 1989 Part of Rutgers University pilot project team to establish a camp for monitoring of common chimpanzee behavior and ecology in the Ishasha River region, eastern Zaire, 1989 Participant at workshop symposium "The Origins and Maintenance of Biotic Diversity," sponsored by the NSF and OTS, La Selva humid tropical rainforest reserve, Costa Rica, 1988 Study of Oligocene and early Miocene fossil mammals in the collections of the South Dakota School of Mines and Technology; study of latest Cretaceous and Oligocene fossil vertebrate sites and collection of fossil mammals at Reva Gap (Brule Formation, Oligocene), South Dakota, 1985 Study of tropical lowland and montane rainforest ecology, Osa Peninsula and Monte Verde Cloud Forest, Costa Rica, 1984 Cachel CV 5 Study of the hominid casts of record from the Hadar Formation, Ethiopia, and comparison of these with australopithecine casts from other East African and South African sites, and with specimens from the Hamann-Todd non-human primate skeletal collection at the Physical Anthropology Laboratory, Cleveland Museum of Natural History, 1982 Study of the type specimen of Dolichocebus gaimanensis (fossil platyrrhine primate, Upper Oligocene, Patagonia), 1981 Study of the primate skeletal collections of the Field Museum of Natural History, Chicago, 1975-1976; 1978; 1981-1983; 1987 Study of the published Egyptian Fayum fossil primate specimens, Kline Geology Laboratory, Peabody Museum of Natural History, Yale University, 1976 Intensive study of neotropical environments and ecology, Costa Rica, 1972 LANGUAGE PROFICIENCY: Reading knowledge of German, Spanish, French, Polish PROFESSIONAL Fellow, American Association for the Advancement of Science SOCIETIES: American Association of Physical Anthropologists Society of Vertebrate Paleontology American Society of Primatologists New York Regional Primatologists Group Associate, Organization for Tropical Studies Member, American Society of Naturalists The Paleoanthropology Society Associate, Behavioral and Brain Sciences Group [peer commentator, BBS] Alpha Lambda, National Honor Society for Anthropology [established the Epsilon Chapter at Rutgers University] PROFESSIONAL ACTIVITIES: Invited participant at Workshop/Symposium on Evolutionary Genetics and Genomics, Rutgers University, New Brunswick, NJ, October 30, 2009 Listed at www.nsfgrfp.org under “Applicant Resources” as an experienced National Science Foundation Graduate Research Fellowship Program resource person, August 2009 Evaluation panelist for 2009 NSF/ASEE (American Society for Engineering Education) Graduate Research Fellowship Program for Genetics and Evolutionary Biology, February 2009 Reviewed 11th edition of Introduction to Physical Anthropology, Cachel CV 6 R. Jurmain et al. (2008) in preparation for the 12th edition
Load more

Recommended publications
  • For Additions to This Section Please See the Media Resources Desk
    UNLV LIBRARY (The) Africans. MEDIA RESOURCES CATALOG PBS (1987) ANTHROPOLOGY 1. The Nature of a Continent: examines Summer 2011 Africa as the birthplace of human kind and discusses the impact of geography on A-OK? African history. Bullfrog Films (2000) 2. A Legacy of Lifestyles: explores how Part 26 of a series on how the African contemporary lifestyles are globalized world economy affects ordinary influenced by indigenous, Islamic and people. In underdeveloped countries Western factors. children with Vitamin A deficiency run the 3. New Gods: examines the factors that risk of dying from common childhood influence religion in Africa. illnesses. The cost of ensuring all children 4. Tools of Exploitation: contrasts the receive enough Vitamin A is small, but impact of the West on Africa and the impact improves children's chances of survival by of Africa on the development of the West. 25%. This episode looks at Vitamin A Looks at the manner in which Africa's distribution programs in Ghana, Uganda, human and natural resources have been India and Guatemala. exploited. Video Cassette (24 min.) 5. New Conflicts: explores the tensions RJ399 V57 A2 2000 inherent in the juxtaposition of the three heritages. Africa. 6. In Search of Stability: studies several National Geographic Video (2001) means of governing and new social orders. Presents Africa through the eyes of its 7. A Garden of Eden in Decay? people, including the personal stories of identifies the problems of a continent that those who shape its future. produces what it does not consume and 1. Savanna homecoming ; Desert consumes what it does not produce.
