Artificial Inoculation of Phytophthora Ramorum on Pseudotsuga Menziesii and Larix Kamperfi Bolts to Assess Lineage Aggression, Survival and Detection Methods

Home , Phytophthora ramorum

Artificial inoculation of Phytophthora ramorum on Pseudotsuga menziesii and Larix kamperfi bolts to assess lineage aggression, survival and detection methods

By Julie Sheppard

A thesis submitted in partial fulfillment of the requirements for the degree of

BACHELOR OF SCIENCE IN FOREST AND CONSERVATION SCIENCES

The Faculty of Forestry

THE UNIVERSITY OF BRITISH COLUMBIA

(Vancouver)

FRST 498: B.Sc.F Undergraduate Thesis April 2015

Table of Contents ABSTRACT ...... 3 LIST OF TABLES AND FIGURES...... 4 MATERIALS AND METHODS...... 11 Isolate preparation...... 11 Bolt Preparation...... 11 Inoculation Methods ...... 12 Treatment ...... 13 Lineage comparisons and re-isolation ...... 13 Molecular Assessment...... 14 RESULTS...... 16 Lesions differences on bolts ...... 16 Differences between isolates and lineages...... 19 Re-isolation...... 21 Comparing diagnostic techniques...... 22 DISCUSSION ...... 24 Susceptibility, lesion length and lineage aggression...... 24 Re-isolation and pathogen survival ...... 26 Molecular detection and pathogen survival ...... 28 CONCLUSION ...... 29 ACKNOWLEDGEMENTS...... 29 LITERATURE CITED ...... 30 APPENDIX A ...... 34 APPENDIX B ...... 35

2 Sheppard FRST 498

ABSTRACT

This experiment tested the survival, and aggression of the four different lineages of P. ramorum (NA1, NA2, EU1, EU2) on Douglas fir bolts. The average lesions size produced at 4 weeks was 7.47cm, at 8 weeks was 13.125cm and at 12 weeks was 6.18cm. There was no significant difference in aggression between the four lineages, but the EU2 lineage produced the largest lesions after 4 weeks with the most variability (8.375±1.99). Re-isolation of the pathogen was poor, with only 16% success after 4 weeks, 4% after 8 weeks and 0% after 12 weeks. Molecular techniques were better able to detect the pathogen, showing presence of the pathogen 9 weeks after exposure to air. This however does not indicate viability and further analysis needs to be done to confirm survival of the pathogen over time. Overall this experiment confirms the susceptibility of Douglas fir to all four lineages of P. ramorum, and indicates that there is potential for survival on logs.

Keywords: Phytophthora ramorum, Molecular diagnostics, Biosecurity, Douglas fir, Artificial Inoculation, Survival, Lineages

3 Sheppard FRST 498

LIST OF TABLES AND FIGURES

Tables

Table 1: List of P.ramorum isolates used for artificial inoculation ……………………..11

Table 2: Parameters for qPCr reactions …………………………………………………15

Table 3: Recipe for cocktail for qPCr mix, same volumes for both C64 and Ramflap …15

Table 4: Sequences of primer and probes used in the qPCr ……………...………….15/16

Table 5: One-way analysis of variance between the three different trees used, 2 Douglas fir species and 1 Japanese larch. …………………………………………………...……17

Table 6: A one-way analysis of variance between the two Douglas fir trees used……....17

Table 7: One-way analysis of variance between the 8 isolates, N=4 ………………..…..19

Table 8: one-way analysis of variance between the four lineages, EU1, EU2, NA1, NA2, N=8 for each lineage ………………………………………………………………….…21

Table 9: One-way analysis of variance between the nuclear assay and mitochondrial assay 4 weeks after re-isolation………………………………………………………….24

Table 10: One-way analysis of variance between the nuclear and mitochondrial assay 13 weeks after re-isolation …………………………………………………………………24

Figures

Figure 1: Average lesions length of all isolates on each bolt (N=8) ……………………17

Figure 2: Lesions on Douglas fir bolts from all four lineages 4 weeks after inoculations …………………………………………………………………………………………..18

Figure 3: Bolt D-2-2, 8 weeks after inoculations, 4 weeks after debarking treatment was applied, black tracings outline the lesions that were present when bark was removed. …………………………………………………………………………………………..19

Figure 4: Average lesions length of each isolate on Douglas fir 4 weeks after inoculations, with standard errors N=4…………………………………………………20

Figure 5: Average lesions length of each lineage on Douglas fir 4 weeks after inoculation, with standard errors N=8………………………………………………………………..21

4 Sheppard FRST 498

Figure 6: Number of successful re-isolations at each time period, from both treated and untreated bolts…………………………………………………………………………..22

Figure 7: Comparison between the detection methods for samples collected from bolts in first time period and then again from the same bolts 9 weeks later. Positive detection was determined by visual comparison for re-isolations and Ct values <38 for qPCR ……………………………………………………………………………………………23

5 Sheppard FRST 498

INTRODUCTION

Globalization and trade have facilitated the dispersal of many species. When introduced species disrupt ecosystem processes and have negative effects on economic activities they are viewed as invasive (Simberlof et al 2013). Pathogens and insects often end up in this invasive group because of their fast and plentiful reproduction, ability to evolve quickly, and sometimes generalist behaviours. Due to their small, sometimes microscopic, size they can easily go undetected and easily become introduced to new landscapes. The need for adequate biosecurity and understanding of the potential impacts of these pests is vital in maintaining ecosystems integrity and reducing economic losses.

Pythophthora ramorum is an aggressive plant pathogen with a wide host range and distribution, making it a serious threat as an invasive species. The pathogen was first described in 2001 by Werres et al, and was attributed as the cause of Sudden Oak Death by Rizzo et al (2002). The broad host range and various genetic lineages makes the pathogen unpredictable and of great concern. Recent discovery of a fourth lineage and its association with the Sudden Larch death demonstrate just how variable and adaptable this pathogen can be (Braiser and Webber 2010, Van Pouke et. al 2012).

The Phytophthora life cycle features two spore types chlamydospores and sporangia; the production of these spores is highly dependant on temperature, moisture and other environmental conditions (Duniway 1983). The chlamydospores are more

“hearty” structures that are able to remain viable for longer, these spores may be responsible for initiating epidemics but are not believed to be important in sustaining them (Widmer 2009). The sporangia are asexual propagules with special features that assist in spreading the disease (Erwin and Reberio 1996). The infection process occurs

6 Sheppard FRST 498 either directly or indirectly from the sporangia (Waterhouse 1983). To infect the host directly the sporangia emits a germ tube through the exit plug directly into the host cell.

