The Role of LC and FAS in Regulating Floral Meristem and Fruit Locule Number in Tomato

The role of LC and FAS in regulating floral meristem and fruit locule number in tomato

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the

Graduate School of The Ohio State University

Yi-Hsuan Chu, B.S. Graduate Program in Horticulture and Crop Science

The Ohio State University

2017

Dissertation Committee

Dr. Jyan-Chyun Jang, Dr. Esther van der Knaap, Advisor

Dr. Anna Dobritsa

Dr. David Mackey

Dr. Leah McHale

Copyrighted by

Yi-Hsuan Chu

2017

Abstract

In tomato, lc and fas control the variation between the small and bilocular fruits from the wild ancestor (S. pimpinellifolium) and large fruit cultivars (S. lycopersicum var. lycopersicum) with up to ten locules. SlWUS and SlCLV3 are the candidates of lc and fas, respectively. The regulatory balance between these two genes plays a pivotal role in meristem maintenance in Arabidopsis. However, the genetic and molecular mechanisms of SlWUS and SlCLV3 have not been functionally characterized in tomato. Here, we performed a detailed phenotypic analysis of the reproductive organs in tomato near-isogenic lines. The results showed that lc and fas synergistically controlled floral organ and locule number. In addition, results from targeted RNA interference (RNAi) and transgenic complementation of fas clearly demonstrated that SlCLV3 was the gene underlying fas. By using mRNA in situ hybridization and transcriptome profiling, we observed temporal and spatial changes in the expression patterns of these two genes during floral development. Our results indicated that lc was a gain-of-function mutation of SlWUS while fas was a loss-of-function mutation of SlCLV3. We also conducted transcriptome analyses to capture differentially expressed genes (DEGs) responding to single and double mutations of lc and fas across vegetative/reproductive meristems and young flower buds. We adopted a recently developed 3’ Tag RNA-seq method for RNA-seq library preparation and compared its performance with the standard whole mRNA-seq method. Gene Ontology analysis over the DEGs showed enriched functionalities related to meristem/floral development and organ patterning. In addition, co- expression analysis revealed that microtubule motor activity and sterol/brassinosteroids biology might underlie differences between wild and fasciated tomato. In summary, the findings on tomato locule number and meristem control in this dissertation have provided new insights into the mechanisms in tomato fruit development.

Dedication

This dedication is dedicated to my beloved family, my father Chao-Liang Chu, my mother Hui- Chun Sun, my husband Chao-Min Huang and son Morris.

iii

Acknowledgments

I would first like to express my sincere gratitude toward my advisor, Esther van der Kannp, for the tremendous help, advices, encouragement and kind supports along the journey of my doctoral studies. Her passion and curiosity made the lab a wonderful place for scientific discussion and learning, which was always a tremendous source of energy for me. My sincere thanks are extended to my advisor, Dr. JC Jang, for always providing valuable suggestions on my project, improving my presentation and writing skills, accepting me to his lab, and helping me in so many aspects. Without the help from my two talented mentors, this work could never be possible. I am also grateful to my committee members, Dr. Anna Dobritsa, Dr. David Mackey and Dr. Leah McHale for providing valuable comments and supports on my research as well as in all my exams. My appreciation also goes to Dr. Zachary Lippman for offering in situ probes and cooperating in the publication; Dr. Thomas Juenger for offering me the RNA-seq library protocol and primers. I also want to thanks all my lab members and other lab colleagues for numerous help in the lab and also the kind friendship. In particular, I would like to thank Dr. Zejun Huang for collaboration on this project. Thanks also go to Jason Van Houten for offering help in the RNA-seq library preparation, Dr. Shan Wu for teaching me the in situ and CRISPR techniques, Dr. Ying Wang and Dr. Hai- Dong Yu for assistant with RNA-seq materials, Jian Wu for helping with Microtome sectioning, and Dr. Rui Wang for teaching me staining tissues. I also want to acknowledge all my special lab mates, Qi Mu, Dr. Shan Wu, Dr. Liang Sun, Dr. Yangping Wang, Dr. Manohar Chakrabarti, Dr. Hyun Jung Kim, Dr. Eudald Illa, Dr. Neda Keyhaninejad, Dr. Xiaoxi Liu and Nathan Taitano for the friendship, stimulus discussions and helping inside and outside the lab. I am also grateful for Meghan Fisher, Jiheun Cho and Brenda Sanchez Montejo for taking care of my plants. Thanks also go to CCBL members, Fabio Gomez cano, Wilberforce Ouma and Eric Mukundi for providing valuable suggestions in data analysis. I feel extremely fortunate to have worked with these kind and intelligent people. Finally, I want to thank my beloved parents for the endless support, sacrifices throughout my life. Thank you both for giving me strength to chase my dream. Thanks to my husband, Chao-Min for being the best father and husband. Thanks to my son, Morris, who is always the source of happiness. My appreciation to them is more than I can expressed here. Without their support, sacrifice and love, this work would not have been possible. iv

Vita

2011……………………………….B.S. Agronomy, National Taiwan University, Taipei, Taiwan 2012 to present……………...... Graduate Research Associate, Department of Horticulture and Crop Science, The Ohio State University 2016 and 2017 Spring ………………..…………….Graduate Teaching Associate, Department of Horticulture and Crop Science, The Ohio State University

Publications van der Knaap E, Chakrabarti M, Chu YH, Clevenger JP, Illa-Berenguer E, Huang Z, Keyhaninejad N, Mu Q, Sun L, Wang Y, and Wu S. 2014. What lies beyond the eye: The molecular mechanisms regulating tomato fruit weight and shape. Front Plant Sci 5:227.

Xu C, Liberatore KL, MacAlister CA, Huang Z, Chu YH, Jiang K, Brooks C, Ogawa-Ohnishi M, Xiong G, Pauly M, Van Eck J. A cascade of arabinosyltransferases controls shoot meristem size in tomato. Nature Genetics. 2015 Jul 1;47(7):784-92.

Fields of Study

Major Field: Horticulture and Crop Science

Table of Contents

Abstract ...... ii

Dedication ...... iii

Acknowledgments ...... iv

Vita ...... v

Table of Contents ...... vi

List of Tables ...... viii

List of Figures ...... ix

Chapter 1. Introduction - The evolution of large cultivated tomatoes from tiny wild relatives ..... 1

Chapter 2. The control of tomato locule number and fruit weight by natural mutant alleles of lc and fas in wild type tomato ...... 16

Abstract ...... 16

Introduction ...... 17

Materials and Methods ...... 19

Results ...... 26

Discussion ...... 31

Chapter 3. Transcriptome analysis of lc and fas controlling tomato fruit development ...... 59

Abstract ...... 59

Introduction ...... 60

Materials and Methods ...... 63

Results ...... 66

Discussion ...... 73

Bibliography ...... 98

Appendix A. Transgene copy number is determined by Southern blot ...... 111

Appendix B. Expression of tomato CLE small peptide gene family in floral and inflorescence meristems from whole mRNA-seq analyses ...... 113

Appendix C. Information of RNA-seq reads mapped to SlYABBY2b genomic region in wild type and fas NILs using IGV viewer ...... 114

Appendix D. Overlapping DEGs between whole mRNA-seq and 3’ Tag seq ...... 115

Appendix E. DEGs overlapping with Arabidopsis WUS inducible system ...... 118

Appendix F. RPM of 675 DEGs identified between WT, lc, fas, lc/fas in 3’ Tag RNA-seq ..... 121

vii

List of Tables

Table 2.1 Markers used for the selection of the lc and fas NILs...... 50 Table 2.2 Markers used to genotype transgenic plants carrying wide type long-promoter SlCLV3 allele...... 51 Table 2.3 Summary of 3’ Tag RNA-seq alignment statistics ...... 52 Table 2.4 Complementation test of pHC2, pHC4 on locule number...... 54 Table 2.5 Comparisons of inflorescence branching, floral organ and locule number among genotypic classes...... 55 Table 2.6 Comparisons of fruit perimeter, area and weight between wild type, lc, fas and lc/fas NILs...... 56 Table 2.7 Effects and interactions of lc and fas on the traits of mature fruits...... 57 Table 2.8 Degree of dominance of lc and fas mutant alleles in LA1589 background...... 58 Table 3.1 Mapping statistics of RNA-seq results...... 96 Table 3.2 Enriched GO terms in each co-expressed gene cluster...... 97

viii

List of Figures

Figure 1.1 Domestication lineage of different tomato accessions from wild type to cultivated tomato...... 12 Figure 1.2 Schematic diagram of tomato fruit development...... 13 Figure 1.3 CLV3-WUS Feedback regulatory loop in Arabidopsis...... 14 Figure 1.4 Phenotypes associated with CLV signaling mutants in different species show conservations in the control of meristem size, floral organ number and fruit size...... 15 Figure 2.1 Floral meristem regulatory mechanism and the phenotype of clv3, wus and ag mutants...... 35 Figure 2.2 Schematic representation of the introgressing of lc and fas mutant alleles into wild type background...... 36 Figure 2.3 Representation of the introgressions at LC and FAS loci in lc, fas, and lc/fas NILs... 37 Figure 2.4 Complementation constructs used in this study...... 38 Figure 2.5 Schematic representation of the RNAi construct used to knock down SlCLV3 expression...... 39 Figure 2.6 The arm sequence in RNAi construct only targets SlCLV3...... 40 Figure 2.7 The natural lc and fas mutant alleles lead to increased floral organs and branched inflorescences...... 41 Figure 2.8 Phenotypic analysis of SlCLV3 RNAi plant...... 43 Figure 2.9 Floral meristem enlargement and fasciated inflorescences caused by lc and fas...... 44 Figure 2.10 Expression analysis of SlCLV3, SlWUS, SlYABBY2 and TAG1 in floral buds among NILs at five developmental stages ...... 45 Figure 2.11 Comparisons of SlCLV3 and SlWUS mRNA expression between RNAi-SlCLV3 and wild type plants...... 46 Figure 2.12 SlCLV3 expression is much lower in fas and lc/fas NILs in floral buds at 3 dpi compared to wild type...... 47 Figure 2.13 SlWUS expression domain is expanded in all NILs and RNAi lines at 2 to 3 dpi floral buds comparing to wild type...... 48 Figure 2.14 in situ hybridization to detect TAG1 signal...... 49 ix

Figure 3.1 The trend of recent plant research using RNA-seq technology...... 79 Figure 3.2 Workflow of the 3’ Tag RNA-seq and standard strand-specific whole mRNA-seq. .. 80 Figure 3.3 Comparison of the sequence quality between whole mRNA-seq and 3’ Tag RNA-seq...... 81 Figure 3.4 Comparisons of the transcript coverage, Pearson correlation coefficient (PCC), and reproducibility between 3’Tag RNA-seq and whole mRNA-seq...... 82 Figure 3.5 Impact of the two RNA-seq methods on data analysis...... 83 Figure 3.6 Differentially expressed genes identified between the two RNA-seq methods...... 85 Figure 3.7 Pipeline for RNA-seq data analysis...... 86 Figure 3.8 Expression profiles of the co-expressed clusters...... 87 Figure 3.9 Simplified plant sterol and BR biosynthesis pathway...... 89 Figure 3.10 Phylogenetic tree of kinesin genes from Arabidopsis, tomato, C. elegans, human and Drosophila...... 90 Figure 3.11 DEGs with significant genotype×developmental stage interaction effects...... 91 Figure 3.12 Identified DEGs involved in auxin and cytokinin metabolism, transport, and response...... 92 Figure 3.13 Common and unique DEGs in lc, fas, and lc/fas...... 93 Figure 3.14 Expression profiles of differentially expressed transcription factors shared in lc, fas, and lc/fas...... 94 Figure 3.15 Expression profiles of differentially expressed transcription factors shared by fas and lc/fas...... 95

Chapter 1. Introduction - The evolution of large cultivated tomatoes from tiny wild relatives

Tomato ranked as the fifth most valuable crops worldwide based on economic value and yield in 2012 from the Food and Agriculture Organization (FAO). The making of tomato fruits with diverse color, shape and size is a consequence of intimate interactions between human and plants in the past 10,000 years. In cultivated plants, edible organs usually have larger size (although may have less number in total) compared to their wild relatives. The maize ear contains up to 100-fold more kernels than the teosinte (Doebley, 2004). Cultivated tomatoes can grow 1,000 times larger than the wild type (Lippman and Tanksley, 2001). Studying the genetic and molecular mechanisms underlying fruit development, ripening and metabolism have long been important tasks in improving fruit yield and quality. The extreme diversity in fruit shape, size and color makes tomato an ideal model for studying fruit development. In addition, studying the genes underlying these traits not only provide new resources for practical breeding but also improve our understanding in the molecular mechanism that govern tomato fruit developmental processes.

1.1 Flower and fruit development

Flower, as defined in botany, is the plant organ where sexual reproduction takes place and the seeds are produced. It typically contains four major outer to inner whorls: sepal, petal, stamen and gynoecium, and the receptacle, which holds all four whorls together. The sepal primordia appear first to protect the immature floral buds from pathogens and insects. The green sepals also provide energy for floral development through photosynthesis. The petal primordia, which appear next, usually have a bright color as they mature to attract pollinators. The stamens, between petals and the gynoecium, produce pollen grains. Pollen grains contain male gametes, required for successful fertilization of the female ovule in the gynoecium. The innermost gynoecium may contain a different number of carpels across species. Most legume flowers contain a single carpel, called monocarpous gynoecium. Flowers from raspberry and strawberry contain multiple separated carpels, called apocarpous gynoecium. Plants containing multiple fused carpels are more common, such as Arabidopsis (A. thaliana), rice (O. sativa) and tomato (S. lycopersicum). For most of the 1 plants, the ovary (the part of the gynoecium containing ovules) develops into the fruit after fertilization. Nevertheless, some fruits, defined as pseudocarp or accessary fruits, such as the strawberry (F. ananassa) and apple (M. domestica), develop from both ovary and swollen receptacle or the extended part of the sepal, petal and stamen adjacent to the ovary. In histology, a fruit is composed of the pericarp and the seed. Based on the pericarp development, the fruit can be classified into two main categories: dry or flesh fruits. For flesh fruits, the pericarp can be further divided into three outer to inner layers: exocarp, mesocarp and endocarp (Wannan and Quinn, 1990; Dardick and Callahan, 2014). The exocarp can be a soft, leathery or tough outer skin that protects the inner components of fruits. The mesocarp usually contains a soft, juicy and fleshy texture and is the main part for human and animal consumption. The endocarp is the inner layer that protects the seed, and it can be either stony or fleshy. Tomato fruit is classified as a fleshy berry fruit, as all three layers of the pericarp are fleshy. For dry fruit, it can be dehiscent, such as Arabidopsis and soybean, or indehiscent, such as the corn, wheat, rice and sunflower. Fruit dehiscent is a strategy for seed dispersal - the carpel splits apart and frees the seeds once fruits mature (Ferrándiz, 2002). Seeds from indehiscent fruits remain inside the fruits after the fruits been separated from their parents. In general, fleshy fruits are more common in dispersing their seeds through animal consumption because of the evolved juicy pericarp, whereas dry fruits are more common in dispersing their seeds by wind, rupture, bur, and other abiotic factors.

1.2 Tomato as an ideal model plant for studying fruit development

Tomato is a great model plant due to its distinct features of fleshy fruits, compound leaves and sympodial shoots, which other model plants such as Arabidopsis, maize and rice lack. Tomato is a superior model for studying fleshy fruit development due to the following reasons: (1) Wide- range of natural variations are observed in fruit size, shape and color. (2) It is one of the most cultivated crops with high economic value worldwide. It contains important source of nutrients, such as vitamin A (ß-carotene), vitamin C (ascorbic acid) and lycopene (an antioxidant believed to prevent heart disease and cancer) (Bergougnoux, 2014). In addition, the usage of tomato as a diet is versatile, as it can be canned, dried, or processed. (3) It belongs to the Solanaceae family,

2 to which many other important crops, such as potato, bell pepper, chili pepper, tobacco and petunias, belong. Thus, knowledge derived from the studies in tomato can be easily applied to other Solanaceae family members. (4) A large collection of germplasm and a completed reference genome sequence can be easily applied to genome-wide association studies (GWAS) and genomic selection (GS) in exploiting breeding resources. In addition, many of the wild species can be easily crossed with domesticated tomatoes, which benefits the QTL studies in quality breeding. (5) It is diploid, self-pollinated (cultivated tomato), transformable and has a relatively short generation period (4 months) compared to other crops.

1.3 Domestication and progression of tomato

Tomatoes (S. lycopersicum) originated near the Andes region of North Peru and Ecuador in South America (Rick and Fobes, 1975; Williams and St. Clair, 1993; Blanca et al., 2015). The semi-wild tomato (S. lycopersicum var. cerasiforme) is believed to be the ancestor of cultivated tomato, and is likely domesticated from its wild relative (S. pimpinellifolium). Wild tomatoes (S. pimpinellifolium) produce tiny, red and round mature fruits (Figure 1.1A). Several semi-wild tomatoes are slightly larger than wild tomatoes but smaller than cultivated ones (Rick and Holle, 1990) (Figure 1.1B). The cultivate tomatoes can grow up to 500 times larger than wild tomatoes with a wide-range of shape diversity (Figure 1.1C). The pre-domestication event was carried out in the Andean region of South America, where S. pimpinellifolium (SP, wild type tomatoes) developed to S. lycopersicum var. cerasiforme (SLC, intermediate between wild type and domesticated tomatoes) and the fruit size was moderately selected. Afterward, some of the S. cerasiforme tomatoes were expanded to the Mesoamerican, where the main domestication took place and S. cerasiforme gave rise to the S. lycopersicum var. lycopersicum (SLL, domesticated tomatoes). Historical, geographical and genetic studies have shown that Mexico is the genetic origin of fruit shape and size diversity in cultivated tomato (Jenkines, 1948; Rick and Fobes, 1975; Williams and St. Clair, 1993; Blanca et al., 2015). In the 16th century, these SLL populations were brought to Europe by the conquistadors, where the fruit shape diversity expanded. The SLL populations were subsequently spread from Europe to North America and elsewhere. During the domestication, fruit size, color and the easiness of harvest are usually the early traits for selection.

Extensive breeding efforts began in the last century, which focused more on abiotic and biotic stress resistance, pharmaceutic compounds production and quality traits such as yield, uniformity, firmness, flavor and nutrient content.

1.4 Tomato fruit development

Tomato fruits are derived from the ovaries, which start an activated cell proliferation after anthesis for 8-10 days (Figure 1.2). The newly divided cells in the ovary then undergo a cell expansion process until 35-40 days post anthesis (dpa). Unlike Arabidopsis, the tomato fruit goes through a complicated ripening process, of which plant hormones, such as abscisic acid (ABA) and ethylene, and secondary metabolites, such as carotenoids and flavonoids, are synthesized (Giovannoni, 2004). The ripening process progressively changes the structure and chemical contents of fruits. Tomato fruit development starts as early as the floral meristem (FM) is formed. Genes involved in meristem regulation, cell division and carpel identity in tomato flowers can affect the size, structure and the ripening process of the fruits (Frary et al., 2000; Gimenez et al., 2016; Xu et al., 2015). In addition, genes that control ovary shape through modulating cell division in proximal- distal or medial-lateral directions before anthesis can also affect fruit shape (van der Knaap et al., 2014). As fruit size is determined by cell division rate and expansion process, mutations of genes in these processes can also change fruit size (Chakrabarti et al., 2013; Mu et al., 2017). Finally, endodupliction process is commonly found in the pericarp of tomato fruits, of which some cells have DNA content between 4C to 512C (Mu et al., 2017).

1.5 Meristem development and organization in tomato and Arabidopsis

In tomato, the variation between bilocular fruits and large fruits with more than ten locules is mainly controlled by two loci, lc and fas (Lippman and Tanksley, 2001). SlWUS and SlCLV3 are the candidates of lc and fas, respectively, and their Arabidopsis homologs are known to maintain the meristem identity by participating in a feedback regulatory loop (Figure 1.3) (Brand et al., 2000; Muños et al., 2011; Xu et al., 2015). Disrupting CLV signaling results in conserved phenotypes between species, such as enlarged meristems and excessive floral organ numbers, 4 especially the carpels (Figure 1.4). These studies support the notion that tomato locule number can be affected by the misregulation of floral meristem development. In the shoot apical meristem (SAM) and FM of Arabidopsis, a single layer of cells or a small group of cells can have extremely diverse fates depending on their position. SAM is typically separated in to three regions, the central zone (CZ), peripheral zone (PZ), and rib zone (RZ) (Clark, 2001). CZ keeps on generating new cells into PZ and RZ. The size of stem cell population in the CZ is controlled by CLAVATA-WUSCHEL (CLV-WUS) regulatory feedback loop. WUS is necessary for meristem cell specification, while SHOOT MERISTEMLESS (STM) maintains the cells in the CZ in an undifferentiated status and promotes cell division (Lenhard et al., 2002). PZ contains dividing cells resulted from anticlinal division, while cells in the RZ contains cells from periclinal division. Cells in the PZ and RZ are eventually differentiated and arranged precisely into different organs. In Arabidopsis, three main layers has been identified within the SAM and FM responsible for proper organ development (Daum et al., 2014). L1 becomes the epidermal layer of shoots, leaves and flowers and also the pericarp of the fruit. L2 forms the ground tissue (cortex, pith and mesophyll). L3 will becomes vascular tissues of stems and internal components of leaves and flowers (Daum et al., 2014). Based on the gene expression patterns, cells in different layer show distinct biological functions (Yadav et al., 2014). For example, L1 layer is enriched in defense responses, L2 layer is enriched in nucleic acid metabolism, and L3 is enriched in the photosynthesis process related gene expression (Yadav et al., 2014). Additionally, the L3 layer of tomato FMs controls the carpel number, while the upper two layers do not (Szymkowiak and Sussex, 1992). These studies highlight the functional complexity between different cell populations in the meristem. Therefore, to gain insights into the mechanism underlying LC-FAS interactions, it is important to examine their temporal and spatial expression patterns.

1.6 Dissecting the signaling pathway of meristem maintenance in plants

CLAVATA3 (CLV3) encodes a 96 amino acid peptide and encompasses two functional domains (Fletcher et al., 1999). One is the 14 amino acid CLE motif, which can act independently to restrict stem cell population by interacting with CLV receptors. The other is the 18 amino acid

5 hydrophobic motif that enables CLV3 secreted to the extracellular space (Rojo et al., 2002). The arabinosylation modification of CLV3 peptide on a hydroxyproline residual is critical for CLV3 function in Arabidopsis and tomato (Shinohara and Matsubayashi, 2013; Xu et al., 2015). The mature active CLV3p is predicted to be a 13 amino acid arabinosylated glycopeptide in the apoplastic region in Arabidopsis plant (Ohyama et al., 2009). Malfunction of arabinosyltransferase blocks the mature CLV3 peptide binding to the leucine-rich repeat (LRR) receptor like kinases and lead to the increase of stem cell population in SAM (Xu et al., 2015). Mature CLV3 peptide diffuses to the extracellular space in L1 layer and migrates to the underlying cells of the organizing center (OC, the region below L3 layer in CZ), where the receptor-like kinases, receptor-like proteins are localized. Several receptors have been identified in controlling meristem size, principally CLV1, CLV2 and CORYNE (CRN) (Müller et al., 2008a; Somssich et al., 2016; Soyars et al., 2016). CLV1 is a receptor like kinase (RLK) that carries an extracellular LRR domain and a cytosolic kinase domain. CLV1 typically forms a homodimer in plasma membrane. CLV2 is a receptor protein that resembles CLV1 but lacks the kinase domain, while CRN contains the kinase domain but lacks the extracellular receptor domain. Multiple lines of evidence show that CLV2 interacts with CRN and is functionally independent of CLV1 signaling pathway to transmit CLV3 signals (Müller et al., 2008a; Shinohara and Matsubayashi, 2015; Zhu et al., 2010). Searching for other receptors acting in parallel with CLV1 results in the identification of BARELY ANY MERISTEM (BAM) receptor kinases (BAM1, BAM2 and BAM3) (DeYoung and Clark, 2008; DeYoung et al., 2006). The clv1 and bam1 double mutants exhibits more severe phenotypes than clv1 in increasing meristem size. Unlike CLV and CRN receptor located in both CZ and PZ, BAM receptors are expressed preliminary in the PZ of the SAM. Another LRR-RLK involved in maintaining the stem cell population is RECEPTOR-LIKE PROTEIN KINASE2 (RPK2). RPK2 is likely involved in the BAM pathway in the PZ, and interacts with CLV1/CLV2/CRN complex in the CZ (Betsuyaku et al., 2011a). The binding of CLV3 with the receptor like kinase triggers the assembly of a protein complex including KINASE-ASSOCIATED PROTEIN PHOSPHATASE (KAPP)-CLV1 and KAPP-CRN in the central zone of SAM (Stone et al., 1998; Waites and Simon, 2000; Zhao et al., 2011). Additionally, two other phosphatases, POLTERGEIST (POL) and POLTERGEIST-LIKE

1 (PLL1) functioning downstream of the CLV reception have been identified (Song et al., 2006). These two phosphatases can presumably connect CLV signaling with WUS expression (Song et al., 2006). ROP (Rho GTPase-like protein) and G-protein also interact with the CLV signaling pathway (Bommert et al., 2013a; Ishida et al., 2014; Trotochaud et al., 1999). These interactions are expected to activate mitogen-activated protein kinase (MAPK) signaling cascade which inhibits WUS expression (Betsuyaku et al., 2011a; Trotochaud et al., 1999; Waites and Simon, 2000). Despite these findings, the mechanistic link between CLV signaling to the regulation of WUS expression is still unclear. It will be interesting to see if bringing data from different species with different approaches might aid in uncovering novel factors during meristem regulation.

1.7 WUS as a hub for meristem maintenance

WUS positively regulates the size of stem cell population. Mutations in any CLV genes results in enlarged meristems, increased carpel primordia and a higher level of WUS expression (Brand et al., 2000; Clark et al., 1995, 1997; Kayes and Clark, 1998). The homeostasis between CLV3 and WUS ensures proper plant structures during both vegetative and reproductive development. Briefly, CLV3 negatively regulates WUS expression while WUS positively regulates CLV3 expression (Figure 3.4) (Brand et al., 2000; Schoof et al., 2000). WUS is a bifunctional homeobox transcription factor (TF) with an activation domain in the acidic region, and two repression domains - WUS-box and EAR-like motif (Ikeda et al., 2009). WUS protein can traffic to the adjacent cells towards the peripheral zone and the central zone up to the L1 layer through plasmodesmota (Yadav et al., 2011). The WUS expression is controlled by different TFs and chromatin remodeling proteins. STIMPY, a homeobox domain protein, positively regulates WUS expression in the SAM and promotes meristem growth (Wu et al., 2005). AP2, an A-class floral organ identity gene, participates in meristem maintenance through either positive regulation of WUS or negative regulation of CLV3 (Würschum et al., 2006). miRNA mediated downregulation of HD-ZIP III genes, PHABULOSA (PHB), PHAVOLUTA (PHV) and CORONA (CRN), increases WUS expression and SAM size, suggesting their roles in meristem size regulation (Jung and Park, 2007). Epigenetic regulation of WUS is also important for meristem maintenance. FANTASTIC FOUR

(FAF) genes negatively regulate WUS expression in the SAM and are also under a negative control by CLV3 (Wahl et al., 2010). SPLAYED (SYD), a SNF2-class ATPase with chromatin remodeling function, directly interacts with WUS promoter region and positively regulates its expression (Guyomarc’h et al., 2005; Kwon et al., 2005). BRAD1 (BRAC1 ASSOCIATED RING DOMAIN 1) regulates WUS expression possibly through interacting with SYD or directly binding to WUS genomic region (Han et al., 2008). Numerous studies have indicated that WUS is a key TFs regulating a large number of genes involved in a plethora of processes, such as meristem maintenance, auxin signaling/transport, cytokinin (CK) signaling, jasmonic acid (JA) signaling and cell division (Busch et al., 2010). WUS directly represses CLV1, encoding a membrane-bound receptor of the CLV3 peptide, as well as lateral organ formation genes, ASYMMETRIC LEAVES2 (AS2) and KANADI (KAN) (Busch et al., 2010; Yadav et al., 2013). In addition, WUS also promotes cytokinin signaling through directly repressing of several Type-A ARABIDOPSIS RESPONSE REGULATOR (ARR) genes, which are negative regulators of CK signaling (Leibfried et al., 2005). Unlike vegetative meristems, the expression of WUS terminate after carpels are formed in FMs. In the FM, WUS directly activates AGAMOUS (AG), the key MADS box gene determining stamen and carpel identities (Lenhard et al., 2001). Through a feedback regulation, AG inhibits WUS expression directly and indirectly through inducing KNUCKLES (KNU) expression (Liu et al., 2011; Sun et al., 2014; Yadav et al., 2011). Delay of the KNU expression leads to the production of additional number of floral primordia and higher cell division rates in FMs (Sun et al., 2014). The complex regulatory network in floral meristem development ensures the production of flowers with a defined number of floral organ primordia. Recently, silencing SlWUS with RNA interference (RNAi) strategy in tomato results in smaller flowers and fruits with decreased locule number (Li et al., 2017). As the lc mutation is hypothesized to cause higher SlWUS expression than that found in the wild type (WT), by examining the CLV-WUS pathway in tomato and combining genetic and mRNA-seq approaches, progress is expected to be made in the field of floral meristem development.

1.8 Boundary formation in the SYM and FM

The mechanism underlying floral organ number determination is related to the balance between stem cell activity and differentiation. The specification of primordia leads to the formation of boundaries separated from the meristem. The boundary zone that separates meristem-to-organ or organ-to-organ has low cell division rate and restricted cell growth. Hormones, such as Brassinosteroid (BR) and auxin, promote organ primordial growth, which in turn causes the depletion of BR and auxin in the boundary cells (Hepworth and Pautot, 2015). The CK level is high in the meristem and low in the boundaries and the initiated organs. CK deficiency greatly reduces SAM size and activity (Kurakawa et al., 2007; Miyawaki et al., 2006). LOG4, a phosphoribohydrolase involved in the CK biosynthesis pathway, is expressed in L1 layer of SAM and stimulates WUS expression (Chickarmane et al., 2012). In addition, WUS positively regulates CK signaling by repressing type-A ARR TFs, which are negative regulators of CK signaling (Chickarmane et al., 2012; Leibfried et al., 2005). Further, the treatment of the clv3 mutant with CK results in a 15-fold increase of the SAM size, suggesting that CLV3 buffers the effect of CK in meristem cells (Chickarmane et al., 2012). Overall, CK accumulation affects the dynamic balance between CLV and WUS, while CK signaling acts as a positional cue of the WUS expression domain (Chickarmane et al., 2012). In contrast to CK, auxin accumulates at a higher level in the initiated primordia, lower in meristem zone and the lowest in the boundaries (Hepworth and Pautot, 2015). The auxin transporter PIN-FORMED 1(PIN1) directs the auxin to the tip of growing primordia and meristem, thereby generating a low auxin pool among boundaries (Heisler et al., 2005). The low-auxin level is essential for the activation of CUC (CUP-SHAPPED COTYLEDON) or NAM (NO APICAL MERISTEM) genes, which are involved in SAM formation and floral organ separation (Aida et al., 2002; Furutani et al., 2004). The distribution of BR level in SAM is similar to auxin, as both hormones have synergistic effects in promoting organ growth (Gendron et al., 2012; Hepworth and Pautot, 2015). The emerging studies suggests that the rice KNOX (putative Arabidopsis STM homolog) suppresses the BR level in the SAM by suppressing the expression of three BR metabolic genes encoding CYP734A6 (Tsuda et al., 2014). In addition, BR-activated TF BRASSINAZOLE RESISTANT 1

(BZR1), which directly represses the organ boundary identity gene CUC, is only localized in the meristem and primordia but not in the boundaries (Gendron et al., 2012). Overexpression of the BR biosynthesis gene DWF4 led to an organ fusion phenotype (Gendron et al. 2012). In contrast, BR-deficient and -insensitive mutants, det2 and bri1, have increased number of carpel in Arabidopsis (Gendron et al. 2012). The establishment and maintenance of boundaries are associated with many aspects of plant architecture. For example, the boundary in the SAM controls plant phyllotaxis, whereas in the leaf it controls leaf margin and complexity. Disrupting the boundary in the inflorescence meristem affects the production of FMs, while in the FM it impairs the separation of different whorls and organ primordia. The plant hormone plays a central role in determining the growth rate among meristems, boundaries and primordia. Therefore, the interactions between hormone profiles and genes that controls boundaries might be the key to uncover the link between FM maintenance and floral organ production.

1.9 Overview of the dissertation research

LC and FAS are two important genes contributing to enlarged fruits with multi-locules in tomato. These two genes have been highly selected in several clades among the tomato population during domestication. lc arose earlier than fas, while fas leads to a much more fasciated fruit than lc. lc is a putative mutation of SlWUS that is caused by two SNPs downstream of the 3’ UTR of SlWUS (Muños et al., 2011). Whereas fas is caused by a ~294 kb inversion with a breakpoint in the promoter region of SlCLV3 (Huang and Knaap, 2011; Xu et al., 2015). Although a number of players in regulating plant stem cell function have been investigated, many key questions remain: 1) How do enlarged meristems lead to more floral organs? 2) Is meristem homeostasis mechanism conserved between Arabidopsis and tomato? 3) Are there any novel factors involved in FM regulation in tomato? To understand the molecular mechanism underpinning LC-FAS mediated developmental processes in affecting the locule number through regulating the meristem activity, we conducted a series of genetic, molecular and RNA-seq analyses. We showed that lc and fas lead to meristem enlargement through SlCLV3-SlWUS pathway. We also demonstrated that although the regulatory feedback loop of LC and FAS seems to be conserved, the SlCLV3

10 expression domain and SlWUS expression duration are different from that in Arabidopsis. Moreover, our RNA-seq results have helped identifying a number of co-expressed gene clusters associated with developmental processes and TFs that might act downstream of LC and FAS. Our findings imply that lc and fas lead to expression changes of genes mostly involved in meristem/flower development, patterning, microtubule binding activity, and sterol biosynthesis. A number of homeobox and MADS TFs, which involve in the meristem activity and floral organ identity, are differentially expressed (DE) at higher levels in lc and fas. Likewise, DE genes related to CK biosynthesis and signaling are also expressed at higher levels in lc and fas mutants. Co- expression analysis reveals that many of the DE genes involved in BR biosynthesis tend to be repressed in lc and fas, while genes related to microtubule binding activity and cell cycle are expressed at higher levels. Together, these observations have provided new insights into the transcriptional network underlying LC-FAS mediated stem cell and locule number controls.

Figure 1.1 Domestication lineage of different tomato accessions from wild type to cultivated tomato. (A) Wild tomato fruits of S. pimpinellifolium. (B) Semi-wild tomato fruits of S. lycopersicum var. cerasiforme. (C) Cultivated tomato fruits of S. lycopersicum var. lycopersicum. Bar = 3cm.

Figure 1.2 Schematic diagram of tomato fruit development. Figures are adapted from Azzi et al. (2015).

Figure 1.3 CLV3-WUS Feedback regulatory loop in Arabidopsis.

Figure 1.4 Phenotypes associated with CLV signaling mutants in different species show conservations in the control of meristem size, floral organ number and fruit size. Arabidopsis clv3- 2 is a loss-of-function mutation in the CLV3 gene. Maize fea3 is caused by natural mutations in the FEA3 gene that encodes a leucine-rich-repeat (LRR)-receptor-like protein. Rice fon4 null mutation is attributed to a ~ 200kb deletion in the FON4 gene, an ortholog of Arabidopsis CLV3. Tomato fin is identified as a nonsense mutation in the FIN gene that encodes hydroxyproline O- arabinosyltransferase (HPAT) protein.

Chapter 2. The control of tomato locule number and fruit weight by natural mutant alleles of lc and fas in wild type tomato

Abstract

In most fruit and vegetable plants, improving the yield by increasing fruit weight is an important goal during domestication and selection. Genes controlling meristem activity and organ formation work in concert to regulate the architecture of reproductive organs. In tomato, lc and fas are natural mutants that are important for the domestication process as they produce enlarged fruits with more locules than their wild progenitors. In this chapter, I show that the natural mutations in LC and FAS, corresponding to SlWUS and SlCLV3 respectively, contribute to enlarged floral meristems and hence fasciated inflorescences and fruits. Both mutations led to an expansion of SlWUS expression domain in the floral meristem. In addition, single or double mutant alleles of lc and fas maintain SlWUS expression at higher levels during the development of the carpel primordia in the floral bud. The attenuation of temporal and spatial expression of SlWUS provides a mechanistic basis for the development of multilocular fruits. Our results suggest that disrupting meristem maintenance can greatly affect the final fruit size and structure. We also show a close conservation between tomato LC-FAS and Arabidopsis WUS-CLV feedback loops, in which LC positively and FAS negatively regulate the floral meristem cell population.