    [Show full text]
  • Family-Cyprinidae-Gobioninae-PDF
    SUBFAMILY Gobioninae Bleeker, 1863 - gudgeons [=Gobiones, Gobiobotinae, Armatogobionina, Sarcochilichthyna, Pseudogobioninae] GENUS Abbottina Jordan & Fowler, 1903 - gudgeons, abbottinas [=Pseudogobiops] Species Abbottina binhi Nguyen, in Nguyen & Ngo, 2001 - Cao Bang abbottina Species Abbottina liaoningensis Qin, in Lui & Qin et al., 1987 - Yingkou abbottina Species Abbottina obtusirostris (Wu & Wang, 1931) - Chengtu abbottina Species Abbottina rivularis (Basilewsky, 1855) - North Chinese abbottina [=lalinensis, psegma, sinensis] GENUS Acanthogobio Herzenstein, 1892 - gudgeons Species Acanthogobio guentheri Herzenstein, 1892 - Sinin gudgeon GENUS Belligobio Jordan & Hubbs, 1925 - gudgeons [=Hemibarboides] Species Belligobio nummifer (Boulenger, 1901) - Ningpo gudgeon [=tientaiensis] Species Belligobio pengxianensis Luo et al., 1977 - Sichuan gudgeon GENUS Biwia Jordan & Fowler, 1903 - gudgeons, biwas Species Biwia springeri (Banarescu & Nalbant, 1973) - Springer's gudgeon Species Biwia tama Oshima, 1957 - tama gudgeon Species Biwia yodoensis Kawase & Hosoya, 2010 - Yodo gudgeon Species Biwia zezera (Ishikawa, 1895) - Biwa gudgeon GENUS Coreius Jordan & Starks, 1905 - gudgeons [=Coripareius] Species Coreius cetopsis (Kner, 1867) - cetopsis gudgeon Species Coreius guichenoti (Sauvage & Dabry de Thiersant, 1874) - largemouth bronze gudgeon [=platygnathus, zeni] Species Coreius heterodon (Bleeker, 1865) - bronze gudgeon [=rathbuni, styani] Species Coreius septentrionalis (Nichols, 1925) - Chinese bronze gudgeon [=longibarbus] GENUS Coreoleuciscus
    [Show full text]
  • The Evolution Deceit
    About The Author Now writing under the pen-name of HARUN YAHYA, Adnan Oktar was born in Ankara in 1956. Hav- ing completed his primary and secondary education in Ankara, he studied arts at Istanbul's Mimar Sinan Univer- sity and philosophy at Istanbul University. Since the 1980s, he has published many books on political, scientific, and faith-related issues. Harun Yahya is well-known as the author of important works disclosing the imposture of evo- lutionists, their invalid claims, and the dark liaisons between Darwinism and such bloody ideologies as fascism and com- munism. Harun Yahya's works, translated into 63 different lan- guages, constitute a collection for a total of more than 45,000 pages with 30,000 illustrations. His pen-name is a composite of the names Harun (Aaron) and Yahya (John), in memory of the two esteemed Prophets who fought against their peoples' lack of faith. The Prophet's seal on his books' covers is symbolic and is linked to their con- tents. It represents the Qur'an (the Final Scripture) and the Prophet Muhammad (saas), last of the prophets. Under the guid- ance of the Qur'an and the Sunnah (teachings of the Prophet [saas]), the author makes it his purpose to disprove each funda- mental tenet of irreligious ideologies and to have the "last word," so as to completely silence the objections raised against religion. He uses the seal of the final Prophet (saas), who attained ultimate wisdom and moral perfection, as a sign of his intention to offer the last word. All of Harun Yahya's works share one single goal: to convey the Qur'an's message, encour- age readers to consider basic faith-related is- sues such as Allah's existence and unity and the Hereafter; and to expose irreligious sys- tems' feeble foundations and perverted ide- ologies.