At lower temperatures the sporangia infect indirectly by releasing single celled biflagellated zoospores (Hardam and Hyde 1997). Zoospores are unique structures of

Phytophthora that can “swim” through fluids, using chemical, electrical and physical recognition to detect their host (Tyler 2002). The sporangia of P. ramorum are cadeous, and can dissipate via wind or water (Judelson and Blanco 2005). Once sporangia are developed they are able to detach from hyphae, enabling the spores to drip through the canopy on rainwater or get caught up in turbulent air and then these swimming zoospores produced travel on the thin layer of water of leaf surfaces to the host (Hansen 2008).

Ristaino and Gumpertz (2000) demonstrated the ability of rain splash to move the pathogen up to a meter, showing how it can easily spread between species. Viable P. ramorum spores have been shown to travel in rainwater, streams, soils and through leaf litters, sometimes hitchhiking on the boots of hikers or tires (Davidson et al 2002,

Tjosvold et. al 2002).

Unlike most Phytophthora’s, which target their host through the roots, P. ramorum tends to infect its host through stems, leaves or needle tissues (Davidson et al

2003). P. ramorum causes two main disease symptoms, either cankers or foliar dieback.

Canker formation is associated with Sudden Oak Death and results in bleeding cankers on the host stem. By killing the phloem the pathogen girdles the tree, resulting in sever wilting of the canopy (Gruenwal et al. 2008). In the other form of disease the pathogen targets the leaves and twigs of its host resulting in shoot dieback or leaf spots that disrupt photosynthetic processes (Gruenwal et. al 2008).

7 Sheppard FRST 498

To date four genetically distinct lineages of P. ramorum have been discovered.

The lineages were named based on their primary locations of discovery and are believed to have genetically diverged after being separately introduced to these locations. The fourth lineage was only identified in 2011 and the oldest strain of this lineage is dated to

2007 (Van Pouke et al 2012). This newest lineage was determined to be the causal agent of Sudden Larch Death, which was the first case of lethal damage on both a conifer and plantation style stand by this pathogen (Webber et. al 2010). This outbreak highlighted the adaptive nature of the pathogen and the consequences of new lineages and introductions to new ecological landscapes.

The economic concern with P. ramorum has resulted from its devastating impacts on the Nursery industry as well as extreme outbreaks in Tan Oak (Lithocarpus densiflorus) stands and now the major losses to the Larch plantations. Due to its high frequency of infecting ornamental species such as Rohdodendrons, Camillia, Lilac

(Syringa vulgaris) and Mountain Laural (Kalmia latifolia) the pathogen has been primarily spread through the Nursery trade (Davidson et al, 2001, Tooley 2004). After the severe impacts from P. ramroum in Oregon, the USDA restricted movement of Nursery stock from Oregon, Washington and California to prevent spread to other states (Cave et. al 2008). In Canada the pathogen is under quarantine measures and nurseries are being continually monitored for introduction and spread. Nurseries testing positive for P. ramorum have had to undergo cost intensive measures for removal, in some cases devastating the operations (CFIA 2013).

The Canadian Food Inspection Agency (CFIA) has assessed the potential risk of

P. ramorum throughout Canada as low, and as medium in Southern British Columbia

8 Sheppard FRST 498

(CFIA 2013). However the government of British Columbia maintains that the risk of dispersal is moderate to high due to the generalist host behavior and suitable climate in areas of BC (Ministry of Agriculture, 2012). Since BC is so dependent on its Forest industry careful monitoring of this pathogen in forest ecosystems is very important.

Particularly as the lineages of this pathogen evolve to attack different hosts and travel between different ecological landscapes, the fear of P. ramorum attack in British

Columbia is ongoing.

As a precautionary measure it is important to know the sorts of effects P. ramorum will have on the timber products of British Columbia. Although there is not suitable evidence to fully support the notion that the pathogen can spread through wood products and timber the unknown behaviour of P. ramorum does not rule out this mode of transmission (Davidson et al 2001, Grunwald et al. 2012). Given that this is the case countries are highly alert about accepting product from P. ramorum infested areas, and should a P. ramorum outbreak occur it will not only have adverse effects on the landscape but on the timber trade as well.

To start a preliminary investigation into this issue, the survival of P. ramorum was tested on Douglas firs (Psedotsuga menziesii) taken from the Malcolm Knapp research forest, while Japanese larch (Larix kamperfi) also from this forest was used as a control comparison. Douglas Fir was chosen as the host species in this study because of its economic value and its wide distribution and availability. Recently Douglas firs have been naturally infected close to the Japanese Larch outbreaks. Since this is the EU2 lineage, which has yet to be tested on Douglas fir, the threat to Douglas fir may be higher than was once thought. (Braiser and Webber, 2010). Douglas fir has been considered to

9 Sheppard FRST 498 be a weak host because of the limited observation of infection in nature; only minimal shoot die back was reported in Sonoma, California, where primarily North American genotypes are observed in forests (Davidson et. al 2001a). Previous studies have produced successful lesions after artificial inoculation on Douglas fir bolts and live

Douglas fir trees but again only the North American genotypes are represented (Hansen et al 2005, Chastengar et. al 2010). Douglas firs were very susceptible to stem-wound inoculations, producing lesions of 6.5cm after 3 weeks (Hansen et. al 2005). The live stems had no lesions when inoculated in the summer, small lesions reaching 2cm after a year when inoculated in the fall and 6.4cm when inoculated in the winter (Chastengar et. al 2010). Seedlings and branches that were inoculated with three lineages (NA1, NA2,

EU1) showed susceptibility, with lesions 2.5cm after 8-11 days. This experiment tests all

4 lineages on bolts of Douglas fir.

The objective of this study is to use molecular techniques and re-isolation strategies to assess the survival of the pathogen over time, as well as examine the difference in aggression of the four lineages on Douglas firs, particularly the newest discovered EU2 lineage. The molecular techniques will validate primers designed by the

TAIGA campaign and provide a contrast between the re-isolation techniques. It is proposed that the pathogen will be re-isolated more readily from the bolts that do not receive the debarking treatment and that DNA will be present in both treated and untreated logs, and that the molecular assays will be more effective in detecting the presence of the pathogen.