Introduction

In cultivated crops, the genetic variation of important agronomic traits such as fruit weight, grain yield, and overall plant architecture can be exploited to develop new varieties with improved qualities. With the advent of QTL mapping and cloning methods in the past decades, many genes contributing to the increase in fruit weight and crop yield have been identified (Frary et al., 2000; Bommert et al., 2013; Li et al., 2011; Chakrabarti et al., 2013; Song et al., 2007). Genes that increase fruit and grain weight may affect cell division rates and directions, cell size as well as the overall structure of the fruit. The underlying mechanisms for weight increase include changes in development pathways, cell signaling, hormone biosynthesis, and others that occur during organogenesis (Frary et al., 2000; Chakrabarti et al., 2013; Muños et al., 2011; Xu et al., 2015; Bommert et al., 2013; Ashikari et al., 2005; Song et al., 2007; Li et al., 2011; Ishimaru et al., 2013). In Arabidopsis and tomato, floral meristem organization is critical in determining final organ size particularly for carpel, as it becomes the fruit after fertilization (Fletcher et al., 1999; Mayer et al., 1998; Xu et al., 2015). This developmental mechanism is highly conserved in plants. The misregulation of floral meristem development also accounts for differences in rice grain size and maize kernel number (Bommert et al., 2013; Suzaki et al., 2009). Meristems maintain the balance between cell differentiation and self-renewal in a coordinated manner through intercellular communication mediated by WUSCHEL (WUS) and CLAVATA3 (CLV3). In Arabidopsis, CLV3 and WUS orchestrate meristem function in a negative feedback regulatory loop (Brand et al., 2000; Fletcher et al., 1999; Mayer et al., 1998; Schoof et al., 2000). CLV3 signals through different receptor complexes, principally CLV1, CLV2, CORYNE (CRN) and RECEPTOR-LIKE PROTEIN KINASE 2 (RPK2) to restrict WUS expression. WUS activates CLV3 expression at the meristem tip through binding to the CLV3 promoter (Brand et al., 2000; Clark et al., 1997; Kinoshita et al., 2010; Müller et al., 2008b; Schoof et al., 2000; Yadav et al., 2011). CLV3 belongs to the CLE small peptide family and acts in a non-cell autonomous manner (Cock and McCormick, 2001; Lenhard and Laux, 2003). CLE family proteins typically share a conserved N-terminal secretion signaling domain and the CLE motif known to interact with CLV receptors (Ni and Clark, 2006; Rojo et al., 2002). The null mutation in clv3 leads to enlarged floral meristems due to the increase of the central zone, which contributes to the development of supernumerary floral organs 17

(Figure 2.1). (Brand et al., 2000; Fletcher et al., 1999). WUS encodes a homeodomain transcription factor required for specifying stem cell identity (Laux et al., 1996; Mayer et al., 1998). In Arabidopsis, the wus null mutant is characterized by aberrant meristem structure and premature termination of shoot apical meristems (SAMs) and floral meristems (FMs). FM premature termination leads to a restriction in stamen and carpel development (Laux et al., 1996). Principally, WUS positively regulates CLV3 expression which in turn leads to downregulation of WUS expression through the interactions of membrane-localized receptors and phosphorylation- dependent downstream effectors (Figure 2.1) (Betsuyaku et al., 2011a; Brand et al., 2000; Gagne and Clark, 2010; Schoof et al., 2000; Somssich et al., 2016). In addition to the CLV3-WUS feedback loop, WUS also positively regulates the carpel identity gene, AGAMOUS (AG), during early floral development in Arabidopsis (Figure 2.1) (Lenhard et al., 2001; Lohmann et al., 2001). AG suppresses WUS expression by binding to the CArG box located downstream of the gene and the subsequent recruitment of Polycomb Group proteins to enhance histone methylation (Liu et al., 2011). An ag loss-of-function mutation completely abolishes carpel development in Arabidopsis (Yanofsky et al., 1990). In tomato, natural mutations in LC and FAS increase the fruit locule number to more than the typical two or three (Barrero and Tanksley, 2004; Lippman and Tanksley, 2001; Muños et al., 2011; Rodríguez et al., 2011; Xu et al., 2015). Both mutants have been differentially selected among different genetic subgroups during tomato domestication due to their positive effects on fruit size and weight (Blanca et al., 2015; Rodríguez et al., 2011). However, mutations in FAS often results in unacceptable fruits that are unevenly shaped and therefore, are not very common in large-scale commercial-grown tomatoes. From the association analysis, two SNPs located downstream of SlWUS were associated with lc (Muños et al., 2011). The characterization of these two SNPs has not been done. fas was caused by a ~294 kb inversion with breakpoints in the first intron of SlYABBY2b as well as in the promoter of SlCLV3 (Huang and Knaap, 2011; Xu et al., 2015). The inversion created a SlYABBY2b null mutant, which initially suggested that SlYABBY2b is likely underlying fas. However, the complementation of SlYABBY2b only showed a minimal rescue from the fasciated phenotype (Cong et al., 2008). Therefore, an alternative possibility was considered that a mutation in SlCLV3 might underlie the fas phenotype. In addition, we

18 hypothesized that both lc and fas mutants, corresponding respectively to mutant alleles of SlWUS and SlCLV3, might contribute to a higher level of SlWUS expression, which in turn leads to enlarged floral meristems and extra fruit locules. Although CLV-WUS pathway has been extensively studied in Arabidopsis, the relationship between meristem maintenance and fruit development in tomato is not well understood. In addition, the lack of lc and fas in a near isogenic background has prevented a detailed analysis of the effects of these two natural mutations in tomato without the effects of the genetic backgrounds. Furthermore, the function of SlCLV3 in fruit development had not been recapitulated by using a transgenic approach (e.g., knockdown) in tomato. In this chapter, we developed a set of near- isogenic lines (NILs) containing lc, fas and lc/fas double mutants to examine the interaction between these loci in fruit development. By using the fas NILs, we performed a complementation test, which clearly demonstrated that SlCLV3 was the gene underlying fas. In addition, results from transgenically suppressed SlCLV3 further demonstrated that SlCLV3 plays a prominent role in determining locule number in tomato. From RNA in situ hybridization, we identified substantial changes of the SlWUS expression domain in developing floral buds in plants carrying lc and/or fas. Overall, our results indicate that lc is a gain-of-function mutation of SlWUS, whereas fas is a loss-of-function mutation of SlCLV3. We also found that the regulatory feedback loop was conserved between tomato LC-FAS and Arabidopsis CLV-WUS.

Materials and Methods

Plant materials and near-isogenic line (NIL) development

S. pimpinellifolium accession LA1589 seeds were obtained from Tomato Genetics Resource Center (http://tgrc.ucdavis.edu/). Mature fruits from LA1589 typically contain 2 locules and about 1 cm diameter. Both S. lycopersicum cv. Orange Strawberry and Yellow Stuffer seeds were obtained from Tomato Growers Supply Company. Orange Strawberry contains the lc and fas mutant alleles and bears large fruits with 14 locules on average. Yellow Stuffer bears large fruits with 3.6 locules on average and only carries the lc allele. The LA1589 NILs carrying the mutant alleles were derived from repeated backcross to the wild species S. pimpinellifolium accession 19

LA1589. After six backcross generations to introgress each locus separately, the lc and the fas lines were crossed to one another to create the double NIL. To further reduce the size of the introgression regions at both loci, we made three more backcrosses to LA1589 and identified close recombination breakpoints, followed by two more self-pollinated generations to generate final

BC9F2 population (family 13S133) (Figure 2.2). During this selection, lc and fas loci were maintained in the heterozygous state, while the surrounding loci were selected to be homozygous wild type and selected for recombinants around the genes. Three NILs, lc, fas, lc/fas and wild type

(WT), were created from the BC9F2 population. The primers used to select recombinants are listed in Table 2.1. The size of the introgressed segment varied for each locus (Figure 2.3). For lc, the region was approximately 184 kb, from 47,014 kb to 47,198 kb on Chr.2 (SL2.50). For fas, the introgression size was about 351 kb, from 54,842 kb to 55,193 kb on Chr.11 (SL2.50). The fas mutation was caused by a large inversion (294kb) which limited the ability to narrow down the region further in this NIL.

The cloning of the fas complementation and RNAi-SlCLV3 constructs

To complement the fas mutation, the vectors containing SlCLV3 gene with its wildtype promoter were constructed by a former post doc Dr. Zejun Huang. These constructs were transformed into the fas NILs (family 12S256) for the complementation test in the laboratory of Tom Clemente at University of Nebraska, Lincoln in the Plant Transformation Facility. Clone pHC2 represented the wild type allele with 5,465 bp upstream and a 3,445 bp downstream sequence around SlCLV3, respectively (Figure 2.4). The pHC4 represented a shorter version of SlCLV3 promoter up to the inversion breakpoint with 1,008 bp upstream and 3,445 bp downstream sequence from the start and stop codon of SlCLV3, respectively. A two-step cloning approach was performed to create pHC2 using the binary vector (pHaoNM), a modification of pCAMBIA1300. First, the intermediate construct pHC1 was created, in which the enzymes MfeI and SacI were used to digest the fosmid SL_FOS0151E08 carrying the wild type allele of fas from Heinz1706. The digested fragment was cloned into pHaoNM in the EcoRI/SacI site. This insert in pHC1 contained

20 the 4,320 bp fragment spanning the SlCLV3 coding region. To create the pHC2 construct, another 5233bp fragment from the same fosmid was released by digestion with SacI and NsiI, and ligated into pHC1 in the SacI/SbfI site. For the pHC4 construct, the shorter version of the SlCLV3 promoter was amplified by PCR with primers 12EP315: 5’-ATGATGAGCCATGCAGCCATTGTTG-3’ and 12EP389: 5’-CTAAGCTTGCATGCCTGCAGGAAACATACAAATAGAGTTTACACAC- 3’ using Phusion High-Fidelity DNA polymerase (NEB). The resulting PCR product was digested with SacI and PstI and ligated into pHC1 in the SacI/SbfI site. T0 plants were analyzed by southern blot analyses to determine transgene copy number and independent transformation (Appendix A). Locule number was evaluated in the T1 generation for 2 independent pHC2 and in the T0 generation of 7 independent pHC4 lines. To reduce the expression of SlCLV3 in wild type tomatoes, a hairpin RNAi construct was created using the pKYLX80 vector similar to the method described in Siminszky et al., (2005). A gene-specific fragment of 355 bp was amplified from SlCLV3 with the following primer pairs: CRF1: 5’-AATTCTAGAAGCTTTCAATCTCT TTGTCTTGCTGA-3’ and CRR1: 5’- ATGGAGCTCTCGAGATGAA ACCATATACTACCCT-3’. The amplified product was digested with HindIII/XhoI and SacI/XbaI to construct sense and antisense fragments flanking the 151 bp region of soybean ω-3 fatty acid desaturase (FAD3) intron (Figure 2.5). Next, both digested fragments were inserted into vector pKYLX80. The resulting EcoRI-XbaI fragment from pKYLX80 containing the CaMV35S2 promoter, SlCLV3 sense arm, FAD3 intron and SlCLV3 antisense arm was subcloned into binary vector pKYLX71 between TL border and the RBCS subunit terminator to produce the final RNAi- SlCLV3 construct, named pRNAi-CR. The pRNAi- CR was stably transformed into S. pimpinellifolium accession LA1589. We selected two independent T0, pRNAi-CR4 and pRNAi-CR9, which were shown to contain six and one copy of the transgene respectively, and were further evaluated by phenotypic and expression analysis in the T1 generation. Target specificity of this RNAi experiment was examined through BLASTN using Tomato genome cDNA database (SL3.20) with the designed arm sequence (Figure 2.6). Comparisons of the expression level of all the SlCLE gene family between wild type and RNAi- SlCLV3 lines in tomato FM and 2dpi floral buds were shown in Appendix B.

Morphological analysis

Inflorescence branching, floral organ number and fruit locule number counts Five to six plants were selected from the seedlings generated by family 13S133 for each genotypic class (lc, fas, lc/fas and wild type) and transplanted in 1-gallon pots in the greenhouse. For the transgenic T1 lines, three to seven plants were used. Inflorescence branching was evaluated on 40 inflorescences per plant. In addition, 40 flowers at anthesis were collected per plant to evaluate sepal, petal and stamen number. To evaluate locule number, 40 ripe representative fruits were collected from each plant, and locule number was counted in cut fruits.

Fruit weight and dimension analysis For fruit weight analysis, 20 ripe representative fruits per plant were selected and weighted. For fruit dimension analysis, eight to ten fully mature fruits from each of the genotypes were cut horizontally and scanned. Tomato analyzer 3.0 (Rodríguez et al., 2010) was used to analyze the scanned images for fruit perimeter and area following the instructions (http://vanderknaaplab.uga.edu/tomato_analyzer.html).

Morphological analysis of inflorescence structure and meristem size measurement The first young inflorescences of lc, fas, lc/fas NILs and wild type were collected in the greenhouse and immediately placed in the ice-cold RNAlater (QIAGEN) to preserve the tissue structure. The inflorescences were imaged using an Olympus SZH10 stereo-microscope and Olympus DP-10 digital camera. For the meristem size measurement, paraffin slide sections were made the same way as described in in situ hybridization procedures. Paraffin slide sections were rehydrated through ethanol series and stained with 1% Toluidine Blue (Sigma-Aldrich). Stained tissues were further dehydrated through ethanol series and finally mounted with Cytoseal 60 (Thermo Scientific). Images were taken under a florescence microscope and meristem size were measured using ImageJ software (NIH). The width of floral meristems was measured along a line between two sepal and petal primordia in floral buds at stage 3 and 4 days post floral initiation (dpi), respectively. For each genotype and time point, at least five meristems were measured. A two-tailed t-test was performed for statistical analysis.

Statistical analysis Analysis of variance (ANOVA) and Tukey’s mean separation tests (HSD) were performed using the average of 20 to 40 measurements from each plant except for fruit size dimension, in which an average of 8 fruits were used. Comparisons were made using the average per plant and 3 to 7 plants per genotype. Epistasis between the two loci was determined using two-way ANOVA with the following model: 푌푖푗푘 = 휇 + 푎푖 + 푏푗 + 푎푏푖푗 + 휖푖푗푘, in which a and b represented the effect of lc and fas, whereas ab was the interaction factor. In addition, i represented the i’th allele at lc, j represented the j’th allele at fas, while k represented the number of all plants used in the analysis. To estimate how lc and fas contributed to trait variance, dominance-to-additive variance ratio (d/a) was calculated by the following equation: d/a= (2Aa-AA-aa)/(AA-aa). AA and aa represented the phenotypic effects caused by homozygous derived and wild type alleles, respectively. Aa represented the phenotypic effect caused by heterozygous alleles.

In situ hybridization to determine LC and FAS expression in floral meristems

RNA in situ hybridization was performed with digoxignin-labeled RNA using the protocol developed by Wu et al., (2011) with minor modifications. To generate the RNA probes, full-length SlCLV3 (Solyc11g071380) and SlWUS (Solyc02g083950) cDNA was amplified from M82 cDNA using Phusion Taq (Invitrogen) and ligated into the pSC-A-amp/kan vector containing T7 and T3 promoter (provided by Lippman’s lab, CSHL). Clone pSL-CLV3-1 and pSL-CLV3-4 were generated to make SlCLV3 antisense and sense probes respectively. Clone pSL-WUS-4 was used to make both SlWUS sense and antisense probes. Depending on the orientation of the insert, T7 or T3 RNA polymerase was used to transcribe sense or antisense RNA. To generate the TAG1 RNA probe, we amplified the linear template of TAG1 from cDNA using the following primers: TAG1_F: 5’-CCAAAGTCTCTTCCATTTTCTGC-3’ and TAG1_R: 5’- ACTCCCTGGCATCAAGTTCA-3’. The antisense and sense probes of TAG1 were created through adding the T7 promoter sequence to the reverse and forward primers, respectively. Afterward, TAG1 RNA probes were generated through in vitro transcription using T7 RNA polymerase and labeled with digoxigenin (DIG) RNA labeling mix (Roche).

Young inflorescences were ﬁxed with ice-cold 4% (w/v) paraformaldehyde and vacuum infiltrated with a pressure of 25-28 inHg for 20-30 minutes until the samples had sunken. Samples were dehydrated through ethanol series, followed by histoclear replacement. Paraffin wax (Polyscience) was used for sample embedding with at least 6 fresh exchanges for 3 days. Microtome sections were taken to obtain 10 µm thick ribbons. Slides were rehydrated in an ethanol series followed by Proteinase K digestion and acetylation. The hybridization reactions were conducted at 55°C overnight with the gene-specific DIG-labeled probes. Excess probes were washed off by saline-sodium citrate buffer (SSC buffer) and slides were blocked with blocking reagent (Roche). To detect the signal, slides were incubated with alkaline phosphatase-conjugated antibody (anti-DIG-AP Fab fragments, Roche) at room temperature for 2 hours. Non-specific binding of antibody was washed three times with BSA buffer for 1.5 hours each. Finally, Western Blue (Promega) was applied to each slide and incubated overnight in dark at room temperature for the color reaction. Images were taken under the florescence microscopy (Leica) equipped with a digital camera in Molecular and Cellular Image Center in OARDC.

Tissue collection and RNA extraction

For each genotype, approximately 300 first and second inflorescences with only 3-4 visible floral buds were collected from 5 to 7-week old plants that were sown over a six-week window. For each replicate, tissues were collected daily between 2 and 3 pm. During the collection, all inflorescences were immediately immersed in ice-cold RNAlater (QIAGEN) solution at five times the volume of the sample in order to prevent RNA degradation. After sample collection, vacuum infiltration was applied until tissues sunk to the bottom of RNAlater solution. The tissues were then stored in RNAlater at -80℃. Five different developmental stages including sympodial shoot apical meristem (SYM), floral and inflorescence meristems (F&IM), 2 days post floral initiation (dpi), 4 dpi and 6 dpi floral buds were collected from each genotype with three replicates. For the dissection, meristems and buds of different developmental stages were isolated by forceps under a dissection microscope and immediately put into a 1.5 ml eppendorf tube in 1ml of fresh

RNAlater that was kept on ice. The samples were stored at -80 ℃ prior to the RNA extraction. Prior to RNA extraction, the precipitated RNAlater crystals need to be dissolved by occasionally

24 shaking of the eppendorf tube at room temperature several times. The RNAlater reagent was further removed using a fine-tip drawn-out glass pipette. RNA extraction was conducted using Trizol® (Invitrogen Inc. USA) following manufacture’s recommendation. The quality of RNA in each sample was examined through Agilent Bioanalyzer prior to RNA library preparation. Samples with a total RNA amount of 1-2 µg were used for subsequent RNA library preparation.

3’ Taq RNA-seq library preparation

RNA-seq libraries of approximately 300 bp fragments were prepared following the 3’-Tagseq protocol of Meyer et al., (2011) with little modifications per directions from Dr. Thomas Juenger, The University of Texas at Austin. Sixty libraries were made, including our four genotypes at five developmental stages, and each with three biological replicates. The mRNA was enriched using

Oligo d(T)25 magnetic beads (NEB) by following the manufacture’s recommendations. The bound mRNA was eluted from the beads by adding 2x SupertScript II first-strand buffer (Invitrogen) supplemented with 10mM DTT. Samples containing eluted mRNA, magnetic beads and first- strand buffer were incubated at 94C for 2 min to fragment the mRNA, and immediately placed on ice. The samples with fragmented RNA were placed on the magnetic rack to remove the Oligo d(T)25 beads. The supernatant containing fragmented mRNA and first-strand buffer was transferred to a new tube for first-strand cDNA synthesis. First-strand cDNA was synthesized using SupertScript II reverse transcriptase in the presence of 3’ Oligo dT primers and 5’ RNA adaptors with GGG at 5’ end at 42C for 1 hour. To amplify targeted 3’ end cDNA, AccuPrime Taq polymerase (Invitrogen) was used for the 16 cycles of PCR amplifications. To purify the resulting 3’ end cDNA products, the excess primers, nucleotides, salts and enzymes were removed by Agencourt AMPure XP using 1.8 volume of beads solution. cDNA quantity was measured using the Qubit HS and all samples were diluted to 40 ng in 42 µl total volume. Next, library- specific barcodes and Illumina universal adaptors were incorporated to each cDNA by 5 cycles of PCR in 50 µl total volume using AccuPrime Taq polymerase (Invitrogen). Afterwards, six libraries were pooled together. To size select 300 to 350 bp fragments, 0.7 volume of Agencourt AMPure XP beads to 1.0 volume of sample was used and the supernatant was collected to remove cDNA size larger than 400 bp. Next, 0.85 volume of Agencourt AMPure XP beads to 1.0 volume of 25 sample was used to target cDNA size around 300-350 bp. The bound cDNA was eluted from the beads by adding distilled water. The fragment size and concentrations of the samples were examined through Agilent Bioanalyzer and the Qubit HS. Samples with 30 ng total amount were mixed together to create two pools with 30 3’ Tag RNA-Seq libraries each. The RNA libraries were sent to the Illumina HiSeq2500 at Genomic Resources Core Facility at Weill Cornell Medical College for 100 bp single–end sequencing.

Gene expression analysis

Raw reads were checked for their quality in FASTQC. Total raw reads for each sample ranged between 5 to 10 million (Table 2.3). Filtering steps were performed using fqtrim program (http://ccb.jhu.edu/software/fqtrim/index.shtm) to remove up to 50% low quality reads with QC score< 20 as well as poly-A tail contaminations. About 94% of clean reads mapped to ITAG2.4 Released Tomato Genome through Rsubread 3.4 (Liao et al., 2013) and 81% of clean reads mapped to annotated genes. Pearson correlations were performed to check the reproducibility between replicate. An average correlation (r = 0.99) was obtained which showed a high reproducibility between samples of the same stage and genotype in this experiment. For the sequencing depth, around 55-60% of all genes in the tomato genome showed at least 3 reads per library. Gene expression levels were normalized using the RPM value (Reads Per Million). Significantly differentially expressed genes (DEGs) were defined using linear factorial modeling in DEseq2 with adjusted p-value<0.1, of which likelihood ratio test was applied (Clevenger et al., 2017).

Results

Genetic changes of lc and fas are located near tomato WUS and CLV3

Tomatoes carrying the lc and fas natural mutant alleles produce fruits with heavier weight and higher number of locules (Figure 2.7A) (Lippman and Tanksley, 2001; Muños et al., 2011; Rodríguez et al., 2011). Both mutant alleles result from mutations in the regulatory regions of the genes. From the association analysis, two SNPs downstream of the 3’UTR of SlWUS were associated with LC (Figure 2.7B). These two SNPs appeared to be located within the tomato CArG

26 box, a MADS box transcription factor binding site with similarity to the CArG box in the regulatory region of Arabidopsis AP3 and WUS. fas is caused by a ~294 kb inversion with one breakpoint 1,008 bp upstream of the putative transcriptional start site of SlCLV3 (Figure 2.7B). To determine the effects of the lc and fas natural mutant alleles in controlling inflorescence and floral development, we evaluated morphological changes of NILs carrying single and double mutant alleles. For inflorescence branching, wild type tomato typically developed a single-branch inflorescence (Figure 2.7C). In contrast, both fas and lc/fas NILs showed a significant increase in inflorescence branching compared to wild type, with the highest branch number generated by lc/fas double NILs (Figure 2.7C, F, and Table 2.5). The lc/fas also resulted in the highest floral organ number among the NILs, especially for the locule number (Figure 2.7D-E, G-I and Table 2.5). A significant effect on floral organ number was also found in the fas single mutant, but the effect was not significant in the lc single mutant. Overall, lc had a weaker effect than fas on inflorescence branching and floral organ number. The effect on these traits in the double mutants was stronger than in each of the single mutant. fas and lc/fas resulted in a 10% and 20% increase, respectively, in petal and stamen number compared to wild type (Figure 2.7G-H). By contrast, these mutants led to 50% and 98% increases in locule number, respectively, showing that the effects of these mutations were strongest in the carpels (Figure 2.7I). To determine the underlying gene of fas, a genomic construct, pHC2, carrying wild type SlCLV3 allele with a 5.5 kb long-promoter and a 3.5 kb downstream region was transformed into the fas NILs. As a control, we also created another line by transforming the fas NILs with the pHC4 construct which carried SlCLV3 with a 1.0 kb short-promoter and 3.4 kb downstream sequence. This shortened promoter extended from the transcription start site to the inversion breakpoint in fas, recapitulating the situation observed in the fas genome. We generated 18 plants for each pHC2 and pHC4. In T0 generation, all the plants transformed with the pHC2 construct in fas background were rescued to the bi-locular fruits phenotype, whereas plants transformed with the pHC4 construct revealed no differences in locule number compared to fas (Figure 2.7I, Table 2.4). We validated the effect in two pHC2 T1 populations, and the results showed that the wildtype phenotype co-segregated with the presence of the wild-type SlCLV3 genomic construct (Table 2.4).

To test whether the plants with severely downregulated SlCLV3 might produce extra floral organs. We also evaluated SlCLV3 RNAi lines in LA1589 background. The effect of SlCLV3 RNAi was much stronger than fas and lc/fas in promoting extra organ formation, as evidenced by the significantly increased inflorescence branch and floral organ number including locule number (Figure 2.7C-I and Table 2.5). Additional phenotypes associated with the severely reduced expression of SlCLV3 in the RNAi-SlCLV3 included: nearly seedless fruit (Figure 2.8A), ectopic development of ovaries inside the initial ovary, widened leaflets, decreased number of secondary leaflets, and reduced complexity of the compound leaf (Figure 2.8B). Extreme phenotypes in the flowers were also occasionally observed, such as an inflorescence that was reinitiated inside a flower (Figure 2.8C). The plant transformation results from complementation and RNAi analyses demonstrated that SlCLV3 was the gene underlying fas and suggested that SlYABBY2b plays a minor role, if any, in the increase of locule number. The increase of fruit locule number is expected to cause increased fruit weight, area and perimeter. With respect to fruit area and perimeter, both fas and lc/fas NILs produced significantly larger fruits compared to wild type (Table 2.6). Although fruit weight was also increased in these mutants, significant increase was only observed in the lc/fas double NILs. This indicated that the fruits were wider but flatter and thus not much heavier. To determine whether lc and fas exerted a synergistic effect on locule number, fruit weight and size, we evaluated the genetic effect between these two loci in wild type background (Table 2.7). The epistatic analysis was performed using two-way ANOVA and the results showed a significant interaction between lc and fas for the locule number trait (p-value <0.001) (Table 2.7). However, although lc/fas led to heavier and larger fruits than single mutant, the synergistic effect between lc and fas was not significant for these traits. In addition to the epistatic analysis, the degree of dominance of each locus was evaluated (Table 2.8). The results showed that lc affected locule number in a mostly additive manner with d/a value of - 0.32, which suggested that there was some additive effects of lc on locule number in the heterozygous. The fas mutation on the other hand was nearly completely recessive with d/a value of -0.88. For the fruit weight, lc and fas acted in an additive manner with d/a value of -0.18 and - 0.36, respectively.

28 lc and fas lead to fasciated inflorescence and enlarged floral meristems

As lc/fas NILs strongly affected inflorescence branching, we sought to determine the effects of these two loci on inflorescence architecture and meristem size. Wild type inflorescences were characterized by a sympodial architecture with a reiterating pattern of a new IM developed simultaneously when a FM was formed (Figure 2.9A). In contrast, the first inflorescence from fas and lc/fas NILs exhibited a fasciated architecture, in which two to three IMs were formed from the SAM, and each IM divided into FMs in a sympodial manner (Figure 2.9A). To determine whether the cause of fasciated flowers and fruits in the mutants was associated with increased meristem size, we compared the width of FMs among the NILs. At 3 dpi, when the sepal primordia were not yet enclosing the remaining meristem, FMs of single and double mutants revealed a significant increase in the meristem width compared to wild type (Figure 2.9B, D). At 4 dpi, well after the initiation of petal primordia, the effect of lc and fas on FM size was even more pronounced than that at 3 dpi, especially in the double mutant background (Figure 2.9C, E). A small sample size and relatively early evaluation of meristem width from 3 and 4 dpi prohibited the evaluation of a synergistic effect between lc and fas on locule number. Nevertheless, there was a clear positive correlation between the floral meristem size and locule number resulting from the effects of lc and fas. lc and fas affect the expression of SlCLV3, SlWUS, SlYABBY2 and TAG1

To determine the effect of the lc and fas mutations on gene expression, RNA-seq analyses were conducted using tissues collected at different stages: sympodial shoot apical meristem (SYM), floral meristem+inflorescence meristem (F&IM), 2 dpi, 4 dpi, 6 dpi. The RNA-seq results revealed that SlCLV3 expression was significantly lower in the SYMs and F&IMs in lines carrying fas compared to wild type (Figure 2.10). A significant increase in SlCLV3 expression, specifically in SYMs, was detected in lc. SlCLV3 expression was similar between different genotypes in the floral buds after 2 dpi, except in 4 dpi floral buds of fas NILs. SlWUS expression was significantly increased in SYMs in lines carrying either single or double mutant alleles as well as in 6 dpi floral buds (Figure 2.10). These results support our hypothesis that down regulation of SlWUS would be delayed in lines carrying lc and fas. 29

To identify additional changes in SlWUS and SlCLV3 gene expression during floral development, we compared results between SlCLV3 RNAi and the wild type plants (Figure 2.11). A significant reduction of SlCLV3 expression was found in F&IM plus 2 dpi floral buds in SlCLV3 RNAi lines (Figure 2.11A). By contrast, SlWUS expression level was unchanged from wild type in the F&IM as well as 2 dpi, but significantly higher at 4 and 6 dpi in SlCLV3 RNAi lines (Figure 2.11B). Together, these results indicated that, as SlCLV3 expression was reduced, the down regulation of SlWUS was delayed. As the inversion that created fas caused a breakpoint in the first intron of SlYABBY2b, we sought to examine its expression level between genotypes (Figure 2.10). SlYABBY2b expression was very low in fas and lc/fas at all stages, suggested that the knockout of SlYABBY2b did not fully block the transcription of N-terminal truncated RNA. Furthermore, almost all detected transcripts mapped to the 5’ region of SlYABBY2b comprising the first exon, before the breakpoint of the fas inversion (Appendix C). This suggested that the mutation still leads to a shortened RNA that is likely non-functional. We further determined if the WUS-dependent AG expression found in Arabidopsis was conserved in tomato. Our results showed that the expression of tomato AG homolog TAG1 was significantly increased in lc, fas, lc/fas floral buds at stage 4 dpi (Figure 2.10). The differences were also observed in mutants at 6 dpi albeit to a lesser degree than at 4 dpi. Notably, the expression of TAG1 was almost undetectable in the SYMs, F&IMs and floral buds at 2 dpi. In addition, the synergistic effect between lc and fas was not observed in the expression analysis of TAG1.

Pronounced changes in the expression domain of SlCLV3 and SlWUS in the lc and fas NILs

To investigate whether the temporal-spatial expression patterns of SlCLV3 and SlWUS were changed in the NILs compared to wild type, we performed RNA in situ hybridization (Figure 2.12; 2.13). In wild type, SlCLV3 transcripts were detected in a group of cells at the apex of FMs and within the developing gynoecium at 7 dpi, when carpel primordia had initiated (Figure 2.12A-C). In lc, SlCLV3 also exhibited a steady expression from FMs to floral buds at 7 dpi, and its signal at 7 dpi was stronger compared to wild type (Figure 2.12C-F). Contrary to wild type and lc, fas and lc/fas led to a weaker expression of SlCLV3 in the floral buds at 3 dpi, when all the sepal primordia

30 were initiated (Figure 2.12H, J). Notably, we did not detect any visible differences of the SlCLV3 expression in FMs between different genotypes (Figure 2.12A, D, G, I). Evaluation of SlWUS expression domains among genotypes revealed that SlWUS was expressed in the organizing center of FMs, resembling the SlCLV3 expression pattern (Figure 2.13A-D). In FMs, we did not detect any changes in the level of SlWUS expression between genotypes. At 2-3 dpi, we observed substantial expansion of SlWUS expression domains in lc, fas, lc/fas NILs compared to wild type (Figure 2.13F-I). Nevertheless, the SlWUS expression in these NILs was constrained to the center again after 3 dpi and showed no visible differences compared to wild type (Figure 2.13K-O). Notably, SlWUS signals were still detected and maintained at a high level in the developing gynoecium of all genotypes at 7 dpi (Figure 2.13K-O). The most substantial expansion of SlWUS domain was detected in the SlCLV3 RNAi lines (Figure 2.13E, J, P, Q). Contrary to lc, fas, lc/fas NILs, SlCLV3 RNAi led to a steady lateral expansion of the SlWUS expression domain in the floral buds from 3 dpi to 7 dpi and beyond. We also examined TAG1 expression, which was hypothesized to be a downstream target of SlWUS (Figure 2.14). The results showed that TAG1 expression was activated in the apex of central zone in FMs at around 3 dpi in both wild type and fas (Figure 2.14A, D), and the expression was expanded to the whole apical dome at 4 dpi (Figure 2.14B, E). Subsequently, TAG1 expression persisted in the stamen and carpel primordia (Figure 2.14C, F). Nevertheless, no conclusive expression alterations in the floral buds between wild type and fas were observed.

Discussion lc and fas affect floral organ number and inflorescence branching

Genetic studies have identified several loci associated with the control of fruit shape and size in cultivated tomato (van der Knaap et al., 2014; Lippman and Tanksley, 2001). lc and fas contributed to extremely fasciated fruits with supernumerary locules, as a result of selection during domestication (Barrero et al., 2006; Lippman and Tanksley, 2001; Rodríguez et al., 2011). lc is more widespread in the tomato germplasm than fas (Muños et al., 2011). However, plants carrying fas usually display a more pronounced increase in locule number than lc. By developing isogenic lines containing single and double natural mutants, more precise comparisons of the effects of both 31 loci can be carried out. In this study, we showed that lc and fas led to enlarged floral meristems with increased floral organ number, and fas had the strongest effect on these traits. lc and fas showed a stronger impact on the development of the innermost whorl of the flower, and weaker impact on the perianth, stamen and inflorescence branching. These results were consistent with the findings in Arabidopsis and rice, where the effects of CLV3 were more evident in the innermost whorl of the flower (Chu et al., 2006; Clark et al., 1995; Kayes and Clark, 1998). During Arabidopsis carpel development, floral meristems are transformed into carpel primordia before termination of meristem activity (Schoof et al., 2000). Therefore, lc and fas produced extra locules probably by increasing meristem cell population and delaying termination of the meristem activity. In SlCLV3 RNAi lines, we observed a reiteration of IM development inside the FM, and formation of ectopic carpels within the carpel. These phenotypes may be due to much lower SlCLV3 expression in the transgenic lines compared to the natural mutants. The fasciated inflorescences in lines carrying fas suggested that tomato CLV-WUS circuit affects the branching pathway, consistent with similar phenotypes caused by Arabidopsis clv1 and clv3 mutations (Fletcher et al., 1999). However, the inflorescence architecture in tomato is different from that in Arabidopsis. In Arabidopsis, the main IM can grow indefinitely and generate either the floral or branch meristems, while the IM in tomato undergoes a sympodial growth, of which a new floral meristem and sympodial IM are generated at the same time (Park et al., 2014; Teo et al., 2014). Therefore, detailed analysis of CLV3-WUS target genes in tomato might help unravel the regulatory mechanism in inflorescence branching. Although synergistic interactions between lc and fas in regulating locule number were detected, the effect of lc alone was minimal on these traits. In Arabidopsis, shoot apical meristem activity is controlled by CLV-WUS feedback loop (Schoof et al., 2000; Brand et al., 2000). Therefore, it is possible that the weak effect of lc is due to the limited delay of SlWUS downregulation or due to the suppression of SlWUS from wild type FAS allele. In addition, the effect of lc on locule number is more pronounced in cultivated tomato, suggesting that other unknown lc interactions exist in the cultivated background (Lippman and Tanksley, 2001; Muños et al., 2011).

Conserved regulatory mechanism between LC-FAS and CLV-WUS

Results from expression analysis revealed that SlCLV3 was significantly downregulated and SlWUS was significantly upregulated in the SYM of fas. On the other hand, as SlWUS was upregulated in lc, SlCLV3 expression was also upregulated in SYM and persisted at a high level in late-stage floral development. These results support our hypothesis that lc is caused by a gain-of- function mutation of SlWUS, while fas is caused by a loss-of-function mutation of SlCLV3. In Arabidopsis, CLV3 negatively regulates WUS, while WUS positively regulates CLV3 (Schoof et al., 2000). Our results suggested the genetic mechanism underlying CLV-WUS feedback loop in Arabidopsis is conserved in tomato. With respect to in situ hybridization results, although we have observed a slight expansion of SlWUS expression domain in floral buds in all mutants at 2-3 dpi (Figure 2.13), differential SlWUS expression was not observed between genotypes at 2 dpi from the RNA-seq results. It is possible that the size of FM increased at the same rate as the SlWUS expression domain expanded in mutants. Therefore, SlWUS expression did not reveal at a higher level in lc, fas and lc/fas NILs at 2 dpi in the RNA-seq results. Similarly, in SlCLV3 RNAi lines, the SlWUS expression was also not altered in F&IMs and 2dpi floral buds compared to wild type. Nevertheless, our RNA-seq results showed a significant upregulation of SlWUS in floral buds at 4 dpi and 6 dpi in SlCLV3 RNAi plants. These results suggested that reducing SlCLV3 expression in the FMs might extend the SlWUS temporal expression during floral development and thus provide additional opportunities for initiating extra carpels. On the other hand, lc mutant led to a slightly upregulated SlCLV3 expression in F&IMs and a significant increase in SlWUS expression in floral buds at 6 dpi. The results were consistent with our hypothesis that the 2 SNPs present downstream of the 3’ UTR of SlWUS might abolish the suppression imposed by tomato AG. Intriguingly, SlWUS expression was also significantly upregulated in the SYMs of lc, which suggested that other unknown mechanisms were involved in the control of SlWUS expression through the CArG box in the SYM. The in situ hybridization results confirmed the expression changes of lc and fas at the cellular level. Our results showed that SlCLV3 signal was significantly weaker in lines carrying fas after 3 dpi, while the SlCLV3 signal was stronger and more persistent in lines carrying lc. In addition, the

SlWUS expression domain expanded laterally in lines carrying one or both mutations at 2-3 dpi, when sepal primordia arised. The resulting expansion of SlWUS expression correlated with the enlarged FM size at 3 and 4 dpi in lc, fas and lc/fas NILs (Figure 2.9). Nevertheless, the expansion of SlWUS signals was not observed in single and double mutants after 4-5 dpi, when petal and stamen primordia were initiated. This result might be due to the repression from other unknown suppressors occurred around 4 dpi. However, in SlCLV3 RNAi lines, SlWUS expression domain was strongly ectopically expanded and the expansion persisted to the late stages of floral development. Similar results were also observed in Arabidopsis clv3 null mutant (Brand et al., 2000; Schoof et al., 2000). Unlike Arabidopsis, in which CLV3 is expressed in the L1, L2 and L3 layer (Fletcher et al., 1999), our results showed that SlCLV3 was absent from L1 and its expression was above and partially overlapped with SlWUS expression domain in tomato. Similar results were also observed in soybean, in which GmCLV3 is absent from L1-L3 layer and its expression domain is overlapped with GmWUS below the L5 layer in SAM (Wong et al., 2013). Therefore, it is possible that the meristem regulatory mechanism is divergent across different species. Together, our results suggested that lc and fas mutations led to an expansion of SlWUS expression domain and delayed the downregulation of SlWUS, resulting in an increase of FM size and hence provided additional opportunities for floral primordia initiation. It has been reported that TAG1 is functionally related to Arabidopsis AG in stamen and carpel specification (Gimenez et al., 2016; Pan et al., 2010; Pnueli et al., 1994a). Therefore, we examined the expression of TAG1 and found that it was upregulated in lines carrying one or both mutations after 4dpi, which was possibly the consequence of the prolonged expression of SlWUS. In addition, the in situ hybridization results of TAG1 were also consistent with Arabidopsis AG expression pattern, with AG expresses at the central zone of stage two FMs and throughout the dome of the FM at stage three (Wollmann et al., 2010). These results suggest that the WUS-mediated activation of AG in Arabidopsis may be conserved in tomato. Nevertheless, more detailed analysis is required to confirm the interaction between SlWUS and TAG1 in tomato.