    [Show full text]
  • New Platyrrhine Tali from La Venta, Colombia Department of Anthropology, Northern Illinois University, Dekalb, Illinois 60115
    Daniel L. Gebo New platyrrhine tali from La Venta, Colombia Department of Anthropology, Northern Illinois University, DeKalb, Illinois 60115. U.S.A. Two new primate tali were discovered from the middle Miocene of South America at La Venta, Colombia. IGM-KU 8802 is similar in morphology to Callicebus and Aotus, and is allocated to cf. Aotus dindensis, while IGM-KU Marian Dagosto 8803, associated with a dentition of a new cebine primate, is similar to Saimiri. Both tali differ from the other known fossil platyrrhine tali, Departments of Cell, Molecular, and Dolichocebus and Cebupithecia, and increase our knowledge of the locomotor Structural Biology and Anthropology, diversity of the La Venta primate fauna. hrorthrerestern lJniuersi;v, Euanston, Illinois 60208, U.S.A. Alfred L. Rosenberger Department of Anthropology, L’niuersity of Illinois at Chicago, Chicago, Illinois 60680, U.S.A. Takeshi Setoguchi Primate Research Institute, Kyoto C’niniuersiQ,Inuyama Cily, Aichi 484, Japan Received 18 April 1989 Revision received 4 December 1989and accepted 2 1 December 1989 Keywords: Platyrrhini, La Venta, foot bones, locomotion. Journal of Human Evolution (1990) 19,737-746 Introduction Two new platyrrhine tali were discovered at La Venta, Colombia, by the Japanese/American field team working in conjunction with INGEOMINAS (Instituto National de Investigaciones Geologico-Mineras) during the field season of 1988. These two fossils add to the rare but growing number of postcranial remains of extinct platyrrhines from the Miocene of South America (Stirton, 1951; Gebo & Simons, 1987; Anapol & Fleagle, 1988; Ford, 1990). They represent the first new primate postcranials to be described from La Venta in nearly four decades.
    [Show full text]
  • New Primate Genus from the Miocene of Argentina
    New primate genus from the Miocene of Argentina Marcelo F. Tejedor*†, Ada´ n A. Tauber‡, Alfred L. Rosenberger§¶, Carl C. Swisher IIIʈ, and Marı´aE. Palacios** *Consejo Nacional de Investigaciones Cientı´ficasy Te´cnicas, Laboratorio de Investigaciones en Evolucio´n y Biodiversidad, Facultad de Ciencias Naturales, Sede Esquel, Universidad Nacional de la Patagonia ‘‘San Juan Bosco,’’ Sarmiento 849, 9200 Esquel, Argentina; ‡Facultad de Ciencias Exactas, Fı´sicasy Naturales, Universidad Nacional de Co´rdoba, Avenida Velez Sarsfield 249, 5000 Co´rdoba, Argentina; §Department of Archaeology and Anthropology, Brooklyn College, City University of New York, 2900 Bedford Avenue, Brooklyn, NY 11210; ¶Division of Vertebrate Zoology (Mammalogy), American Museum of Natural History, Central Park West at 79th Street, New York, NY 11024; ʈDepartment of Geological Sciences, Rutgers University, Piscataway, NJ 08854; and **Museo Regional Provincial ‘‘Padre Manuel Jesu´s Molina,’’ Ramo´n y Cajal 51, 9400 Rı´oGallegos, Argentina Edited by Jeremy A. Sabloff, University of Pennsylvania Museum of Archaeology and Anthropology, Philadelphia, PA, and approved December 28, 2005 (received for review August 4, 2005) Killikaike blakei is a new genus and species of anthropoid from the of the estuary of the Rio Gallegos river. The stratigraphy is late Early Miocene of southeastern Argentina based on the most divided into two members (6): Estancia La Costa (120 m thick pristine fossil platyrrhine skull and dentition known so far. It is part with 18 fossiliferous levels) and Estancia Angelina (103 m thick of the New World platyrrhine clade (Family Cebidae; Subfamily with four fossiliferous levels). There are two types of volcanic ash Cebinae) including modern squirrel (Saimiri) and capuchin mon- at the locality.