10 Sheppard FRST 498

MATERIALS AND METHODS

Isolate preparation

Two isolates from each of the four lineages were chosen for the inoculation experiment. When possible isolates from different hosts and geographic regions were chosen (Table 1). All isolates were maintained on carrot agar and sub-cultured to fresh plates 2 weeks prior to the inoculations.

Table 1: List of P.ramorum isolates used for artificial inoculation Geographic Point Lineage Isolate origin Plant host Source Rhododendron A EU1 07_13013 Canada sp. KIS

B NA2 07_17204 BC, Canada Gauthlauria CBEL Northern Clive Braiser and Joan Webber, C EU2 P2460 Ireland Larix kampirfi Forest Commision UK D NA1 07_101 CA, USA Camellia C. Blomquist E NA2 04_015 WA, USA Rhododendron USDA Northern Rhododendron Clive Braiser and Joan Webber, F EU2 P2566 Ireland sp. Forest Commision UK Clive Braiser and Joan Webber, G EU1 P2599 UK Larix kampirfi Forest Commision UK H NA1 01_004 OR, USA Lithocarpus USDA I Control

Bolt Preparation

Two Douglas firs and one Japanese Larch (used as control) were freshly felled on

October 15th, 2014 from the Malcolm Knapp Research Forest in Maple Ridge, British

Columbia. Once divided the ends of the logs were labeled and then covered with black garbage bags and secured with PVC tape. The Douglas fir trees were labeled D-1 and D-2

11 Sheppard FRST 498 and the Japanese Larch was labeled L-1. Each tree was cut into three segments to be transported back to FP Innovation, Vancouver, BC.

Once at the research site the logs were cleaned with a wire brush to remove excess bark, moss and dirt. They were cut into approximately 0.5m segments, resulting in

6 bolts from each tree. The logs were washed in a 10% bleach solution and cleaned off with a hose. Epoxy was added to the ends of each segment to retain moisture throughout the experiment. The logs were left to dry over 4 days. After 4 days the logs were divided into treatment and time groupings and transferred to the quarantine room. Logs were labeled with species - tree number- time period -treatment, (e.g. D-1-1A), a schematic of the labeling can be seen in the Appendix. The logs were stored standing upright in plastic buckets until inoculations occurred.

Inoculation Methods

Using a hammer and cork borer a hole to the depth of the cambium was made in the bolt. Using a plastic plugger a 6mm diameter plug from the margin of a P. ramorum colony actively growing on carrot agar was placed in the wound. A drop of sterile water was placed on the agar plug before replacing the bark plug. The wound was then covered with cotton wool and a 5x5cm square of aluminum foil. PVC tape was used to secure the patch in place. All bolts were inoculated in the same way with each lineage represented by two isolates. This inoculations process is a slight adaptation from the methods of

Braiser and Kirk (2001).

Once the logs were inoculated they were covered in plastic tubing, the insides of bags were sprayed with sterile water and paper towel soaked in sterile water was added to the sleeve to retain moisture content. For the first 4 weeks of inoculation both ends of the

12 Sheppard FRST 498 plastic sleeve were sealed with tuck tape. Logs were stood up right in plastic buckets and left to incubate at room temperature in the quarantine room for 4 weeks, 8 weeks or 12 weeks.

Treatment

Only time periods 2 and 3 were given a debarking treatment. After 4 weeks half of the logs for the 8 and 12 weeks incubation times were given debarked using a chisel and knife to expose the cambium layer. The lesions were traced with a black sharpie.

These logs were placed in new plastic sleeves and return to standing upright in the buckets, the tops of the sleeves were left open. Bolts treated without debarking were labeled A and bolts with debarking were labeled B.

Lineage comparisons and re-isolation

At each time period, 4 weeks, 8 weeks and 12 weeks, a set of bolts was assessed.

For each inoculation point the surrounding wood was removed with chisels and a knife to expose the entire lesion. Only the lesions measured 4 weeks after the inoculations on the

Douglas fir were used to determine the average lesions length per isolates and lineages.

This was done to keep the host species consistent and to keep the time period for lesion growth the same. The length and width of each uncovered lesions was measured. The lesion lengths from time period 1 were used to detect differences between isolates and lineages. For isolates the sample size was N=4, and for lineages the sample size was N=8.

From each lesion we attempted to re-isolate the pathogen on Phythophthora selective media (PARP-CMA), points from around the lesion margin, and inside the lesion were samples. Each inoculation point was re-isolated 3-4 times on a single plate.

13 Sheppard FRST 498

The petri plates were stored in an incubator in the quarantine room at 20C for 3-5 days until growth appeared. Any Phytophthora like growth was sub cultured to a new PARP-

CMA plate and visually compared to a known P. ramorum sample for identification.

Molecular Assessment

At every time period tissue samples were collected from the same area that re- isolations were attempted and stored at -80 until processed. Every four weeks a new set of bolts was assess, and tissues samples were collected and stored in the same way.

DNA was extracted from samples taken from the first set of bolts, D-1-1A, D-1-

1B, D-2-1A, D-2-1B. The remaining samples were retained at -80C for future analysis.

Samples were taken from the lesions margins 4 weeks after inoculation and then again from these same lesion areas after they had been exposed for 9 weeks. DNA was extracted using the Qiagen Plant Mini kit (Qiagen Inc., Valencia, CA) following the manufacture’s protocols, but eluting with 50µL of sterile water instead of 100µL of

Buffer AE. The samples were amplified using qPCR, parameters and recipe are outlined in table 2 and 3. The qPCR was done using the C62 (TAIGA) assay, which codes a portion of the nuclear DNA and with the Ramflap assay, which codes for a portion of mitochondrial DNA, primer and probe details can be seen in Table 4. This test was done to determine the difference between DNA presence after lesion exposure by comparing the Ct values from the two collection dates. The Ct values were obtained from the

StepOne software v2.3 (Applied Biology Tech). A Ct value <38 was considered to be a positive read.

14 Sheppard FRST 498

One-way analyses of variances, generated by Excel (2013), were used to determine differences between the trees, isolates, lineages, and molecular diagnostics.