Figure 2.1 Floral meristem regulatory mechanism and the phenotype of clv3, wus and ag mutants. (A) CLV3-WUS pathway regulates the size of stem cell population at early stages of floral development. Afterwards, AG-WUS pathway directly and indirectly controls the termination of stem cell activity at late stages of floral development. (B) Arabidopsis wild type (WT) flower. (C) clv3-1 mutant flower, showing an increase in floral organ number and enlarged gynoecium relative to wild type. (D) wus-1 mutant flower, showing lack of carpels and stamens. (D) ag-1 mutant flower, showing supernumerary petals and lack of carpels and stamens. Mutant phenotype of Arabidopsis flowers were adapted from Yumul et al., (2013).

Figure 2.2 Schematic representation of the introgressing of lc and fas mutant alleles into wild type background. Populations used for generating transgenic lines, phenotypic analysis and transcriptional profiling were indicated.

Figure 2.3 Representation of the introgressions at LC and FAS loci in lc, fas, and lc/fas NILs. The number of genes inside the crossover and introgression region is indicated. The positions are based on tomato genome build 2.50 (SL2.50).The blank and black bar represent plants with marker genotype of homozygous LA1580 and donors, respectively. The diagonal bar represents potential heterozygous crossover region based on the genotyping data.

Figure 2.4 Complementation constructs used in this study. The pHC2 construct contains wild type SlCLV3 long-promoter, whereas the pHC4 control construct contains a shorter version of SlCLV3 promoter, recapitulating the promoter with a breakpoint in the fas mutant allele. Plasmid backbone: pHaoNM.

Figure 2.5 Schematic representation of the RNAi construct used to knock down SlCLV3 expression. The arm sequence is highlighted in red. The underlined sequence represents the genomic sequence of SlCLV3. Plasmid backbone: pKYLX71.

Figure 2.6 The arm sequence in RNAi construct only targets SlCLV3. BLASTN tool was used to confirm there were no potential off-targets.

Figure 2.7 The natural lc and fas mutant alleles lead to increased floral organs and branched inflorescences. (A) Tomato varieties containing single and double mutant alleles resulted in multilocular fruits. The wild type tomato (S. pimpinellifolium LA1589) typically contains 2 locules. Size bar=3 cm. (B) Regulatory changes in lc and fas. The genomic sequence underlying the lc mutation was aligned with the CArG box of Arabidopsis AP3 and WUS. The two SNPs underlying lc were marked in red and the putative CArG box was highlighted in grey. fas mutant allele is caused by a ~294 kb inversion with a breakpoint in the promoter region of SlCLV3. (C- E). Inflorescences, flowers and cut fruits from lc, fas, lc/fas NILs and RNAi-SlCLV3 lines. Bar =1cm. (F-I) The ratio of branched inflorescences and floral organ number in NILs and independent transgenic lines. RNAi-CR4 and RNAi-CR9 represented two independent transgenes that suppress SlCLV3 expression, whereas pHC2-6-2 and pHC2-7-2 represented two independent complementation lines. pHC4, containing a short version of the SlCLV3 promoter as transformed into fas NILs, served as a negative control for complementation test. For each genotype, 40 samples were examined for individual plant. Data from 5-6 plants was collected for NILs, while 3-7 plants for transgenic lines. A two-tailed t-test was performed between mutants and wild type. Significant differences are indicated by asterisks. *P<0.01, **P< 0.001, ***P< 0.0001.

Figure 2.8 Phenotypic analysis of SlCLV3 RNAi plant. (A) Locule number was dramatically increased in SlCLV3 RNAi plant. Aberrant seed development and ectopic fruit structure, with extra carpels produced inside the primary carpel, were also observed. (B) Reduced complexity of the compound leaf, leaflet number, and widen leaflets in transgenic lines. (C) Ectopic formation of an inflorescence inside a flower in transgenic lines.

Figure 2.9 Floral meristem enlargement and fasciated inflorescences caused by lc and fas. (A) The phenotype of the first inflorescence in lc, fas, lc/fas NILs and wild type. Red arrow indicates floral meristem. (B-C) Measurement of floral meristem width in lc, fas, lc/fas NILs and wild type at 3 and 4 dpi, respectively. The red dash arrow marks the width used to measure the meristem size. (D-E) Quantification of FM width from lc, fas, lc/fas NILs and wild type. Data are shown as means±s.d., n=5-9. A two-tailed t-test was performed between mutants and wild type. Significant differences are indicated by asterisks. *P<0.01, **P< 0.001. Scale bar = 100µm.

Figure 2.10 Expression analysis of SlCLV3, SlWUS, SlYABBY2 and TAG1 in floral buds among NILs at five developmental stages: sympodial shoot apical meristem (SYM), floral meristem with inflorescence meristem (F&IM), 2 dpi, 4 dpi and 6 dpi. The expression levels are normalized using Reads per Million reads (RPM). Data are shown as means±s.d. from three biological replicates. The p-value was obtained from linear-based LRT() function between mutants and wild type using DEseq2 in R. Significant differences are represented by asterisks. * P<0.05.

Figure 2.11 Comparisons of SlCLV3 and SlWUS mRNA expression between RNAi-SlCLV3 and wild type plants. (A) SlCLV3 and (B) SlWUS expression levels across developmental stages. Data are shown as means±s.d. using RPKM normalization from four biological replicates. The adjusted p-value was obtained from pairwise comparison between mutants and wild type through DEseq2 in R. Significant differences are represented by asterisks. *adjust P<0.05. Scale bars =1 cm (A) and 5 cm (B).

Figure 2.12 SlCLV3 expression is much lower in fas and lc/fas NILs in floral buds at 3 dpi compared to wild type. (A, D, G, I) Floral meristems. (B, E, H, J) floral buds at 3 and 4 dpi, when sepal and stamen primordia arised. (C, F) floral buds at 7 dpi, when carpel primordia formed a central column. Scale bar = 100µm.

Figure 2.13 SlWUS expression domain is expanded in all NILs and RNAi lines at 2 to 3 dpi floral buds comparing to wild type. (A-E) Floral meristems. (F-I) Floral buds at 3 dpi, when sepal primordia arised. (K, M, P) Floral buds at 4 dpi, when petal primordia arised. (L, N, O, Q) floral buds at 7 dpi, when carpel primordia formed a central column. Scale bar = 100 µm.

Figure 2.14 in situ hybridization to detect TAG1 signal. (A-F) In situ hybridization results using the TAG1 antisense probe. (A, D) floral buds at 3 dpi when sepals were initiated. (B, E) floral buds at 4 dpi when stamen primordia arise. (C, F) floral buds at 7-8 dpi when carpel primordia formed a central column and elongated. Scale bar = 100 µm.

Table 2.1 Markers used for the selection of the lc and fas NILs.

Locus Marker Type Forward (5' - 3') Reverse (3' - 5') Note LC 13EP270 dCAPs AATCCTGAATGAGGGAAGAC CTAGGTAGGAAGTGAACTGC 11EP205 (HP51) InDel AATTCATGAGAAGATGATGATG ATAGTAGCCACCATAGCCAC 11EP7 dCAPs GCCGAACACATCAACATTTC CCTTTTCCTAAAAGATTTGGCATGAAG lc SNPs 13EP264 dCAPs CCGCAAAAGTAGTTGATAGC GGTTCACCACTCCTTTTATCTAATAGTA FAS 11EP197(HP43) InDel TGTCGCTATCTAATGACTGG CCCTTATACCAAACAAGCAC EP1802 InDel CATCACCACTATCACCACCA GCTGATGTTGATGACTCGGA EP1069 InDel CCAATGATAATTAAGATATTGTGACG CAGAAATCAGAGTCCAATTCCA fas inversion EP1806 InDel GTGATTATTTCCATAGTGGC CACCATAAGCAAAACCTGTG

Table 2.2 Markers used to genotype transgenic plants carrying wide type long-promoter SlCLV3 allele.

Primers Primer pairs sequence(5'-3') position size 12EP683 pBINF1 AAATGGGATAACGGAGGAAG pHC2: 244-263 (-) 324 bp pBINF1 TGTTGTGTGGAATTGTGAGC pHC2: 18,193-18,212 (+) 12EP684 12EP140 CCGCTAATAGAGGGACAACA pHC2: 9,311-9,330 (+) 428 bp 12EP140 GCACATACAAATGGACGAACG pHC2: 9,718-9,738 (-)

Table 2.3 Summary of 3’ Tag RNA-seq alignment statistics

Rep Sample Total # Clean % of #Unique % of # Successful % of reads raw raw clean mapped Unique reads mapped mapped to reads reads raw reads mapped to annotated reference reads reads genes gene 1 R1-WT-SAM 9,111,554 5,030,437 55.2% 4,761,502 94.7% 4,112,955 81.8% 1 R1-WT-FM 8,553,446 4,596,478 53.7% 4,329,347 94.2% 3,712,597 80.8% 1 R1-WT-2dpi 7,727,217 4,071,465 52.7% 3,839,132 94.3% 3,307,435 81.2% 1 R1-WT-4dpi 10,465,841 5,000,478 47.8% 4,697,251 93.9% 4,070,597 81.4% 1 R1-WT-6dpi 7,654,823 3,985,466 52.1% 3,748,483 94.1% 3,244,672 81.4% 1 R1-SA50-SAM 9,007,652 4,063,856 45.1% 3,820,513 94.0% 3,257,492 80.2% 1 R1-SA50-FM 8,228,361 4,337,650 52.7% 4,095,500 94.4% 3,504,939 80.8% 1 R1-SA50-2dpi 10,227,751 5,230,322 51.1% 4,931,057 94.3% 4,221,448 80.7% 1 R1-SA50-4dpi 13,649,986 6,396,881 46.9% 6,010,389 94.0% 5,207,895 81.4% 1 R1-SA50-6dpi 16,351,384 8,397,823 51.4% 7,917,188 94.3% 6,896,601 82.1% 1 R1-SA51-SAM 8,487,436 4,191,335 49.4% 3,949,223 94.2% 3,392,544 80.9% 1 R1-SA51-FM 9,231,597 5,043,787 54.6% 4,778,665 94.7% 4,136,723 82.0% 1 R1-SA51-2dpi 10,662,282 5,897,445 55.3% 5,588,012 94.8% 4,857,317 82.4% 1 R1-SA51-4dpi 12,701,190 6,112,890 48.1% 5,747,030 94.0% 4,973,272 81.4% 1 R1-SA51-6dpi 12,998,707 6,339,626 48.8% 5,972,868 94.2% 5,182,557 81.7% 1 R1-SA52-SAM 12,919,754 6,610,804 51.2% 6,234,346 94.3% 5,356,125 81.0% 1 R1-SA52-FM 11,078,660 6,100,872 55.1% 5,776,458 94.7% 4,995,909 81.9% 1 R1-SA52-2dpi 7,273,364 4,071,270 56.0% 3,847,380 94.5% 3,332,479 81.9% 1 R1-SA52-4dpi 10,749,900 5,185,597 48.2% 4,881,961 94.1% 4,214,978 81.3% 1 R1-SA52-6dpi 8,515,526 3,612,337 42.4% 3,380,683 93.6% 2,956,877 81.9% 2 R2-WT-SAM 11,758,899 6,332,278 53.9% 5,989,049 94.6% 5,146,857 81.3% 2 R2-WT-FM 10,696,386 5,683,756 53.1% 5,369,228 94.5% 4,594,731 80.8% 2 R2-WT-2dpi 12,336,165 6,360,887 51.6% 6,002,741 94.4% 5,185,519 81.5% 2 R2-WT-4dpi 8,856,000 4,387,780 49.5% 4,101,764 93.5% 3,452,870 78.7% 2 R2-WT-6dpi 8,875,343 4,269,581 48.1% 4,017,707 94.1% 3,473,836 81.4% 2 R2-SA50-SAM 9,529,255 4,946,808 51.9% 4,652,469 94.0% 3,981,246 80.5% 2 R2-SA50-FM 8,238,198 3,969,392 48.2% 3,734,643 94.1% 3,191,554 80.4% 2 R2-SA50-2dpi 12,982,201 6,831,762 52.6% 6,453,900 94.5% 5,574,556 81.6% 2 R2-SA50-4dpi 4,805,737 2,448,057 50.9% 2,291,819 93.6% 1,940,413 79.3% 2 R2-SA50-6dpi 8,028,907 3,649,816 45.5% 3,407,294 93.4% 2,946,796 80.7% 2 R2-SA51-SAM 5,583,046 2,774,752 49.7% 2,587,855 93.3% 2,189,340 78.9% 2 R2-SA51-FM 7,472,355 3,795,704 50.8% 3,542,686 93.3% 3,004,605 79.2% 2 R2-SA51-2dpi 8,303,345 4,352,108 52.4% 4,057,241 93.2% 3,491,856 80.2% 2 R2-SA51-4dpi 4,938,574 2,392,438 48.4% 2,232,195 93.3% 1,926,586 80.5% 2 R2-SA51-6dpi 3,827,010 1,790,443 46.8% 1,667,338 93.1% 1,439,372 80.4% 2 R2-SA52-SAM 7,179,481 3,346,135 46.6% 3,113,962 93.1% 2,613,660 78.1% 2 R2-SA52-FM 11,461,121 5,649,872 49.3% 5,262,330 93.1% 4,429,928 78.4% 2 R2-SA52-2dpi 9,290,825 4,605,318 49.6% 4,301,218 93.4% 3,653,095 79.3% 2 R2-SA52-4dpi 7,939,247 3,779,665 47.6% 3,525,248 93.3% 3,030,085 80.2% 2 R2-SA52-6dpi 10,336,288 4,899,184 47.4% 4,561,532 93.1% 3,922,276 80.1%

Rep. Sample Total # Clean % of #Unique % of # Successful % of raw raw reads clean mapped Unique reads mapped reads reads raw reads mapped to annotated mapped reads reads genes to reference gene 3 R3-WT-SAM 8,478,828 3,916,845 46.2% 3,638,370 92.9% 3,089,885 78.9% 3 R3-WT-FM 14,070,887 7,300,487 51.9% 6,849,253 93.8% 5,875,490 80.5% 3 R3-WT-2dpi 8,388,552 4,037,885 48.1% 3,770,142 93.4% 3,206,863 79.4% 3 R3-WT-4dpi 9,481,760 5,020,830 53.0% 4,705,420 93.7% 4,070,491 81.1% 3 R3-WT-6dpi 12,603,317 6,460,592 51.3% 6,049,222 93.6% 5,229,589 80.9% 3 R3-SA50-SAM 10,749,138 5,092,913 47.4% 4,736,027 93.0% 4,010,767 78.8% 3 R3-SA50-FM 8,398,223 4,336,578 51.6% 4,061,447 93.7% 3,467,869 80.0% 3 R3-SA50-2dpi 7,085,198 3,649,239 51.5% 3,412,774 93.5% 2,916,310 79.9% 3 R3-SA50-4dpi 7,294,887 3,546,686 48.6% 3,313,069 93.4% 2,850,519 80.4% 3 R3-SA50-6dpi 9,733,338 4,856,247 49.9% 4,539,276 93.5% 3,913,666 80.6% 3 R3-SA51-SAM 7,155,161 3,312,590 46.3% 3,082,310 93.0% 2,610,256 78.8% 3 R3-SA51-FM 5,116,566 2,684,284 52.5% 2,518,073 93.8% 2,140,524 79.7% 3 R3-SA51-2dpi 8,138,655 4,194,102 51.5% 3,929,835 93.7% 3,357,751 80.1% 3 R3-SA51-4dpi 6,784,974 3,334,427 49.1% 3,116,661 93.5% 2,685,149 80.5% 3 R3-SA51-6dpi 11,017,665 5,112,539 46.4% 4,760,054 93.1% 4,060,606 79.4% 3 R3-SA52-SAM 6,664,334 3,008,725 45.1% 2,791,567 92.8% 2,353,049 78.2% 3 R3-SA52-FM 6,334,452 3,135,194 49.5% 2,926,650 93.3% 2,489,978 79.4% 3 R3-SA52-2dpi 7,467,525 3,993,808 53.5% 3,741,081 93.7% 3,193,248 80.0% 3 R3-SA52-4dpi 6,525,911 3,102,081 47.5% 2,891,759 93.2% 2,470,827 79.7% 3 R3-SA52-6dpi 932,237 350,746 37.6% 321,868 93.26% 272,465 77.7%

Table 2.4 Complementation test of pHC2, pHC4 on locule number. Student t-test was used to determine the significance between transgenic and non-transgenic plants.

Generation Genotype Transgenic Number of Plants Ave LC ± SD p value (T-Test) T0 pHC4 short-pSlCLV3 18 2.667 ± 0.913 6.88E-03 pHC2 long-pSlCLV3 19 2.005 ± 0.013 T1-pHC2 13S28 NT 8 2.775 ± 0.099 5.34E-08 13S28 T 8 2.013 ± 0.019 T1-pHC2 13S31 NT 8 2.642 ± 0.134 2.75E-06 13S31 T 8 2.000 ± 0.000

Table 2.5 Comparisons of inflorescence branching, floral organ and locule number among genotypic classes. For NILs and RNAi lines, 40 samples were measured for each plant, while, for pHC2, 20 samples were measured. Pairwise comparisons between the genotypes were made using ANOVA and Tukey’s HSD test with p< 0.05.

Inflorescence Plant Stamen Genetic branch Sepal number Petal number Locule number Construct N number background number Wild Type 6 1.000 ± 0.000 a 4.992 ± 0.020 a 4.992 ± 0.020 a 4.992 ± 0.020 a 2.000 ± 0.000 a LA1589 NA lc 5 1.005 ± 0.011 a 4.995 ± 0.011 a 4.990 ± 0.022 a 4.955 ± 0.062 a 2.010 ± 0.014 a LA1589 NA fas 5 1.055 ± 0.021 a 5.090 ± 0.049 a 5.065 ± 0.038 a 5.065 ± 0.038 a 2.485 ± 0.101 ab LA1589 NA lc/fas 6 1.088 ± 0.034 a 5.475 ± 0.160 a 5.388 ± 0.154 a 5.383 ± 0.140 a 3.321 ± 0.127 b LA1589 NA

RNAi_CR4 4 1.875 ± 0.911 b 7.269 ± 0.727 b 7.338 ± 0.550 b 7.194 ± 0.527 b 6.024 ± 0.434 c LA1589 RNAi-SlCLV3, >6 copies.

RNAi_CR9 7 2.004 ± 0.126 b 7.475 ± 0.552 b 7.536 ± 0.456 b 7.546 ± 0.531 b 5.950 ± 0.986 c LA1589 RNAi- SlCLV3, 1 copy. T1, Genomic construct of wild pHC2-6-2 3 1.000 ± 0.000 a 5.000 ± 0.000 a 5.000 ± 0.000 a 4.983 ± 0.129 a 2.000 ± 0.000 a LA1589, fas type SlCLV3, 2 copies. T1, Genomic construct of wild pHC2-7-2 3 1.000 ± 0.000 a 5.000 ± 0.000 a 4.967 ± 0.181 a 4.915 ± 0.279 a 2.000 ± 0.000 a LA1589, fas type SlCLV3, 4 copies.

Table 2.6 Comparisons of fruit perimeter, area and weight between wild type, lc, fas and lc/fas NILs. The fruit weight of each plant is measured from 20 ripe fruits. The fruit perimeter and area are measured from 8 to 10 ripe fruits though tomato fruit analyzer version 3.0. Pairwise comparisons between the NILs were performed with ANOVA and means are separated by Tukey's HSD test.

Plant Fruit Area Fruit Weight (g/per Fruit Perimeter (cm) N (cm) fruit) Wild type 6 3.707±0.083 a 1.000±0.043 a 0.810±0.061 a lc 5 3.773±0.106 a 1.034±0.056 a 0.835±0.063 a fas 5 3.943±0.094 b 1.125±0.054 b 0.914±0.063 ab lc/fas 6 4.095±0.092 b 1.215±0.055 c 0.971±0.060 b

Table 2.7 Effects and interactions of lc and fas on the traits of mature fruits. Significant effects and interactions were shown by the p-values computed from the F ratio in ANOVA.

Pr > F Population Traits lc fas lc x fas 12S190(BC8) Locule number < 0.001 < 0.001 < 0.001 Fruit weight < 0.001 < 0.001 0.963 13S133(BC9F2) Locule number < 0.001 < 0.001 < 0.001 Fruit weight 0.063 < 0.001 0.544 Fruit area 0.003 < 0.001 0.234

Table 2.8 Degree of dominance of lc and fas mutant alleles in LA1589 background. a: the mean of phenotypic effects of homozygous S. lycopersicum allele; b: the mean of phenotypic effects of heterozygous alleles; c: the mean of phenotypic effects of homozygous S. pimpinellifolium; d: degree of dominance of S. lycopersicum allele. d/a=(2Aa-AA-aa)/(AA-aa). AA: homozygous S. pimpinellifolium alleles. aa: homozygous S. lycopersicum alleles. Aa: heterozygous alleles.

Population Traits Locus N AA meanᵃ N Aa meanᵇ N aa meanᶜ d/aᵈ 12S190(BC8) Locule number lc 10 2.318 7 2.123 9 2.022 -0.32 fas 10 3.238 9 2.094 9 2.022 -0.882 lc/fas 9 4.322 8 2.272 9 2.022 Fruit weight lc 10 1.535 8 1.414 9 1.331 -0.187 fas 10 1.723 9 1.455 9 1.331 -0.365 lc/fas 9 2.014 8 1.552 9 1.331

Chapter 3. Transcriptome analysis of lc and fas controlling tomato fruit development

Abstract

The rapid advancement of next generation sequencing (NGS) technology provides researchers an efficient way to capture transcriptional dynamics on a genome-wide scale. Although many fast and easy RNA-seq library preparation kits are readily available, the current cost for NGS is still a major barrier in high-throughput sequencing. In the first part of this chapter, we presented the 3’ Tag RNA-seq library preparation protocol that could reduce the expenditures through increasing the level of multiplexing. Compared to the standard whole mRNA-seq method, the 3’ Tag RNA- seq obtained higher reproducibility between biological replicates. In addition, the 3’ Tag RNA-seq method provided similar capacities in discovering expressed genes, compared to the standard whole mRNA-seq method. In the second part of this chapter, the 3’ Tag RNA-seq method was used to conduct a transcriptome analysis to reveal the differences between WT, lc, fas and lc/fas, using vegetative meristems, reproductive meristems and young floral buds. We found that the fasciated fruit shape was associated with changes of gene expression in the meristem function, patterning specification, sterol biosynthesis and microtubule motor activity. In addition, cytokinin biosynthesis and signaling genes had higher expression levels in lc and fas compared to WT, while the brassinosteroid biosynthesis genes showed an inversed trend. Our RNA-seq results have provided new insights into the transcriptional networks that modulate the meristem maintenance and floral organ determinacy in tomato.

Introduction

In recent years, RNA-seq technology has become a standard transcriptome analysis tool in studying plant development, plant-microbe interactions, plant response to internal and external cues, plant ecology and evolutionary biology. Searching the Google Scholar database using the term “RNA-seq” with “Arabidopsis”, “Maize” and “Tomato” returned a trend of exponential growth of studies using RNA-seq in the last six years (Figure 3.1). Recent advances of large-scale gene expression analysis have provided opportunities to generate large datasets to elucidate the regulatory modules. Many of these RNA-seq data have been integrated with other biological network information, such as protein-DNA interactome and proteome in deciphering important biological processes (Eveland et al., 2014; Walley et al., 2016). Identifying novel factors or gene expression modules using these system-level approaches has become a major focus in studying plant development. RNA-seq data are often used in exploring the underlying molecular mechanisms that could explain the mutant phenotypes (Clevenger et al., 2015; Sun et al., 2015; Xiao et al., 2016; Zhang et al., 2015). Natural alleles for tomato shape and weight have been selected during domestication of tomato and several of the underlying genes are now been identified (van der Knaap et al., 2014). To investigate the roles of these natural alleles on fruit morphology, near isogenic lines (NILs) are often created prior to developmental and molecular studies. However, the introgression of one allele to another genetic background is time consuming and can be challenging due to the lack of recombination surrounding the gene of interest. Koenig et al., (2013) reported that, among the 131 genes differentially expressed (DE) between isogenic lines (ILs) carrying the donor introgression (S. pennellii) versus the recipient (S. lycopersicum), almost half of genes were located in the introgressed region. In addition, most of the DE genes (DEGs) in the introgression of ILs exhibited the donor-like expression. Similar results were also found in maize. The RNA-seq analysis related to starch quantitative traits in maize kernel identified up to 71% of these DEGs fell within the introgressed region in the NILs (Xiao et al., 2016). The large introgression might cause new expression phenotypes outside of the introgressed region, which can be unrelated to the gene of interest (Koenig et al., 2013). This raises a concern of increased false positive rate in identifying DEGs. Therefore, the starting materials for an RNA-seq experiment should be carefully chosen. 60

Library preparation is another important step for transcriptome analysis. Many of the widely used protocols for RNA-seq library construction, such as Illumina TruSeq Stranded mRNA library preparation kit and NEBNext Ultra II RNA library preparation kit, are cost-prohibitive for many researchers. Moreover, these kits are used for whole mRNA-seq sequencing and a greater sequencing depth is required to precisely quantify the reads mapped to the entire length of the gene. Normally, 20 to 30 million raw reads per sample are recommended for a whole-mRNA sequencing experiment. The stringent requirement of high depth limits the number of libraries pooled per lane to a maximum of eight libraries on the Illumina Hiseq 2500 platform. The initial high cost of sequencing in the past has forced researchers to reduce the number of biological replicates as well as the sequencing depth for each sample. Consequently, this might significantly reduce the power in detecting DEGs. In this Chapter, a low-cost RNA-seq alternative was evaluated and adapted to our study. Specifically, a pipeline suitable for RNA-seq library preparation at a minimal cost was optimized for studying floral development in tomato. Meyer et al., (2011) presented a 3’ Tag RNA-seq approach that solely focused on sequencing the 3’ end of mRNA. This 3’ Tag RNA-seq method requires only 5 million reads per sample, which can significantly reduce the cost for sequencing per sample by allowing a higher degree of multiplexing. Additionally, 3’ Tag RNA-seq can greatly improve the accuracy in identifying low abundant transcripts compared to the whole mRNA-seq (Lohman et al., 2016; Moll et al., 2014). However, the 3’ Tag method has some drawbacks that should be considered before use. For example, the 3’ Tag method is unable to distinguish alternative spliced transcript variants as well as to define polymorphisms in the 5’ end of the gene. Nevertheless, for the purpose of our study, the advantages of 3’ Tag RNA-seq approach outweighs its disadvantages. Here, we showed that the 3’ Tag RNA-seq method is suitable for an accurate and affordable transcriptome analysis. Tomato is an ideal model for studying berry fruit development, with a remarkable diversity in fruit shape, size, weight, and locule number. The increase in locule number is typically correlated with increase in fruit weight and size. Tomato locule number is mainly affected by two loci, lc and fas, known as tomato WUS and CLV3, respectively (Muños et al., 2011; Rodríguez-Leal et al., 2017; Xu et al., 2015). These two homologous genes in Arabidopsis control the size of meristem

61 cell population by sharing a feedback regulatory loop. The knowledge of regulatory networks underlying important developmental mechanisms, such as meristem maintenance and floral patterning, have been greatly contributed by the studies using Arabidopsis as a model. Busch et al., 2010 and Leibfried et al., 2005 have identified a large set of genes that are differentially expressed in response to WUS expression in the SAM by comparing inducible overexpression allele of WUS versus the wus mutant in Arabidopsis seedlings. The gene ontology (GO) analysis shows that the DEGs induced by WUS are mostly involved in meristem and stem cell maintenance, metabolic process (auxin biosynthesis), and response to various stimuli (Busch et al., 2010). Overexpression of WUS also positively regulates cytokinin (CK) signaling by directly repressing Type-A RESPONSE REGULATER (ARR) genes, while negatively regulates auxin biosynthesis and signaling (Busch et al., 2010; Leibfried et al., 2005). Despite intensive investigations on the transcriptional control of WUS in Arabidopsis, it is still unclear how WUS in the FM might affect floral organ patterning. Therefore, transcriptional profiling using FMs carrying lc or/and fas may uncover novel components orchestrating tomato meristem development. In the second part of this chapter, we applied the 3’ Tag RNA-seq to elucidate DEGs that could potentially modulate floral meristem size and organ number in tomato. We showed that lc and fas affected a plethora of biological processes including meristem maintenance, floral development, microtubule binding, hormone biosynthesis, metabolite biosynthesis as well as response to environmental stimuli. By performing the cluster analysis, we also successfully captured several co-expressed DEGs involved in sterol/brassinosteroid biosynthesis and microtubule motor activity. In conclusion, we have established and validated a 3’ Tag RNA-seq pipeline for transcriptome analysis in tomato. We have also identified candidate components involved in LC-FAS pathway on a genome-wide scale. Results of this study will be valuable resources for data mining and pathway integration in the future.

Materials and Methods

Plant material, growth conditions, and tissue collection

The 3’ Tag mRNA-seq part is as described in Chapter 2 Materials and Methods. For the whole mRNA-seq, tissues were collected from wild type, lc, fas and lc/fas NILs at three developmental stages, each with four replicates. The first stage included inflorescence meristems, floral meristems and the youngest floral buds. The second and third stage included floral buds at 4 and 6 dpi, respectively. Plants were grown in two-gallon pots under natural light supplemented with artificial light (16/8 hr light/dark cycle) in the greenhouse in Wooster, OH, USA, 2013. For each genotype, 100 to 150 young inflorescences (the largest floral bud was smaller than 0.5 cm) from six individual plants were collected using forceps. For each replicate, tissues were weekly collected during 10 am to 12 pm in the greenhouse over four weeks.

RNA extraction for RNA-seq

As described in Chapter 2 Materials and Methods

RNA-seq library construction and sequencing

An overview of library constructions between the 3’ Tag RNA-seq and whole mRNA-seq is shown in Figure 3.2. For the 3’ Tag RNA-seq, the library construction method is as described in Chapter 2. The 3’ Tag RNA-seq method presented in this study included a number of modifications to original Tagseq method of Meyer at al., 2011: 1) Poly-A enrichment was performed prior to the RNA fragmentation to reduce rRNA contaminations. 2) RNA fragmentation efficiency was increased by using the first strand synthesis buffer (Invitrogen) containing magnesium. 3) Replaced the Titanium Taq polymerase (Clontech) with AccuPrime Taq polymerase (Invitrogen) that yielded less GC bias in Illumina reads (Aird et al., 2011). 4) Replaced gel extraction-based cDNA size selection with AMPure XP bead selection, which greatly reduced cDNA loss and was more time-efficient. For the whole mRNA-seq, strand-specific RNA libraries of approximately 250 bp fragments were prepared following the protocol of Zhong et al., 2011. Briefly, six libraries were barcoded

63 and pooled in one lane. The RNA-seq libraries were sent to the Illumina HiSeq2000 at Genomic Resources Core Facility at Weill Cornell Medical College for single–end sequencing. After filtering low quality reads and de-multiplexing, the quality of 51 bp raw reads were checked through FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/).

Comparisons between 3’ Tag RNA-seq and whole mRNA-seq

The Pearson correlation coefficients (PCCs) of gene expression between the 3’ Tag RNA-seq and whole mRNA-seq were calculated. Gene expression levels were normalized using RPM (Reads Per Million) and RPKM (Reads Per Kilobase per Million) for 3’ Tag RNA-seq and whole mRNA-seq, respectively. The PCCs between these two methods were calculated using samples from the same genotypes and identical developmental stages. Principle component analysis was performed to evaluate the sample-to-sample distance using rlog transformed raw counts through DEseq2 in both method. Heatmap analysis was also conducted with 680 DEGs to examining relationships between samples of different genotypes and developmental stages using hierarchical clustering.

RNA-seq data analysis

Methods for the alignment and raw read counts per gene are as described in Chapter 2. The significance of differentially expressed genes (DEGs) was determined by linear factorial modeling in DEseq2, of which likelihood ratio test was applied (Clevenger et al., 2017). To identify genes with significant genotype effects using DEseq2 in R, the full model (Genotype + Time) and reduced model (Time) were used to test whether the observed differences in read counts of a given gene between genotypes were significantly larger than the variations between developmental stages and replicates. Similarly, genes with significant genotype by time point interactions were identified form the full model using (Genotype + Time + Genotype*Time) as well as the reduced model (Genotype + Time). For the genotype category, DEGs with adjusted p-value < 0.1 in at least one comparison were selected, whereas the threshold of p-value <0.001 was used for selecting DEGs with interaction effects. The p-value was adjusted with the default Benjamini-Hochberg method in DEseq2. The relatively lower stringency (adj.P < 0.1) was used as a cutoff in the 64 genotype category because of the weak cis-regulatory mutant alleles at lc and fas. In addition, because very few DEGs (7 genes) were identified in the interaction category with adj.P< 0.1, we objectively selected a p-value cutoff at SlWUS, close to the p-value < 0.0001 significance. As a results, 675 DEGs were identified. To obtain an overview of enriched Gene Ontology (GO) terms for the 675 DEGs, Arabidopsis homologs of these DEGs were used as inputs in the Cytoscape plug-in, GlueGO v2.1.6 (Bindea et al., 2009). To identify co-expressed genes, samples were clustered based on the normalized expression (Z-score) of wild type (WT) across four developmental stages (F&IM, 2dpi, 4dpi, and 6dpi). By using the Mfuzz package (Kumar and E. Futschik, 2007) with K-mean algorithm in R, DEGs were grouped into eight clusters. Furthermore, to identify a core of genes showing similar expression dynamics in mutants within each cluster, expression values from lc, fas and lc/fas NILs were Z-score normalized with WT. The normalized expression values were used to calculate PCCs between gene pairs within each cluster. To select the core co-expressed genes, the PCC matrix was hierarchically clustered using Ward’s method and visualized through heatmap3 in R (Zhao et al., 2014). DEGs clustered within the hierarchical sub-group were objectively selected as a sub-cluster as they were tightly co-expressed among WT and mutants through different developmental stages. The significantly DEGs from the linear factorial model analysis were also used to construct the Venn diagrams. To extract DEGs between lc, fas and lc/fas versus wild type at each time point, the Wald test was used to extract pairwise-comparison contrasts from the DEseq2 results. For the purpose of identifying overlapping DEGs between lc, fas and lc/fas, we used a relatively relaxed cutoff (p-value < 0.05) for each pairwise comparison. DEGs overlapping between mutants at each of five developmental stages were sorted out and presented with the Venn diagram (VENNY 2.1, http://bioinfogp.cnb.csic.es/tools/venny/index.html).

Phylogenetic analysis

Phylogenetic tree analysis was performed to assigned 9 differentially expressed kinesin genes to one of 10 plant kinesin families. To retrieve the kinesin protein sequences in tomato, full-length protein sequences were downloaded from the International Tomato Annotation Group release 3.20 predicted proteins (ITAG 3.20) (http://solgenomics.net/). To retrieve the Arabidopsis kinesin

65 proteins, we selected kinesin genes based on Zhu and Dixit, (2012) and downloaded their sequence from The Arabidopsis Information Resource (TAIR) database. Kinesin proteins from other organisms were also selected based on previous analyses reported on the online website (https://labs.cellbio.duke.edu/kinesin/index.html) created by Liz Greene, Steve Henikoff and Sharyn Endow. The (Multiple Expectation Maximization for Motif Elicitation) tool (Bailey and Elkan, 1994) was used to define the conserved kinesin motifs in tomato kinesin genes. Phylogeny.fr was used to perform the MUSCHEL for multiple sequence alignment, PhyML for phylogeny tree building and visualization with neighbor-joining method based on the p-distance (Dereeper et al., 2008; Edgar, 2004).

Results

Evaluation of 3’ Tag RNA-seq method

In contrast to the whole mRNA-seq, the NILs for 3’ Tag RNA-seq were self-crossed for two additional generations to select recombinants at lc. Also, the introgression region at lc was greatly reduced in 3’ Tag RNA-seq analysis. In addition, the tissues used in the 3’ Tag method were collected from plants of different ages and under distinct environmental conditions. Despite these variables, the comparisons between whole mRNA-seq and 3’ Tag RNA-seq were still attempted to assess the quality of results from each method. The 3’ Tag RNA-seq library was sequenced via Illumina Hiseq 2500 and about 8 million single-end reads were generated per sample (Table 3.1). The whole mRNA-seq library was sequenced via Illumina Hiseq 2000 and about 24 million single-end reads were generated per sample. The assessment of read quality using FastQC revealed that the 3’ Tag RNA-seq had lower overall quality compared to the whole mRNA-seq (Table 3.1, Figure 3.3). The whole mRNA-seq had an overall high quality score Q score > 30 and 96% of the reads passed the quality filter (Figure 3.3A). In contrast, the 3’ Tag RNA-seq had a relatively low Q score along the transcript. Its base quality per position was also more varied, especially in the 3’ end of the transcript (Figure 3.3B). Additionally, the 3’ Tag RNA-seq reads were contaminated with poly-A tail signals in the 3’ end of the reads (Figure 3.3B). However, after the sequence-trimming and quality-checking, the cleaned 3’ Tag RNA-seq reads were of similar quality to that of the whole mRNA-seq (Figure 66

3.3C). Overall, the 3’ Tag RNA-seq produced a lower rate of filtered cleaned reads for alignment (Table 3.1). To examine the mapping efficiency, the percentages of trimmed and filtered reads that could be aligned to the reference genome from both methods were evaluated. The mapping efficiencies were similar in both methods, returning with 80% for 3’ Tag RNA-seq and 84% for whole mRNA- seq. The slightly lower alignment rates in 3’ Tag RNA-seq might be due to the poor annotation of the 3’ UTR regions. The number of expressed genes (>3 counts) detected in the 3’ Tag RNA-seq was approximately 57%, slightly lower than the 62% in whole mRNA-seq (Table 3.1). We plotted the distribution of the 3’ Tag RNA-seq and whole mRNA reads to the normalized transcript frames (Figure 3.4A). The whole mRNA-seq exhibited a bell shape distribution with under-represented reads mapped to 5’ and 3’ ends. As expected, the 3’ Tag RNA-seq reads covered the 3’ end of transcripts. To determine whether data from 3’ Tag-seq and whole mRNA-seq were compatible, we examined the correlation of gene expression between these two methods. The correlations between 3’ Tag and whole mRNA-seq were relatively low, with an average Pearson correlation coefficient (PCC) of 0.73 (Figure 3.4B). The correlations between time points within the same RNA-seq method were much higher (~ 0.99), suggesting that the methods are both reliable but the discrepancies might be due to variation in samples and experimental conditions. To determine the reproducibility and quality of data within experiments and to identify outliers, the correlations between replicates were calculated. The PCCs between replicates were high for both methods, especially the 3’ Tag RNA-seq (Figure 3.4C). However, certain time points, notably the 6 dpi, showed much larger variation, which suggested the large floral buds containing sepals might be more sensitive to the environmental variables or developmental noise. To view the overall variances between samples in these two methods, sample-to-sample distance was calculated and visualized using principle component analysis (PCA) and heatmap analysis (Figure 3.5A, B). The PCA results showed that the differences between developmental stages accounted for the major variances between samples in both methods. Similar results were obtained using the heatmap analysis, which employed hierarchical clustering algorithm to calculate sample-to-sample distance. Nevertheless, in the 3’ Tag RNA-seq, fas and lc/fas were

67 consistently grouped together along the developmental gradient, while, in the whole-mRNA-seq, lc and lc/fas were more closely related due to the large introgression at lc (Figure 3.5B, C). Compared to the 3’ Tag RNA-seq, a higher number of DEGs (~50%) was found within the introgressed segments (3Mb) at the lc locus in the whole mRNA-seq dataset (Figure 3.5C). In contrast, the 3’ Tag RNA-seq method showed a more random distribution of DEGs across chromosomes, because the introgressed segment was much smaller (184 kb). Together, these results indicated that larger introgression at lc caused a significant bias toward identifying DEGs. Nevertheless, 13% (adj.P< 0.05) of DEGs in 3’ Tag RNA-seq were also found in the whole mRNA-seq (Figure 3.6A). Furthermore, after incorporating the DEGs obtained from an RNAi- SlCLV3 mutant in whole mRNA-seq experiment, the percentage of overlapping DEGs increased to 41% (Figure 3.6B, Appendix D). In conclusion, although we were unable to fully assess the differences between the two methods due to multiple variables in the two independent studies, results from the two RNA-seq methods did overlap to a certain extent. This suggested that robust DEGs were likely to be identified in both studies, whereas less robust DEGs might only be detected in one of the two experiments.