    [Show full text]
  • Development of Microsatellite Markers in Pungtungia Herzi Using Next-Generation Sequencing and Cross-Species Amplification in the Genus Pseudopungtungia
    Int. J. Mol. Sci. 2013, 14, 19923-19931; doi:10.3390/ijms141019923 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Development of Microsatellite Markers in Pungtungia herzi Using Next-Generation Sequencing and Cross-Species Amplification in the Genus Pseudopungtungia Young-Eun Yun 1, Jeong-Nam Yu 1, Sang Ki Kim 2, Ui Wook Hwang 2,3 and Myounghai Kwak 1,* 1 National Institute of Biological Resources, Incheon 404-708, Korea; E-Mails: [email protected] (Y.-E.Y.); [email protected] (J.-N.Y.) 2 School of Life Science, Kyungpook National University, Daegu 702-701, Korea; E-Mails: [email protected] (S.K.K.); [email protected] (U.W.H.) 3 Department of Biology, Teachers College & Institute for Phylogenomics and Evolution, Kyungpook National University, Daegu 702-701, Korea * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +82-32-590-7186; Fax: +82-32-590-7230. Received: 1 June 2013; in revised form: 10 July 2013 / Accepted: 18 September 2013 / Published: 1 October 2013 Abstract: Nuclear microsatellite markers for Pungtungia herzi were developed using a combination of next-generation sequencing and Sanger sequencing. One hundred primer sets in the flanking region of dinucleotide and trinucleotide repeat motifs were designed and tested for efficiency in polymerase chain reaction amplification. Of these primer sets, 16 new markers (16%) were successfully amplified with unambiguous polymorphic alleles in 16 individuals of Pungtungia herzi. Cross-species amplification with these markers was then examined in two related species, Pseudopungtungia nigra and Pseudopungtungia tenuicorpa.
    [Show full text]
  • CHAPTER 9 - LOWER PRIMATES and MONKEYS We Humans Are Classified As Members of Order Primates
    CHAPTER 9 - LOWER PRIMATES AND MONKEYS We humans are classified as members of Order Primates. In the Linnaean system, Primates are commonly broken down into subgroups as follows. Visual ORDER PRIMATES # 9-1 Suborder Prosimii Suborder Anthropoidea (Strepsirrhines) (Haplorrhines) Lemurs/Lorises Aye-ayes Adapoids Tarsiers Omomyids Platyrrhines Catarrhines (extinct) (extinct) (nostrils nostrils facing facing sideways) down or front) New World Old World Apes Humans monkeys monkeys (after Perelman et al., 2011) There are obviously similarities between humans, monkeys, and apes. There are contradictory explanations: (1) Common design, and (2) Common ancestry with later evolution. Each is a matter of faith and cannot be tested. Initial Complexity leads us to believe that humans and each primate kind were directly created Visual # 9-2 and have varied only within definite genetic limits. By contrast, Initial Disorganization leads us to believe that each type of primate has evolved from some lower type, starting with something similar to lagomorphs (rabbits and hares). Perelman, Johnson et al. (2011) give the most common scenario, that one of these evolved to something like tree shrews (Scandentia), which in turn evolved into Dermoptera (colugos or “flying lemurs”), then primates. In order for us to tell which is more likely to be correct, we can look at the available fossils. • If Initial Complexity is correct, there should be a complete absence of transitional forms between any of the groups shown above. There should also be a resistance to basic change in each of the primate groups. They may exhibit variation within a kind, but there should be no traces of evolution from one kind to another.
    [Show full text]
  • Figure S1. Schematic Maximum-Likelihood Tree of Ucp Sequences Used in This Study (N=400)
    Figure S1. Schematic maximum-likelihood tree of ucp sequences used in this study (N=400). Branch lengths denote number of substitutions per site. Exon 1 1 10 20 30 40 50 |...|....|....|....|....|....|....|....|....|....