Table 2: Parameters for qPCr reactions

C64 Ramflap

Cycle Temperature Duration Temperature Duration

1 cycle 95 5 min 95 5 min

40 cycles 60 30 seconds 57 30 seconds

95 30 seconds 95 30 seconds

Table 3: Recipe for cocktail for qPCr mix, same volumes for both C64 and Ramflap Reagent Volume (µL) Concentration mastermix 5 frwd primer 0.4 10mM rvrs primer 0.4 10mM probe 2 10mM

DNA 2.2

TOTAL 10ul

Table 4 : Sequences of primer and probes used in the qPCr

C62: primers PHYC626F ACCATTGAGGAAGTGCRTTTRCACGG

PHYC626R AGAAAKTCGTTCCATATCCGCGGWGT

C62: probe Pram-C62-P CAAGGGGACCGGAACCGTAT

Ramflap Primers: Phyto_gen_Fflap AAT AAA TCA TAA CCT TCT TTA CAA

15 Sheppard FRST 498

CAA GAA TTA ATG AG AAT AAA TCA TAA TAT AGG TAA AAT Pram_Rflap TTG TAA TAA ATG TTG ACT

Ramflap Probes

ACGTTACGT/ZEN/CTAGACTTG Pram_nad9sp_1F

RESULTS

Lesions differences on bolts

The lesion lengths were variable across the different bolts, figure 1 shows the average lesion length for each bolt where measurements could be taken. The lesions on the Douglas fir were significantly larger than the lesions on the Japanese larch (p=0.02), as seen in table 5. Though not significantly different based on a one-way analysis of variance (p=0.109) the lesions on Douglas fir tree 2 were on average larger than the lesions on Douglas fir tree number 1 (table 6). A lesion from each lineage on bolt D-1-1 can be seen in figure 2. Bolts that were given the debarking treatment became oxidized and lesions were no longer distinguishable (figure 3), a black sharpie outlines the lesions that could be seen when the bark was removed.

The average lesions length on the Douglas firs after 4 weeks was 7.47cm (n=4), after 8 weeks it was 13.125(n=2) and after 12 weeks it was 6.18 (n=1). The bolt from the second Douglas fir tree after 12 weeks was almost completely covered with lesions and no measurements could be taken.

16 Sheppard FRST 498

Average lesions length (cm) 0

Bolts

Figure 1: Average lesions length of all isolates on each bolt, with standard error, (N=8)

Table 5: One-way analysis of variance between the lesions lengths on the three different trees used, 2 Douglas fir species and 1 Japanese larch.

ANOVA

Source of Variation SS df MS F P-value F crit

Between Trees 177.9806 2 88.99031 7.70952 0.021981 5.143253

Within Trees 69.25748 6 11.54291

Total 247.2381 8

Table 6: A one-way analysis of variance between the lesions lengths on the two Douglas fir trees used ANOVA

Source of Variation SS df MS F P-value F crit

Between Douglas 72.71461 1 72.71461 4.199806 0.109772 7.708647 firs

Within Douglas firs 69.25521 4 17.3138

Total 141.9698 5

17 Sheppard FRST 498

P2460_EU2 PR_07_101_NA2

PR-04_015_NA2 P2599_EU1

Figure 2: Lesions on Douglas fir bolts from all four lineages 4 weeks after inoculations

18 Sheppard FRST 498

Figure 3: Bolt D-2-2, 8 weeks after inoculations, 4 weeks after debarking treatment was applied, black tracings outline the lesions that were present when bark was removed.

Differences between isolates and lineages

The lesions lengths produced by individual isolates were not significantly different from one another based on a one-way analysis of variance (p=0.88) (table 7).

The average lesions length for each isolate can be seen in figure 4.

Table 7: One-way analysis of variance between the lesion lengths produce by the 8 isolates after 4 weeks of inoculation on Douglas fir, N=4

ANOVA

Source of SS df MS F P-value F crit Variation

19 Sheppard FRST 498

Between Groups 44.73219 7 6.390313 0.419607 0.880468 2.422629

Within Groups 365.5025 24 15.22927

Total 410.2347 31

14 12 10 8 6 4 2 Average lesion lnegth (cm) 0

Isolates

Figure 4: Average lesions length of each isolate on Douglas fir 4 weeks after inoculations, with standard errors, N=4.

When the isolates were pooled into lineages no significant difference (p=0.44) between the lesions lengths of the lineages emerged (table 8). The EU2 lineage had the largest average lesions length at 8.375cm (±1.99), and also has the most variability. The

NA1 was the smallest at 5.63cm (±0.92). Figure 5 shows the slight differences between the four lineages.

20 Sheppard FRST 498

Table 8: one-way analysis of variance between the lesion lengths produced by the four different lineages, (EU1, EU2, NA1, NA2), 4 weeks after inoculation on Douglas fir, N=8 for each lineage

ANOVA

Source of SS df MS F P-value F crit Variation

Between Lineages 37.40344 3 12.46781 0.936345 0.436228 2.946685

Within Lineages 372.8313 28 13.3154

Total 410.2347 31

2 Avergae lesion lenght (cm)

0 EU1 EU2 NA1 NA2 Lineages

Figure 5: Average lesions length of each lineage on Douglas fir 4 weeks after inoculation, with standard errors N=8.

Re-isolation

Four weeks after inoculations we were able to re-isolate a total of 8 lesions from all the bolts that were inoculated. . This resulted in a 16% re-isolation success rate, of these 4 were from the Japanese larch and 4 were from the Douglas fir. From the larch

21 Sheppard FRST 498 isolates EU1-07_13013, NA2-07_172014, NA1-07_101 and NA2-04_101 were successfully re-isolated, and from the Douglas fir 3 of the re-isolation were from tree #1, with NA-01_004, NA2-04_015, and EU2-P2460 successfully re-isolated. The fourth successful re-isolation on Douglas fir was from tree #2 and was isolate EU1-13013. Eight weeks after the inoculations only 2 lesions produced successful re-isolation, resulting in a

4% re-isolation success rate. Isolate NA1-07_101 was re-isolated from Douglas fir tree

#2 that was untreated, and the other was EU1-P2599 re-isolated from the Larch that was debarked. In the final assessment period, 12 weeks after inoculation, none of the re- isolations produced Phytophthora like growth. Figure 6 shows the decrease in successful re-isolation over time.