Analyses of differentially expressed genes associated with meristem and floral development in lc and fas

To investigate the genome-wide expression changes resulting from mutations in lc and fas, we applied linear-factorial analysis across five developmental stages. By comparing the full to the reduced model, the groups of differentially expressed genes (DEG) were either genotype only or the interaction of genotype x developmental stage (Figure 3.7). A total of 669 and 13 DEGs were identified with significant genotype and interaction effect, respectively (Figure 3.7). With 7 genes shared by the two categories, a total of 675 unique DEGs were found for the downstream data analyses. To identify groups of genes that might be specifically affected by the mutations in lc and fas, we determined whether certain pathways were overrepresented in the dataset by a Gene Ontology (GO) enrichment analysis. Among the enriched terms, ‘meristem maintenance’, ‘flower 68 development’, ‘patterning specification process’, and ‘microtubule motor activity' were identified (Figure 3.7). These results implied that lc and fas mutants affected the genes involved in floral development and mitotic activity. Genes enriched with GO terms such as ‘steroid metabolic process’, ‘oxidation-reduction process’, ‘stress response (light/oxidative/inorganic substance)’ and ‘flavonoid biosynthesis’ were also identified, suggesting that a broad range of cellular processes were affected by lc and fas. Co-expressed genes may also highlight shared function in similar developmental pathways. We clustered DEGs based on the transcription profile across four developmental stages: F&IM, 2dpi, 4dpi, and 6dpi, using the normalized expression levels of WT and fuzzy C-means clustering leading to 8 co-expressed clusters (Figure 3.8A). For each cluster, the Arabidopsis homologs of tomato genes were used to identify enriched GO terms related to biological processes or molecular functions in each cluster (Table 3.2). Clusters with higher expression at early developmental stages (cluster 1, 2, 6) were most dramatically enriched in ‘stem cell population maintenance’, ‘reproductive structure development’, ‘regionalization’, and ‘microtubule binding activity’ (Table 3.2). DEGs with higher expression at the later developmental stages (cluster 5 and 8) were enriched in metabolic/sterol biosynthesis pathways and in response to environmental stimuli. In Arabidopsis, the WUS-CLV3 pathways has been extensively studied. This included the identification of genes that were immediate downstream of WUS by using a DEX inducible system (Busch et al, 2010). Despite the differences between the Arabidopsis and this tomato study, 91 out of 675 DEGs were identified in both studies (Appendix E). These common DEGs were potential candidates to study mechanisms involved in organogenesis and floral development that were conserved across different plant species.

DEGs co-expressed with SlWUS

WUS is a key transcription factor that is required in maintaining the stem cell population in above ground meristems in Arabidopsis (Ikeda et al., 2009). To identify genes that might be involved in stem cell regulation together with SlWUS, the PCCs between gene pairs in cluster 1 were calculated using the normalized expression levels from mutants and WT. As shown in Figure 3.8B, a set of genes highly correlated to SlWUS expression were selected (Figure 3.8B, C). The

69 selected 29 genes showed highest expression levels in the F&IM and their expression levels were reduced as the organ primordia arose and tissues became more determinate (Figure 3.8C). In addition, these genes showed higher expression levels in fas and lc/fas compared to WT, indicating their expressions might be related to expanded SlWUS expression domains. The identification of co-expressed tomato SHOOT MERISTEMLESS (STM) with SlWUS suggested that many genes in this cluster might be related to stem cell function. Six out of these 29 genes highlighted in red (Figure 3.8C) were involved in meristem or floral development based on previous studies in Arabidopsis (Irish and Sussex, 1990; Krizek, 2011; Lee et al., 2000; Lenhard et al., 2002; Omidbakhshfard et al., 2015).

Modulation of gene expression in phytosterols/brassinosteroids (BRs) biosynthesis pathway and microtubule motor activity in tomato carrying lc and/or fas mutant alleles

In cluster 5, a group of co-expressed genes encoding enzymes participated in the phytosterols (also referred to as sterol) and BRs biosynthesis pathway were found, including Arabidopsis homologs of DWARF1, DWARF 5, DWARF 7(STE1) and DET2 (Figure 3.8D, Figure 3.9). In contrast to genes co-expressed with SlWUS the expression of these genes was positively correlated to the developmental gradients. In addition, these genes were expressed at lower levels in fas and lc/fas compared to WT across different developmental stages, implying a hypothetical negative role of these genes in meristem maintenance. As sterols are precursors of BRs, membrane components and signaling molecules during plant development (Vriet et al., 2013), our results have provided new insights for potential roles of sterols/BRs in FM regulation. A subset of co-expressed genes in cluster 6 was enriched for the kinesin genes as well as some genes related to cell division (Figure 3.8E). Intriguingly, these genes were expressed at higher levels at 2dpi, indicating their expression might be positively regulated by genes mediating outer whorl initiation. In addition, these genes were more highly expressed in lc compared to fas and lc/fas, implying that their expression might be associated with the increased CLV signaling in lc. Phylogenetic analysis revealed that these kinesin genes belonged to different kinesin families (Figure 3.10). We hypothesized that these kinesin genes might act cooperatively in facilitating

70 organelle trafficking or cytokinesis events. In addition to the kinesin genes, a B type tomato cyclin gene and cellulose synthase like D6 were also co-expressed in cluster 6.

DEGs with significant genotype by developmental gradient interaction effects

The 13 DEGs that showed genotype x development interaction included the already known genes, SlCLV3 (Solyc11g071380), SlWUS (Solyc02g083950), SlYABBY2b (Solyc11g071810) (Figure 3.11). In addition, genes involved in diverse functions included the sugar transporter SlSWEET1b (Solyc04g064620) and the auxin efflux carrier SlSoPIN1a (Solyc10g078370). The SlSWEET1b encodes a transmembrane protein that its Arabidopsis homolog AtSWEET1 functions to facilitate sugar transport (Chen et al., 2010; Feng et al., 2015). Sugar transporters are known to affect meristem development through regulating sugar accumulation and distribution in the meristem (Francis and Halford, 2006; Lastdrager et al., 2014). The slpin1a loss-of-function mutation, also known as entire-2, causes aberrant organ positioning in the shoot, inflorescence and floral meristems by disrupting directional auxin transport (Martinez et al., 2016). We also identified metabolic enzymes such as glucose-6-phosphate isomerase (Solyc04g076090), ALCOHOL DEHYDROGENASE 2/SlADH2 (Solyc06g059740) involved in fatty acid degradation and the production of volatiles during fruit ripening (Speirs et al., 1998), and a close homolog of ANTHOCYANINLESS 2 (ANL2) in Arabidopsis (Solyc03g026070), which affects anthocyanin accumulation (Kubo et al., 1999). DEGs with interaction effects also included an ethylene responsive transcription factor 12/SlERF12 (Solyc03g117230), a zinc finger-like protein (Solyc10g078990), a putative DNA-directed RNA polymerase subunit beta-beta protein (Solyc06g054640), a heavy metal transport/detoxification protein (Solyc01g066880), and a non- phototropic hypocotyl 3 (NPH3) protein (Solyc11g040040) that is involved in phototropic responses and protein ubiquitination in Arabidopsis (Gingerich et al., 2005; Pedmale and Liscum, 2007).

DEGs related to cytokinin and auxin synthesis, transport and signaling processes

Cytokinin (CK) plays an important role in meristem formation and maintenance, whereas auxin is more involved in primordia initiation and differentiation (Hepworth and Pautot, 2015). In 71 this study, we did not observe a co-expressed cluster overrepresented for either CK or auxin. The DEGs related to CK and auxin were sorted in Figure 3.12. Overall, genes involved in CK biosynthesis and signaling tended to be upregulated in fas and lc/fas mutants, whereas genes related to auxin showed more variable changes.

Transcription factors differentially expressed in lc or/and fas

Plants carrying lc and fas showed very similar phenotypes in locule number changes. To understand whether lc and fas also shared common changes at the gene expression level we separated DEGs in lc, fas and lc/fas mutants at individual developmental stages (Figure 3.13A). More DEGs were shared between lc and fas in SYM than in the F&IM and floral buds. In SYM, 36% of DEGs in fas were also found in lc, whereas in F&IM, only 9.6% were found in lc (Figure 3.13A). A similar trend was observed for DEGs between lc/fas versus lc or fas. GO term enrichment analysis was conducted to reveal the common features in DEGs shared between lc, fas and lc/fas (Figure 3.13B). We separated DEGs into four categories, primary (common DEGs among lc, fas and lc/fas), secondary (common DEGs between lc and lc/fas or fas and lc/fas), lc-specific and fas-specific (Figure 3.13B). In SYM, the shared GO terms in three mutants included meristem development and transferase activity. In the floral tissues, the shared terms were meristem/floral development and patterning. Interestingly, the observation of enriched GO terms in lc-secondary and lc-specific DEGs indicated that lc was likely more involved in cell cycle process, chromatin modification, and microtubule motor activity (Figure 3.13B). In contrast, fas was possibly more involved in sterol biosynthesis, response to stimuli, and transcriptional control. To identify putative transcription factors (TFs) involved in LC-FAS pathway in the developmental processes, we searched for the DE TFs in the primary group overlapped in lc, fas and lc/fas (Figure 3.14). All the 18 TFs showed similar expression patterns in the three mutants. In addition, 16 out of 18 TFs were significantly up-regulated, while only 2 TFs were downregulated in mutants. Homeobox and MADS-box (MCM1-AGAMOUS-DEFICIENS-SRF box) TFs were all up-regulated, including the ones involved in meristem development and floral patterning, such as the tomato STM, BEL-like protein 8, TOMATO AGAMOUS1 (TAG1) and

TOMATO MADS-box 5 (TM5, a SEP3 homolog). In addition, because fasciated fruit phenotype was more severe in fas and lc/fas, we also searched for differentially expressed TFs overlapping between fas and lc/fas, but not in lc (Figure 3.15). Similarly, most of the identified TFs were upregulated, including the homeobox and MADS-box family members (Figure 3.15).

Discussion

Evaluation of the 3’ Tag RNA-seq method

Compared 3’ Tag RNA-seq with the standard whole mRNA-seq, the two methods achieved very similar quality in capturing the expressed genes. However, the 3’ Tag RNA-seq generated more low quality reads possibly due to the high multiplexing rate and the initial RNA quality. Using RNA with higher quality in our pilot experiment of the 3’ Tag RNA-seq, a relatively higher Q-score was obtained compared to the current data in this study (data not shown). We also recommended to increase the final cDNA size from 300-400 bp to 400-500 bp to avoid high poly- A tail contamination as well as to improve the alignment rate caused by poor 3’ end annotation. The low PCC between the two methods might be contributed by the following reasons: 1) The results were generated from two different Illumina platforms (HiSeq 2000 for whole-mRNA-seq and HiSeq 2500 for 3’ Tag RNA-seq). 2) The bias of read coverage along the transcripts (Figure 3.4A). 3) The inability to distinguish transcripts that do not differ at the 3' end. 4) Different plant materials (NIL populations and the age of plants) and environmental factors. The low rate of overlapping DEGs between these two methods might be due to the large introgression at lc and developmental variables. Sun et al., (2013) reported 27% and 49% of overlapping DEGs identified using Illumina PolyA and NuGEN protocols, respectively, when the same RNA from the human cells was used. Kumar et al., (2012) also showed an average of 53% and 64% of overlapping DEGs using two different RNA-seq preparation protocols with the same input RNA from tomato. These studies indicated that even with exactly the same RNA sample, the impact of library preparation protocols on the results could be varied. In this study, we pooled 30 3’ Tag RNA-seq libraries in one lane to generate an average of 8 million reads per sample. The high multiplexing number could easily produce high variations between samples. To improve the measurements of those lowly expressed genes, we recommended 73 researchers to reduce the pool of libraries to 24 to achieve 10 million raw reads per sample. This could also provide extra sequencing space for those low input cDNA libraries caused by the technical error. In summary, we showed that the 3’ Tag RNA-seq had both pros and cons compared to the traditional whole mRNA-seq. Nevertheless, the results indicated that the 3’ Tag RNA-seq could provide a cost-effective and reliable alternative for researchers with limited resources.

Mechanisms underlying LC-FAS mediated control of meristem development revealed by co- expressed gene clusters

The transcriptional network controlling tomato meristem development is still largely unexplored. Previously, we have shown that disruption of tomato CLV-WUS pathway led to enlarged meristem and fasciated fruits in lc and fas mutants. To reveal potential players participating in LC- and FAS- mediated meristem and floral development programs, a time-course RNA-seq gene expression profile was conducted. From the cluster analysis, a group of genes co- expressed with SlWUS, including tomato STM, was identified. In Arabidopsis, STM is expressed in the meristematic cells in SAMs and FMs (Long et al., 1996; Scofield et al., 2007). WUS works in parallel with STM to maintain stem cell functions, as well as prevent cells in the CZ from been adopted to the PZ for differentiation (Lenhard et al., 2002). The higher expression of tomato STM in lc, fas and lc/fas mutants might be due to the enlarged FMs and vice versa. We uncovered a cluster enriched with genes related to microtubule motor activity. This group of genes showed a higher level of expression in lc compared to WT. It is unclear why this cluster of genes expressed at relatively lower levels in the fas and lc/fas compared to lc. One explanation might be that this group of genes are activated by CLV-mediated MAPK signaling cascade (Betsuyaku et al., 2011a), and CLV activity is elevated in lc. MAPK pathway controls gene expression in a number of ways including activating TFs through phosphorylation and changing the protein-DNA binding affinity (Popescu et al., 2009). In Arabidopsis, MAPK cascade targets the TFs involved in the regulation of developmental, defense, and stress responses (Popescu et al., 2009). The tobacco MAPK cascade, positively regulates cytokinesis thorough phosphorylating NtMAP65-1, a microtubule-associated protein (Sasabe et al., 2006). In our results, we also found

74 a tomato microtubule-associated protein gene MAP65-1a (Solyc11g072280), which was significantly induced in lc (Appendix F). Another possibility might be that the increased organ primordia in fas and lc/fas diluted the mRNA concentration of these genes in the meristem. Although kinesins are more involved in the cell division process, there is a possibility that they might play a role in cellular organelle movement (Zhu and Dixit, 2012). However, the co- expressed pattern of these kinesin genes with Cellulose Synthase-Like D (CSLD) gene and cyclinB gene indicated that they are more likely involved in cytokinesis events (Hunter et al., 2012; Tank et al., 2011). To further address these questions, a cell division index measurement along the FM proximal-distal direction should be compared between WT and mutants. In addition, a precise map of these kinesin gene expression and their protein localization in the FM will provide clues about their putative roles in meristem development and patterning. The identification of a cluster involved in phytosterols and BRs synthesis indicates their putative roles in meristem function during tomato floral development. Genes in this cluster were expressed at lower levels in fas and lc/fas, indicating that the BR level might also be lower in the meristem of fas and lc/fas. Phytostereols are the precursors of BRs and control the homeostasis of BRs by feedback regulatory loops (Vriet et al., 2013). Mutants defective in phytosterol/BR synthesis are typically dwarf (Carland et al., 2010). The previous study demonstrates that phytosterols have a BR-independent role in controlling plant growth and development (He et al., 2003). In addition, the upstream sterol deficient mutants are often associated with additional defects in embryonic patterning and meristem programming (Jang et al., 2000). Specifically, the fackel (fk) mutant (Figure 3.9) showed enlarged/supernumerary SAMs and organ fusion phenotypes (Jang et al., 2000). These phenotypes cannot be rescued by exogenously applied active BRs, suggesting that some sterols are also active signals for plant development. BRs are growth promoting hormones in general and the BR contents are maintained at a low level in the meristem, particularly in the organ boundary (Hepworth and Pautot, 2015). The KNOX genes, such as STM, maintain the identity of meristem and boundary in the SAM by suppressing the BR levels and directly activate genes involved in boundary formation (Bolduc et al., 2012; Johnston et al., 2014; Spinelli et al., 2011; Tsuda et al., 2014). In addition, the rice OSH1 (homolog of STM) represses BR levels through the induction of BR catabolic genes (Tsuda et al., 2014). In

Arabidopsis, BR biosynthesis mutant, det2, and BR membrane-bound receptor mutant, bri1, show extra carpel formation (Gendron et al., 2012). Together, these results raise a possibility that higher expressions of SlWUS and tomato STM in the FMs of lc, fas and lc/fas suppress sterol/BR biosynthesis, thereby promote the formation of extra boundaries and floral organs.

Common and unique biological processes in lc and fas revealed by differentially expressed gene profiles

Identifying DEGs shared by lc, fas and lc/fas have helped to narrow down genes involved in common developmental pathways. It is hypothesized that the lower expression of SlCLV3 in fas and the higher expression of SlWUS in lc would result in a significant number of common DEGs. However, our results showed that although both mutants share similar phenotypes, the percentage of overlapping DEGs between lc and fas was low (5% ~ 36%) (Figure 3.13). One reason might be the weak allele of lc, which has minimal impact on locule number in wild tomato (LA1589) background. Therefore, the detection of DEGs associated with floral development in lc might be limited. Another possibility might be due to the unique role of CLV3. In Arabidopsis, CLV pathway plays a negative role in CK signaling, as evidenced by a synergistic effect with CK treatment in enhancing meristem size and increasing floral organ number in clv mutant (Chickarmane et al., 2012). In addition, CLV3 belongs to the CLV3/ENDOSPERM SURROUNDING REGION (CLE) small peptide family, which also involves in plant-microbe interactions, vascular development and long-distance signal transduction (Betsuyaku et al., 2011b; Kucukoglu and Nilsson, 2015). Lee et al., (2011) demonstrated that CLV3 triggers immune responses to restrict pathogen growth in the SAM of Arabidopsis via the interaction with the flagellin receptor kinase FLS2, independent from the CLV signaling pathway. Strabala et al., (2006) shows that the ectopic expression of CLV3 causes anthocyanin accumulation in Arabidopsis. Our results also showed that the fas-secondary and fas-specific GO terms (Figure 3.13) were more involved in lignin metabolism, flavonoid biosynthesis, and response to environmental stimuli. Together, these results indicated that SlCLV3, in addition to its involvement in maintaining the meristem cell population with SlWUS, might be involved in other developmental processes.

We also observed a trend of reduction in the percentage of overlapping genes as floral buds developed further. Because the whole flower buds were used in this study, the growing mass of sepals, petals and stamens might dilute the mRNAs in relatively constant-sized meristems. The TFs found in the overlapping DEGs among three mutants are mostly up-regulated MADS box and Homeobox TF families, such as tomato homologs of SEPALLATA3 (SEP3), AG, PISTALLATA (PI), STM, BEL1-LIKE 8 (POUNDFOOLISH/PNF/BLH8). In Arabidopsis, AG is required for specifying carpel identity with SEP3, while PI controls petal and stamen identities. (Coen et al., 1991; Pelaz et al., 2000). Pnueli et al., (1994b) reports that tomato SEP3 (TM5) functions in floral meristem organization and floral organ number determination, especially in the three inner whorls. Transgenically down-regulated tomato AG shows defects in stamen and carpel development (Pan et al., 2010), whereas silencing tomato PI shows loss of stamens and petals in developing flowers (Geuten and Irish, 2010). These lines of evidence suggest that these genes play similar roles in floral organ determinacy in tomato. In addition, the AG, PI and SEP3 work in the same protein complex to promote floral organ growth and they are coordinately regulated in a positive-feedback loop to activate their own expressions (Gómez-Mena et al., 2005). Transient expression of AG is sufficient to trigger higher expression of SEP3 and PI in Arabidopsis (Gómez- Mena et al., 2005). Therefore, it is possible that the higher expression of tomato AG in mutants induces the expression of the MADS floral identities genes. In addition, this also suggests that their activities might underlie the developmental processes in floral organ determination. In Arabidopsis, the KNOX-BELL heterodimers control floral specification and maintain the boundary identity between floral primordia (Kanrar et al., 2006). Specifically, two BELL homeodomain proteins, POUNDFOOLISH (PNF) and PENNYWISE (PNY), interact with STM (KNOX protein) to maintain the SAM and repress the expression of organ boundary genes, such as BLADE-ON-PETIOLE1/2 (BOP1/2) (Hepworth and Pautot, 2015; Kanrar et al., 2006; Khan et al., 2015). The PNY/PNF-STM complex also functions in parallel with LEAFY (LFY) and WUS to promote carpel formation through positive regulation of AG expression (Yu et al., 2009). Therefore, the identification of tomato STM and BEL1-LIKE 8 (PNF) in the overlapping DEGs among three mutants suggested that their activities might be positively correlated with enlarged FMs and the increase in floral organ number.

In summary, our RNA-seq analysis has captured the dynamics of gene expression in vegetative meristem, floral meristem, and young floral buds in lc and fas. These results have provided useful information for the future study of important developmental questions, such as the link between the meristem regulation and floral organ determinacy. These results can also be integrated with other large-scale dataset at various levels to decipher the regulatory network in meristem development, and provide predictive models in improving fruit traits.

Figure 3.1 The trend of recent plant research using RNA-seq technology.

Figure 3.2 Workflow of the 3’ Tag RNA-seq and standard strand-specific whole mRNA-seq.

Figure 3.3 Comparison of the sequence quality between whole mRNA-seq and 3’ Tag RNA-seq. For the quality score (Q-score), the blue line represents the mean quality and the yellow box represents the inter-quartile range (25-75%). The background of the plot divides the Y- axis into good quality (green), reasonable quality (orange) and poor quality (red). Y-axis represents the quality score (Q-score), which is a prediction of the probability of the base that has an error. X- axis represents the base position along the transcripts. For Q30, 99.9% of base call is predicted to be corrected. For Q20, 99% of base call is predicted to be correct. For sequence content bases, the per base sequence content is plotted out to show the proportion of each base per position along the transcripts. The line of the plot shows the percentage of T (red), C (blue) A (green) and G (black) base along each position of transcripts. (A) and (B): The raw read quality of Whole mRNA-seq and 3’ Tag RNA-seq, respectively. (C) Quality of 3’ Tag reads after filtering bases with Q score <20 and trimming the poly-A tail.

Figure 3.4 Comparisons of the transcript coverage, Pearson correlation coefficient (PCC), and reproducibility between 3’Tag RNA-seq and whole mRNA-seq. (A) The average of read coverage across the normalized transcript. (B) PCC of gene expression (RPM in 3’ Tag RNA-seq and RPKM in whole mRNA-seq) between two methods. PCCs in red are comparisons of floral buds at same developmental stages but with different methods (PCC ranged from 0.66 to 0.77). (C) Average PCC between biological replicates in each sample.

Figure 3.5 Impact of the two RNA-seq methods on data analysis. (A) The principle component analysis results showed that samples at different developmental stages are clustered together in both methods, indicating that the main effect of variance is from developmental gradient. (B) The heatmap shows a similar influence from developmental stage on differentially expressed genes (DEGs). (C) Distribution of identified DEGs across the tomato chromosomes. The tick marks on each chromosome indicated the physical positions of DEGs. A higher portion of DEGs in the introgressed region is found in the whole mRNA-seq method.

Figure 3.6 Differentially expressed genes identified between the two RNA-seq methods. Only 12- 13% of DEGs in 3’ Tag RNA-seq is commonly identified in whole mRNA-seq. By incorporating results from RNAi-SlCLV3 lines, the overlapping ratio is increased to 40%.

Figure 3.7 Pipeline for RNA-seq data analysis. DEGs are identified using linear factorial modeling. Overrepresented Gene Ontology (GO) terms with adjusted p-value < 0.05 among the DEGs are presented by using Arabidopsis homologs as inputs in the Cytoscape ClueGO App. These DEGs are further used to generate co-expressed clusters.

Figure 3.8 Expression profiles of the co-expressed clusters. (A) Normalized expression values (z- scores) of WT are clustered using K-mean algorithm in Mfuzz (R package). The dark blue lines represented the average of expression values, whereas the light blue regions represented the maximum and minimum expression values. Clusters highlighted in red are discussed in the results for the enriched GO signatures. (B) Pearson Correlation Coefficient matrix based on the expression of genes in WT and mutants in cluster 1. The core genes co-expressed with SlWUS are selected from hierarchical clustering in heatmap, marked by the red square. (C) Heatmap of core genes co- expressed with SlWUS in cluster 1. Normalized expression values across WT, lc, fas, lc/fas are used for hierarchical clustering. (D) Co-expressed genes enriched for the sterols and brassinosteroids (BR) biosynthesis pathway in cluster 5. (E) Co-expressed genes enriched for microtubule motor activity and cell cycle processes in cluster 6. Genes in red are putatively involved in microtubule binding activity and cytokinesis.

Figure 3.9 Simplified plant sterol and BR biosynthesis pathway. Genes in the blue boxes are differentially expressed in this study.

Figure 3.10 Phylogenetic tree of kinesin genes from Arabidopsis, tomato, C. elegans, human and Drosophila. Red circle marked genes co-expressed in cluster 6.

Figure 3.11 DEGs with significant genotype×developmental stage interaction effects. Y-axis represents the RPM value. X-axis represents five different developmental stages.

Figure 3.12 Identified DEGs involved in auxin and cytokinin metabolism, transport, and response.

Figure 3.13 Common and unique DEGs in lc, fas, and lc/fas. (A) DEGs shared among lc, fas and lc/fas at different developmental stages (P < 0.05) (B) Enriched GO terms for common and unique DEGs in lc, fas, and lc/fas.

Figure 3.14 Expression profiles of differentially expressed transcription factors shared in lc, fas, and lc/fas. DEGs with p-value < 0.05 at a specific developmental stage are marked with stars. Color bar represents down- or upregulation compared to the WT. The TF family affiliation was determined using Arabidopsis homologs as inputs to search Arabidopsis transcription factor database (http://arabidopsis.med.ohio-state.edu/AtTFDB/).

Figure 3.15 Expression profiles of differentially expressed transcription factors shared by fas and lc/fas. DEGs with p-value < 0.05 at a specific stage are marked with stars. Color bar represented down- or upregulation compared to the WT. The TF affiliation was identified using Arabidopsis homologs as inputs to search in Arabidopsis transcription factor database (http://arabidopsis.med.ohio-state.edu/AtTFDB/).

Table 3.1 Mapping statistics of RNA-seq results. Values are averages of all samples. Reads were cleaned by trimming the bases with an average Q-score lower than 20 in a 5-bp sliding window. All reads were poly-A trimmed and quality-checked before alignment. The cleaned reads were assigned to each gene by FeatureCount, a Subread package in R.

Total raw reads % of clean raw reads % of reads mapped % of genes have to reference genes counts >3 3'Tag-RNAseq 9,144,478 ± 2,516,927 50% ± 3% 80% ± 5% 57% ± 2%

Whole-mRNAseq 24,682,250 ± 10,352,340 96% ± 6% 84% ± 3% 62% ± 2%

Table 3.2 Enriched GO terms in each co-expressed gene cluster. P-value was adjusted with the Benjaminin-Hochberg (BH) correction.

Bibliography

Aida, M., Vernoux, T., Furutani, M., Traas, J., and Tasaka, M. (2002). Roles of PIN-FORMED1 and MONOPTEROS in pattern formation of the apical region of the Arabidopsis embryo. Development 129, 3965–3974.

Ashikari, M., Sakakibara, H., Lin, S., Yamamoto, T., Takashi, T., Nishimura, A., Angeles, E.R., Qian, Q., Kitano, H., and Matsuoka, M. (2005). Cytokinin Oxidase Regulates Rice Grain Production. Science 309, 741–745.

Bailey, T.L., and Elkan, C. (1994). Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proc. Int. Conf. Intell. Syst. Mol. Biol. 2, 28–36.

Barrero, L.S., and Tanksley, S.D. (2004). Evaluating the genetic basis of multiple-locule fruit in a broad cross section of tomato cultivars. Theor. Appl. Genet. 109, 669–679.

Barrero, L.S., Cong, B., Wu, F., and Tanksley, S.D. (2006). Developmental characterization of the fasciated locus and mapping of Arabidopsis candidate genes involved in the control of floral meristem size and carpel number in tomato. Genome 49, 991–1006.

Bergougnoux, V. (2014). The history of tomato: From domestication to biopharming. Biotechnol. Adv. 32, 170–189.

Betsuyaku, S., Takahashi, F., Kinoshita, A., Miwa, H., Shinozaki, K., Fukuda, H., and Sawa, S. (2011a). Mitogen-activated protein kinase regulated by the CLAVATA receptors contributes to shoot apical meristem homeostasis. Plant Cell Physiol. 52, 14–29.

Betsuyaku, S., Sawa, S., and Yamada, M. (2011b). The Function of the CLE Peptides in Plant Development and Plant-Microbe Interactions. Arab. Book Am. Soc. Plant Biol. 9.

Bindea, G., Mlecnik, B., Hackl, H., Charoentong, P., Tosolini, M., Kirilovsky, A., Fridman, W.- H., Pagès, F., Trajanoski, Z., and Galon, J. (2009). ClueGO: a Cytoscape plug-in to decipher functionally grouped gene ontology and pathway annotation networks. Bioinformatics 25, 1091– 1093.

Blanca, J., Montero-Pau, J., Sauvage, C., Bauchet, G., Illa, E., Díez, M.J., Francis, D., Causse, M., van der Knaap, E., and Cañizares, J. (2015). Genomic variation in tomato, from wild ancestors to contemporary breeding accessions. BMC Genomics 16, 257.

Bolduc, N., Yilmaz, A., Mejia-Guerra, M.K., Morohashi, K., O’Connor, D., Grotewold, E., and Hake, S. (2012). Unraveling the KNOTTED1 regulatory network in maize meristems. Genes Dev. 26, 1685–1690.

Bommert, P., Je, B.I., Goldshmidt, A., and Jackson, D. (2013a). The maize Gα gene COMPACT PLANT2 functions in CLAVATA signalling to control shoot meristem size. Nature 502, 555– 558.

Bommert, P., Nagasawa, N.S., and Jackson, D. (2013b). Quantitative variation in maize kernel row number is controlled by the FASCIATED EAR2 locus. Nat. Genet. 45, 334–337.

Brand, U., Fletcher, J.C., Hobe, M., Meyerowitz, E.M., and Simon, R. (2000). Dependence of Stem Cell Fate in Arabidopsis on a Feedback Loop Regulated by CLV3 Activity. Science 289, 617–619.

Busch, W., Miotk, A., Ariel, F.D., Zhao, Z., Forner, J., Daum, G., Suzaki, T., Schuster, C., Schultheiss, S.J., Leibfried, A., et al. (2010). Transcriptional Control of a Plant Stem Cell Niche. Dev. Cell 18, 841–853.

Carland, F., Fujioka, S., and Nelson, T. (2010). The Sterol Methyltransferases SMT1, SMT2, and SMT3 Influence Arabidopsis Development through Nonbrassinosteroid Products. Plant Physiol. 153, 741–756.

Chakrabarti, M., Zhang, N., Sauvage, C., Muños, S., Blanca, J., Cañizares, J., Diez, M.J., Schneider, R., Mazourek, M., McClead, J., et al. (2013). A cytochrome P450 regulates a domestication trait in cultivated tomato. Proc. Natl. Acad. Sci. 110, 17125–17130.

Chickarmane, V.S., Gordon, S.P., Tarr, P.T., Heisler, M.G., and Meyerowitz, E.M. (2012). Cytokinin signaling as a positional cue for patterning the apical–basal axis of the growing Arabidopsis shoot meristem. Proc. Natl. Acad. Sci. 109, 4002–4007.

Chu, H., Qian, Q., Liang, W., Yin, C., Tan, H., Yao, X., Yuan, Z., Yang, J., Huang, H., Luo, D., et al. (2006). The FLORAL ORGAN NUMBER4 Gene Encoding a Putative Ortholog of Arabidopsis CLAVATA3 Regulates Apical Meristem Size in Rice. Plant Physiol. 142, 1039– 1052.

Clark, S.E. (2001). Cell signalling at the shoot meristem. Nat. Rev. Mol. Cell Biol. 2, 276–284.

Clark, S.E., Running, M.P., and Meyerowitz, E.M. (1995). CLAVATA3 is a specific regulator of shoot and floral meristem development affecting the same processes as CLAVATA1. Development 121, 2057–2067.

Clark, S.E., Williams, R.W., and Meyerowitz, E.M. (1997). The CLAVATA1Gene Encodes a Putative Receptor Kinase That Controls Shoot and Floral Meristem Size in Arabidopsis. Cell 89, 575–585.

Clevenger, J., Houten, J.V., Blackwood, M., Gustavo, R.R., Jikumaru, Y., Kamiya, Y., Kusano, M., Saito, K., Visa, S., and Knaap, E. van der (2015). Network analyses reveal shifts in transcript

99 profiles and metabolites that accompany the expression of SUN and an elongated tomato fruit. Plant Physiol. pp.00379.2015.

Clevenger, J., Chu, Y., Guimaraes, L.A., Maia, T., Bertioli, D., Leal-Bertioli, S., Timper, P., Holbrook, C.C., and Ozias-Akins, P. (2017). Gene expression profiling describes the genetic regulation of Meloidogyne arenaria resistance in Arachis hypogaea and reveals a candidate gene for resistance. Sci. Rep. 7, 1317.

Cock, J.M., and McCormick, S. (2001). A Large Family of Genes That Share Homology withCLAVATA3. Plant Physiol. 126, 939–942.

Coen, E. S., & Meyerowitz, E. M. (1991). The war of the whorls: genetic interactions controlling flower development. Nature, 353(6339), 31.

Cong, B., Barrero, L.S., and Tanksley, S.D. (2008). Regulatory change in YABBY-like transcription factor led to evolution of extreme fruit size during tomato domestication. Nat. Genet. 40, 800–804.

Dardick, C., and Callahan, A.M. (2014). Evolution of the fruit endocarp: molecular mechanisms underlying adaptations in seed protection and dispersal strategies. Front. Plant Sci. 5.

Daum, G., Medzihradszky, A., Suzaki, T., and Lohmann, J.U. (2014). A mechanistic framework for noncell autonomous stem cell induction in Arabidopsis. Proc. Natl. Acad. Sci. 111, 14619– 14624.

Dereeper, A., Guignon, V., Blanc, G., Audic, S., Buffet, S., Chevenet, F., Dufayard, J.-F., Guindon, S., Lefort, V., Lescot, M., et al. (2008). Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 36, W465–W469.

DeYoung, B.J., and Clark, S.E. (2008). BAM Receptors Regulate Stem Cell Specification and Organ Development Through Complex Interactions With CLAVATA Signaling. Genetics 180, 895–904.

DeYoung, B.J., Bickle, K.L., Schrage, K.J., Muskett, P., Patel, K., and Clark, S.E. (2006). The CLAVATA1-related BAM1, BAM2 and BAM3 receptor kinase-like proteins are required for meristem function in Arabidopsis. Plant J. 45, 1–16.

Doebley, J. (2004). The genetics of maize evolution. Annu. Rev. Genet. 38, 37–59.

Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797.

Eveland, A.L., Goldshmidt, A., Pautler, M., Morohashi, K., Liseron-Monfils, C., Lewis, M.W., Kumari, S., Hiraga, S., Yang, F., Unger-Wallace, E., et al. (2014). Regulatory modules controlling maize inflorescence architecture. Genome Res. 24, 431–443.

100

Ferrándiz, C. (2002). Regulation of fruit dehiscence in Arabidopsis. J. Exp. Bot. 53, 2031–2038.

Fletcher, J.C., Brand, U., Running, M.P., Simon, R., and Meyerowitz, E.M. (1999). Signaling of Cell Fate Decisions by CLAVATA3 in Arabidopsis Shoot Meristems. Science 283, 1911–1914.

Frary, A., Nesbitt, T.C., Frary, A., Grandillo, S., Knaap, E. van der, Cong, B., Liu, J., Meller, J., Elber, R., Alpert, K.B., et al. (2000). fw2.2: A Quantitative Trait Locus Key to the Evolution of Tomato Fruit Size. Science 289, 85–88.

Furutani, M., Vernoux, T., Traas, J., Kato, T., Tasaka, M., and Aida, M. (2004). PIN-FORMED1 and PINOID regulate boundary formation and cotyledon development in Arabidopsis embryogenesis. Development 131, 5021–5030.

Gagne, J.M., and Clark, S.E. (2010). The Arabidopsis Stem Cell Factor POLTERGEIST Is Membrane Localized and Phospholipid Stimulated. Plant Cell Online 22, 729–743.

Gendron, J.M., Liu, J.-S., Fan, M., Bai, M.-Y., Wenkel, S., Springer, P.S., Barton, M.K., and Wang, Z.-Y. (2012). Brassinosteroids regulate organ boundary formation in the shoot apical meristem of Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 109, 21152–21157.

Geuten, K., and Irish, V. (2010). Hidden variability of floral homeotic B genes in Solanaceae provides a molecular basis for the evolution of novel functions. Plant Cell 22, 2562–2578.

Gimenez, E., Castañeda, L., Pineda, B., Pan, I.L., Moreno, V., Angosto, T., and Lozano, R. (2016). TOMATO AGAMOUS1 and ARLEQUIN/TOMATO AGAMOUS-LIKE1 MADS-box genes have redundant and divergent functions required for tomato reproductive development. Plant Mol. Biol. 91, 513–531.

Giovannoni, J.J. (2004). Genetic Regulation of Fruit Development and Ripening. Plant Cell Online 16, S170–S180.

Gómez-Mena, C., Folter, S. de, Costa, M.M.R., Angenent, G.C., and Sablowski, R. (2005). Transcriptional program controlled by the floral homeotic gene AGAMOUS during early organogenesis. Development 132, 429–438.