| Homo sapiens ATGGGGGGCCTGA-CAGCCTCGGACGTACACCCGACCC---TGGGGGTCC Bradypus variegatus ?????????????????????????????????????????????????? Choloepus hoffmanni ?????????????????????????????????????????????????? Mylodon darwinii ?????????????????????????????????????????????????? Cyclopes didactylus ?????????????????????????????????????????????????? Dasypus novemcinctus ATGGGGCGCCAGGGCTCCCGCGGGCTCACCCCCCGC-------------- Procavia capensis CTG--AGTTAAGA-CAACCTCAGAAATGCCGCCTAC-----------GCA Elephas maximus ACGGTAGGCCAGA-CGACCGCAGACGTGCCCCGGACCATGGTGGGGGTCA Mammuthus primigenius ACGGTAGGCCAGA-CGACCGCAGACGTGCCCCGGACCATGGTGGGGGTCA Loxodonta africana ACCGTAGGCCAGA-CGACCGCAGACGTGCCCCGGACCATGGTGGGGGTCA Trichechus manatus ATGGTGGGCCAGA-CTACCTGGGATGTGCCCCCGACCA---TGGGCGTCA Dugong dugon ATGGTGGGCCAGA-CTACCTCGGATGTGCCCCCGACCA---TGGGCGTCA Hydrodamalis gigas ATGGTGGGCCAGA-CTACCTCGGATGTGCCCCCGACCA---TGGGCGTCA Sus scrofa CTGTCAGGA-TGA-CAGTTCCTGAAGTGCCCCCGACCA---TAGCGGTCA Sus verrucosus CTGTCAGGA-TGA-CAGTTCCTGAAGTGCCCTCGACCA---TAGCGGTCA Sus cebifrons CTGTCAGGA-TGA-CAGTTCCTGAAGTGCCCTCGACCA---TAGCGGTCA Physeter macrocephalus ATGGTGGGACTCG-CAGCCTCATACGTGCCCCCGACCA---TGGCGGTCA Delphinapterus leucas -------------------------------------------------- Lipotes vexillifer ATGGTGGGACTCG-CAGCCTCAGACGTGCCCCCGACCA---TGGCGGTCA Balaena mysticetus ATGGTGGCACTCA-CAGCCTCAGACGTGCCCCCGACCA---TGGCGGTCA
    [Show full text]
  • Centromere Repositioning in Mammals
    Heredity (2012) 108, 59–67 & 2012 Macmillan Publishers Limited All rights reserved 0018-067X/12 www.nature.com/hdy REVIEW Centromere repositioning in mammals M Rocchi1, N Archidiacono1, W Schempp2, O Capozzi1 and R Stanyon3 The evolutionary history of chromosomes can be tracked by the comparative hybridization of large panels of bacterial artificial chromosome clones. This approach has disclosed an unprecedented phenomenon: ‘centromere repositioning’, that is, the movement of the centromere along the chromosome without marker order variation. The occurrence of evolutionary new centromeres (ENCs) is relatively frequent. In macaque, for instance, 9 out of 20 autosomal centromeres are evolutionarily new; in donkey at least 5 such neocentromeres originated after divergence from the zebra, in less than 1 million years. Recently, orangutan chromosome 9, considered to be heterozygous for a complex rearrangement, was discovered to be an ENC. In humans, in addition to neocentromeres that arise in acentric fragments and result in clinical phenotypes, 8 centromere- repositioning events have been reported. These ‘real-time’ repositioned centromere-seeding events provide clues to ENC birth and progression. In the present paper, we provide a review of the centromere repositioning. We add new data on the population genetics of the ENC of the orangutan, and describe for the first time an ENC on the X chromosome of squirrel monkeys. Next-generation sequencing technologies have started an unprecedented, flourishing period of rapid whole-genome sequencing. In this context, it is worth noting that these technologies, uncoupled from cytogenetics, would miss all the biological data on evolutionary centromere repositioning. Therefore, we can anticipate that classical and molecular cytogenetics will continue to have a crucial role in the identification of centromere movements.
    [Show full text]
  • 30 Tejedor.Pmd
    Arquivos do Museu Nacional, Rio de Janeiro, v.66, n.1, p.251-269, jan./mar.2008 ISSN 0365-4508 THE ORIGIN AND EVOLUTION OF NEOTROPICAL PRIMATES 1 (With 4 figures) MARCELO F. TEJEDOR 2 ABSTRACT: A significant event in the early evolution of Primates is the origin and radiation of anthropoids, with records in North Africa and Asia. The New World Primates, Infraorder Platyrrhini, have probably originated among these earliest anthropoids morphologically and temporally previous to the catarrhine/platyrrhine branching. The platyrrhine fossil record comes from distant regions in the Neotropics. The oldest are from the late Oligocene of Bolivia, with difficult taxonomic attribution. The two richest fossiliferous sites are located in the middle Miocene of La Venta, Colombia, and to the south in early to middle Miocene sites from the Argentine Patagonia and Chile. The absolute ages of these sedimentary deposits are ranging from 12 to 20 Ma, the oldest in Patagonia and Chile. These northern and southern regions have a remarkable taxonomic diversity and several extinct taxa certainly represent living clades. In addition, in younger sediments ranging from late Miocene through Pleistocene, three genera have been described for the Greater Antilles, two genera in eastern Brazil, and at least three forms for Río Acre. In general, the fossil record of South American primates sheds light on the old radiations of the Pitheciinae, Cebinae, and Atelinae. However, several taxa are still controversial. Key words: Neotropical Primates. Origin. Evolution. RESUMO: Origem e evolução dos primatas neotropicais. Um evento significativo durante o início da evolução dos primatas é a origem e a radiação dos antropóides, com registros no norte da África e da Ásia.