2 Total number re-isolated

0 Time 1 Time 2 Time 3

Figure 6: Number of successful re-isolations at each time period, from both treated and untreated bolts. Comparing diagnostic techniques

Molecular techniques proved to be more accurate in diagnosing the presence of the pathogen (figure 7). After 4 weeks the nuclear assay detected 100% presence, the

22 Sheppard FRST 498 mitochondrial assay detected 90% presence and the re-isolation detected only 25% presence. After 13 weeks the nuclear assays had 93% detection, the mitochondrial had

60% detection and the re-isolation had 0% detection. All of the Ct values from the samples collected after 13 weeks were higher than the Ct values collected after 4 weeks.

Between the two assays the mitochondrial assay was more sensitive (over-all lower Ct values) for the samples collected after 4 weeks (p=0.02983) but the nuclear assay was more sensitive for the samples collected after 13 weeks (p=0.000145), significant can be observed in the one-way ANOVAs in table 9 and 10. The appendix shows the lengths of the lesions associated with the different Ct values and which ones were successfully re- isolated. There is no clear pattern between the level of Ct value, length of lesion and ability to re-isolate.

1 0.9 Re-isolation 0.8 0.7 C62 - genomic sequences 0.6 Ramfpal - mitochondria 0.5 sequences 0.4

Percent detected 0.3 0.2 0.1 0 4 weeks 13 weeks Time after incoulation

23 Sheppard FRST 498

Table 9: One-way analysis of variance between the nuclear assay and mitochondrial assay 4 weeks after re-isolation from Douglas firs

Source of Variation SS df MS F P-value F crit Between Mitochondrial and Nuclear DNA 11.80661843 1 11.80661843 4.991141336 0.029802361 4.0266314 Within Mitochondrial and Nuclear DNA 123.0067667 52 2.365514745

Total 134.8133852 53

Table 10: One-way analysis of variance between the nuclear and mitochondrial assay, 13 weeks after re-isolation from Douglas firs.

Source of Variation SS df MS F P-value F crit Between Mitochondrial and Nuclear DNA 52.76343751 1 52.76343751 17.46968752 0.000144722 4.072653759 Within Mitochondrial and Nuclear DNA 126.8519756 42 3.020285134

Total 179.6154131 43

DISCUSSION

Susceptibility, lesion length and lineage aggression

The inoculations produced lesions on Douglas fir from all lineages, and the lesions appeared to be increasing in length, confirming that Douglas fir is a suitable host for the pathogen, and the EU2 lineage is a threat to Douglas fir. Inoculation experiment on seedlings and branches by Chastengar et. al (2013) that tested three lineages showed that the species was susceptible to NA1, NA2 and EU1, with an average lesion length of

2.5cm. Experiment on bolts showed an average lesion area of 12.7cm2 after 5 weeks,

24 Sheppard FRST 498 experiencing the smallest lesions when inoculations were done in the fall, and the largest when inoculations were done in January (Hansen et. al 2005). Given that our inoculations were done in the fall and were able to produce larger lesions than the Hansen experiment it suggest that Douglas fir is more susceptible to P. ramorum than previously thought, especially when considering all four lineages. It could be argued that the high frequency of infection is due to the direct wound inoculations. With the high potential for damage to trees during forest practices, wound entry is a valid possibility for the pathogen in a timber harvest setting. Knowing that the stems are susceptible further studies need to investigate the potential for airborne inoculums to infect wounded tree stems.

The fact that the Douglas fir was more susceptible than the Japanese larch in this study is concerning for British Columbia as it provides evidence that the threat of the

European lineages in high. This result could have been a result of the climatic conditions that these larches were grown under or an unintentional selection of resistant larches for the experiment. Generally Larch is more susceptible to P. ramorum than Douglas fir, both in artificial inoculations and in nature (Chastenger et al 2013, Braiser and Webber

2010).

Typically many isolates are needed to accurately describe differences in the aggressiveness of lineages and this small sample size is likely why the results were not significant. Although not significant the results did show trends that are consistent with the literature, which often shows that NA2 and EU1 isolates tend to be more aggressive than the NA1 isolates (Braiser et al 2006, Elliott et al. 2011). It has been noted that differences in aggressiveness between both isolates and lineages is more prominent in

25 Sheppard FRST 498 trials that use foliage rather than wood tissues, which also explains the non-significance in the results (Elliott et al 2011).

Although more isolates would need to be incorporated for a firm result this study shows that there is variation in aggression between the lineages on Douglas fir. The EU2 genotype has been shown to be more significantly aggressive on Larch than EU1 isolates, but this had not been previously observed for other tree species (Webber 2014). In this experiment the EU2 though not significantly more aggressive was more aggressive on the

Douglas fir than the EU1. This is particularly important because to date all lineages have been identified in British Columbia, except for EU2 (Goss et al 2011). Since EU2 had the highest aggression with the largest variation it is important to retain quarantine measures against this pathogen because although the current threat is deemed to be low, this newer lineage could pose a more significant problem.

Re-isolation and pathogen survival

This limited re-isolation is likely due to the pathogens growth on woody tissues, it does not produce sporangia or other reproductive structures as frequently on this type of surface (Grünwald et. al 2012). Chastenger at. al (2010) had similar issues with re- isolation when attempting to re-isolate the pathogen from inoculations on living stems of

Douglas Fir, and were only able to re-isolate 1.4% from 1 780 inoculations. In other studies no spores were observed on the bark cankers of oaks, and when re-isolation was attempted from bleeding sap in which sporangia were observed no colonies formed

(Rizzo et al. 2002). It is important to be aware of the fact that these are all re-isolations from the phloem tissues and research has shown that the pathogen can be recovered from xylem tissues, and have even been re-isolated at higher frequency from xylem than

26 Sheppard FRST 498 overlaying phloem tissues (Brown and Braiser 2007). The physiological aspects such as spore development, colonization and physiological characteristics still need to be explored in order to determine if the pathogen can cause introductions by surviving in the xylem tissues. So far oaks have been considered to be a dead-end host, and this experiment suggests that Douglas firs could be a dead-end hosts as well (Kasuga et al.

2012). This poor re-isolation from peripheral woody tissues and dead-end status could mean that lesions on stems and bolts pose less of a threat for pathogen spread than infected foliage or pathogen persistence in soils (Grünwald et al 2012).