Guyomarc’h, S., Bertrand, C., Delarue, M., and Zhou, D.-X. (2005). Regulation of meristem activity by chromatin remodelling. Trends Plant Sci. 10, 332–338.

Han, P., Li, Q., and Zhu, Y.-X. (2008). Mutation of Arabidopsis BARD1 Causes Meristem Defects by Failing to Confine WUSCHEL Expression to the Organizing Center. Plant Cell Online 20, 1482–1493.

He, J.-X., Fujioka, S., Li, T.-C., Kang, S.G., Seto, H., Takatsuto, S., Yoshida, S., and Jang, J.-C. (2003). Sterols regulate development and gene expression in Arabidopsis. Plant Physiol. 131, 1258–1269.

101

Heisler, M.G., Ohno, C., Das, P., Sieber, P., Reddy, G.V., Long, J.A., and Meyerowitz, E.M. (2005). Patterns of Auxin Transport and Gene Expression during Primordium Development Revealed by Live Imaging of the Arabidopsis Inflorescence Meristem. Curr. Biol. 15, 1899– 1911.

Hepworth, S.R., and Pautot, V.A. (2015). Beyond the Divide: Boundaries for Patterning and Stem Cell Regulation in Plants. Front. Plant Sci. 6.

Huang, Z., and Knaap, E. van der (2011). Tomato fruit weight 11.3 maps close to fasciated on the bottom of chromosome 11. Theor. Appl. Genet. 123, 465–474.

Ikeda, M., Mitsuda, N., and Ohme-Takagi, M. (2009). Arabidopsis WUSCHEL Is a Bifunctional Transcription Factor That Acts as a Repressor in Stem Cell Regulation and as an Activator in Floral Patterning. Plant Cell Online 21, 3493–3505.

Irish, V.F., and Sussex, I.M. (1990). Function of the apetala-1 gene during Arabidopsis floral development. Plant Cell Online 2, 741–753.

Ishida, T., Tabata, R., Yamada, M., Aida, M., Mitsumasu, K., Fujiwara, M., Yamaguchi, K., Shigenobu, S., Higuchi, M., Tsuji, H., et al. (2014). Heterotrimeric G proteins control stem cell proliferation through CLAVATA signaling in Arabidopsis. EMBO Rep. 15, 1202–1209.

Ishimaru, K., Hirotsu, N., Madoka, Y., Murakami, N., Hara, N., Onodera, H., Kashiwagi, T., Ujiie, K., Shimizu, B., Onishi, A., et al. (2013). Loss of function of the IAA-glucose hydrolase gene TGW6 enhances rice grain weight and increases yield. Nat. Genet. 45, 707–711.

Jang, J.-C., Fujioka, S., Tasaka, M., Seto, H., Takatsuto, S., Ishii, A., Aida, M., Yoshida, S., and Sheen, J. (2000). A critical role of sterols in embryonic patterning and meristem programming revealed by the fackel mutants of Arabidopsis thaliana. Genes Dev. 14, 1485–1497.

Jenkins, J. A. (1948). The origin of the cultivated tomato. Economic Botany, 2(4), 379-392.

Johnston, R., Wang, M., Sun, Q., Sylvester, A.W., Hake, S., and Scanlon, M.J. (2014). Transcriptomic Analyses Indicate That Maize Ligule Development Recapitulates Gene Expression Patterns That Occur during Lateral Organ Initiation. Plant Cell Online 26, 4718– 4732.

Jung, J.-H., and Park, C.-M. (2007). MIR166/165 genes exhibit dynamic expression patterns in regulating shoot apical meristem and floral development in Arabidopsis. Planta 225, 1327–1338.

Kanrar, S., Onguka, O., and Smith, H.M.S. (2006). Arabidopsis inflorescence architecture requires the activities of KNOX-BELL homeodomain heterodimers. Planta 224, 1163–1173.

Kayes, J.M., and Clark, S.E. (1998). CLAVATA2, a regulator of meristem and organ development in Arabidopsis. Development 125, 3843–3851.

102

Khan, M., Ragni, L., Tabb, P., Salasini, B.C., Chatfield, S., Datla, R., Lock, J., Kuai, X., Despres, C., Proveniers, M., et al. (2015). Repression of lateral organ boundary genes by PENNYWISE and POUND-FOOLISH is essential for meristem maintenance and flowering in Arabidopsis thaliana1. Plant Physiol. pp.00915.2015.

Kinoshita, A., Betsuyaku, S., Osakabe, Y., Mizuno, S., Nagawa, S., Stahl, Y., Simon, R., Yamaguchi-Shinozaki, K., Fukuda, H., and Sawa, S. (2010). RPK2 is an essential receptor-like kinase that transmits the CLV3 signal in Arabidopsis. Development 137, 3911–3920. van der Knaap, E., Chakrabarti, M., Chu, Y.H., Clevenger, J.P., Illa-Berenguer, E., Huang, Z., Keyhaninejad, N., Mu, Q., Sun, L., Wang, Y., et al. (2014). What lies beyond the eye: the molecular mechanisms regulating tomato fruit weight and shape. Front. Plant Sci. 5.

Koenig, D., Jiménez-Gómez, J.M., Kimura, S., Fulop, D., Chitwood, D.H., Headland, L.R., Kumar, R., Covington, M.F., Devisetty, U.K., Tat, A.V., et al. (2013). Comparative transcriptomics reveals patterns of selection in domesticated and wild tomato. Proc. Natl. Acad. Sci. 110, E2655–E2662.

Krizek, B.A. (2011). Aintegumenta and Aintegumenta-Like6 regulate auxin-mediated flower development in Arabidopsis. BMC Res. Notes 4, 176.

Kucukoglu, M., and Nilsson, O. (2015). CLE peptide signaling in plants - the power of moving around. Physiol. Plant. 155, 74–87.

Kumar, L., and E. Futschik, M. (2007). Mfuzz: A software package for soft clustering of microarray data. Bioinformation 2, 5–7.

Kumar, R., Ichihashi, Y., Kimura, S., Chitwood, D.H., Headland, L.R., Peng, J., Maloof, J.N., and Sinha, N.R. (2012). A High-Throughput Method for Illumina RNA-Seq Library Preparation. Front. Plant Sci. 3.

Kurakawa, T., Ueda, N., Maekawa, M., Kobayashi, K., Kojima, M., Nagato, Y., Sakakibara, H., and Kyozuka, J. (2007). Direct control of shoot meristem activity by a cytokinin-activating enzyme. Nature 445, 652–655.

Kwon, C.S., Chen, C., and Wagner, D. (2005). WUSCHEL is a primary target for transcriptional regulation by SPLAYED in dynamic control of stem cell fate in Arabidopsis. Genes Dev. 19, 992–1003.

Laux, T., Mayer, K.F., Berger, J., and Jurgens, G. (1996). The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development 122, 87–96.

Lee, H., Suh, S.-S., Park, E., Cho, E., Ahn, J.H., Kim, S.-G., Lee, J.S., Kwon, Y.M., and Lee, I. (2000). The AGAMOUS-LIKE 20 MADS domain protein integrates floral inductive pathways in Arabidopsis. Genes Dev. 14, 2366–2376.

103

Lee, H., Chah, O.-K., and Sheen, J. (2011). Stem-cell-triggered immunity through CLV3p-FLS2 signalling. Nature 473, 376–379.

Leibfried, A., To, J.P.C., Busch, W., Stehling, S., Kehle, A., Demar, M., Kieber, J.J., and Lohmann, J.U. (2005). WUSCHEL controls meristem function by direct regulation of cytokinin- inducible response regulators. Nature 438, 1172–1175.

Lenhard, M., and Laux, T. (2003). Stem cell homeostasis in the Arabidopsis shoot meristem is regulated by intercellular movement of CLAVATA3 and its sequestration by CLAVATA1. Development 130, 3163–3173.

Lenhard, M., Bohnert, A., Jürgens, G., and Laux, T. (2001). Termination of Stem Cell Maintenance in Arabidopsis Floral Meristems by Interactions between WUSCHEL and AGAMOUS. Cell 105, 805–814.

Lenhard, M., Jürgens, G., and Laux, T. (2002). The WUSCHEL and SHOOTMERISTEMLESS genes fulfil complementary roles in Arabidopsis shoot meristem regulation. Development 129, 3195–3206.

Li, H., Qi, M., Sun, M., Liu, Y., Liu, Y., Xu, T., Li, Y., and Li, T. (2017). Tomato Transcription Factor SlWUS Plays an Important Role in Tomato Flower and Locule Development. Front. Plant Sci. 8.

Li, Y., Fan, C., Xing, Y., Jiang, Y., Luo, L., Sun, L., Shao, D., Xu, C., Li, X., Xiao, J., et al. (2011). Natural variation in GS5 plays an important role in regulating grain size and yield in rice. Nat. Genet. 43, 1266–1269.

Lippman, Z., and Tanksley, S.D. (2001). Dissecting the Genetic Pathway to Extreme Fruit Size in Tomato Using a Cross Between the Small-Fruited Wild Species Lycopersicon pimpinellifolium and L. esculentum var. Giant Heirloom. Genetics 158, 413–422.

Liu, X., Kim, Y.J., Müller, R., Yumul, R.E., Liu, C., Pan, Y., Cao, X., Goodrich, J., and Chen, X. (2011). AGAMOUS Terminates Floral Stem Cell Maintenance in Arabidopsis by Directly Repressing WUSCHEL through Recruitment of Polycomb Group Proteins[W]. Plant Cell 23, 3654–3670.

Lohman, B.K., Weber, J.N., and Bolnick, D.I. (2016). Evaluation of TagSeq, a reliable low-cost alternative for RNAseq. Mol. Ecol. Resour. 16, 1315–1321.

Lohmann, J.U., Hong, R.L., Hobe, M., Busch, M.A., Parcy, F., Simon, R., and Weigel, D. (2001). A molecular link between stem cell regulation and floral patterning in Arabidopsis. Cell 105, 793–803.

Long, J.A., Moan, E.I., Medford, J.I., and Barton, M.K. (1996). A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379, 66–69.

104

Mayer, K.F.X., Schoof, H., Haecker, A., Lenhard, M., Jürgens, G., and Laux, T. (1998). Role of WUSCHEL in Regulating Stem Cell Fate in the Arabidopsis Shoot Meristem. Cell 95, 805–815.

Meyer, E., Aglyamova, G.V., and Matz, M.V. (2011). Profiling gene expression responses of coral larvae (Acropora millepora) to elevated temperature and settlement inducers using a novel RNA-Seq procedure. Mol. Ecol. 20, 3599–3616.

Miyawaki, K., Tarkowski, P., Matsumoto-Kitano, M., Kato, T., Sato, S., Tarkowska, D., Tabata, S., Sandberg, G., and Kakimoto, T. (2006). Roles of Arabidopsis ATP/ADP isopentenyltransferases and tRNA isopentenyltransferases in cytokinin biosynthesis. Proc. Natl. Acad. Sci. 103, 16598–16603.

Moll, P., Ante, M., Seitz, A., and Reda, T. (2014). QuantSeq 3′ mRNA sequencing for RNA quantification. Nat. Methods 11.

Mu, Q., Huang, Z., Chakrabarti, M., Illa-Berenguer, E., Liu, X., Wang, Y., Ramos, A., and Knaap, E. van der (2017). Fruit weight is controlled by Cell Size Regulator encoding a novel protein that is expressed in maturing tomato fruits. PLOS Genet. 13, e1006930.

Müller, R., Bleckmann, A., and Simon, R. (2008a). The Receptor Kinase CORYNE of Arabidopsis Transmits the Stem Cell–Limiting Signal CLAVATA3 Independently of CLAVATA1. Plant Cell 20, 934–946.

Müller, R., Bleckmann, A., and Simon, R. (2008b). The Receptor Kinase CORYNE of Arabidopsis Transmits the Stem Cell–Limiting Signal CLAVATA3 Independently of CLAVATA1. Plant Cell 20, 934–946.

Muños, S., Ranc, N., Botton, E., Bérard, A., Rolland, S., Duffé, P., Carretero, Y., Paslier, M.- C.L., Delalande, C., Bouzayen, M., et al. (2011). Increase in Tomato Locule Number Is Controlled by Two Single-Nucleotide Polymorphisms Located Near WUSCHEL. Plant Physiol. 156, 2244–2254.

Ni, J., and Clark, S.E. (2006). Evidence for Functional Conservation, Sufficiency, and Proteolytic Processing of the CLAVATA3 CLE Domain. Plant Physiol. 140, 726–733.

Ohyama, K., Shinohara, H., Ogawa-Ohnishi, M., and Matsubayashi, Y. (2009). A glycopeptide regulating stem cell fate in Arabidopsis thaliana. Nat. Chem. Biol. 5, 578–580.

Omidbakhshfard, M.A., Proost, S., Fujikura, U., and Mueller-Roeber, B. (2015). Growth- Regulating Factors (GRFs): A Small Transcription Factor Family with Important Functions in Plant Biology. Mol. Plant 8, 998–1010.

Pan, I.L., McQuinn, R., Giovannoni, J.J., and Irish, V.F. (2010). Functional diversification of AGAMOUS lineage genes in regulating tomato flower and fruit development. J. Exp. Bot. 61, 1795–1806.

105

Park, S.J., Eshed, Y., and Lippman, Z.B. (2014). Meristem maturation and inflorescence architecture--lessons from the Solanaceae. Curr. Opin. Plant Biol. 17, 70–77.

Pnueli, L., Hareven, D., Rounsley, S.D., Yanofsky, M.F., and Lifschitz, E. (1994a). Isolation of the tomato AGAMOUS gene TAG1 and analysis of its homeotic role in transgenic plants. Plant Cell 6, 163–173.

Pnueli, L., Hareven, D., Broday, L., Hurwitz, C., and Lifschitz, E. (1994b). The TM5 MADS Box Gene Mediates Organ Differentiation in the Three Inner Whorls of Tomato Flowers. Plant Cell 6, 175–186.

Popescu, S.C., Popescu, G.V., Bachan, S., Zhang, Z., Gerstein, M., Snyder, M., and Dinesh- Kumar, S.P. (2009). MAPK target networks in Arabidopsis thaliana revealed using functional protein microarrays. Genes Dev. 23, 80–92.

Rick, C. M., & Fobes, J. F. (1975). Allozyme variation in the cultivated tomato and closely related species. Bulletin of the Torrey Botanical Club, 376-384.

Rick, C. M., & Holle, M. (1990). Andean Lycopersicon esculentum var. cerasiforme: genetic variation and its evolutionary significance. Economic Botany, 44, 69-78.

Rodríguez, G.R., Muños, S., Anderson, C., Sim, S.-C., Michel, A., Causse, M., Gardener, B.B.M., Francis, D., and Knaap, E. van der (2011). Distribution of SUN, OVATE, LC, and FAS in the Tomato Germplasm and the Relationship to Fruit Shape Diversity. Plant Physiol. 156, 275–285.

Rodríguez-Leal, D., Lemmon, Z.H., Man, J., Bartlett, M.E., and Lippman, Z.B. (2017). Engineering Quantitative Trait Variation for Crop Improvement by Genome Editing. Cell 171, 470–480.e8.

Rojo, E., Sharma, V.K., Kovaleva, V., Raikhel, N.V., and Fletcher, J.C. (2002). CLV3 Is Localized to the Extracellular Space, Where It Activates the Arabidopsis CLAVATA Stem Cell Signaling Pathway. Plant Cell 14, 969–977.

Sasabe, M., Soyano, T., Takahashi, Y., Sonobe, S., Igarashi, H., Itoh, T.J., Hidaka, M., and Machida, Y. (2006). Phosphorylation of NtMAP65-1 by a MAP kinase down-regulates its activity of microtubule bundling and stimulates progression of cytokinesis of tobacco cells. Genes Dev. 20, 1004–1014.

Schoof, H., Lenhard, M., Haecker, A., Mayer, K.F.X., Jürgens, G., and Laux, T. (2000). The Stem Cell Population of Arabidopsis Shoot Meristems Is Maintained by a Regulatory Loop between the CLAVATA and WUSCHEL Genes. Cell 100, 635–644.

106

Scofield, S., Dewitte, W., and Murray, J.A.H. (2007). The KNOX gene SHOOT MERISTEMLESS is required for the development of reproductive meristematic tissues in Arabidopsis. Plant J. 50, 767–781.

Shinohara, H., and Matsubayashi, Y. (2013). Chemical Synthesis of Arabidopsis CLV3 Glycopeptide Reveals the Impact of Hydroxyproline Arabinosylation on Peptide Conformation and Activity. Plant Cell Physiol. 54, 369–374.

Shinohara, H., and Matsubayashi, Y. (2015). Reevaluation of the CLV3-receptor interaction in the shoot apical meristem: dissection of the CLV3 signaling pathway from a direct ligand- binding point of view. Plant J. 82, 328–336.

Siminszky, B., Gavilano, L., Bowen, S.W., and Dewey, R.E. (2005). Conversion of nicotine to nornicotine in Nicotiana tabacum is mediated by CYP82E4, a cytochrome P450 monooxygenase. Proc. Natl. Acad. Sci. U. S. A. 102, 14919–14924.

Somssich, M., Je, B.I., Simon, R., and Jackson, D. (2016). CLAVATA-WUSCHEL signaling in the shoot meristem. Development 143, 3238–3248.

Song, S.-K., Lee, M.M., and Clark, S.E. (2006). POL and PLL1 phosphatases are CLAVATA1 signaling intermediates required for Arabidopsis shoot and floral stem cells. Development 133, 4691–4698.

Song, X.-J., Huang, W., Shi, M., Zhu, M.-Z., and Lin, H.-X. (2007). A QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nat. Genet. 39, 623– 630.

Soyars, C.L., James, S.R., and Nimchuk, Z.L. (2016). Ready, aim, shoot: stem cell regulation of the shoot apical meristem. Curr. Opin. Plant Biol. 29, 163–168.

Spinelli, S.V., Martin, A.P., Viola, I.L., Gonzalez, D.H., and Palatnik, J.F. (2011). A Mechanistic Link between STM and CUC1 during Arabidopsis Development. Plant Physiol. 156, 1894–1904.

Stone, J.M., Trotochaud, A.E., Walker, J.C., and Clark, S.E. (1998). Control of Meristem Development by CLAVATA1 Receptor Kinase and Kinase-Associated Protein Phosphatase Interactions. Plant Physiol. 117, 1217–1225.

Strabala, T.J., O’donnell, P.J., Smit, A.-M., Ampomah-Dwamena, C., Martin, E.J., Netzler, N., Nieuwenhuizen, N.J., Quinn, B.D., Foote, H.C.C., and Hudson, K.R. (2006). Gain-of-function phenotypes of many CLAVATA3/ESR genes, including four new family members, correlate with tandem variations in the conserved CLAVATA3/ESR domain. Plant Physiol. 140, 1331– 1344.

107

Sun, B., Looi, L.-S., Guo, S., He, Z., Gan, E.-S., Huang, J., Xu, Y., Wee, W.-Y., and Ito, T. (2014). Timing Mechanism Dependent on Cell Division Is Invoked by Polycomb Eviction in Plant Stem Cells. Science 343, 1248559.

Sun, L., Rodriguez, G.R., Clevenger, J.P., Illa-Berenguer, E., Lin, J., Blakeslee, J.J., Liu, W., Fei, Z., Wijeratne, A., Meulia, T., et al. (2015). Candidate gene selection and detailed morphological evaluations of fs8.1, a quantitative trait locus controlling tomato fruit shape. J. Exp. Bot. 66, 6471–6482.

Sun, Z., Asmann, Y.W., Nair, A., Zhang, Y., Wang, L., Kalari, K.R., Bhagwate, A.V., Baker, T.R., Carr, J.M., Kocher, J.-P.A., et al. (2013). Impact of Library Preparation on Downstream Analysis and Interpretation of RNA-Seq Data: Comparison between Illumina PolyA and NuGEN Ovation Protocol. PLOS ONE 8, e71745.

Suzaki, T., Ohneda, M., Toriba, T., Yoshida, A., and Hirano, H.-Y. (2009). FON2 SPARE1 Redundantly Regulates Floral Meristem Maintenance with FLORAL ORGAN NUMBER2 in Rice. PLOS Genet. 5, e1000693.

Szymkowiak, E. J., & Sussex, I. M. (1992). The internal meristem layer (L3) determines floral meristem size and carpel number in tomato periclinal chimeras. The Plant Cell, 4(9), 1089-1100.

Teo, Z.W.N., Song, S., Wang, Y.-Q., Liu, J., and Yu, H. (2014). New insights into the regulation of inflorescence architecture. Trends Plant Sci. 19, 158–165.

Trotochaud, A.E., Hao, T., Wu, G., Yang, Z., and Clark, S.E. (1999). The CLAVATA1 Receptor-like Kinase Requires CLAVATA3 for Its Assembly into a Signaling Complex That Includes KAPP and a Rho-Related Protein. Plant Cell Online 11, 393–405.

Tsuda, K., Kurata, N., Ohyanagi, H., and Hake, S. (2014). Genome-Wide Study of KNOX Regulatory Network Reveals Brassinosteroid Catabolic Genes Important for Shoot Meristem Function in Rice. Plant Cell Online 26, 3488–3500.

Vriet, C., Russinova, E., and Reuzeau, C. (2013). From Squalene to Brassinolide: The Steroid Metabolic and Signaling Pathways across the Plant Kingdom. Mol. Plant 6, 1738–1757.

Wahl, V., Brand, L.H., Guo, Y.-L., and Schmid, M. (2010). The FANTASTIC FOUR proteins influence shoot meristem size in Arabidopsis thaliana. BMC Plant Biol. 10, 285.

Waites, R., and Simon, R. (2000). Signaling Cell Fate in Plant Meristems: Three Clubs on One Tousle. Cell 103, 835–838.

Walley, J.W., Sartor, R.C., Shen, Z., Schmitz, R.J., Wu, K.J., Urich, M.A., Nery, J.R., Smith, L.G., Schnable, J.C., Ecker, J.R., et al. (2016). Integration of omic networks in a developmental atlas of maize. Science 353, 814–818.

108

Wannan, B.S., and Quinn, C.J. (1990). Pericarp structure and generic affinities in the Anacardiaceae. Bot. J. Linn. Soc. 102, 225–252.

Williams, C. E., & Clair, D. A. S. (1993). Phenetic relationships and levels of variability detected by restriction fragment length polymorphism and random amplified polymorphic DNA analysis of cultivated and wild accessions of Lycopersicon esculentum. Genome, 36(3), 619-630.

Wollmann, H., Mica, E., Todesco, M., Long, J.A., and Weigel, D. (2010). On reconciling the interactions between APETALA2, miR172 and AGAMOUS with the ABC model of flower development. Development 137, 3633–3642.

Wong, C.E., Singh, M.B., and Bhalla, P.L. (2013). Spatial expression of CLAVATA3 in the shoot apical meristem suggests it is not a stem cell marker in soybean. J. Exp. Bot. 64, 5641– 5649.

Wu, S., Xiao, H., Cabrera, A., Meulia, T., and Knaap, E. van der (2011). SUN Regulates Vegetative and Reproductive Organ Shape by Changing Cell Division Patterns. Plant Physiol. 157, 1175–1186.

Wu, X., Dabi, T., and Weigel, D. (2005). Requirement of Homeobox Gene STIMPY/WOX9 for Arabidopsis Meristem Growth and Maintenance. Curr. Biol. 15, 436–440.

Würschum, T., Groß-Hardt, R., and Laux, T. (2006). APETALA2 Regulates the Stem Cell Niche in the Arabidopsis Shoot Meristem. Plant Cell Online 18, 295–307.

Xiao, Y., Thatcher, S., Wang, M., Wang, T., Beatty, M., Zastrow-Hayes, G., Li, L., Li, J., Li, B., and Yang, X. (2016). Transcriptome analysis of near-isogenic lines provides molecular insights into starch biosynthesis in maize kernel. J. Integr. Plant Biol. 58, 713–723.

Xu, C., Liberatore, K.L., MacAlister, C.A., Huang, Z., Chu, Y.-H., Jiang, K., Brooks, C., Ogawa-Ohnishi, M., Xiong, G., Pauly, M., et al. (2015). A cascade of arabinosyltransferases controls shoot meristem size in tomato. Nat. Genet. 47, 784–792.

Yadav, R.K., Perales, M., Gruel, J., Girke, T., Jönsson, H., and Reddy, G.V. (2011). WUSCHEL protein movement mediates stem cell homeostasis in the Arabidopsis shoot apex. Genes Dev. 25, 2025–2030.

Yadav, R.K., Perales, M., Gruel, J., Ohno, C., Heisler, M., Girke, T., Jönsson, H., and Reddy, G.V. (2013). Plant stem cell maintenance involves direct transcriptional repression of differentiation program. Mol. Syst. Biol. 9, 654.

Yadav, R.K., Tavakkoli, M., Xie, M., Girke, T., and Reddy, G.V. (2014). A high-resolution gene expression map of the Arabidopsis shoot meristem stem cell niche. Development 141, 2735– 2744.

109

Yanofsky, M.F., Ma, H., Bowman, J.L., Drews, G.N., Feldmann, K.A., and Meyerowitz, E.M. (1990). The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors. Nature 346, 35–39.

Yu, L., Patibanda, V., and Smith, H.M.S. (2009). A novel role of BELL1-like homeobox genes, PENNYWISE and POUND-FOOLISH, in floral patterning. Planta 229, 693–707.

Yumul, R.E., Kim, Y.J., Liu, X., Wang, R., Ding, J., Xiao, L., and Chen, X. (2013). POWERDRESS and diversified expression of the MIR172 gene family bolster the floral stem cell network. PLoS Genet. 9, e1003218.

Zhang, J., Yuan, H., Fei, Z., Pogson, B.J., Zhang, L., and Li, L. (2015). Molecular characterization and transcriptome analysis of orange head Chinese cabbage (Brassica rapa L. ssp. pekinensis). Planta 241, 1381–1394.

Zhao, H., Li, S., Sheng, J., Shen, L., Yang, Y., and Yao, B. (2011). Identification of Target Ligands of CORYNE in Arabidopsis by Phage Display Library. J. Integr. Plant Biol. 53, 281– 288.

Zhao, S., Guo, Y., Sheng, Q., and Shyr, Y. (2014). Advanced Heat Map and Clustering Analysis Using Heatmap3.

Zhu, C., and Dixit, R. (2012). Functions of the Arabidopsis kinesin superfamily of microtubule- based motor proteins. Protoplasma 249, 887–899.

Zhu, Y., Wang, Y., Li, R., Song, X., Wang, Q., Huang, S., Jin, J.B., Liu, C.-M., and Lin, J. (2010). Analysis of interactions among the CLAVATA3 receptors reveals a direct interaction between CLAVATA2 and CORYNE in Arabidopsis. Plant J. Cell Mol. Biol. 61, 223–233.

110

Appendix A. Transgene copy number is determined by Southern blot

111

locule number Plant ID Copy number Transgenetic line discription (Mean ± SD) RNAi (knock down SlCLV3 gene) CR1 Group-1: >6 Copies, 2 Plants 5.85 ± 0.834 RNAi (knock down SlCLV3 gene) CR4 Group-1: >6 Copies, 2 Plants 6.24 ± 0.943 RNAi (knock down SlCLV3 gene) CR9 Group-2: 1 copy, 1 Plant 6.875 ± 0.939 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 1--3 Group-1: 1 Copy, 1 Plant 2 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 3--2 Group-2: 2 Copies, 1 Plant 2 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 4--1 Group-3: 1 Copy, 1 Plant 2 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 4--3 Group-4: 2 Copies, 1 Plant 2 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 6--2 Group-5: 2 Copies, 2 Plants 2 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 6--4 Group-5: 2 Copies, 2 Plants 2 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 7--1 Group-6: 1 Copy, 1 Plant 2 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 7--2 Group-7: 4 Copies, 1 Plant 2 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 8--2 Group-8: 1 Copy, 1 Plant 2 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 8--3 Group-9: 1 Copy, 1 Plant 2.05 ± 0.22 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 9--2 Group-10: 1 Copy, 1 Plant 2 Complementary Line ( Complement fas with SlCLV3 -long promoter) HC2 9--4 Group-11: 1 Copy, 1 Plant 2 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 10--2 Group-12: 2 Copies, 3 Plants 2.025 ± 0.158 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 10--3 Group-12: 2 Copies, 3 Plants 2.025 ± 0.158 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 10--4 Group-12: 2 Copies, 3 Plants 2 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 11--1 Group-13: 2 Copies, 2 Plants 2 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 11--2 Group-14: 2 Copies, 1 Plant 2 Complementary Line ( Complement fas with SlCLV3 - long promoter) HC2 11--4 Group-13: 2 Copies, 2 Plants 2 Non-transtenic control HC2 9--1 Non-Transgenic Plant 2.45 ± 0.552 Non-transtenic control 12S256-1 Non-Transgenic Plant 2.475± 0.599 Non-transtenic control 12S256-2 Non-Transgenic Plant 2.475 ± 0.554 Complement control (with SlCLV3 and its short promoter) HC4-1-1 Groupe-1: 2 Copies, 9 Plants 2.325 ± 0.474 Complement control (with SlCLV3 and its short promoter) HC4-1-2 Groupe-2: 1 Copy, 1 Plant 2.55 ± 0.504 Complement control (with SlCLV3 and its short promoter) HC4-1-3 Groupe-1: 2 Copies, 9 Plants 2.4 ± 0.496 Complement control (with SlCLV3 and its short promoter) HC4-1-4 Groupe-3: >6 Copies, 1 Plants 5.8 ± 1.018 Complement control (with SlCLV3 and its short promoter) HC4-2-1 Groupe-4: 4 Copies, 1 Plant 4.3 ± 0.687 Complement control (with SlCLV3 and its short promoter) HC4-3-1 Groupe-5: 2 Copies, 1 Plant 2.275± 0.452 Complement control (with SlCLV3 and its short promoter) HC4-4-1 Groupe-1: 2 Copies, 9 Plants 2.4 ± 0.591 Complement control (with SlCLV3 and its short promoter) HC4-4-2 Groupe-1: 2 Copies, 9 Plants 2.3 ± 0.516 Complement control (with SlCLV3 and its short promoter) HC4-4-4 Groupe-1: 2 Copies, 9 Plants 2.275 ± 0.452 Complement control (with SlCLV3 and its short promoter) HC4-5-1 Groupe-1: 2 Copies, 9 Plants 2.475 ± 0.554 Complement control (with SlCLV3 and its short promoter) HC4-5-2 Groupe-1: 2 Copies, 9 Plants 2.325 ± 0.474 Complement control (with SlCLV3 and its short promoter) HC4-5-3 Groupe-1: 2 Copies, 9 Plants 2.3 ± 0.464 Complement control (with SlCLV3 and its short promoter) HC4-5-4 Groupe-1: 2 Copies, 9 Plants 2.375 ± 0.49 Complement control (with SlCLV3 and its short promoter) HC4-6-1 Groupe-6: 2 Copies, 4 Plants 2.25 ± 0.439 Complement control (with SlCLV3 and its short promoter) HC4-6-2 Groupe-6: 2 Copies, 4 Plants 2.6 ± 0.496 Complement control (with SlCLV3 and its short promoter) HC4-9-1 Groupe-7: 2 Copies, 1 Plants 2.625 ± 4.9 Complement control (with SlCLV3 and its short promoter) HC4-12-1 Groupe-6: 2 Copies, 4 Plants 2.2 ± 0.405 Complement control (with SlCLV3 and its short promoter) HC4-12-2 Groupe-6: 2 Copies, 4 Plants 2.225 ± 0.423

112

Appendix B. Expression of tomato CLE small peptide gene family in floral and inflorescence meristems from whole mRNA-seq analyses

Expression of the tomato CLV3/EMBRYO-SURROUNDING REGION (CLE) peptide family

40 *** 35 30 25 * 20 ** 15 RPKM * 10 5 0 -5

wild type RNAi-SlCLV3

Comparisons were made between wild type and transgenically downregulated SlCLV3 plants using student t-test with RPKM values of four replicates. *P<0.05, **P<0.001, ***P<0.001.

113

Appendix C. Information of RNA-seq reads mapped to SlYABBY2b genomic region in wild type and fas NILs using IGV viewer

114

Appendix D. Overlapping DEGs between whole mRNA-seq and 3’ Tag seq

Tomato gene ID Arabidopsis Arabidopsis gene description Arabidopsis gene name Solyc00g026160 AT5G23980 Encodes a ferric chelate reductase. FERRIC REDUCTION OXIDASE 4 (FRO4) Solyc00g050430 AT5G65640 bHLH093/NFL encodes a bHLH transcription factor. BETA HLH PROTEIN 93 (bHLH093) Solyc01g066880 AT5G27690 Heavy metal transport/detoxification superfamily protein 0 Solyc01g081250 AT3G09270 Encodes glutathione transferase belonging to the tau class of GSTs. GLUTATHIONE S-TRANSFERASE TAU 8 (GSTU8) Solyc01g090340 AT2G44840 Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor ETHYLENE-RESPONSIVE ELEMENT BINDING FACTOR 13 family. (ERF13) Solyc01g092950 AT2G45660 Controls flowering and is required for CO to promote flowering. AGAMOUS-LIKE 20 (AGL20) Solyc01g098190 AT3G05030 Encodes a vacuolar K+/H+ exchanger. SODIUM HYDROGEN EXCHANGER 2 (NHX2) Solyc01g104400 AT2G02850 Encodes plantacyanin one of blue copper proteins. PLANTACYANIN (ARPN) Solyc01g109500 AT1G49320 Encodes USPL1, a BURP domain protein targeted to the protein storage vacuoles. UNKNOWN SEED PROTEIN LIKE 1 (USPL1) Solyc02g069600 AT5G36110 member of CYP716A CYTOCHROME P450, FAMILY 716, SUBFAMILY A, POLYPEPTIDE 1 (CYP716A1) Solyc02g071800 AT1G07650 Leucine-rich repeat transmembrane protein kinase 0 Solyc02g077980 NA #N/A #N/A Solyc02g080880 AT1G11910 Encodes an aspartic proteinase. ASPARTIC PROTEINASE A1 (APA1) Solyc02g081480 AT1G66920 Protein kinase superfamily protein 0 Solyc02g081880 AT1G30910 Molybdenum cofactor sulfurase family protein 0 Solyc02g083020 AT4G35690 hypothetical protein (DUF241) 0 Solyc02g083520 AT3G56850 Encodes an ABA-responsive element binding protein with a bZIP domain. ABA-RESPONSIVE ELEMENT BINDING PROTEIN 3 (AREB3) Solyc02g083790 AT4G36010 Pathogenesis-related thaumatin superfamily protein 0 Solyc02g083880 AT2G18420 Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein 0 Solyc02g083890 AT5G66230 Chalcone-flavanone isomerase family protein 0 Solyc02g088100 AT2G03090 member of Alpha-Expansin Gene Family. EXPANSIN A15 (EXPA15) Solyc02g089080 NA #N/A #N/A Solyc02g089210 AT1G69120 Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. APETALA1 (AP1) Solyc03g081230 AT5G53730 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family NDR1/HIN1-LIKE 26 (NHL26) Solyc03g082920 AT5G42020 Luminal binding protein (BiP2) (BIP2) Solyc03g095370 NA #N/A #N/A Solyc03g096760 AT5G24660 response to low sulfur 2 RESPONSE TO LOW SULFUR 2 (LSU2) Solyc03g096960 AT1G08580 hypothetical protein 0 Solyc03g096990 AT1G64940 member of CYP89A CYTOCHROME P450, FAMILY 87, SUBFAMILY A, POLYPEPTIDE 6 (CYP89A6) Solyc03g097150 AT5G16760 Encodes a inositol 1,3,4-trisphosphate 5/6-kinase. INOSITOL (1,3,4) P3 5/6-KINASE 1 (ITPK1) Solyc03g098790 AT1G73325 Kunitz family trypsin and protease inhibitor protein 0 Solyc03g111410 AT3G53310 AP2/B3-like transcriptional factor family protein 0 Solyc03g120690 AT3G16120 Dynein light chain type 1 family protein 0 Solyc03g121850 AT1G05950 hypothetical protein 0 Solyc04g008330 AT3G53160 UDP-glucosyl transferase 73C7 UDP-GLUCOSYL TRANSFERASE 73C7 (UGT73C7) Solyc04g009900 AT1G08650 Encodes a phosphoenolpyruvate carboxylase kinase PHOSPHOENOLPYRUVATE CARBOXYLASE KINASE 1 (PPCK1) Solyc04g010330 AT5G59790 UPSTREAM OF FLC protein (DUF966) 0 Solyc04g014480 AT5G37670 HSP20-like chaperones superfamily protein 0 Solyc04g014520 AT1G55230 proteinase inhibitor I4, serpin (DUF716) 0 Solyc04g016120 NA #N/A #N/A Solyc04g064620 AT1G21460 Nodulin MtN3 family protein (SWEET1) 115

Solyc04g080040 AT1G75100 Contains a J-domain at the C-terminus J-DOMAIN PROTEIN REQUIRED FOR CHLOROPLAST ACCUMULATION RESPONSE 1 (JAC1) Solyc04g080130 AT3G50700 zinc finger protein, similar to maize Indeterminate1 (ID1) INDETERMINATE(ID)-DOMAIN 2 (IDD2) Solyc04g082100 NA #N/A #N/A Solyc05g009310 AT1G25440 B-box type zinc finger protein with CCT domain-containing protein B-BOX DOMAIN PROTEIN 15 (BBX15) Solyc05g014280 AT4G27670 Encodes Hsp21 HEAT SHOCK PROTEIN 21 (HSP21) Solyc05g015390 AT1G67360 Encodes a small rubber particle protein homolog. LD-ASSOCIATED PROTEIN 1 (LDAP1) Solyc05g024160 AT5G50850 Transketolase family protein MACCI-BOU (MAB1) Solyc05g032680 AT2G30650 ATP-dependent caseinolytic (Clp) protease/crotonase family protein 0 Solyc05g054340 AT1G59780 NB-ARC domain-containing disease resistance protein 0 Solyc06g005750 AT1G07420 Arabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA. STEROL 4-ALPHA-METHYL-OXIDASE 2-1 (SMO2-1) Solyc06g053830 AT3G23050 Transcription regulator acting as repressor of auxin-inducible gene expression. INDOLE-3-ACETIC ACID 7 (IAA7) Solyc06g054640 AT2G38820 DNA-directed RNA polymerase subunit beta-beta protein, putative (DUF506) 0 Solyc06g060610 AT1G62620 Flavin-binding monooxygenase family protein 0 Solyc06g074060 AT2G27250 One of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. CLAVATA3 (CLV3) Solyc06g075520 AT1G75270 dehydroascorbate reductase 2 DEHYDROASCORBATE REDUCTASE 2 (DHAR2) Solyc06g075540 AT3G45740 hydrolase family protein / HAD-superfamily protein 0 Solyc06g075550 AT1G07870 Protein kinase superfamily protein 0 Solyc07g006680 AT3G26040 HXXXD-type acyl-transferase family protein 0 Solyc07g043500 AT5G49690 UDP-Glycosyltransferase superfamily protein 0 Solyc07g052480 AT3G21720 Encodes a glyoxylate cycle enzyme isocitrate lyase (ICL). ISOCITRATE LYASE (ICL) Solyc07g056310 AT2G30933 Carbohydrate-binding X8 domain superfamily protein 0 Solyc07g061750 AT1G03670 Ankyrin repeat containing protein 0 Solyc07g065210 AT3G20150 Kinesin motor family protein 0 Solyc08g008310 AT4G23850 AMP-dependent synthetase and ligase family protein LONG-CHAIN ACYL-COA SYNTHETASE 4 (LACS4) Solyc08g066490 AT2G25790 Leucine-rich receptor-like protein kinase family protein STERILITY-REGULATING KINASE MEMBER 1 (SKM1) Solyc08g067610 AT1G15520 ABC transporter family ATP-BINDING CASSETTE G40 (ABCG40) Solyc08g068710 AT2G39030 Encodes a protein that acts as an ornithine N-delta-acetyltransferase N-ACETYLTRANSFERASE ACTIVITY 1 (NATA1) Solyc08g077230 AT4G18020 Encodes pseudo-response regulator 2 (APRR2) (APRR2) Solyc08g077460 AT1G32740 SBP (S-ribonuclease binding protein) family protein 0 Solyc08g079310 AT4G12320 member of CYP706A CYTOCHROME P450, FAMILY 706, SUBFAMILY A, POLYPEPTIDE 6 (CYP706A6) Solyc08g079830 AT1G12520 Copper-zinc superoxide dismutase copper chaperone (delivers copper to the Cu-Zn superoxide dismutase). COPPER CHAPERONE FOR SOD1 (CCS) Solyc08g082250 AT1G64390 glycosyl hydrolase 9C2 GLYCOSYL HYDROLASE 9C2 (GH9C2) Solyc09g009620 NA #N/A #N/A Solyc09g011220 AT2G39770 Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. CYTOKINESIS DEFECTIVE 1 (CYT1) Solyc09g059220 AT2G31490 neuronal acetylcholine receptor subunit alpha-5 0 Solyc09g065170 NA #N/A #N/A Solyc09g075750 AT5G26230 Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MEMBRANE-ASSOCIATED KINASE REGULATOR 1 (MAKR1) Solyc09g089530 AT2G38870 Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. 0 Solyc10g007870 NA #N/A #N/A Solyc10g009320 AT2G46640 Encodes TAC1 (Tiller Angle Control 1). TILLER ANGLE CONTROL 1 (TAC1) Solyc10g054910 AT2G16600 Encodes cytosolic cyclophilin ROC3. ROTAMASE CYP 3 (ROC3) Solyc10g076720 NA #N/A #N/A Solyc10g078700 AT3G57920 Encodes a putative transcriptional regulator that is involved in the vegetative to reproductive phase transition. SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 15 (SPL15) Solyc10g085280 AT3G11340 Encodes a glucosyltransferase that conjugates isoleucic acid and modulates plant defense and senescence. UDP-DEPENDENT GLYCOSYLTRANSFERASE 76B1 (UGT76B1) Solyc10g086620 AT5G06060 NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) 0 Solyc11g006230 AT5G28640 Encodes a protein with similarity to mammalian transcriptional coactivator that is involved in cell ANGUSTIFOLIA 3 (AN3) proliferation during leaf and flower development.