    [Show full text]
  • Stem Taxa, Homoplasy, Long Lineages, and the Phylogenetic Position of Dolichocebus
    Journal of Human Evolution 59 (2010) 218e222 Contents lists available at ScienceDirect Journal of Human Evolution journal homepage: www.elsevier.com/locate/jhevol News and Views Stem taxa, homoplasy, long lineages, and the phylogenetic position of Dolichocebus Richard F. Kay a,*, John G. Fleagle b a Department of Evolutionary Anthropology, Duke University, Durham, NC 27708, USA b Department of Anatomical Sciences, Health Sciences Center, Stony Brook University, Stony Brook, New York 11794-8081, USA article info identifying them as being members of a clade. In our analysis, a suite of derived anatomical features that are generally lacking in Article history: the Patagonian taxa unites all living, or crown, platyrrhines. Among Received 16 November 2009 other things, compared with the Patagonian taxa, crown platyr- Accepted 12 February 2010 rhines have a shorter rostrum, a more transversely arched palate, Keywords: more convergent orbits, reorganization of the arrangement of the Platyrrhini bones at pterion, larger, more transversely positioned premolar Phylogenetics metaconids, loss of molar hypoconulids and of a postentoconid Anthropoidea sulcus, and reduction of molar roots. It is the absence of the above- Molecular clocks listed derived features of crown platyrrhines in the Patagonian taxa that suggests each of them is a stem platyrrhine, and outside of the modern radiation. The Patagonian taxa may belong to a separate stem clade or they may be a paraphyletic group, one species of which may prove to be the sister to the most recent common In his reply to our recent paper (Kay et al., 2008) entitled “The ancestor of living platyrrhines. Either way, Dolichocebus, Trem- anatomy of Dolichocebus gaimanensis, a stem platyrrhine monkey acebus and the other less-well known Patagonian early Miocene from Argentina,” Rosenberger (2010: p.1) addresses a wide range of monkeys are stem platyrrhines.
    [Show full text]
  • Checklist of Species Within the CCBNEP Study Area: References, Habitats, Distribution, and Abundance
    Current Status and Historical Trends of the Estuarine Living Resources within the Corpus Christi Bay National Estuary Program Study Area Volume 4 of 4 Checklist of Species Within the CCBNEP Study Area: References, Habitats, Distribution, and Abundance Corpus Christi Bay National Estuary Program CCBNEP-06D • January 1996 This project has been funded in part by the United States Environmental Protection Agency under assistance agreement #CE-9963-01-2 to the Texas Natural Resource Conservation Commission. The contents of this document do not necessarily represent the views of the United States Environmental Protection Agency or the Texas Natural Resource Conservation Commission, nor do the contents of this document necessarily constitute the views or policy of the Corpus Christi Bay National Estuary Program Management Conference or its members. The information presented is intended to provide background information, including the professional opinion of the authors, for the Management Conference deliberations while drafting official policy in the Comprehensive Conservation and Management Plan (CCMP). The mention of trade names or commercial products does not in any way constitute an endorsement or recommendation for use. Volume 4 Checklist of Species within Corpus Christi Bay National Estuary Program Study Area: References, Habitats, Distribution, and Abundance John W. Tunnell, Jr. and Sandra A. Alvarado, Editors Center for Coastal Studies Texas A&M University - Corpus Christi 6300 Ocean Dr. Corpus Christi, Texas 78412 Current Status and Historical Trends of Estuarine Living Resources of the Corpus Christi Bay National Estuary Program Study Area January 1996 Policy Committee Commissioner John Baker Ms. Jane Saginaw Policy Committee Chair Policy Committee Vice-Chair Texas Natural Resource Regional Administrator, EPA Region 6 Conservation Commission Mr.
    [Show full text]