Due to this limited re-isolation of the pathogen no conclusions could be made about the difference between the control logs and the treated debarked logs. This could suggest that the lack of re-isolation from either treatment means de-barking treatments would not be a cost effective measure for preventing the transmission of P. ramorum should timber be a source of introduction. Leaving the logs to dry for a few months could be sufficient in preventing the spread of the pathogen, as survival tends to be poor on abscised tissues and under warmer, drier conditions (Davidson et al 2002b, 2003, Tooley et al. 2008). Especially since in this experiment the ends of the logs were sealed to retain moisture, if the ends were not sealed it could lead to a more inhospitable environment.

Though others have recommended that complete removal of bark, phloem and 3cm of sapwood are required for absolute removal of the pathogen for biosecurity measures

(Brown and Braiser 2007). Due to these rare cases of re-isolation and existence in xylem tissues that quarantine efforts on P. ramorum spread through woody tissues should remain vigilant. Especially since other studies have been able to re-isolate the pathogen from woody tissues 6 months after air drying (Shelly et al 2005). Even a heat treatment at

27 Sheppard FRST 498

56 degrees for thirty minutes, as a phytosanitary measure may not be adequate, as observed by Tubajika et. al (2007).

Even if the pathogen is surviving deeper in the tissues on timber products would this result in a threat to the spread of the pathogen? This elicits the question of whether or not the hyphae is able to grow between logs when stacked in a pile, and if timber products act as a source of introduction. Further investigation should be done as to the threat of spread between sitting logs after being felled, during transportation and while waiting to be processed.

Molecular detection and pathogen survival

Since re-isolation is difficult from woody tissues, molecular analysis is a better way to detect pathogen presence and potentially survival. Even though re-isolations did not show pathogen presence the qPCR showed that the pathogen was present in the tissues even after being exposed to air for 9 weeks. This is the first time that the TAIGA assays have been used to detect the presence of P. ramorum from woody tissues. The increasing Ct values suggest that the pathogen is diminishing over time and further supports the notion that P. ramorum does not thrive on woody tissues, but it is present and could potentially be surviving. The result of a better detection from the nuclear assays after 13 weeks is unexpected, as mitochondrial assays are believed to be more sensitive (Tooley et al 2006). This result would be due to less stable mitochondrial DNA once the pathogens cells have died. The shortcoming of DNA diagnostic is that it is only able to detect the presence of the pathogen and cannot test for viability. The next steps are to test for viability using mRNA and qPCR to show levels of gene expression. compared to DNA content, and see if this provides a better indication of whether of not

28 Sheppard FRST 498 the pathogen is surviving and viable. Or tissues collected at the 8 and 12 week periods could be analyzed for DNA content – with the lesions getting larger DNA presence at the edge of lesions would indicate survival. Unfortunately there was not enough time during this study to process these extra samples and add them to the results.

CONCLUSION

Douglas fir is a more suitable host for P. ramorum than previously thought. If the pathogen were to be introduced into forest stands in British Columbia, particularly the

EU2 lineage, devastating economic and environmental impacts could occur. Quarantine measures should remain high against introductions, particularly from Europe, but also from the US. Though the threat of the pathogen is high should an introduction occur because the pathogen is not content on woody tissues appropriate phytosanitary measures post harvesting could prevent economic loss from timber exports. To detect pathogen’s presence the molecular diagnostics are more useful, but better methods using a molecular approach need to be established to confirm pathogen viability.

ACKNOWLEDGEMENTS

I would like to thank Richard Hamelin for supervising this project, Angela Dale for her input and advice throughout it, Adnan Uzunovic for his assistance with the design and logistics, Malcom Knapp research forest for supplying the logs, Daniel Wong for helping get the logs, FP Innovations for supplying the resources and space necessary to carry out the project, Padimini Herath and Sandra Cervantes for their assistance with the qPCR work and lastly my family and friends for their support throughout the project.

29 Sheppard FRST 498

LITERATURE CITED

Brasier, C. and S. Kirk. 2001. Comparative aggressiveness of standard and variant hybrid alder phytophthoras, Phytophthora cambivora and other Phytophthora species on bark of Alnus, Quercus and other woody hosts. Plant Pathology 50: 218-229.

Brasier, C., S. Kirk, and J. Rose. 2006. Differences in phenotypic stability and adaptive variation between the main European and American lineages of Phytophthora ramorum. Proceedings of the Third International IUFRO Working Party (S07. 02.09) Meeting: Progress in Research on Phytophthora Diseases of Forest Trees.

Brasier, C., and J. Webber. 2010. Plant pathology: sudden larch death. Nature 466: 824- 825.

Brown, A., and C. Brasier. 2007. Colonization of tree xylem by Phytophthora ramorum, P. kernoviae and other Phytophthora species. Plant Pathology 56: 227-241.

Cave, G., B., Randall-Schadel, and S.,Redlind. 2008. Risk Analysis for Phytophthora ramorum Werres, de Cock & Man in't Veld, Causal Agent of Sudden Oak Death, Ramorum Leaf Blight, and Ramorum Dieback. USDA – Plant Protection and Quaratine. Available at http://www.aphis.usda.gov/plant_health/plant_pest_info/pram/downloads/pdf_files/pra- cphst-08.pdf.

Chastagner, G., K. Riley, and M. Elliott. 2013. Susceptibility of larch, hemlock, Sitka spruce, and Douglas-fir to Phytophthora ramorum. Proceedings of the Sudden Oak Death Fifth Science Symposium, US Department of Agriculture, Forest Service, Pacific Southwest Research Station, Albany, CA : 77-79.

Chastagner, G., K., Riley, K., Coats, M., Elliott, A., DeBauw, and N., Dart. 2010. Symptoms associated with inoculation of stems on living Douglas-fir and Grand Fir Trees with Phytophthora ramorum. Proceedings of the Sudden Oak Death Fourth Science Symposium. Gen. Tech. Rep. PSW-GTR-229. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 85-86.

CFIA. 2013. Phytosanitary Requirements to Prevent the Entry and Spread of Phytophthora ramorum. Available from http://www.inspection.gc.ca/plants/plant- protection/directives/horticulture/d-01-01/eng/1323825108375/1323825214385.

Davidson, J. M., Garbelotto, M., Koike, S. T., & Rizzo, D. M. 2002a. First report of Phytophthora ramorum on Douglas-fir in California. Plant Disease 86: 1274-1274.

Davidson, J., D., Rizzo, M., Garbelotto, S., Tjosvold, and G., Slaughter. 2002b. Phytophthora ramorum and sudden oak death in California: II. Transmission and survival. . Proceedings of the fifth symposium on oak woodlands: oaks in California's

30 Sheppard FRST 498 changing landscape. Gen. Tech. Rep. PSW-GTR-184, Albany, CA: US Department of Agriculture, Forest Service, Pacific Southwest Research Station : 741-749.

Davidson, J., S., Werres, M., Garbelotto, E., Hansen and D., Rizzo. 2003. Sudden oak death and associated diseases caused by Phytophthora ramorum. Online. Plant Health Progress doi:10.1094/PHP-2003-0707-01-DG.

Duniway, J. M. 1983. Role of physical factors in the development of Phytophthora diseases. In: Erwin, D.C.; Bartnicki-Garci, S.; Tsao, P.H., editors. Phytophthora: its biology, taxonomy, ecology and pathology. St. Paul, MN: The American Phytopathological Society: 175-188.

Elliott, M., G., Sumampong, A., Varga, S., Shamoun, D., James, S., Masri, and N., Grünwald. 2011. Phenotypic differences among three clonal lineages of Phytophthora ramorum. Forest Pathology, 41(1), 7-14.

Erwin, D., and O., Rebeiro. 1996. Phytophthora Diseases Worldwide. American Phy- topathological Society, St. Paul, MN.

Goss, E., M., Larsen, A., Vercauteren, S., Werres, K., Heungens, and N., Grünwald. 2011. Phytophthora ramorum in Canada: evidence for migration within North America and from Europe. Phytopathology 101:166-171.

Grünwald, N., M.,Garbelotto, E., Goss, K., Heungens, and S., Prospero. 2012. Emergence of the sudden oak death pathogen Phytophthora ramorum.Trends in microbiology 20: 131-138.

Grunwald, N., E., Goss, and C., Press. 2008. Phytophthora ramorum: a pathogen with a remarkably wide host range causing sudden oak death on oaks and ramorum blight on woody ornamentals. Molecular Plant Pathology 9 : 729-740.

Hansen, E. M., J. L. Parke, and W. Sutton. 2005. Susceptibility of Oregon forest trees and shrubs to Phytophthora ramorum: a comparison of artificial inoculation and natural infection. Plant Disease 89: 63-70.

Hansen, E. 2008. Alien forest pathogens: Phytophthora species are changing world forests. Boreal environment research 13.

Hardham, A., and G., Hyde. 1997. Asexual sporulation in the Oomycetes. Advanced Botanical Research 24: 353-398.

Judelson, H., and F., Blanco. 2005. The spores of Phytophthora: Weapons of the plant destroyer. Natural Reviews Microbiology 3 :47-58.

Kasuga, T., M., Kozanitas, M, Bui, D., Hüberli, D., Rizzo, and M., Garbelotto, M. 2012. Phenotypic diversification is associated with host-induced transposon derepression in the sudden oak death pathogen Phytophthora ramorum. PLoS One 7: e34728.

31 Sheppard FRST 498

Ministry of Agriculture. 2012. Ramorum blight and dieback (Sudden Oak Death). Available at http://www.agf.gov.bc.ca/cropprot/sod.htm.

Ristaino, J., M., Gumpertz. 2000. New frontiers in the study of dispersal and spatial analysis of epidemics caused by species in the genus Phytophthora. Annual Review of Phytopathology 38: 541-76.

Rizzo, D., et al. 2002. Phytophthora ramorum and sudden oak death in California: I. Host relationships. 5th Symposium on California Oak Woodlands, San Diego, CA.

Simberloff, D., J., Martin, P., Genovesi, V.,Maris, D., Wardle, J., Aronson, and M., Vila. 2013. Impacts of biological invasions: what's what and the way forward. Trends in Ecology & Evolution, 28: 58-66.

Shelly, J., R., Singh, C., Langford, and T., Mason. 2005. Evaluating the survival of Phytophthora ramorum in firewood. Proceedings of the Sudden Oak Death Second Science Symposium, Monterey, California:18-21.

Tjosvold, S., D., Chambers, J. ,Davidson, and D., Rizzo. 2002. Incidence of Phytophthora ramorum inoculum found in soil collected from a hiking trail and hikers’ shoes in a California park. InProceedings of Sudden Oak Death, A Science Symposium, USDA Forest Service and University of California, Berkeley: 53.

Tooley, P., M., Browning, and D., Berner. 2008. Recovery of Phytophthora ramorum following exposure to temperature extremes. Plant Disease 92: 431-437.

Tooley, P., F., Martin, M., Carras, and R., Frederick. 2006. Real-time fluorescent polymerase chain reaction detection of Phytophthora ramorum and Phytophthora pseudosyringae using mitochondrial gene regions. Phytopathology, 96: 336-345.

Tooley, P., K.,Kyde, and L., Englander. 2004. Susceptibility of selected ericaceous ornamental host species to Phytophthora ramorum. Plant Disease 88: 993-999.

Tubajika, K., R., Singh, and J., Shelly. 2007. Preliminary observations of heat treatment to control Phytophthora ramorum in infected wood species. General Technical Report PSW-GTR-214, Proceedings of the Sudden Oak Death Third Science Symposium, SJ Frankel, JT Kliejunas, and KM Palmeri (Eds): 477-480.

Tyler, Brett M. 2012. Molecular basis of recognition between Phytophthora pathogens and their hosts. Annual review of phytopathology 40: 137-167.

Waterhouse, G. M., et al. 1983. Phytophthora: Its Biology, Taxonomy, Ecology, and Pathology. St. Paul, MN: The American Phytopathological Society.

Webber, J. F., M., Mullett, and C.,Brasier. 2010. Dieback and mortality of plantation Japanese larch (Larix kaempferi) associated with infection by Phytophthora ramorum. New Disease Reports 22: 2044-0588.

32 Sheppard FRST 498

Webber, J., J.,Turner, G., Thorpe and A., McCracken. 2014. Difference between genotype of phytophtora ramorum in the UK in relation to risk and disease management. Forest Research – FFG-1141 End of Project Review.

Werres S., R., Marwitz, W., Man In’t Veld, A., De Cock. P., Bonants, M., De Weerdt, K., Themann, E., Ilieva and R., Baayen. 2001. Phytophthora ramorum sp. nov., a new pathogen on Rhododendron and Vibur- num. Mycological Research 105: 1155–1165.

Widmer, T. L. 2009. Infective potential of sporangia and zoospores of Phytophthora ramorum. Plant Disease 93: 30-35.

33 Sheppard FRST 498

APPENDIX A Bolt labeling schematic, Time period 1=4 weeks, Time period 2=8 weeks, Time period 3=13 weeks. No treatment was applied to the bolts in time period 1. Species Time Period Tree Number Bolt label Treatment

Douglas fir 1 1 A

Douglas fir 1 2 A

Douglas fir 1 1 B

Douglas fir 1 2 B

Larch 1 1 A

Larch 1 1 B

Douglas fir 2 1 A

Douglas fir 2 2 A

Douglas fir 2 1 B de-barked

Douflas fir 2 2 B de-barked

Larch 2 1 A

Larch 2 1 B de-barked

Douglas fir 3 1 A

Douglas fir 3 2 A

Douglas fir 3 1 B de-barked

Douglas fir 3 2 B de-barked

Larch 3 1 A

Larch 3 1 B de-barked

34 Sheppard FRST 498

APPENDIX B Comparison of detection methods and lesion sizes lesions size re-isolated SAMPLE Target DNA 4 weeks 13 weeks after 4 weeks after 4 weeks D-1-1A A nuclear 29.62735176 32.65362167 D-1-1A A mitochondrial 27.35899353 34.91521454 9.5 D-1-1A B nuclear 30.97905922 35.9416275 D-1-1A B mitochondrial 29.536726 36.32749176 6 D-1-1A C nuclear 30.55607033 33.6722641 D-1-1A C mitochondrial 28.95277214 33.33494568 1.5 D-1-1A D nuclear 31.42880821 32.31099319 D-1-1A D mitochondrial 29.8719902 31.42182159 3.4 D-1-1A E nuclear 30.04382324 33.98315811 D-1-1A E mitochondrial 28.63500977 34.95283127 6.5 D-1-1A F nuclear 30.03076553 33.06758118 D-1-1A F mitochondrial 27.74583054 35.11688614 5.5 D-1-1A G nuclear 29.93933296 33.15988541 D-1-1A G mitochondrial 29.51709557 33.65713882 9 D-1-1A H nuclear 30.40273666 Undetermined D-1-1A H mitochondrial Undetermined Undetermined 9 D-1-1A I nuclear Undetermined 38.18780899 D-1-1A I mitochondrial Undetermined Undetermined 0 D-1-1B A nuclear 29.30105019 33.0749321 D-1-1B A mitochondrial 28.17264557 34.87374878 4 D-1-1B B nuclear 31.95228386 33.86322403 D-1-1B B mitochondrial 30.00317383 Undetermined 9.5 D-1-1B C nuclear 28.77109337 31.86958122 Y D-1-1B C mitochondrial 26.7716465 33.30525208 7 D-1-1B D nuclear 37.73025513 35.96350098 D-1-1B D mitochondrial Undetermined 39.12301254 0 D-1-1B E nuclear 30.4991951 Undetermined Y D-1-1B E mitochondrial 30.89421463 Undetermined 2.2 D-1-1B F nuclear 29.88785934 31.83977699 D-1-1B F mitochondrial 27.4461422 33.81681061 4.5 D-1-1B G nuclear 29.70599365 31.58772087 D-1-1B G mitochondrial 30.53185272 33.3337822 6.5 D-1-1B H nuclear 31.23508453 37.86412048 Y D-1-1B H mitochondrial 30.35535431 Undetermined 3 D-1-1B I nuclear Undetermined Undetermined D-1-1B I mitochondrial Undetermined Undetermined 0 D-2-1A A nuclear 30.68962669 33.19896698 D-2-1A A mitochondrial 29.70134926 37.00997543 8.5 D-2-1A B nuclear 31.07216644 34.99758148 D-2-1A B mitochondrial 29.17305946 38.700634 9.8 D-2-1A C nuclear lost 33.83825684 D-2-1A C mitochondrial lost 37.00133133 13 D-2-1A D nuclear 29.9315033 35.79525757 D-2-1A D mitochondrial 28.34614944 Undetermined 7 D-2-1A E nuclear 31.68747711 34.4275856 D-2-1A E mitochondrial Undetermined 38.54652786 11 D-2-1A F nuclear 27.92075348 34.13912582 14

35 Sheppard FRST 498

D-2-1A F mitochondrial 26.65256882 35.62939453 D-2-1A G nuclear 30.84216309 36.94638824 D-2-1A G mitochondrial 29.52589798 Undetermined 8.5 D-2-1A H nuclear 29.38135529 33.89174652 Y D-2-1A H mitochondrial 27.57706833 Undetermined 6.5 D-2-1A I nuclear Undetermined Undetermined D-2-1A I mitochondrial Undetermined Undetermined 0 D-2-1B A nuclear 28.96639442 33.22696686 D-2-1B A mitochondrial 27.70726776 38.04035568 6 D-2-1B B nuclear 31.57741165 33.74175644 D-2-1B B mitochondrial 31.13216019 36.84934235 13.4 D-2-1B C nuclear 29.22382164 34.99271393 D-2-1B C mitochondrial 28.55009079 37.38440323 13.5 D-2-1B D nuclear 30.98299026 38.30038834 D-2-1B D mitochondrial 30.86386108 Undetermined 9 D-2-1B E nuclear 30.6425705 34.17884445 D-2-1B E mitochondrial 29.47127151 36.95651245 8.5 D-2-1B F nuclear 30.72405052 34.61813354 D-2-1B F mitochondrial 32.19281006 38.37005615 12.5 D-2-1B G nuclear 32.01481628 33.74942017 D-2-1B G mitochondrial 35.99049377 Undetermined 7.5 D-2-1B H nuclear n/a 33.40451431 D-2-1B H mitochondrial 31.43633461 36.25910568 3.5

D-2-1B I nuclear 38.27518845 Undetermined contamination? D-2-1B I mitochondrial Undetermined Undetermined 6.5 negative control nuclear Undetermined Undetermined negative control mitochondrial Undetermined Undetermined positive control nuclear 23.7893219 positive control mitochondrial 21.86700058