116

Solyc11g007200 AT3G56240 CCH protein belongs to a family of eukaryotic proteins that participate in intracellular copper homeostasis by COPPER CHAPERONE (CCH) delivering this metal to the secretory pathway Solyc11g010960 AT4G39330 cinnamyl alcohol dehydrogenase 9 CINNAMYL ALCOHOL DEHYDROGENASE 9 (CAD9) Solyc11g021020 NA #N/A #N/A Solyc11g021360 NA #N/A #N/A Solyc11g040040 AT3G19850 Phototropic-responsive NPH3 family protein 0 Solyc11g066390 AT2G28190 Encodes a chloroplastic copper/zinc superoxide dismutase CSD2 that can detoxify superoxide radicals. COPPER/ZINC SUPEROXIDE DISMUTASE 2 (CSD2) Solyc11g069890 AT2G27990 Encodes a BEL1-like homeobox gene that functions together with PNY in meristem maintenance BEL1-LIKE HOMEODOMAIN 8 (BLH8) Solyc11g071370 AT1G05750 Encodes a pentatricopeptide repeat protein PIGMENT DEFECTIVE 247 (PDE247) Solyc11g071490 AT1G36240 Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein 0 Solyc11g071540 AT2G02955 maternal effect embryo arrest 12 MATERNAL EFFECT EMBRYO ARREST 12 (MEE12) Solyc11g071640 AT5G20950 Encodes a beta-glucosidase involved in xyloglucan metabolism. (BGLC1) Solyc11g071730 AT3G44050 P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) 0 Solyc11g071790 AT1G08480 predicted to encode subunit 6 of mitochondrial complex II and to participate in the respiratory chain The SUCCINATE DEHYDROGENASE 6 (SDH6) mRNA is cell-to-cell mobile. Solyc11g071810 AT1G08465 Member of the YABBY family of Arabidopsis proteins involved in the abaxial cell fate specification in YABBY2 (YAB2) lateral organs Solyc11g071830 AT3G44110 homologous to the co-chaperon DNAJ protein from E coli (J3) Solyc12g040800 AT1G48590 Calcium-dependent lipid-binding (CaLB domain) family protein C2-DOMAIN ABA-RELATED 5 (CAR5) Solyc12g056650 AT1G22770 Together with CONSTANTS (CO) and FLOWERING LOCUS T (FT), GIGANTEA promotes flowering GIGANTEA (GI) under long days in a circadian clock-controlled flowering pathway Solyc12g056920 AT5G10180 Encodes a low-affinity sulfate transporter expressed in the root cap and central cylinder SULFATE TRANSPORTER 2;1 (SULTR2;1) Solyc12g082720 NA #N/A #N/A Solyc12g082730 AT5G65930 encodes a novel member of the kinesin superfamily of motor proteins. ZWICHEL (ZWI)

117

Appendix E. DEGs overlapping with Arabidopsis WUS inducible system

41 DEGs overlapping with WUS induced genes in Arabidopsis Tomato_gene Arabidopsis Arabidopsis description GeneID Solyc02g083950 AT2G17950 Homeobox gene controlling the stem cell pool. Expressed in the stem cell organizing center of meristems WUSCHEL (WUS) Solyc00g007070 AT5G66010 RNA-binding (RRM/RBD/RNP motifs) family protein NA Solyc01g099970 AT5G27920 F-box family protein NA Solyc02g069510 AT1G07090 LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640) LIGHT SENSITIVE HYPOCOTYLS 6 (LSH6) Solyc02g081120 AT1G62360 Class I knotted-like homeodomain protein that is required for shoot apical meristem (SAM) formation during SHOOT MERISTEMLESS (STM) embryogenesis and for SAM function throughout the lifetime of the plant. Solyc02g087270 AT3G23880 F-box and associated interaction domains-containing protein NA Solyc02g088100 AT2G03090 member of Alpha-Expansin Gene Family. EXPANSIN A15 (EXPA15) Solyc03g093140 AT3G47420 Encodes a Pi starvation-responsive protein AtPS3. GLYCEROL-3-PHOSPHATE PERMEASE 1 (G3Pp1) Solyc03g097030 AT1G65060 encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general 4-COUMARATE:COA LIGASE 3 (4CL3) phenylpropanoid pathway. Solyc03g098010 AT3G17790 Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite PURPLE ACID PHOSPHATASE 17 (PAP17) (Phi) in roots and shoots. Solyc03g115650 AT1G69410 Encodes eIF5A-2, a putative eukaryotic translation initiation factor. EUKARYOTIC ELONGATION FACTOR 5A-3 (ELF5A-3) Solyc03g120500 AT4G29080 phytochrome-associated protein 2 (PAP2) PHYTOCHROME-ASSOCIATED PROTEIN 2 (PAP2) Solyc04g009900 AT1G08650 Encodes a phosphoenolpyruvate carboxylase kinase that is expressed at highest levels in leaves. PHOSPHOENOLPYRUVATE CARBOXYLASE KINASE 1 (PPCK1) Solyc04g077490 AT4G37750 ANT is required for control of cell proliferation and encodes a putative transcriptional regulator similar to AP2. AINTEGUMENTA (ANT) Solyc04g079570 AT3G50410 Arabidopsis Dof protein containing a single 51-amino acid zinc finger DNA-binding domain, which may play an OBF BINDING PROTEIN 1 (OBP1) important roles in plant growth and development. Solyc05g013460 AT1G12950 root hair specific 2 ROOT HAIR SPECIFIC 2 (RHS2) Solyc05g015390 AT1G67360 Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and LD-ASSOCIATED PROTEIN 1 (LDAP1) development and in drought stress responses. Solyc06g007580 AT3G07350 sulfate/thiosulfate import ATP-binding protein, putative (DUF506) NA Solyc06g036290 AT5G52640 Encodes a cytosolic heat shock protein AtHSP90.1. HEAT SHOCK PROTEIN 9NA.1 (HSP9NA.1) Solyc06g065630 AT5G11320 Belongs to the YUC gene family. Encodes a predicted flavin monooxygenase YUC4 involved in auxin biosynthesis YUCCA4 (YUC4) and plant development. Solyc06g074390 AT4G33790 Encodes an alcohol-forming fatty acyl-CoA reductase, involved in cuticular wax biosynthesis. ECERIFERUM 4 (CER4) Solyc06g074530 AT1G08250 Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. AROGENATE DEHYDRATASE 6 (ADT6) Solyc06g075520 AT1G75270 dehydroascorbate reductase 2 DEHYDROASCORBATE REDUCTASE 2 (DHAR2) Solyc07g008250 AT2G25490 Encodes an F-box protein involved in the ubiquitin/proteasome-dependent proteolysis of EIN3. EIN3-BINDING F BOX PROTEIN 1 (EBF1) Solyc07g008570 AT5G50400 purple acid phosphatase 27 PURPLE ACID PHOSPHATASE 27 (PAP27) Solyc07g041900 AT3G45310 Cysteine proteinases superfamily protein NA Solyc07g043460 AT3G14610 putative cytochrome P450 CYTOCHROME P45NA, FAMILY 72, SUBFAMILY A, POLYPEPTIDE 7 (CYP72A7) Solyc07g063410 AT4G27410 Encodes a NAC transcription factor induced in response to desiccation. It is localized to the nucleus and acts as a RESPONSIVE TO DESICCATION 26 (RD26) transcriptional activator in ABA-mediated dehydration response. Solyc08g068710 AT2G39030 Encodes a protein that acts as an ornithine N-delta-acetyltransferase, leading to the formation of N-delta- N-ACETYLTRANSFERASE ACTIVITY 1 (NATA1) actetylornithine. Solyc08g075950 AT3G13960 Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing GROWTH-REGULATING FACTOR 5 (GRF5) nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower. Solyc08g081960 AT4G23750 encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. CYTOKININ RESPONSE FACTOR 2 (CRF2)

118

Solyc09g018010 AT2G38530 Involved in lipid transfer between membranes and plays a role in maintaining the integrity of the cuticle-cell wall LIPID TRANSFER PROTEIN 2 (LTP2) interface. Solyc09g075230 AT1G02816 pectinesterase (Protein of unknown function, DUF538) NA Solyc09g092690 AT5G48570 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (ROF2) Solyc10g005960 AT5G55730 Encodes fasciclin-like arabinogalactan-protein 1 (Fla1). fla1 mutants show defects in shoot regeneration. FASCICLIN-LIKE ARABINOGALACTAN 1 (FLA1) Solyc10g018870 AT1G34770 Encodes a nuclear localized, structural subunit of the SMC 5/6 complex and a non- SMC element. Loss of function (NSE3) results in abnormal cell division and embryo lethality. Solyc10g081260 AT3G03620 MATE efflux family protein NA Solyc10g083330 AT2G36220 hypothetical protein NA Solyc11g006230 AT5G28640 Encodes a protein with similarity to mammalian transcriptional coactivator that is involved in cell proliferation during ANGUSTIFOLIA 3 (AN3) leaf and flower development. Solyc11g010960 AT4G39330 cinnamyl alcohol dehydrogenase 9 CINNAMYL ALCOHOL DEHYDROGENASE 9 (CAD9) Solyc12g005910 AT5G42570 B-cell receptor-associated 31-like protein NA

50 DEGs overlapping with WUS repressed genes in Arabidopsis Tomato_gene Arabidopsis Arabidopsis discription GeneID Solyc01g057000 AT3G11930 Adenine nucleotide alpha hydrolases-like superfamily protein NA Solyc01g080640 AT3G62700 member of MRP subfamily ATP-BINDING CASSETTE C14 (ABCC14) Solyc01g090340 AT2G44840 encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor ETHYLENE-RESPONSIVE ELEMENT BINDING family. FACTOR 13 (ERF13) Solyc01g108240 AT4G34410 encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor REDOX RESPONSIVE TRANSCRIPTION FACTOR 1 family. (RRTF1) Solyc01g108910 AT2G15890 Encodes CBP1, a regulator of transcription initiation in central cell-mediated pollen tube guidance. MATERNAL EFFECT EMBRYO ARREST 14 (MEE14) Solyc02g014860 AT5G23240 DNAJ heat shock N-terminal domain-containing protein DNA J PROTEIN C76 (DJC76) Solyc02g063520 AT4G37790 Encodes homeobox protein HAT22, member of the HD-Zip II family. (HAT22) Solyc02g079960 AT1G11530 Encodes a monocysteinic thioredoxin, thioredoxin in which the second cysteine of the redox site is C-TERMINAL CYSTEINE RESIDUE IS CHANGED replaced by a serine, with low disulfide reductase but efficient disulfide isomerase activity. TO A SERINE 1 (CXXS1) Solyc02g083280 AT4G35770 Senescence-associated gene that is strongly induced by phosphate starvation. SENESCENCE 1 (SEN1) Solyc02g083790 AT4G36010 Pathogenesis-related thaumatin superfamily protein NA Solyc03g006360 AT2G33830 Dormancy/auxin associated family protein DORMANCY ASSOCIATED GENE 2 (DRM2) Solyc03g058160 AT2G41940 Encodes a zinc finger protein containing only a single zinc finger. ZINC FINGER PROTEIN 8 (ZFP8) Solyc03g081240 AT5G24470 Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events PSEUDO-RESPONSE REGULATOR 5 (PRR5) Solyc03g083730 AT5G62360 Plant invertase/pectin methylesterase inhibitor superfamily protein NA Solyc03g116870 AT1G15980 Encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic electron PHOTOSYNTHETIC NDH SUBCOMPLEX B 1 flow around photosystem I to produce ATP. (PnsB1) Solyc03g120690 AT3G16120 Dynein light chain type 1 family protein NA Solyc04g016180 AT2G41640 Glycosyltransferase family 61 protein NA Solyc04g078880 AT5G42900 cold regulated protein 27 COLD REGULATED GENE 27 (COR27) Solyc04g080130 AT3G50700 zinc finger protein, similar to maize Indeterminate1 (ID1) INDETERMINATE(ID)-DOMAIN 2 (IDD2) Solyc04g082200 AT1G20450 Encodes a gene induced by low temperature and dehydration EARLY RESPONSIVE TO DEHYDRATION 1NA (ERD1NA) Solyc05g009420 AT1G68440 transmembrane protein NA Solyc05g025820 AT2G05940 Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4, leading to the RPM1-INDUCED PROTEIN KINASE (RIPK) activation of a plant innate immune receptor RPM1. Solyc05g052030 AT5G07580 Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor (ERF1NA6) family. 119

Solyc06g007180 AT3G47340 Encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type GLUTAMINE-DEPENDENT ASPARAGINE glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative SYNTHASE 1 (ASN1) effect on its mRNA accumulation. Solyc06g061240 AT4G17900 PLATZ transcription factor family protein NA Solyc06g065970 AT2G45180 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein NA Solyc06g068680 AT5G47910 NADPH/respiratory burst oxidase protein D (RbohD). RESPIRATORY BURST OXIDASE HOMOLOGUE D (RBOHD) Solyc06g082070 AT5G58600 Belongs to a large family of plant-specific genes of unknown function. POWDERY MILDEW RESISTANT 5 (PMR5) Solyc06g083040 AT4G12910 serine carboxypeptidase-like 20 SERINE CARBOXYPEPTIDASE-LIKE 2NA (scpl2NA) Solyc07g008180 AT2G26580 plant-specific transcription factor YABBY family protein YABBY5 (YAB5) Solyc07g063690 AT5G54490 Encodes a PINOID (PID)-binding protein containing putative EF-hand calcium-binding motifs. The PINOID-BINDING PROTEIN 1 (PBP1) interaction is dependent on the presence of calcium. Solyc07g063850 AT5G54510 Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this DWARF IN LIGHT 1 (DFL1) gene accumulate IAA-ASP and are hypersensitive to several auxins. Solyc08g036640 AT1G30135 jasmonate-zim-domain protein 8 JASMONATE-ZIM-DOMAIN PROTEIN 8 (JAZ8) Solyc08g065610 AT4G32940 Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed GAMMA VACUOLAR PROCESSING ENZYME in vegetative organs and is upregulated in association with various types of cell death and under stressed (GAMMA-VPE) conditions. Solyc08g077060 AT1G32540 Encodes a protein with 3 plant-specific zinc finger domains that acts as a positive regulator of cell death. LSD ONE LIKE 1 (LOL1) Solyc09g008970 AT3G10020 plant/protein NA Solyc09g014480 AT5G06870 Encodes a polygalacturonase inhibiting protein involved in plant defense response. POLYGALACTURONASE INHIBITING PROTEIN 2 (PGIP2) Solyc09g075140 AT3G62860 alpha/beta-Hydrolases superfamily protein (MAGL12) Solyc09g075750 AT5G26230 Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MEMBRANE-ASSOCIATED KINASE REGULATOR 1 (MAKR1) Solyc09g075890 AT2G32150 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein NA Solyc09g083200 AT2G23770 Encodes a putative LysM-containing receptor-like kinase LYK4. LYSM-CONTAINING RECEPTOR-LIKE KINASE 4 (LYK4) Solyc09g084480 AT2G38870 Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor NA family. Solyc10g008410 AT4G03510 RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring RING MEMBRANE-ANCHOR 1 (RMA1) domain that is involved in the secretory pathway. Solyc10g078920 AT5G06690 Encodes a thioredoxin (WCRKC1) localized in chloroplast stroma. WCRKC THIOREDOXIN 1 (WCRKC1) Solyc11g040040 AT3G19850 Phototropic-responsive NPH3 family protein NA Solyc11g066970 AT2G27740 RAB6-interacting golgin (DUF662) NA Solyc11g071380 AT2G27250 One of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. CLAVATA3 (CLV3) Solyc11g071740 AT1G76650 calmodulin-like 38 CALMODULIN-LIKE 38 (CML38) Solyc12g006460 AT2G32440 ent-kaurenoic acid hydroxylase (KAO2) ENT-KAURENOIC ACID HYDROXYLASE 2 (KAO2) Solyc12g082730 AT5G65930 Encodes a novel member of the kinesin superfamily of motor proteins. ZWICHEL (ZWI)

120

Appendix F. RPM of 675 DEGs identified between WT, lc, fas, lc/fas in 3’ Tag RNA-seq. DEGs in the introgressed regions are marked in yellow. RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc00g007070 100.82 87.87 88.21 93.68 100.62 91.98 93.67 90.85 83.63 78.40 79.67 74.15 79.11 70.28 74.85 79.98 87.80 73.49 74.36 71.92 Solyc00g026160 0.00 0.51 0.54 0.60 1.58 3.97 2.67 1.93 3.37 7.71 4.41 5.82 10.47 19.41 9.64 12.17 9.01 18.01 6.32 8.13 Solyc00g050430 70.17 70.80 66.09 65.42 112.61 104.81 78.75 82.40 105.39 92.06 82.28 82.29 130.96 135.08 120.84 111.85 129.25 145.27 125.81 124.02 Solyc00g080750 8.29 9.82 11.70 11.42 11.11 14.04 16.77 17.39 12.69 12.32 14.51 17.99 18.41 21.91 22.94 21.41 27.95 28.65 32.30 30.97 Solyc01g005210 40.49 35.86 45.10 43.08 44.10 48.17 53.28 57.06 41.57 42.29 50.37 54.44 50.68 46.11 51.93 60.86 58.18 49.80 69.30 60.70 Solyc01g005300 47.81 50.40 64.43 57.23 47.72 47.54 69.44 56.58 58.31 47.93 68.70 64.54 51.30 47.91 69.48 57.03 67.57 60.72 90.16 74.59 Solyc01g005420 0.17 0.13 0.91 0.44 0.28 1.01 1.46 0.51 0.21 0.50 0.68 0.14 2.30 3.09 3.82 1.63 5.55 7.10 5.98 6.76 Solyc01g006390 573.76 532.40 507.01 595.01 407.14 421.31 451.71 532.01 616.63 691.72 668.43 791.62 377.91 405.34 340.45 478.50 222.50 268.39 172.47 314.94 Solyc01g006510 86.72 102.89 107.67 106.83 121.82 134.59 133.96 146.54 126.47 127.56 138.33 143.98 114.34 124.14 147.45 130.60 133.45 126.98 152.92 137.39 Solyc01g007860 342.65 348.62 379.12 343.31 389.46 380.79 425.44 393.56 350.33 307.56 362.66 326.64 304.83 294.95 328.99 302.66 346.57 321.44 386.53 349.34 Solyc01g008110 606.79 471.67 418.47 398.99 344.09 335.50 294.90 298.50 440.90 474.33 366.04 379.20 454.43 460.36 380.35 389.51 564.83 515.88 512.37 481.02 Solyc01g010600 5.64 6.71 7.85 9.20 11.15 7.63 11.58 11.42 11.11 9.20 11.05 12.27 4.82 3.87 5.74 8.40 4.24 4.97 6.28 6.76 Solyc01g010700 5.12 6.52 8.11 6.75 9.11 7.54 9.69 7.10 8.73 6.65 12.14 8.05 13.96 10.22 13.51 10.36 17.68 12.55 17.47 15.14 Solyc01g014180 309.38 275.43 333.39 296.66 316.81 311.89 366.86 322.00 249.48 244.25 274.16 256.86 250.64 246.34 286.06 254.99 339.22 274.16 373.12 333.03 Solyc01g057000 0.91 1.08 2.38 2.05 1.85 0.97 1.60 1.78 2.91 1.85 3.02 2.12 2.07 2.33 5.30 2.73 5.32 4.07 6.41 5.71 Solyc01g060420 1.18 0.13 1.31 0.71 4.59 3.80 6.67 6.10 2.66 0.84 2.57 2.31 1.93 1.61 1.83 3.58 4.70 2.82 5.01 6.76 Solyc01g065980 31.80 31.68 37.69 39.15 26.10 20.48 29.46 23.39 23.27 20.21 26.76 22.55 31.42 27.73 35.62 30.57 38.58 37.43 47.04 41.19 Solyc01g066760 67.18 48.41 53.22 46.88 68.09 64.34 69.75 60.14 52.81 46.51 41.24 41.06 43.69 40.94 36.40 37.13 42.07 34.62 26.49 35.79 Solyc01g066880 14.74 16.84 31.63 42.03 7.88 10.36 17.27 19.09 22.22 18.52 31.55 24.88 32.66 42.24 57.06 42.87 50.92 49.17 59.44 50.71 Solyc01g073640 425.89 336.39 271.33 279.18 193.41 180.09 142.77 151.27 219.64 224.61 173.83 170.97 329.49 327.71 315.98 283.92 423.81 368.25 252.60 353.17 Solyc01g073770 172.96 185.28 207.42 211.74 162.19 153.17 190.92 194.28 178.74 174.54 194.34 186.21 158.95 157.95 174.87 172.91 170.29 198.80 287.13 220.06 Solyc01g079610 91.98 91.39 82.74 89.26 78.12 85.32 74.91 76.85 97.79 108.37 90.27 94.42 85.80 89.38 75.14 73.84 75.87 80.08 64.85 71.68 Solyc01g079980 23.87 22.42 20.12 15.33 31.74 36.74 26.99 29.06 29.77 33.21 29.30 22.83 21.89 24.12 22.83 17.57 22.10 19.15 14.24 18.49 Solyc01g080640 110.42 95.36 82.71 83.61 62.29 57.42 53.62 53.66 93.40 97.05 81.49 87.22 141.63 136.25 130.40 112.97 155.92 133.23 132.09 120.00 Solyc01g081190 17.82 18.03 19.48 19.11 18.62 15.22 23.31 20.08 17.82 18.69 20.38 21.41 24.28 22.95 26.49 26.02 31.43 30.44 35.20 37.04 Solyc01g081250 7.17 9.46 4.59 1.70 8.96 15.20 4.55 1.85 8.14 16.35 3.73 2.25 6.29 7.16 2.53 0.80 7.17 7.99 3.26 1.73 Solyc01g081450 74.44 87.40 89.03 82.08 67.30 69.19 77.70 69.35 65.81 66.62 78.22 69.92 58.83 61.40 74.26 71.63 74.61 90.37 109.68 85.73 Solyc01g087560 58.84 59.66 55.99 61.14 55.33 59.53 52.09 60.63 49.39 54.01 49.89 59.76 51.76 58.02 47.33 51.02 45.52 49.48 43.24 47.58 Solyc01g087570 128.38 105.45 97.55 100.62 79.05 77.94 72.69 75.27 107.93 108.93 86.67 100.51 118.47 107.38 93.23 107.86 106.96 93.03 73.59 88.38 Solyc01g089910 28.10 41.04 41.31 47.53 28.18 32.73 39.80 36.56 70.80 77.62 96.84 99.51 114.75 113.73 127.65 118.31 132.77 156.35 136.34 128.39 Solyc01g090340 56.62 45.91 39.59 39.35 30.47 27.22 24.07 27.20 37.25 38.74 31.59 32.51 36.89 36.33 32.14 30.97 44.36 35.40 23.27 27.09 Solyc01g090410 14.30 15.89 14.24 11.53 8.87 10.90 9.08 8.32 19.68 20.34 16.02 15.64 19.66 22.59 19.39 16.14 21.16 21.95 20.95 21.83 Solyc01g090670 52.44 46.82 44.59 44.91 55.97 46.60 47.37 41.54 43.73 45.57 41.82 40.78 47.77 43.46 38.68 45.36 36.99 32.33 32.16 32.49 Solyc01g091320 632.94 601.71 465.05 473.29 344.67 343.16 285.60 276.55 505.24 535.17 411.40 381.49 664.43 649.40 582.20 528.79 763.77 748.32 570.48 616.76 Solyc01g092950 156.93 184.39 176.52 174.52 37.07 33.92 54.42 54.62 38.65 36.40 52.58 48.40 26.56 22.25 32.58 33.08 18.06 21.44 22.47 24.49 Solyc01g095030 19.47 16.52 22.86 22.25 22.78 20.68 26.89 21.59 15.00 15.49 19.46 13.63 19.62 19.80 22.26 17.51 21.40 19.18 25.34 18.92 Solyc01g095760 13.55 13.50 16.97 12.43 7.50 7.32 9.57 6.70 9.17 8.21 12.46 11.81 7.69 6.97 9.29 8.32 6.64 7.60 14.67 10.88 Solyc01g096190 29.15 28.93 21.80 23.25 21.70 21.10 18.21 18.97 16.85 20.01 18.34 17.06 24.02 25.55 19.69 25.33 25.63 24.91 20.51 23.59 Solyc01g096320 2.89 1.80 6.77 2.23 4.94 2.18 5.97 3.56 3.91 1.52 6.11 1.22 7.30 2.84 7.03 3.28 13.98 3.59 14.77 4.24 Solyc01g096650 8.67 11.35 7.30 6.12 13.05 11.17 10.80 10.25 10.07 9.86 7.70 5.87 7.91 7.03 6.84 5.62 5.20 5.03 5.47 5.65

121

RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc01g096740 20.92 18.42 13.65 13.00 11.15 12.02 10.63 7.86 10.22 10.92 11.19 8.14 20.05 15.88 16.12 15.62 22.36 18.36 12.64 17.54 Solyc01g096810 87.78 93.60 126.11 111.35 115.57 118.43 148.83 143.59 108.99 103.97 117.76 127.13 119.87 117.23 155.32 134.18 167.87 150.74 229.37 171.56 Solyc01g097930 0.58 0.23 0.06 0.35 0.68 0.74 0.35 0.98 0.87 0.33 0.10 0.54 1.01 0.20 0.32 0.42 2.55 1.19 0.89 1.65 Solyc01g098190 14.59 18.95 20.36 20.02 10.74 9.60 15.97 12.97 12.99 12.85 17.31 15.89 16.30 12.97 20.35 20.45 21.57 18.10 31.29 24.28 Solyc01g098320 113.21 144.40 146.36 140.61 98.20 110.61 109.06 112.96 90.15 93.51 96.68 94.88 68.25 79.37 79.70 75.36 61.39 71.85 70.88 68.24 Solyc01g098390 48.86 40.85 53.52 43.46 52.15 43.65 60.05 51.78 39.25 41.17 51.89 50.19 36.64 38.55 42.85 39.48 37.49 31.79 49.19 46.21 Solyc01g098400 39.89 58.45 83.93 94.15 79.04 67.99 98.01 92.43 47.91 45.57 54.23 62.08 61.80 69.42 100.11 87.75 88.30 117.90 117.44 115.30 Solyc01g098930 6.55 6.78 9.08 9.03 11.10 11.12 13.55 15.41 10.46 10.11 14.00 12.26 16.53 12.15 14.38 15.32 17.86 11.86 15.77 18.20 Solyc01g099210 11.19 12.33 19.05 19.92 15.30 15.60 23.32 19.39 7.78 9.83 9.07 10.44 6.60 5.25 5.91 6.09 6.82 7.48 6.02 6.89 Solyc01g099840 50.98 44.98 83.39 80.93 108.29 92.84 175.19 136.27 133.16 112.50 199.06 159.86 238.97 187.34 282.92 227.59 302.55 215.87 315.22 277.36 Solyc01g099970 2.74 1.93 2.70 4.14 2.89 2.40 3.44 2.34 2.13 1.90 2.87 2.53 1.84 1.63 4.22 3.37 2.41 3.22 2.63 4.73 Solyc01g102960 6.97 9.47 4.86 4.68 8.05 11.66 7.73 4.50 9.52 14.98 9.89 8.35 14.38 15.59 11.86 5.84 19.31 25.10 16.81 13.33 Solyc01g103510 137.46 115.71 109.82 114.65 128.77 134.72 115.37 104.82 132.79 139.50 118.22 114.51 85.29 78.30 70.61 75.02 72.26 75.84 60.60 66.92 Solyc01g103590 114.27 133.65 136.55 141.91 127.49 144.28 154.21 164.44 159.77 185.15 195.13 214.15 249.08 269.53 286.05 316.90 241.76 296.13 362.23 317.01 Solyc01g104010 8.94 8.14 12.73 15.32 18.14 16.61 21.23 22.07 5.53 6.26 5.23 7.64 4.43 3.88 4.11 5.34 8.64 9.24 8.74 10.13 Solyc01g104020 27.53 19.30 20.37 19.00 21.22 19.23 18.27 15.93 20.05 20.38 18.07 15.87 21.22 22.12 18.78 19.60 23.88 22.80 15.52 23.94 Solyc01g104400 223.59 212.26 159.70 170.09 193.76 193.52 142.81 151.12 97.63 99.63 76.93 80.55 63.07 58.06 54.69 59.04 71.25 61.30 60.52 70.04 Solyc01g105000 19.83 19.70 16.62 20.33 12.54 12.57 10.93 12.30 51.87 57.00 45.66 49.50 67.71 62.08 57.74 54.72 59.96 62.32 45.09 48.92 Solyc01g105410 181.58 179.39 243.73 249.33 225.76 232.96 339.16 314.50 263.08 259.86 338.98 304.05 224.20 211.21 275.55 260.00 284.34 233.15 404.16 317.31 Solyc01g108240 1.26 1.40 2.58 2.27 1.43 1.28 2.32 3.15 1.60 2.08 2.50 3.38 3.40 2.47 3.00 4.83 1.92 2.26 4.92 6.52 Solyc01g108320 6.21 7.35 9.53 9.56 12.97 12.42 17.90 14.56 6.47 7.21 8.40 8.01 2.19 2.88 3.22 2.09 1.37 1.22 0.68 1.79 Solyc01g108910 33.67 33.03 46.95 41.89 51.23 48.11 72.98 64.20 55.57 53.68 68.80 63.51 76.19 70.36 97.75 91.53 91.27 88.06 128.66 99.95 Solyc01g109090 34.42 25.87 64.27 64.39 124.69 113.50 167.61 142.25 89.13 73.07 92.57 90.79 211.39 166.34 265.17 215.18 463.52 307.39 552.29 487.80 Solyc01g109280 65.71 69.91 80.82 78.93 69.26 69.87 73.56 73.08 71.11 75.61 76.26 74.58 61.64 67.42 70.99 67.42 59.53 67.19 75.79 62.89 Solyc01g109480 2.34 3.40 1.69 0.87 1.66 1.89 1.00 1.66 0.51 0.96 0.59 0.53 0.78 1.38 0.89 0.82 1.07 1.57 0.47 0.84 Solyc01g109500 1.09 2.56 1.88 1.26 3.65 1.33 5.16 0.89 1.24 1.37 1.76 0.65 2.19 1.74 3.96 1.73 5.70 3.62 3.10 3.33 Solyc01g109920 0.30 0.20 1.07 0.89 0.51 0.32 1.26 0.51 0.74 0.52 1.77 1.00 1.04 0.55 3.07 1.86 2.85 0.72 3.31 1.44 Solyc01g110290 54.58 53.40 47.80 53.66 49.15 49.03 45.45 39.41 47.91 52.35 44.53 40.80 49.90 53.18 46.13 42.07 53.69 49.75 39.54 43.53 Solyc01g111630 38.22 40.77 32.60 38.93 42.96 46.94 37.82 37.83 55.91 55.23 46.58 51.98 66.87 62.48 57.93 61.03 70.59 80.31 72.36 72.84 Solyc01g112230 2.54 1.63 3.22 1.35 0.66 0.24 1.23 0.20 0.47 0.10 0.87 0.22 0.71 0.00 0.85 0.00 0.45 0.00 0.72 0.82 Solyc02g014860 1.06 0.40 1.92 1.16 4.56 3.67 6.16 5.78 3.19 2.81 5.76 5.91 6.20 5.11 8.97 5.92 8.04 8.22 14.38 11.74 Solyc02g022900 8.50 5.25 10.23 5.00 10.26 7.50 11.17 7.40 9.55 6.51 8.20 6.61 7.35 6.12 8.61 5.41 7.74 5.09 5.51 5.43 Solyc02g024070 198.88 300.63 247.20 318.45 128.65 136.53 139.17 177.11 219.33 211.41 264.66 327.00 130.49 147.10 142.80 143.37 127.18 150.90 155.31 139.47 Solyc02g031830 7.98 5.41 7.07 8.85 9.00 7.62 7.44 9.01 6.26 5.34 7.51 7.44 6.89 4.99 6.63 7.97 9.44 6.94 5.47 7.90 Solyc02g050260 77.90 74.38 65.94 70.66 70.50 71.48 65.70 65.16 66.89 74.36 63.49 64.60 70.17 60.95 70.76 60.35 65.08 58.99 53.58 59.87 Solyc02g055370 138.59 118.12 152.28 178.05 157.33 158.36 187.03 230.21 92.70 81.54 86.19 86.97 22.00 22.87 22.74 29.57 16.28 13.53 13.12 17.02 Solyc02g062140 20.27 15.95 21.45 18.83 14.37 12.68 18.89 12.92 14.29 13.20 17.38 14.90 23.24 18.49 26.36 25.05 29.49 24.62 23.87 30.97 Solyc02g062490 77.34 66.82 50.63 52.74 29.74 26.83 22.72 29.49 57.56 65.21 48.17 53.37 111.02 113.63 101.00 96.44 129.59 134.07 121.45 112.26 Solyc02g063380 5.52 4.66 8.19 8.36 1.02 0.84 1.44 2.25 1.80 1.93 2.30 3.22 5.51 6.61 6.30 7.11 8.92 8.80 7.72 11.40 Solyc02g063420 2.73 3.34 6.28 5.46 3.24 1.78 4.19 3.06 2.25 2.54 2.64 2.68 2.65 1.27 3.32 2.84 4.14 2.55 3.14 3.18 Solyc02g063520 3.40 4.36 4.45 5.61 4.35 3.32 4.03 4.73 3.24 3.60 4.17 5.72 4.39 3.79 5.24 7.45 5.35 5.88 5.47 7.53 Solyc02g064560 1.11 1.61 3.72 1.33 1.30 0.65 2.60 2.39 1.87 1.25 1.89 0.99 5.02 4.00 7.70 5.90 8.31 6.81 13.22 11.46 Solyc02g064730 604.23 608.29 694.35 651.57 761.29 707.53 837.45 796.95 624.82 574.51 682.96 636.84 618.75 574.83 664.41 636.19 669.49 616.38 816.48 688.26 Solyc02g064830 0.63 0.20 0.52 0.77 2.61 1.93 2.14 1.72 0.97 0.10 0.37 0.43 2.11 0.80 0.46 0.63 2.91 0.92 0.64 1.47 Solyc02g067100 23.90 30.87 26.29 28.78 23.72 26.94 27.08 25.66 24.45 29.23 24.25 25.73 18.94 27.29 22.79 24.51 15.12 17.70 12.13 12.94 Solyc02g069490 634.52 580.79 456.32 462.59 330.33 323.40 254.09 254.08 654.93 686.25 500.73 505.71 798.87 774.59 645.34 605.28 1043.02 1038.78 896.83 795.76 Solyc02g069510 74.02 66.23 72.76 52.25 14.31 14.67 15.70 9.03 61.84 66.16 65.38 53.49 129.96 137.20 143.84 125.93 154.07 140.97 134.98 128.31 Solyc02g069600 0.98 0.23 0.39 0.10 1.41 0.61 0.70 0.29 2.42 0.89 1.40 0.63 1.09 0.74 1.58 0.66 1.28 0.59 0.30 0.10 122

RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc02g070630 55.95 50.02 59.97 57.08 57.96 49.02 62.80 57.94 39.82 43.38 47.68 48.44 43.73 39.55 47.79 43.47 50.35 48.14 68.99 54.45 Solyc02g070800 90.21 100.04 110.10 107.86 81.87 87.06 102.57 92.36 117.43 123.96 144.07 136.09 174.82 187.25 213.61 186.93 178.36 222.08 226.01 207.09 Solyc02g071740 34.79 35.43 46.76 43.56 31.13 31.22 33.30 34.96 33.18 37.54 37.74 41.89 34.62 33.92 38.90 40.89 36.49 40.98 46.89 43.35 Solyc02g071800 7.10 6.33 6.53 3.49 4.60 8.20 6.29 3.88 2.85 3.68 3.73 1.44 3.26 4.69 5.03 2.12 3.23 4.07 5.22 1.65 Solyc02g071980 16.99 21.78 21.70 21.84 19.53 21.99 23.89 23.89 17.87 19.91 21.63 23.17 21.12 20.36 26.46 22.62 19.57 22.33 25.18 21.62 Solyc02g072210 0.61 0.65 2.40 1.35 2.29 1.29 3.28 3.77 2.58 1.82 2.97 4.62 3.73 2.81 3.16 6.43 5.56 4.76 5.56 7.28 Solyc02g077030 0.16 0.74 0.25 0.00 0.28 0.32 0.35 0.38 0.13 0.37 0.20 0.00 0.59 2.12 1.02 1.71 2.11 5.16 1.36 1.78 Solyc02g077240 13.73 11.55 11.94 10.44 8.63 6.98 11.03 7.64 6.45 3.60 6.51 5.16 4.64 3.72 4.41 3.42 5.07 2.86 3.27 3.75 Solyc02g077330 75.24 69.45 61.08 61.33 61.13 64.94 58.68 55.95 74.16 81.00 68.18 69.08 99.10 98.89 81.53 92.32 103.66 104.27 93.31 91.44 Solyc02g077980 2.69 0.70 2.21 2.45 1.50 1.44 3.30 1.57 1.19 0.91 2.60 0.79 0.92 0.72 1.83 0.79 2.72 0.88 6.44 3.35 Solyc02g079240 0.30 1.54 2.32 2.57 1.65 1.64 8.03 5.44 2.71 2.19 6.05 3.88 2.42 2.21 6.10 5.72 5.01 2.90 9.33 3.87 Solyc02g079960 15.77 13.38 19.30 20.76 19.36 18.24 25.70 18.55 18.51 18.30 23.09 20.62 21.08 23.70 23.90 23.10 28.36 23.72 32.71 27.25 Solyc02g080490 8.13 8.52 8.95 6.90 10.38 11.22 9.42 7.62 11.33 13.24 8.12 8.68 11.55 12.05 10.25 8.74 10.53 11.11 10.56 9.80 Solyc02g080880 105.38 109.77 135.00 138.19 111.47 122.17 146.67 135.42 105.87 101.90 131.22 118.34 103.32 90.94 113.47 108.20 114.87 93.63 103.65 116.12 Solyc02g081070 119.36 129.07 125.58 125.13 130.82 142.94 130.66 112.27 106.10 120.24 102.72 92.67 91.31 107.55 98.55 99.56 71.57 74.46 54.62 62.91 Solyc02g081120 219.81 294.98 318.00 335.80 494.71 484.90 493.64 542.92 405.85 392.94 460.62 483.31 166.91 167.73 184.03 192.20 80.20 87.98 95.03 100.60 Solyc02g081130 2.54 1.93 4.51 2.07 2.22 1.16 2.31 1.56 1.59 1.16 1.99 0.33 2.04 1.14 2.99 1.53 3.03 1.93 3.43 2.53 Solyc02g081190 132.84 183.10 193.52 210.03 238.60 262.74 285.82 291.55 126.45 114.45 124.03 137.00 152.95 186.74 236.41 228.32 315.30 395.98 373.12 443.66 Solyc02g081480 5.89 5.93 7.72 8.25 2.02 2.77 3.79 4.15 1.00 2.14 0.67 3.01 0.18 0.24 0.16 1.02 0.20 0.44 0.76 0.45 Solyc02g081570 3.64 5.18 2.64 2.45 2.76 3.23 2.26 2.09 3.45 4.34 2.53 2.87 4.35 2.71 2.89 2.92 4.08 3.10 2.93 2.55 Solyc02g081730 74.05 65.19 58.90 54.01 49.82 48.66 45.43 46.14 65.22 68.64 57.16 61.46 55.72 60.59 53.95 53.57 63.85 55.06 45.44 51.23 Solyc02g081880 75.58 76.25 93.51 85.42 84.39 81.48 92.77 90.22 65.87 55.89 70.35 66.32 63.71 59.67 72.17 60.76 61.91 63.50 84.84 64.66 Solyc02g082260 446.24 365.12 331.97 316.29 312.78 314.40 295.72 278.33 326.29 370.34 291.50 287.88 296.09 296.48 266.32 255.04 319.67 279.52 204.17 256.62 Solyc02g083020 1.93 2.36 2.86 2.41 4.53 2.45 5.08 4.11 2.14 1.93 5.22 3.04 4.59 2.37 5.29 5.84 3.41 3.19 5.05 2.83 Solyc02g083030 0.48 1.28 2.59 1.41 2.74 1.17 3.43 2.42 1.13 1.19 2.54 2.47 2.53 2.62 4.66 4.30 5.36 4.91 7.59 6.92 Solyc02g083280 20.86 19.20 26.75 26.32 32.13 38.66 43.36 41.97 31.72 27.75 38.55 34.94 42.09 39.12 58.28 54.69 76.27 54.19 87.51 78.75 Solyc02g083320 181.20 177.36 213.07 179.07 187.00 187.14 218.96 189.32 160.39 153.51 182.63 158.50 160.55 136.95 175.58 147.85 172.70 151.15 192.20 180.25 Solyc02g083520 318.47 344.08 398.49 400.83 138.14 140.14 195.10 174.53 111.07 107.84 134.37 126.33 94.09 80.66 102.29 94.60 97.59 88.91 98.94 100.09 Solyc02g083790 5.66 4.78 6.41 7.77 3.62 2.88 4.13 5.71 4.96 5.80 6.90 8.57 4.53 7.52 5.91 7.36 5.03 5.42 6.06 7.18 Solyc02g083860 165.73 138.92 150.90 141.59 157.59 152.37 151.90 129.14 148.49 131.03 129.06 109.06 220.59 193.49 196.73 170.73 336.00 272.65 284.39 244.87 Solyc02g083880 204.97 159.75 308.48 178.71 412.33 275.71 397.47 251.48 330.51 259.59 293.84 247.60 162.04 116.38 191.68 131.97 130.39 99.70 121.97 98.23 Solyc02g083890 153.28 276.41 171.46 256.92 152.94 240.88 150.91 224.88 184.85 270.37 175.93 260.82 141.77 223.17 139.38 218.19 97.28 171.70 131.82 150.45 Solyc02g083950 12.44 17.76 18.93 23.12 43.43 44.12 46.73 49.25 28.24 30.49 31.51 28.67 5.91 6.42 5.50 9.86 1.07 3.89 4.15 4.21 Solyc02g084240 732.83 625.41 869.07 767.65 875.42 738.72 1067.47 870.19 767.63 606.72 874.09 730.36 852.13 703.94 885.78 777.18 1063.78 776.56 1059.91 958.66 Solyc02g084570 11.49 21.28 23.38 25.13 22.12 19.10 26.62 29.05 17.02 14.59 18.73 20.93 8.61 9.65 12.66 12.71 5.73 9.15 12.21 9.91 Solyc02g085150 6.99 6.10 13.05 8.29 10.97 11.91 13.40 9.86 4.77 4.36 6.46 3.96 11.94 11.11 18.96 11.69 21.41 12.82 34.49 15.84 Solyc02g085920 62.22 70.20 71.99 73.80 62.20 59.44 70.18 70.95 76.80 67.08 85.43 77.20 72.70 71.54 81.10 74.53 74.71 71.08 129.80 86.88 Solyc02g086180 243.62 183.70 134.18 139.17 113.99 103.69 86.00 87.05 164.14 175.62 139.64 129.59 210.88 188.14 162.57 139.96 272.34 200.47 173.93 175.91 Solyc02g086650 33.70 39.21 25.80 26.91 13.75 16.74 15.58 15.82 34.65 33.13 31.20 31.38 41.83 45.39 42.84 35.64 39.25 45.84 33.93 32.88 Solyc02g087120 43.03 51.11 44.32 44.33 67.35 69.94 60.38 58.18 66.20 73.17 63.18 60.14 30.03 35.54 28.18 28.59 18.10 20.12 17.65 17.72 Solyc02g087240 161.68 163.93 153.23 153.05 184.45 189.72 163.01 161.91 160.59 160.86 155.54 147.27 130.23 129.36 128.51 132.46 134.34 135.10 101.95 126.05 Solyc02g087270 1.27 2.33 1.43 2.23 1.76 2.08 1.18 1.67 1.12 2.74 1.37 1.54 1.64 1.32 0.86 1.57 1.45 2.07 0.47 1.61 Solyc02g087780 37.76 25.10 24.51 23.15 26.04 27.84 24.86 23.44 42.74 44.36 35.04 39.66 56.75 52.86 50.43 53.91 56.74 48.02 45.87 47.90 Solyc02g088100 32.20 30.13 29.09 30.02 31.91 28.89 29.23 23.64 26.70 27.43 21.27 25.87 52.93 50.64 48.62 43.78 47.84 52.99 36.88 36.82 Solyc02g088130 49.64 41.12 38.02 37.10 112.20 100.52 84.64 82.81 77.08 67.36 69.13 65.37 37.82 32.50 35.19 35.26 31.59 25.65 18.18 26.35 Solyc02g089080 17.81 19.74 17.13 19.61 23.52 28.95 26.56 25.73 24.32 26.52 21.48 25.30 37.50 49.68 38.30 45.23 52.15 63.72 45.64 61.63 Solyc02g089210 33.54 42.39 59.48 68.70 84.66 80.84 92.00 96.80 61.18 67.44 72.80 70.63 24.64 23.34 30.62 33.83 18.70 18.70 27.35 26.21 Solyc02g089620 103.69 111.98 119.87 129.44 119.61 120.86 129.62 126.93 132.05 145.20 147.16 176.14 180.03 162.81 197.55 205.78 118.06 128.64 188.73 155.97 123

RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc02g090490 3.89 5.15 6.49 5.09 7.86 9.75 11.26 10.90 3.57 4.66 6.35 7.11 6.98 5.91 8.95 10.44 7.97 7.24 9.79 11.64 Solyc02g091700 11.90 7.62 14.79 12.91 16.40 13.58 17.52 17.79 16.31 14.75 20.10 18.07 19.54 15.83 24.87 21.22 23.25 18.74 26.62 26.58 Solyc02g092240 10.83 9.36 14.59 13.05 26.84 24.12 25.04 28.22 15.90 14.60 16.44 19.12 11.75 10.88 11.98 15.13 10.64 11.70 10.72 14.46 Solyc02g092290 24.19 21.53 28.95 26.95 21.98 21.40 27.15 23.42 22.57 18.58 24.12 21.75 19.71 21.84 23.36 21.60 22.24 17.30 26.74 21.39 Solyc02g092480 111.30 99.49 96.55 92.51 70.93 75.69 71.44 77.12 106.08 113.21 101.70 104.28 133.15 135.41 121.08 127.42 113.56 112.57 93.73 98.22 Solyc02g092530 12.81 7.32 11.73 16.61 12.46 10.23 15.22 13.36 6.07 5.23 6.71 8.81 5.20 4.67 7.86 7.42 8.08 6.89 7.46 7.96 Solyc02g092550 39.73 31.97 40.89 46.28 23.96 26.15 31.61 32.50 16.70 16.98 17.85 19.22 19.32 18.16 20.04 24.81 20.92 14.25 14.96 24.12 Solyc02g093370 126.47 146.21 155.22 143.95 124.19 131.08 141.58 134.35 123.90 128.40 134.60 130.35 123.22 132.29 138.96 132.73 131.97 149.07 165.03 149.07 Solyc02g093760 26.28 35.80 36.33 32.67 31.56 30.96 31.13 31.67 32.41 33.81 31.38 27.50 21.48 26.78 25.90 21.20 17.25 23.03 22.43 16.88 Solyc02g094120 54.04 42.83 48.99 49.87 64.30 62.58 79.40 61.27 59.44 53.72 63.73 60.21 65.38 66.31 75.06 61.35 85.44 63.85 106.26 80.09 Solyc02g094280 54.07 48.82 48.62 49.77 67.18 63.54 60.49 56.77 50.43 54.48 47.02 53.37 43.80 45.40 37.10 46.28 46.46 43.66 27.94 41.97 Solyc03g005010 58.58 75.36 78.62 72.62 69.75 66.51 76.86 73.58 61.76 63.37 70.61 65.54 73.65 69.98 81.98 76.94 65.79 64.37 72.02 70.75 Solyc03g005420 4.94 5.16 7.87 6.78 7.03 5.63 6.12 6.10 6.44 5.49 11.20 5.99 3.47 2.87 6.49 5.84 4.19 5.44 3.48 4.93 Solyc03g005450 6.14 5.26 5.67 6.30 5.31 6.64 7.65 7.13 5.22 6.58 8.43 8.10 10.70 7.77 11.37 10.53 12.31 12.12 18.22 16.20 Solyc03g006350 29.34 32.44 40.53 34.92 37.35 31.33 39.81 40.74 34.22 27.86 39.36 31.97 31.85 29.17 40.24 31.28 27.13 28.15 34.65 28.72 Solyc03g006360 20.57 17.26 40.05 43.23 101.02 80.67 166.00 146.60 64.36 61.58 102.27 95.88 140.51 120.44 170.04 151.82 256.35 166.90 305.60 258.09 Solyc03g006490 166.22 213.87 293.95 381.69 609.87 660.05 753.14 886.34 564.60 591.96 676.19 833.55 486.75 510.39 595.46 722.15 408.74 457.24 580.95 631.28 Solyc03g007200 0.13 0.10 0.79 1.30 0.86 1.24 1.20 1.58 1.05 0.30 2.01 1.93 1.00 1.39 2.42 2.11 1.63 1.67 2.46 2.63 Solyc03g007500 68.44 58.81 69.73 59.54 34.52 35.58 47.62 49.50 46.03 43.29 55.17 55.70 39.06 42.27 45.89 45.95 51.65 50.07 62.10 49.05 Solyc03g007610 73.83 73.12 68.26 68.42 78.14 77.68 72.29 73.58 76.46 77.18 63.60 65.79 67.80 65.12 64.47 64.21 63.39 69.80 61.78 61.57 Solyc03g019820 0.08 0.10 0.58 0.58 0.16 0.08 0.69 0.20 0.40 0.10 0.79 0.27 1.11 0.65 3.53 0.82 3.18 1.48 4.91 1.99 Solyc03g020060 37.62 21.24 24.37 46.15 7.66 7.73 8.51 12.61 20.85 12.93 14.64 23.86 57.62 47.25 48.50 58.81 86.12 100.29 112.00 123.68 Solyc03g020080 141.67 97.12 122.72 176.54 35.58 38.05 40.41 54.56 58.44 51.19 51.03 70.38 248.55 218.43 203.63 262.65 299.50 283.63 282.42 395.34 Solyc03g025390 49.84 35.30 29.60 30.85 30.53 26.39 22.36 22.28 41.61 45.80 35.38 33.74 60.07 56.90 45.91 44.89 56.76 54.87 43.22 49.44 Solyc03g026020 32.77 26.19 29.59 28.29 30.89 31.44 33.09 34.39 25.80 22.91 30.42 26.04 33.20 24.35 29.98 27.91 38.42 29.05 48.13 36.56 Solyc03g026070 13.32 7.09 9.95 9.84 3.22 4.56 3.86 4.66 4.10 8.71 7.16 4.54 6.48 7.48 8.14 8.19 11.68 7.26 6.07 9.88 Solyc03g031890 3.33 3.18 5.17 6.68 7.26 6.40 11.54 12.22 8.75 7.33 13.76 11.41 18.05 15.67 26.23 25.76 24.41 19.23 34.94 34.25 Solyc03g031970 91.16 88.69 85.75 81.86 76.94 76.35 73.04 64.61 72.06 74.94 58.30 63.27 75.70 76.15 71.81 70.00 72.85 77.48 68.08 69.61 Solyc03g032190 71.47 82.02 71.11 78.49 76.73 83.21 75.77 79.55 84.28 97.11 77.47 86.11 61.40 76.79 53.94 64.14 52.03 67.94 65.10 44.72 Solyc03g033590 1.07 1.31 0.52 1.70 2.12 2.81 1.45 2.38 1.34 1.77 1.37 3.73 4.84 5.87 4.39 8.04 7.17 7.85 3.52 7.59 Solyc03g034400 3.27 5.63 4.61 5.21 3.21 4.94 3.63 4.68 8.28 11.00 14.84 15.17 3.34 2.59 3.04 4.52 2.70 2.65 2.41 3.39 Solyc03g043740 9.43 14.16 14.23 15.69 7.67 5.94 8.62 8.35 5.72 4.63 6.72 6.04 4.75 5.35 10.55 6.11 7.09 8.87 12.10 9.44 Solyc03g044840 3.44 3.92 3.74 5.94 3.03 1.47 2.59 5.15 2.92 1.64 3.31 4.81 5.44 3.28 4.61 6.57 9.23 8.83 11.83 11.25 Solyc03g058160 1.52 1.18 0.86 1.01 0.42 0.74 0.43 0.69 3.74 5.27 2.55 3.78 6.23 5.19 5.01 3.09 3.05 6.13 3.26 2.54 Solyc03g063600 52.39 40.44 44.69 40.15 61.16 53.50 47.96 47.08 41.76 44.70 41.63 43.84 50.10 42.04 42.98 42.41 48.65 42.14 40.85 40.66 Solyc03g081230 10.71 4.14 5.05 3.33 11.06 9.05 12.56 8.22 6.75 4.45 6.13 2.93 10.40 8.49 9.78 6.70 23.55 14.34 13.05 13.40 Solyc03g081240 13.67 13.86 19.93 14.78 22.38 14.97 24.47 21.42 20.78 16.22 23.61 21.50 25.18 23.65 31.08 25.72 31.22 24.89 35.77 29.77 Solyc03g082370 4.17 2.58 6.66 5.76 12.89 10.17 21.30 15.71 12.48 8.70 18.61 13.29 17.66 12.81 16.87 18.03 30.82 15.27 44.21 30.55 Solyc03g082600 185.08 166.60 152.31 168.34 178.41 176.55 166.63 157.18 183.54 175.30 171.52 166.01 161.25 138.97 149.17 146.38 163.24 150.82 125.22 145.33 Solyc03g082890 19.01 22.90 20.03 20.80 21.29 24.70 24.86 28.17 31.42 30.07 27.69 32.19 32.76 39.23 38.49 39.51 30.27 44.22 39.61 42.97 Solyc03g082920 208.14 186.30 154.05 169.19 161.14 184.77 129.72 139.99 200.94 245.69 171.88 208.25 242.07 289.39 195.63 239.48 215.12 251.95 176.72 209.60 Solyc03g083000 28.45 24.71 39.25 33.20 32.47 29.94 38.18 34.33 23.02 24.07 26.68 23.68 30.56 27.66 34.28 30.40 33.75 30.04 33.71 34.95 Solyc03g083730 0.44 0.25 0.50 0.35 0.53 0.24 1.21 1.30 0.53 0.16 0.74 0.48 2.30 2.37 2.98 3.32 5.05 5.43 14.37 10.10 Solyc03g083770 1.60 1.05 2.25 2.32 1.29 0.54 1.44 1.28 0.95 0.95 1.25 0.78 36.07 32.37 46.24 39.47 164.70 142.88 267.77 225.08 Solyc03g093140 6.48 3.40 2.81 3.41 5.96 4.01 3.35 4.16 9.76 6.39 6.00 6.76 18.54 13.32 13.29 15.47 15.63 12.45 12.72 10.02 Solyc03g095370 3.30 3.33 4.91 5.02 2.93 1.97 4.23 3.51 2.11 2.34 4.53 2.83 1.12 1.45 2.99 2.50 3.84 1.99 3.82 2.93 Solyc03g096660 8.10 11.08 9.16 10.54 6.49 6.79 5.26 4.90 9.67 10.34 7.14 7.79 6.71 7.90 5.03 6.48 4.73 5.48 3.01 4.27 Solyc03g096730 45.46 46.87 47.16 46.51 22.28 36.40 42.76 30.84 22.34 38.18 36.58 30.98 43.83 49.23 45.41 40.71 48.70 49.79 50.71 53.21 124

RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc03g096760 6.59 13.73 11.34 8.44 3.54 9.67 10.48 8.78 2.91 8.87 6.71 5.94 16.01 26.64 24.58 23.97 30.61 45.84 38.15 41.45 Solyc03g096880 20.12 25.17 25.98 25.14 19.83 25.64 29.85 23.57 24.71 23.06 31.29 26.91 22.40 30.16 32.32 22.33 23.74 26.86 33.37 26.41 Solyc03g096900 7.32 13.23 12.97 10.03 7.74 15.40 15.05 10.83 9.03 12.41 14.89 11.99 8.99 17.07 16.63 15.39 11.51 19.82 25.00 12.86 Solyc03g096930 33.82 37.47 37.46 39.45 35.26 50.99 40.37 39.45 32.88 46.71 38.19 40.13 33.22 41.15 43.43 40.52 32.52 36.96 28.07 30.07 Solyc03g096940 65.86 78.42 76.72 68.94 73.54 96.16 85.21 74.36 59.13 82.17 73.53 68.57 53.60 71.13 61.73 53.59 54.21 62.46 47.53 61.95 Solyc03g096960 112.92 180.16 181.81 160.87 124.80 178.02 198.08 161.31 154.14 202.85 208.05 167.11 123.96 156.17 174.75 146.53 110.40 179.66 178.91 139.26 Solyc03g096990 14.11 10.10 10.16 9.59 14.78 11.78 11.92 14.31 14.84 11.71 11.81 14.80 18.78 15.54 9.78 14.68 15.52 12.78 12.63 15.10 Solyc03g097010 51.60 66.27 61.78 56.42 62.16 70.08 74.75 65.07 49.96 71.43 61.17 54.81 42.14 50.77 56.10 51.44 43.10 53.53 31.29 45.42 Solyc03g097030 9.28 12.39 13.20 8.66 6.44 9.86 10.12 6.91 8.16 13.57 11.68 8.43 9.47 8.80 9.93 7.08 10.55 11.69 16.48 12.39 Solyc03g097060 17.90 23.62 24.68 23.19 18.64 19.34 22.39 20.78 15.05 20.49 18.12 17.10 16.89 19.64 18.42 17.25 17.23 20.62 20.04 17.27 Solyc03g097150 2.21 6.12 4.49 5.11 2.10 4.99 3.61 2.82 1.27 3.22 2.03 1.94 0.49 2.40 0.80 0.95 1.41 2.99 2.80 3.15 Solyc03g097230 4.77 4.81 8.28 8.08 8.20 6.81 8.50 8.28 5.85 6.54 8.43 7.79 3.36 3.80 3.60 6.06 4.75 4.72 6.74 5.15 Solyc03g098010 0.42 0.63 0.52 0.76 1.78 0.43 1.36 0.90 4.00 2.29 2.82 1.88 4.25 2.69 4.41 2.86 3.01 1.65 4.11 1.60 Solyc03g098710 181.70 101.68 74.96 99.25 44.91 52.86 35.88 75.49 84.33 87.60 54.93 104.17 533.26 543.45 316.08 441.46 365.20 365.36 168.85 398.60 Solyc03g098730 0.77 0.45 0.79 2.17 2.10 2.10 2.33 4.33 1.34 1.74 1.07 2.30 3.76 4.17 3.70 6.03 4.67 4.75 3.18 8.09 Solyc03g098790 3.67 3.49 5.74 7.99 2.38 6.27 6.33 5.78 29.07 37.77 43.42 78.98 404.13 577.47 432.01 774.40 530.08 693.42 425.39 991.21 Solyc03g111140 6.01 6.40 9.89 8.46 8.05 7.59 10.92 9.60 9.13 7.17 9.81 10.14 6.40 5.86 10.53 7.57 12.23 9.14 17.80 10.88 Solyc03g111410 1.94 0.83 0.91 0.68 1.41 0.76 1.50 0.50 2.29 0.76 1.47 0.42 2.26 1.06 1.68 1.65 3.04 1.34 2.93 0.94 Solyc03g111640 115.19 107.58 130.61 124.96 125.08 120.93 153.63 132.53 112.81 108.71 126.99 116.78 126.00 120.90 144.68 126.68 156.10 135.73 178.02 153.15 Solyc03g111710 17.32 16.74 25.96 28.16 18.06 19.55 24.36 25.73 18.51 19.14 23.61 23.58 28.37 30.13 33.47 34.77 31.81 29.82 35.65 38.36 Solyc03g111820 3.79 3.63 3.43 3.16 5.25 5.30 5.61 3.42 4.78 5.40 4.21 2.90 4.77 4.72 2.90 2.73 11.69 11.22 7.34 7.96 Solyc03g112540 43.29 32.81 34.94 51.66 49.85 36.93 42.27 45.97 38.70 38.74 36.61 43.34 43.87 42.44 49.68 50.58 40.82 39.04 35.12 39.88 Solyc03g112590 36.14 36.89 54.51 50.73 29.88 26.07 44.40 37.62 24.74 22.87 36.51 33.46 19.21 18.67 30.36 24.43 22.59 21.22 38.89 26.57 Solyc03g113620 29.05 27.52 36.53 38.22 34.36 33.56 39.19 37.99 32.99 30.79 40.52 38.95 57.75 62.12 75.66 67.49 81.77 71.44 75.65 88.28 Solyc03g113800 182.18 155.19 151.48 143.80 174.69 181.51 165.51 154.27 162.30 167.68 149.41 148.74 145.12 145.64 132.61 142.36 150.32 134.10 118.24 138.62 Solyc03g114090 0.70 1.63 3.00 3.96 4.83 5.00 7.03 6.63 7.24 7.28 8.62 9.22 1.56 2.25 2.09 2.85 1.20 1.26 0.98 1.48 Solyc03g115650 326.95 281.08 381.85 371.28 470.36 426.80 601.41 548.26 353.42 331.51 453.21 440.40 339.29 319.01 412.61 406.34 383.26 305.02 382.73 407.98 Solyc03g115990 27.34 20.91 22.92 22.18 32.35 27.20 24.74 28.56 28.99 28.90 27.18 24.53 24.97 18.94 19.61 19.80 25.16 17.79 13.95 19.40 Solyc03g116390 8.05 3.11 4.22 2.96 5.21 4.25 6.36 4.60 4.55 2.07 3.66 1.77 2.51 2.56 2.43 1.78 4.75 1.39 2.29 1.10 Solyc03g116520 6.56 8.54 11.84 14.08 10.84 10.37 15.03 14.83 14.69 10.83 14.95 16.55 11.10 10.71 11.31 14.59 9.76 12.89 9.33 12.53 Solyc03g116670 34.76 33.83 36.91 35.66 41.10 33.32 49.38 42.42 38.52 29.34 47.10 35.89 62.67 52.15 69.69 55.59 93.60 71.26 137.19 87.60 Solyc03g116870 2.47 2.40 3.14 3.46 1.36 1.94 2.38 3.03 1.38 2.51 2.65 2.01 5.05 7.16 8.98 7.49 9.66 12.84 13.99 12.99 Solyc03g117230 43.24 52.79 72.65 82.58 119.23 113.20 122.04 121.65 93.17 97.91 113.90 106.27 35.66 34.04 23.89 29.76 1.23 0.77 2.03 2.19 Solyc03g117440 40.12 44.57 43.62 44.63 40.43 47.01 47.83 50.24 40.90 40.30 44.11 42.42 38.46 47.00 46.68 46.77 39.51 45.28 43.46 45.70 Solyc03g118890 17.41 15.92 20.40 18.88 15.37 13.94 21.03 21.77 20.52 18.32 20.46 17.73 21.94 20.77 24.79 24.50 25.87 22.80 30.07 29.97 Solyc03g120500 126.31 131.86 145.62 149.33 140.85 140.53 158.05 149.13 153.80 149.42 167.08 164.56 133.50 126.06 142.13 135.55 140.00 139.88 135.42 137.15 Solyc03g120690 4.37 2.91 5.61 4.88 5.11 5.02 8.70 6.19 4.13 2.35 7.64 4.86 5.33 4.35 7.41 5.31 4.91 5.83 8.48 7.36 Solyc03g121010 37.49 46.43 45.57 48.80 39.59 40.33 49.67 39.98 36.85 44.19 45.31 45.03 48.37 45.11 58.07 52.08 55.23 58.41 61.19 62.47 Solyc03g121090 26.06 31.73 59.05 63.93 82.99 82.32 123.60 118.99 75.53 59.56 95.52 92.38 127.56 111.94 153.81 169.67 161.73 145.52 191.10 228.47 Solyc03g121850 10.75 5.24 6.78 15.24 10.09 4.87 6.92 13.23 11.73 5.90 7.84 11.78 8.61 5.40 5.78 13.25 9.53 6.02 6.19 9.29 Solyc03g121970 9.05 5.43 12.29 10.26 12.82 9.24 12.49 13.59 11.58 9.08 9.20 10.65 28.97 23.49 25.96 27.76 34.28 32.97 36.04 34.89 Solyc03g123390 38.97 39.58 27.48 29.53 22.24 23.74 16.54 21.22 29.80 34.24 23.26 29.45 42.70 43.06 34.43 33.40 42.34 46.07 36.20 37.61 Solyc03g123430 36.36 51.88 26.07 36.52 42.06 50.70 37.55 40.87 57.20 56.60 53.25 55.52 30.71 33.44 30.50 31.30 38.01 42.99 39.98 35.31 Solyc03g123540 3.48 2.11 1.76 1.93 3.60 5.59 2.65 2.37 6.59 8.98 5.87 5.19 6.51 10.77 6.12 3.61 8.89 10.65 7.92 6.28 Solyc03g123710 3.96 2.33 3.36 2.83 4.25 3.18 3.72 3.15 3.53 3.43 4.21 2.96 6.36 4.72 7.40 4.15 9.23 6.77 8.48 7.58 Solyc04g005070 157.23 154.64 123.09 118.24 96.00 96.30 80.67 78.88 123.00 125.60 102.01 108.25 161.57 171.78 149.21 127.09 176.20 179.27 122.21 140.18 Solyc04g005250 1.83 2.08 4.40 2.54 5.73 5.19 6.98 5.46 3.70 2.49 4.64 2.57 3.83 3.75 5.67 2.79 5.16 5.44 8.82 3.36 Solyc04g005380 49.56 39.62 47.72 37.97 25.83 16.31 25.78 14.95 27.99 17.96 32.55 18.08 31.24 19.98 29.16 15.36 40.16 28.50 49.95 26.34 125

RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc04g007470 7.69 9.53 8.20 11.93 10.49 9.72 9.02 11.54 7.47 7.17 7.55 9.44 9.88 9.03 7.72 8.82 8.11 6.55 5.76 8.40 Solyc04g007690 0.63 1.28 0.25 0.54 0.56 0.27 0.14 0.40 0.56 1.54 0.10 0.37 4.34 3.94 2.76 2.97 8.28 10.47 6.16 5.94 Solyc04g007950 15.38 11.11 10.91 12.06 12.38 12.12 10.19 11.18 10.62 8.98 9.56 10.66 19.09 13.77 15.77 13.46 23.13 15.96 15.30 16.61 Solyc04g007970 132.04 138.73 147.64 143.91 124.60 118.52 146.28 133.66 92.72 95.97 103.98 101.68 101.41 97.51 111.75 106.09 124.22 112.92 120.26 112.71 Solyc04g008330 11.72 14.22 9.42 10.38 19.31 21.02 16.36 15.35 23.78 29.12 15.88 15.09 12.39 10.00 7.56 8.08 10.15 12.43 9.87 8.33 Solyc04g009900 107.93 97.40 114.27 113.03 72.77 72.96 96.56 82.97 63.34 68.18 84.01 75.16 74.10 68.56 86.78 76.44 77.73 67.60 106.95 83.46 Solyc04g011350 14.14 12.92 10.93 10.36 14.70 16.72 16.27 11.74 10.08 14.40 9.50 7.35 14.55 14.79 10.45 12.47 14.75 13.89 8.65 13.88 Solyc04g011430 203.74 194.33 223.36 220.38 217.76 211.61 244.87 235.24 200.54 188.81 225.17 227.81 158.32 143.93 181.46 176.40 181.27 164.56 197.83 183.93 Solyc04g011530 23.79 15.73 15.52 17.40 22.18 16.81 19.09 16.56 16.94 17.23 15.11 17.66 17.03 13.54 17.37 15.83 16.47 14.15 12.37 15.86 Solyc04g011550 18.98 16.50 20.63 20.56 18.18 16.37 27.23 21.52 17.16 17.42 21.78 19.63 25.04 21.37 30.29 28.44 43.76 39.58 60.19 39.88 Solyc04g011770 9.86 11.66 8.06 7.21 5.18 5.59 4.50 4.53 33.37 29.21 22.87 27.56 23.38 27.15 19.94 24.20 20.34 19.31 16.29 15.44 Solyc04g014480 32.28 36.44 28.43 29.38 36.20 47.15 40.13 35.09 30.42 46.75 33.85 30.11 40.87 45.67 37.69 32.21 47.08 51.12 42.77 39.89 Solyc04g014520 0.19 0.25 0.20 0.27 0.20 0.31 0.00 0.58 0.81 0.40 0.39 0.00 2.96 2.91 0.78 1.26 6.77 5.59 3.52 3.70 Solyc04g014730 20.04 22.13 17.89 21.63 18.50 22.19 13.55 16.05 12.35 18.33 11.72 13.45 16.67 19.89 17.20 18.61 19.17 20.49 16.03 22.54 Solyc04g014830 1.24 2.17 2.32 3.45 1.59 0.86 1.87 2.19 0.94 1.41 1.79 2.29 0.16 0.19 0.67 0.71 0.81 1.03 0.81 1.27 Solyc04g015200 5.06 5.56 8.43 6.31 5.38 5.31 7.61 5.36 5.10 5.84 8.03 5.29 5.50 6.30 6.83 5.25 6.01 5.43 8.90 5.77 Solyc04g015620 97.69 85.51 84.47 89.59 122.96 117.06 103.70 112.41 101.17 100.37 92.93 99.03 148.71 141.29 124.51 133.03 127.83 122.03 88.12 129.52 Solyc04g016120 1.41 0.66 1.82 1.45 2.73 0.40 1.07 0.38 3.01 1.17 2.03 0.62 3.78 1.84 3.41 0.41 1.98 1.07 3.18 0.84 Solyc04g016180 23.36 29.17 29.42 31.07 24.84 23.75 27.23 29.29 38.02 38.47 40.93 48.63 38.98 40.07 39.76 39.44 36.65 37.64 48.74 43.60 Solyc04g025610 4.51 4.79 6.81 6.00 5.83 6.31 9.48 7.12 3.13 3.90 4.77 3.86 1.48 2.62 2.72 2.55 1.44 2.00 2.25 2.19 Solyc04g040220 21.29 18.73 17.91 14.34 24.77 21.59 23.51 19.39 8.02 6.59 6.31 3.86 7.62 5.44 10.02 5.85 8.72 7.58 6.57 7.28 Solyc04g049920 8.37 6.78 7.16 6.06 5.23 6.00 3.66 4.67 11.31 15.59 10.48 9.08 6.43 7.15 6.52 5.57 6.67 5.22 6.87 4.03 Solyc04g051280 520.26 632.50 795.67 750.18 355.36 331.91 422.75 426.35 316.91 264.75 367.12 323.84 256.60 240.89 361.09 295.58 328.08 319.40 634.48 416.07 Solyc04g051350 82.58 103.01 99.98 105.81 75.88 77.23 84.07 94.50 76.88 84.83 91.50 92.38 58.29 57.99 70.73 63.48 41.54 59.18 52.30 49.14 Solyc04g054340 35.68 54.32 56.76 72.30 62.78 76.17 78.46 85.53 68.72 70.19 82.45 95.90 77.24 85.45 88.77 107.22 86.78 102.25 98.83 139.09 Solyc04g054740 36.77 42.19 51.20 52.51 12.93 13.44 17.46 16.07 21.31 20.34 35.29 28.00 46.00 52.68 63.83 48.88 94.44 108.00 124.27 89.68 Solyc04g054990 255.22 239.20 203.91 209.63 158.76 171.20 147.12 147.33 252.66 290.97 230.97 252.16 269.97 279.37 225.34 234.33 222.18 227.86 149.88 210.14 Solyc04g056610 23.69 16.64 18.32 19.74 25.13 21.45 17.73 18.54 22.25 22.24 19.34 19.75 17.45 15.15 17.91 16.41 16.39 14.54 13.01 13.25 Solyc04g064620 2.07 4.68 5.15 7.00 25.09 26.88 39.83 46.62 70.93 70.18 98.65 90.45 60.73 60.43 65.60 61.14 47.09 51.72 62.96 52.63 Solyc04g070980 115.65 102.53 81.69 87.55 52.27 58.50 45.14 44.62 93.06 103.27 83.11 80.98 130.04 123.44 108.79 105.51 137.14 115.69 92.49 100.98 Solyc04g071360 10.63 10.62 9.40 8.45 7.44 9.03 5.59 5.48 7.36 7.18 5.78 7.67 23.06 26.46 22.27 22.18 25.29 32.51 25.31 25.94 Solyc04g071660 221.37 306.98 267.74 288.29 202.98 222.61 198.82 240.02 273.83 273.78 248.92 295.76 223.56 315.24 263.62 235.01 164.61 225.46 189.10 174.63 Solyc04g071900 32.73 21.79 23.14 22.19 19.45 17.76 18.73 18.18 22.99 20.89 20.52 15.37 37.08 32.16 29.93 24.15 44.33 31.83 41.56 30.37 Solyc04g072880 16.59 11.03 14.71 15.39 15.35 11.11 14.56 13.23 13.08 10.34 14.51 11.02 15.68 11.77 11.11 12.38 13.70 8.80 13.13 16.24 Solyc04g074730 172.50 137.93 161.67 173.56 424.86 391.36 392.40 396.12 398.26 400.55 393.81 439.19 396.36 385.94 376.23 425.79 375.32 324.83 295.00 370.52 Solyc04g075000 51.44 58.28 53.69 50.58 22.80 30.66 23.61 27.22 29.24 33.20 31.86 29.45 35.01 39.69 37.23 38.05 38.47 45.85 44.81 39.53 Solyc04g076090 39.21 31.79 36.32 34.40 37.05 44.69 33.27 32.44 30.45 36.65 34.48 29.17 36.27 36.97 29.54 38.24 39.09 30.81 17.77 31.29 Solyc04g076100 28.66 25.61 23.16 23.80 28.18 23.36 23.62 26.27 22.48 25.33 23.41 21.39 27.91 26.41 20.75 24.50 24.01 20.75 20.65 20.39 Solyc04g077150 117.15 98.29 90.51 84.39 73.86 65.91 59.16 58.47 86.47 93.22 81.10 70.42 75.81 74.40 66.23 69.52 76.58 65.53 43.07 62.67 Solyc04g077490 640.58 680.22 716.35 690.97 635.60 666.00 718.19 713.63 507.39 553.06 592.13 566.18 296.53 302.39 344.00 341.24 290.86 302.68 402.74 321.46 Solyc04g078060 2.34 2.92 4.77 3.36 3.44 2.88 6.83 3.87 2.51 2.11 3.49 2.25 3.86 4.61 3.58 4.06 4.75 3.54 9.02 5.42 Solyc04g078200 37.00 26.54 26.82 23.17 47.16 49.30 47.53 42.76 29.02 28.61 27.31 21.14 48.74 50.27 56.70 44.28 131.32 102.74 137.76 105.60 Solyc04g078880 6.64 4.11 13.47 10.62 9.56 10.10 16.70 12.12 11.15 10.97 14.47 11.86 8.88 8.06 9.93 7.37 9.01 6.74 14.03 10.89 Solyc04g079130 134.01 142.02 147.71 139.44 150.29 160.95 143.56 138.70 129.38 149.86 132.06 131.91 85.38 91.87 73.55 78.69 60.05 68.93 56.89 56.39 Solyc04g079570 7.49 5.54 11.80 12.22 12.32 10.69 16.22 18.01 9.98 13.33 14.61 15.16 4.60 4.15 4.99 5.14 4.96 3.89 4.91 4.76 Solyc04g079860 6.31 13.08 7.17 10.86 10.13 14.83 11.37 13.72 11.00 12.73 9.01 12.46 14.16 17.33 12.70 17.61 23.75 28.45 27.79 31.99 Solyc04g080040 6.37 7.26 9.15 4.96 9.51 12.67 10.35 5.77 11.18 10.90 10.16 6.71 13.68 15.82 16.63 11.22 17.25 22.64 21.91 16.05 Solyc04g080130 53.92 59.89 59.43 52.70 5.45 4.66 7.54 8.06 26.07 23.76 28.64 29.47 37.19 39.43 46.25 38.57 54.64 60.95 92.75 68.44 126

RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc04g080300 20.88 17.83 20.25 21.10 24.18 21.89 27.03 26.92 21.63 19.91 23.57 24.05 24.60 20.19 26.31 19.29 24.93 22.20 33.99 26.47 Solyc04g080660 0.44 0.13 0.46 0.85 0.37 0.50 1.29 0.80 0.23 0.36 0.75 0.47 0.26 0.24 0.85 1.05 0.65 0.67 3.18 1.29 Solyc04g082050 17.14 13.95 12.32 10.25 9.68 8.95 9.23 7.89 15.28 13.80 9.60 8.69 14.36 10.40 9.81 10.38 8.77 8.61 7.25 8.25 Solyc04g082060 13.58 15.37 20.46 16.93 14.12 17.03 20.86 18.97 11.97 14.98 14.00 14.66 10.63 11.89 14.28 12.95 10.10 14.28 11.53 12.65 Solyc04g082100 2.82 4.39 4.81 4.95 4.11 4.26 6.65 5.82 3.51 4.97 7.29 7.64 0.88 1.91 2.73 2.20 1.73 1.31 0.68 2.62 Solyc04g082200 114.32 113.85 175.81 189.33 140.94 147.38 206.34 184.41 124.61 94.16 156.92 150.78 196.86 167.97 255.23 220.80 325.42 295.06 615.29 339.70 Solyc04g082740 11.30 14.22 16.34 13.11 9.55 8.47 13.81 11.73 9.77 8.86 9.77 9.54 9.45 10.62 12.81 12.08 12.19 15.23 17.85 14.54 Solyc04g082820 94.06 84.92 83.63 88.13 98.38 91.06 81.80 93.51 87.58 98.19 88.01 91.46 85.49 87.73 73.75 83.76 66.64 65.00 58.39 67.02 Solyc05g005160 190.73 197.00 153.54 156.40 156.94 155.19 119.25 132.38 237.32 261.64 198.64 212.09 221.20 225.88 188.61 183.12 191.33 201.42 189.49 167.98 Solyc05g005570 5.61 8.60 10.00 8.41 2.96 3.04 6.67 5.92 6.49 5.54 8.55 7.10 8.06 7.56 10.16 8.07 5.83 6.09 7.13 4.92 Solyc05g005920 19.03 19.63 13.37 16.15 14.43 16.47 12.39 11.26 23.44 20.78 18.43 21.51 30.12 28.85 24.89 27.89 35.04 35.94 28.66 34.08 Solyc05g005950 145.50 125.37 115.98 117.51 78.89 87.40 72.86 79.59 115.77 110.89 94.67 101.97 127.78 133.45 116.33 117.13 139.80 142.74 103.29 120.07 Solyc05g005960 84.57 71.49 55.28 57.98 44.50 48.02 37.97 41.59 60.56 68.25 49.58 54.82 96.28 91.72 80.40 81.74 108.46 101.30 92.86 95.06 Solyc05g005980 169.21 164.78 142.65 141.37 82.68 78.48 73.25 83.96 151.46 131.45 121.22 130.52 138.28 128.57 125.14 112.54 134.90 137.60 114.82 113.39 Solyc05g006160 163.27 142.21 165.33 152.57 195.28 155.34 180.80 174.79 133.90 128.72 140.71 136.70 97.05 86.54 97.48 94.68 78.50 61.01 67.80 67.75 Solyc05g006740 0.43 0.54 0.90 0.39 1.14 0.38 0.96 1.68 0.30 0.33 0.59 0.42 0.74 0.42 0.75 1.55 1.28 1.11 1.57 3.42 Solyc05g006820 10.10 8.45 18.40 15.35 15.60 14.73 17.96 17.94 13.43 13.22 14.67 15.05 17.31 19.57 19.07 21.51 21.03 20.38 24.45 25.00 Solyc05g007150 33.58 36.86 31.33 34.75 29.32 33.55 26.60 32.07 34.89 41.47 31.73 40.93 50.63 58.49 45.24 52.47 46.16 47.47 29.71 42.40 Solyc05g008120 10.14 12.79 17.46 10.45 16.35 18.76 24.23 16.45 20.44 26.40 32.84 23.05 18.07 25.28 31.10 19.43 25.96 28.03 49.55 25.02 Solyc05g008140 101.25 108.09 92.94 97.24 124.30 124.64 110.20 125.46 129.41 143.20 111.61 128.99 114.63 120.08 106.68 115.19 99.90 110.84 118.25 103.34 Solyc05g009310 6.51 5.26 7.71 8.97 5.48 5.97 8.92 10.52 6.04 5.00 7.56 9.44 14.83 17.11 19.95 20.21 18.61 22.02 29.64 23.59 Solyc05g009420 30.77 34.29 37.06 39.99 37.88 44.75 41.94 47.41 50.96 53.65 49.85 56.90 41.62 40.95 37.48 52.23 37.77 44.89 47.09 48.47 Solyc05g010260 38.56 36.41 33.09 40.64 33.82 39.92 31.71 35.55 44.56 42.46 37.89 41.31 34.10 28.71 31.65 36.74 29.94 29.98 20.49 32.42 Solyc05g013460 23.27 21.82 21.13 17.04 14.80 16.44 12.17 14.29 18.67 18.25 16.50 14.90 24.27 26.72 20.41 19.65 30.29 33.91 26.59 26.29 Solyc05g014000 5.27 6.41 5.66 5.51 4.41 4.37 3.14 2.91 11.54 10.75 8.84 7.82 32.65 31.78 30.97 25.90 40.72 46.45 37.10 36.20 Solyc05g014260 9.98 11.23 13.66 14.77 8.11 8.79 10.69 10.95 7.50 8.44 9.93 10.37 16.41 13.08 26.40 17.78 28.50 27.58 44.93 29.68 Solyc05g014280 1.56 1.18 1.61 0.77 1.04 2.03 1.02 0.59 1.83 3.30 1.53 0.92 3.14 4.44 4.28 2.06 7.12 7.81 5.39 2.90 Solyc05g014470 787.33 623.36 597.55 583.20 702.25 730.03 644.43 588.60 569.88 622.94 534.69 516.59 520.99 491.01 453.39 493.48 579.06 491.11 430.91 505.59 Solyc05g015390 114.22 92.21 137.95 111.62 101.48 103.65 148.20 115.02 99.79 92.27 120.31 96.71 155.26 143.15 174.17 152.37 262.85 204.77 254.03 214.35 Solyc05g015420 145.60 143.12 156.46 146.16 136.00 138.08 153.64 141.98 142.46 145.44 163.45 166.13 158.17 162.44 164.83 179.94 164.81 163.98 192.62 187.02 Solyc05g015750 1.67 3.26 2.76 2.73 6.09 10.20 5.96 7.05 115.47 145.73 167.42 188.04 296.25 331.38 392.62 380.18 312.88 318.95 307.14 368.50 Solyc05g017760 117.89 109.88 85.29 92.24 72.34 65.87 64.30 61.56 94.75 97.87 79.89 82.47 88.05 86.03 77.34 79.12 85.59 79.51 64.84 72.80 Solyc05g024160 9.19 6.78 15.21 13.07 4.41 4.29 9.45 5.41 4.54 3.74 6.29 6.55 3.62 3.98 5.28 5.11 5.55 3.91 8.30 7.10 Solyc05g025820 1.31 1.26 1.12 1.19 1.28 1.26 0.33 0.29 2.10 2.10 0.78 1.53 0.59 1.12 0.59 0.48 0.50 0.44 0.00 0.16 Solyc05g032680 6.07 7.90 7.28 6.68 7.22 10.10 7.13 7.77 6.87 13.62 6.80 12.23 11.21 13.72 8.59 8.66 11.24 14.98 13.35 12.39 Solyc05g045670 7.40 4.68 3.64 4.48 23.78 27.32 21.03 16.35 14.03 14.45 11.46 12.04 19.03 20.74 17.87 17.19 20.82 17.21 15.67 17.47 Solyc05g046270 0.36 0.67 0.91 1.22 1.99 3.23 2.90 3.76 2.61 2.07 4.14 3.80 2.54 2.85 3.02 3.06 3.82 3.19 5.38 6.35 Solyc05g051330 11.88 13.29 13.05 11.01 13.12 12.23 14.99 11.58 14.20 13.15 17.40 13.12 11.64 13.26 17.06 15.41 14.99 13.80 22.25 15.42 Solyc05g052030 28.47 23.97 24.59 26.17 17.19 15.98 18.29 19.66 14.12 13.27 17.90 18.86 17.50 16.00 18.54 20.92 23.25 23.77 28.99 29.22 Solyc05g052240 62.97 51.65 53.35 54.22 69.26 70.52 69.53 60.31 54.45 51.45 49.01 46.05 78.24 77.32 72.41 68.04 120.37 109.30 83.70 96.16 Solyc05g052940 47.01 58.19 59.74 68.73 54.95 52.30 56.75 58.21 51.83 52.17 55.61 61.26 44.83 52.68 59.00 53.31 44.75 50.73 57.35 53.75 Solyc05g053160 0.57 0.70 0.53 0.52 0.00 0.16 0.69 0.49 0.31 0.33 1.17 0.89 1.30 0.58 2.29 1.27 1.80 0.95 1.78 2.09 Solyc05g053490 4.59 2.38 3.07 2.24 3.86 3.43 3.86 2.59 4.60 3.54 2.90 2.65 4.60 2.08 3.33 3.26 3.40 2.72 2.71 2.58 Solyc05g053890 17.27 21.12 23.92 16.17 18.08 22.85 23.22 18.64 15.28 18.48 19.25 17.33 18.49 20.97 18.58 17.65 17.78 19.21 22.51 16.98 Solyc05g054320 70.30 91.42 61.05 65.62 30.65 29.07 25.40 29.53 70.35 71.49 52.51 60.42 95.66 110.79 98.23 81.57 116.98 135.57 92.51 99.40 Solyc05g054340 4.37 1.86 3.30 2.28 2.73 0.91 1.37 1.38 2.62 1.43 1.42 1.30 10.32 6.66 7.51 6.99 12.09 7.65 14.66 8.23 Solyc05g054350 17.86 10.90 16.43 13.64 9.81 8.74 11.18 10.21 12.96 8.90 12.82 9.17 23.76 19.24 21.72 22.18 36.90 24.56 26.92 27.25 Solyc05g054840 7.98 7.53 10.87 10.36 8.86 8.02 10.18 11.03 7.63 6.20 8.14 8.27 7.14 4.00 7.71 7.60 6.12 5.84 5.00 7.51 127

RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc05g055010 7.33 9.02 11.77 10.83 8.51 13.62 11.74 8.90 8.21 10.37 10.79 8.08 8.79 10.35 11.01 8.41 7.97 8.97 10.48 6.89 Solyc05g055240 26.85 34.15 32.52 32.60 28.55 28.72 36.55 31.38 28.46 28.08 31.81 34.31 28.93 31.46 33.47 30.21 28.31 31.14 37.04 35.04 Solyc05g056110 63.14 65.16 75.18 72.07 72.43 66.37 82.92 84.22 67.66 64.75 79.97 72.58 68.09 63.64 74.38 65.84 76.26 71.04 93.76 85.74 Solyc05g056170 72.34 60.61 52.82 56.15 36.12 39.35 34.92 38.63 62.02 67.37 54.49 63.67 66.12 63.01 49.01 62.22 52.40 49.51 41.08 54.23 Solyc05g056390 233.14 198.99 194.84 188.86 250.65 240.45 229.88 214.00 215.40 216.61 194.17 198.06 173.98 153.59 144.85 161.05 169.28 144.64 114.21 146.68 Solyc06g005160 1144.89 959.59 953.03 971.11 923.13 928.48 894.30 838.76 888.25 995.08 832.26 845.54 816.16 785.53 708.44 731.69 844.88 745.37 539.57 745.73 Solyc06g005390 45.71 52.82 38.59 44.44 39.31 48.27 33.79 39.35 52.70 65.63 52.94 66.27 38.93 39.74 35.51 40.05 33.81 34.75 28.23 35.74 Solyc06g005750 481.06 472.58 375.24 386.83 363.33 352.17 301.17 311.71 460.65 471.56 353.63 361.05 474.03 502.61 408.97 424.88 504.62 504.60 352.00 427.72 Solyc06g006000 68.55 77.63 118.12 106.02 107.81 112.76 158.30 151.52 160.00 174.15 230.49 206.99 267.11 304.40 371.16 313.45 328.51 379.86 499.59 409.21 Solyc06g007180 53.10 52.33 117.42 180.23 479.46 482.20 603.89 848.41 607.10 607.39 893.72 1059.30 1124.00 1200.35 1823.69 1392.36 1344.88 1456.83 2025.30 1366.44 Solyc06g007440 0.53 1.42 1.16 1.90 1.63 1.82 2.21 2.88 4.09 2.49 2.07 5.61 10.41 10.40 13.32 16.57 15.97 14.67 19.91 26.12 Solyc06g007580 35.04 38.05 49.37 46.32 32.15 32.11 41.40 41.13 25.66 23.23 31.06 28.97 15.95 13.37 21.30 25.58 26.51 17.76 34.68 29.43 Solyc06g008980 149.51 202.33 172.28 174.90 153.03 151.12 133.68 143.90 158.29 157.62 149.71 146.78 123.51 152.58 142.74 135.90 87.24 114.70 81.64 92.48 Solyc06g009020 300.31 249.01 247.96 238.84 212.33 220.31 189.93 207.66 181.46 196.78 168.68 173.59 208.10 185.92 160.79 184.90 253.11 216.38 206.58 229.50 Solyc06g009380 22.86 18.43 20.54 16.26 19.28 21.52 22.72 14.85 13.25 13.51 13.55 11.99 22.01 24.13 22.58 20.48 32.19 34.18 28.99 25.83 Solyc06g036290 231.26 303.83 216.73 193.78 277.35 411.60 237.25 230.52 340.81 429.49 307.08 320.06 329.30 443.32 302.46 284.02 345.54 432.73 290.94 227.86 Solyc06g048960 20.64 20.37 19.54 18.84 33.98 36.87 31.63 26.78 27.10 31.59 23.63 30.95 20.03 20.97 16.77 20.04 12.98 14.72 11.27 11.88 Solyc06g050130 29.43 29.31 31.60 26.26 41.24 42.46 49.48 38.36 45.45 44.36 50.08 44.59 47.50 42.46 45.80 38.53 45.32 39.40 49.08 36.27 Solyc06g050600 15.25 18.98 21.17 19.56 10.25 10.65 12.98 11.20 8.80 11.37 15.02 12.98 11.13 10.82 12.14 10.89 11.44 14.27 17.30 14.59 Solyc06g050930 10.37 7.88 8.54 9.85 9.50 9.27 8.18 8.78 8.94 6.76 6.30 7.00 10.96 9.35 7.39 8.47 14.68 10.21 10.68 13.15 Solyc06g051680 1.53 0.83 1.79 1.43 2.72 1.30 4.52 2.57 1.61 1.40 2.91 1.64 3.98 2.68 4.54 3.70 3.91 3.12 4.11 5.83 Solyc06g053830 47.60 53.29 65.42 71.46 55.09 48.31 71.57 68.55 85.75 83.53 112.29 118.25 121.01 114.41 140.84 129.55 97.31 104.97 109.70 104.80 Solyc06g053910 33.84 31.53 37.00 35.60 38.02 33.97 43.25 42.04 39.52 34.07 41.90 40.14 47.79 43.13 48.33 50.08 58.56 48.55 79.86 66.73 Solyc06g054640 13.64 17.67 13.32 15.60 3.05 1.44 6.44 7.19 2.31 3.27 8.47 8.38 5.33 5.93 6.19 10.27 0.89 0.31 0.68 2.38 Solyc06g059740 20.85 18.25 19.64 15.10 17.98 19.52 17.39 11.15 31.37 17.70 16.74 9.30 9.02 8.82 11.14 7.56 9.71 9.22 17.20 13.93 Solyc06g059930 53.19 41.32 40.48 35.21 43.55 40.68 39.67 42.01 40.86 45.13 41.16 35.64 41.46 35.03 33.12 34.76 44.00 39.08 39.84 42.24 Solyc06g060010 0.46 0.79 0.39 0.42 0.53 0.19 0.63 0.97 1.92 2.41 3.41 4.97 2.20 1.54 1.75 4.24 1.07 1.97 2.88 3.43 Solyc06g060610 14.76 12.30 11.71 13.71 18.99 14.72 12.75 15.79 15.77 14.01 11.13 14.65 15.17 11.42 10.80 14.03 13.66 10.70 9.66 9.75 Solyc06g061240 11.41 8.75 9.98 9.91 20.83 17.56 19.74 16.00 18.17 13.95 15.71 12.81 23.08 18.39 23.08 20.61 34.18 26.21 34.45 31.34 Solyc06g062680 8.65 11.50 14.44 14.98 10.13 11.02 11.46 12.96 13.55 15.59 16.03 15.81 7.41 9.95 9.99 10.04 6.47 8.45 9.12 7.95 Solyc06g065030 15.29 12.10 12.76 14.64 13.10 10.76 14.25 14.83 9.26 9.55 10.26 11.89 10.08 9.67 10.35 12.65 9.95 9.08 6.11 12.11 Solyc06g065050 0.08 0.23 0.57 0.77 0.38 0.24 0.71 0.29 0.23 0.10 0.49 1.04 0.45 0.13 1.66 1.00 2.25 1.46 5.81 2.13 Solyc06g065360 8.96 11.76 12.94 13.33 9.43 10.27 12.34 11.64 7.97 13.07 11.77 13.32 14.42 14.44 12.66 13.61 10.83 12.64 13.07 14.73 Solyc06g065630 37.47 44.10 56.20 47.48 41.32 42.70 48.37 59.22 78.23 77.30 84.94 91.75 51.10 53.58 65.81 56.90 28.71 33.21 32.98 28.51 Solyc06g065970 114.67 92.37 78.21 71.13 16.77 19.00 12.95 13.77 62.75 72.59 48.25 54.17 260.02 246.31 207.87 217.57 445.01 372.91 313.21 388.72 Solyc06g066420 1.39 2.14 5.37 6.13 15.67 8.01 17.26 17.95 12.35 8.84 14.06 12.42 19.80 11.05 16.37 21.62 27.47 19.93 33.73 34.23 Solyc06g067980 3.04 1.74 3.30 2.63 4.50 2.13 4.78 2.96 5.12 2.59 5.35 2.50 3.83 1.55 4.00 1.63 9.24 3.71 5.44 2.21 Solyc06g068160 11.25 5.23 14.51 11.69 7.58 5.77 11.28 6.53 8.76 6.04 11.78 7.01 10.15 8.26 13.94 9.95 14.57 6.96 14.54 10.78 Solyc06g068270 0.51 0.51 1.77 0.62 1.01 0.92 3.72 2.70 2.94 2.41 3.25 4.62 2.80 4.17 6.00 4.50 4.99 3.71 6.83 7.46 Solyc06g068500 2.09 2.38 4.40 4.20 4.78 3.79 7.00 6.14 8.25 7.12 8.79 9.04 19.54 22.30 24.67 26.48 38.96 36.83 43.41 46.02 Solyc06g068680 2.77 4.46 4.78 5.51 1.74 2.24 3.02 3.44 2.18 2.05 2.70 1.96 0.70 0.85 1.53 0.91 0.66 0.67 1.44 1.19 Solyc06g069120 344.62 348.12 389.12 390.52 448.85 449.82 542.04 531.38 432.28 403.63 460.66 462.74 478.93 429.94 505.21 475.72 577.18 511.53 698.47 596.57 Solyc06g069630 18.89 25.30 29.72 28.50 16.29 14.48 15.57 18.74 15.58 15.89 18.47 17.12 13.74 13.44 17.25 18.18 14.28 15.00 19.63 18.33 Solyc06g069730 6.62 8.64 9.36 11.85 1.74 2.70 3.64 4.40 3.81 6.97 8.68 8.92 19.33 20.85 22.55 26.12 35.94 34.18 28.15 48.03 Solyc06g069790 223.20 176.13 179.02 187.04 196.78 180.81 158.31 151.51 234.47 225.70 212.14 198.44 274.18 253.37 216.60 232.04 233.44 207.10 144.79 191.97 Solyc06g071890 20.36 38.01 38.42 35.47 23.27 31.21 29.14 25.78 24.38 34.43 35.19 30.92 22.91 31.76 34.07 35.44 18.25 29.31 40.20 26.96 Solyc06g072840 3.41 3.07 0.96 1.92 1.47 1.23 1.29 0.97 2.72 2.46 1.10 1.56 5.93 4.34 3.60 2.62 12.00 7.56 5.26 7.53 Solyc06g073190 23.30 17.45 15.87 16.79 27.68 25.93 20.81 22.02 20.97 23.21 18.42 18.66 13.53 10.65 9.39 12.22 17.08 16.18 11.87 13.32 128

RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc06g073350 5.61 3.59 5.77 7.07 7.55 4.87 6.46 4.26 7.77 4.87 8.45 6.02 7.21 4.77 6.51 5.54 5.93 4.78 5.43 6.05 Solyc06g074060 8.83 9.76 43.51 48.64 5.77 6.93 32.42 34.53 1.32 2.63 15.16 13.41 0.42 1.34 3.60 4.46 0.06 0.15 0.13 0.86 Solyc06g074090 224.03 192.81 159.02 160.73 148.53 140.21 115.05 118.34 203.25 229.03 164.59 167.79 235.30 221.29 190.58 187.12 271.62 218.41 166.52 182.84 Solyc06g074110 57.07 48.74 54.32 46.29 71.41 64.38 67.40 64.64 62.22 61.29 61.32 54.33 58.74 54.47 55.46 51.83 56.12 53.54 43.66 48.65 Solyc06g074390 56.36 41.46 45.94 51.49 63.80 56.70 56.77 55.38 56.58 54.82 49.16 50.77 54.74 54.48 49.06 51.38 46.16 39.04 28.23 36.58 Solyc06g074530 31.41 27.16 21.70 25.75 15.24 17.91 17.62 18.64 23.67 29.51 20.48 22.63 30.38 29.86 23.69 33.64 34.66 29.23 17.65 31.46 Solyc06g074750 9.96 8.43 12.15 11.64 8.73 7.83 10.34 9.30 9.50 7.03 14.74 9.38 6.79 7.40 9.65 8.19 8.64 6.36 10.30 8.49 Solyc06g075170 23.29 17.34 24.26 25.18 23.22 18.28 29.54 30.87 30.57 32.13 33.88 39.43 37.62 27.84 37.25 45.73 44.70 35.72 68.07 53.28 Solyc06g075520 2.69 0.40 0.06 0.25 2.40 0.11 0.34 0.10 2.58 0.24 0.10 0.00 2.13 0.83 0.35 0.00 2.01 0.08 0.13 0.00 Solyc06g075540 28.30 23.47 31.34 27.28 32.52 23.10 30.13 26.64 27.67 21.09 27.71 23.01 27.58 22.35 31.67 25.43 24.52 18.70 20.48 19.30 Solyc06g075550 6.41 6.97 9.73 11.15 9.49 8.84 12.81 15.53 10.26 8.01 13.06 11.32 15.59 12.64 15.92 17.74 15.00 14.00 19.25 20.18 Solyc06g075580 148.03 183.93 160.13 171.45 149.22 161.48 139.71 148.53 157.11 179.10 155.66 168.65 134.99 159.22 138.82 135.06 106.23 125.01 101.89 101.09 Solyc06g076020 38.51 49.46 32.91 34.73 26.75 51.66 31.40 26.49 40.89 61.20 38.71 36.39 58.07 75.08 49.91 51.09 72.45 94.69 101.66 65.80 Solyc06g076210 12.16 19.90 17.71 17.34 4.56 4.49 5.00 6.95 7.99 8.98 14.16 10.25 9.13 15.78 13.00 11.94 8.75 14.96 13.65 10.00 Solyc06g076280 31.15 32.73 39.53 36.34 30.87 33.58 37.22 38.84 29.32 29.47 35.78 33.70 34.18 35.44 35.11 36.56 37.17 34.75 39.63 43.61 Solyc06g076320 2.95 3.92 3.16 4.60 0.91 1.38 1.96 1.16 2.87 1.88 3.77 3.23 3.67 3.54 5.63 5.44 6.81 7.38 9.33 10.26 Solyc06g076400 7.06 3.81 9.16 5.61 1.91 0.86 1.82 1.20 3.27 3.15 4.43 3.65 10.03 5.68 9.86 9.54 14.33 10.99 15.81 12.69 Solyc06g082070 73.11 57.26 56.73 59.59 62.24 59.63 59.03 54.01 55.32 56.51 51.35 52.86 48.62 42.44 39.66 35.22 35.77 35.27 29.97 35.17 Solyc06g083040 13.38 14.32 15.23 18.11 15.49 14.25 18.80 17.93 28.96 31.90 37.45 39.21 39.42 43.76 40.94 52.87 39.88 42.19 36.72 44.70 Solyc06g083270 36.72 41.76 33.06 32.59 34.15 33.14 31.12 28.05 51.96 50.24 43.52 45.67 68.65 62.95 57.86 53.91 46.89 51.54 37.13 39.47 Solyc07g005440 34.93 33.14 27.32 27.52 28.62 28.62 30.87 23.53 36.64 35.83 36.12 28.92 64.87 61.74 58.58 55.91 91.32 90.84 95.21 79.97 Solyc07g005710 24.77 32.63 42.29 34.13 26.78 38.42 41.86 39.05 20.39 32.43 38.24 35.81 21.25 28.42 33.30 33.42 21.58 28.29 29.25 31.29 Solyc07g005760 29.87 23.01 23.72 23.68 31.35 27.65 30.83 30.10 29.57 32.50 28.38 29.05 52.68 44.55 39.91 46.55 61.02 51.09 43.76 48.63 Solyc07g006500 13.76 16.99 21.36 20.38 19.78 18.48 27.29 29.78 32.93 35.17 51.37 51.93 35.80 40.89 53.39 39.79 45.25 45.73 81.54 52.32 Solyc07g006550 7.89 7.46 5.92 7.30 16.53 12.71 13.85 11.76 11.10 8.95 7.45 8.22 10.23 11.40 9.03 7.78 9.74 10.01 6.27 8.53 Solyc07g006570 67.86 47.97 31.27 38.08 39.11 38.50 30.11 33.68 85.47 102.25 68.52 78.23 255.58 248.11 180.83 169.45 462.49 378.36 274.91 332.51 Solyc07g006680 0.93 1.28 0.77 1.24 0.55 1.50 1.00 0.69 3.30 5.05 3.00 2.90 4.51 6.70 2.68 3.51 5.00 8.19 3.90 4.32 Solyc07g007400 0.50 0.78 1.21 1.10 1.56 1.03 2.25 1.25 1.51 1.52 3.13 1.87 5.65 5.57 10.59 9.20 8.66 5.29 13.68 7.77 Solyc07g007690 9.07 7.99 5.05 6.24 6.90 5.70 4.98 3.93 6.96 3.89 5.00 4.31 6.31 6.55 7.51 5.91 9.93 4.68 8.56 7.20 Solyc07g008180 207.25 204.55 176.03 173.49 55.39 51.07 44.14 55.85 236.43 235.17 222.07 244.37 232.64 243.83 219.67 215.75 237.45 260.90 204.41 220.35 Solyc07g008250 17.80 10.10 11.96 12.47 24.29 17.75 19.76 19.88 16.01 15.65 17.20 14.56 16.01 10.74 11.57 14.03 27.84 13.75 17.84 24.29 Solyc07g008410 21.51 15.36 11.82 13.74 8.62 7.41 5.47 5.25 22.44 24.51 14.32 21.59 55.18 49.63 37.71 40.87 55.78 46.49 47.63 38.08 Solyc07g008570 275.64 413.28 368.37 381.14 221.99 351.90 307.18 361.11 303.56 421.14 377.62 427.02 641.49 754.67 730.86 751.21 515.96 663.94 538.77 610.60 Solyc07g014670 8.19 9.13 10.54 10.29 8.92 11.21 13.74 14.22 6.01 6.24 7.82 9.15 10.26 10.30 10.27 11.23 14.42 17.86 26.03 18.17 Solyc07g017780 7.74 5.34 7.88 5.81 17.06 11.63 15.20 13.57 27.15 21.85 28.93 29.46 31.08 25.60 32.82 27.48 45.67 43.03 56.19 48.54 Solyc07g019460 117.90 104.03 95.06 100.28 84.40 77.73 76.43 81.36 115.26 119.80 104.65 113.56 113.62 116.78 102.38 112.11 114.18 101.24 89.08 98.95 Solyc07g032670 2.70 1.04 2.27 1.78 2.25 1.03 2.94 1.65 2.21 1.93 2.46 1.57 2.28 1.28 2.54 2.03 1.64 1.41 2.80 1.14 Solyc07g040680 28.52 32.37 41.67 35.99 26.79 22.11 34.73 27.48 37.50 32.86 46.17 34.84 37.16 32.34 37.42 32.95 49.14 34.95 65.84 36.36 Solyc07g041730 5.10 3.54 5.10 5.46 3.64 3.23 5.09 4.87 3.46 2.95 5.21 4.52 3.23 2.89 4.27 4.45 3.43 3.99 4.37 4.19 Solyc07g041900 5.39 6.30 6.43 5.78 6.15 6.43 9.06 7.29 3.84 2.99 5.19 5.07 7.01 6.55 8.74 6.11 11.24 10.97 18.83 15.98 Solyc07g042560 40.29 55.15 45.99 49.36 42.17 49.42 43.80 42.16 48.62 56.87 46.98 50.53 31.49 40.19 34.02 39.73 25.42 30.59 28.14 27.57 Solyc07g043120 17.22 16.54 13.42 12.60 23.97 23.06 21.46 20.28 16.68 16.29 13.07 11.91 13.82 10.65 10.39 10.34 15.66 15.91 15.52 13.46 Solyc07g043400 931.76 732.60 640.53 622.29 378.63 403.31 338.57 333.10 457.79 513.15 398.42 388.27 667.67 651.94 592.92 562.03 775.66 675.50 413.73 602.86 Solyc07g043420 3048.21 3629.73 2487.04 2729.42 1735.69 1670.54 1266.56 1379.13 3344.47 3118.31 2472.74 2525.64 4838.42 4794.09 4259.18 3511.27 6834.61 7914.42 7475.39 5607.83 Solyc07g043460 492.66 562.09 390.65 442.63 331.75 344.20 248.47 284.51 514.32 514.73 399.24 429.19 545.36 526.62 470.62 412.64 610.03 685.40 586.24 513.52 Solyc07g043480 348.55 327.07 278.71 260.52 262.12 258.42 216.66 236.97 358.48 347.25 304.65 296.55 349.67 348.97 311.72 304.20 331.78 336.28 323.92 284.66 Solyc07g043490 252.20 173.70 139.57 135.42 191.73 172.33 139.24 139.26 211.38 207.37 162.21 164.88 207.55 184.56 145.81 142.03 241.81 176.04 150.74 159.11 Solyc07g043500 177.39 171.98 134.14 130.11 152.53 144.39 111.81 120.17 193.41 182.85 134.66 135.37 229.19 216.98 189.88 174.35 227.09 230.01 209.61 177.07 129

Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc07g044970 0.32 0.00 0.87 0.74 0.80 1.11 3.77 1.46 2.21 1.66 4.13 1.65 1.21 2.03 2.71 2.88 2.55 1.17 3.56 3.03 Solyc07g045350 349.28 313.58 294.63 304.33 322.49 314.23 292.03 300.70 293.29 334.09 286.20 273.63 205.04 192.52 176.93 186.54 192.55 150.01 108.47 155.88 Solyc07g049450 93.27 81.12 72.97 76.61 79.33 83.51 73.93 67.59 75.90 82.43 65.92 81.97 90.28 90.42 79.67 82.40 81.08 82.38 44.42 74.33 Solyc07g049690 8.89 11.24 15.99 14.55 21.42 22.98 22.42 25.75 26.54 28.02 34.72 33.19 42.18 52.51 54.36 61.91 91.38 101.83 93.07 100.26 Solyc07g052480 10.25 11.65 22.68 21.03 19.66 20.36 40.10 36.61 123.61 108.04 165.53 168.89 233.07 223.16 323.25 328.83 185.58 214.66 266.03 247.33 Solyc07g053120 0.83 1.69 1.52 2.10 0.46 0.97 0.70 0.99 0.00 0.63 0.87 0.43 0.00 0.55 0.24 0.63 0.22 0.36 0.42 0.32 Solyc07g053200 2.90 1.72 1.39 2.20 2.79 2.97 4.36 2.55 1.96 1.72 3.16 1.46 1.49 1.06 2.49 1.20 2.92 2.21 4.07 1.81 Solyc07g053360 6.63 11.47 35.96 23.33 4.41 4.81 14.58 7.35 6.77 5.02 16.94 8.87 27.85 22.09 68.82 28.96 73.44 38.27 131.39 47.34 Solyc07g053540 1.03 0.98 2.15 3.74 2.38 3.43 4.00 4.71 1.86 3.13 3.88 5.20 1.21 1.57 2.13 1.89 1.97 1.61 2.46 2.65 Solyc07g055050 51.39 49.32 62.74 55.60 51.38 50.50 57.32 53.19 55.66 56.05 57.21 54.04 64.65 71.21 78.73 74.10 83.61 86.23 98.55 93.85 Solyc07g055720 1.33 1.00 1.77 1.64 1.65 1.08 2.73 1.83 1.24 0.81 1.74 1.67 1.92 1.04 4.59 2.74 2.07 2.37 5.34 3.73 Solyc07g056310 6.10 6.95 5.93 6.03 17.90 14.54 13.39 9.90 6.12 6.48 5.73 4.54 7.01 6.38 5.17 4.59 6.41 6.37 5.13 5.28 Solyc07g061730 6.90 7.93 13.26 15.20 21.44 16.42 25.87 26.36 22.19 19.39 26.92 27.22 26.75 21.91 33.14 37.22 23.04 18.31 14.12 19.65 Solyc07g061750 2.10 3.43 4.93 6.25 0.82 1.45 1.25 2.65 1.62 1.77 1.40 4.05 12.24 10.59 12.97 19.66 25.56 23.16 28.17 31.77 Solyc07g061800 53.04 48.17 34.27 32.27 23.08 22.16 16.07 22.26 64.12 73.86 50.86 56.15 105.59 96.05 76.90 72.59 114.41 106.56 102.42 87.12 Solyc07g061940 25.41 18.54 30.41 27.39 35.67 29.55 39.39 39.65 24.04 17.77 27.19 26.56 20.28 19.28 24.00 21.95 23.54 17.71 19.93 22.53 Solyc07g062560 1.17 0.48 2.00 1.28 0.59 0.73 1.04 1.27 0.91 0.67 0.50 1.13 0.52 0.70 1.33 0.61 1.40 0.85 3.22 2.79 Solyc07g063050 69.00 89.70 92.00 85.07 82.31 78.56 90.13 92.78 84.99 77.99 90.02 89.66 80.56 82.94 90.84 88.73 80.46 90.14 131.38 98.70 Solyc07g063310 11.20 10.03 10.44 12.29 11.12 9.81 11.21 12.91 10.19 9.20 11.77 11.62 9.51 10.77 15.50 14.19 13.46 13.72 19.96 14.94 Solyc07g063410 4.09 3.99 7.46 7.38 10.86 7.79 13.93 14.37 9.85 7.34 12.18 11.25 23.92 23.11 34.21 28.81 67.36 51.20 89.30 65.30 Solyc07g063430 36.33 38.17 39.16 41.19 45.41 41.10 50.47 43.90 35.30 36.61 43.30 35.38 44.33 41.14 51.93 41.13 59.76 52.50 65.63 61.69 Solyc07g063540 56.46 55.00 55.63 54.23 61.63 51.12 52.60 56.51 56.66 50.70 53.11 48.23 41.16 37.83 36.25 38.49 38.81 32.26 28.69 33.53 Solyc07g063640 9.21 9.27 9.03 6.71 16.06 13.65 10.51 7.81 16.41 14.68 9.14 6.74 4.78 5.16 4.82 3.77 6.51 4.30 3.01 4.00 Solyc07g063690 2.50 1.49 6.53 6.03 5.13 3.72 7.77 5.40 14.88 13.64 18.80 16.60 31.01 25.94 34.29 33.68 38.39 31.14 28.98 38.43 Solyc07g063850 156.28 127.56 146.51 150.50 215.23 190.53 219.15 217.38 185.28 178.64 193.74 205.96 161.30 147.76 158.74 161.61 190.35 151.79 149.03 174.17 Solyc07g064150 286.27 266.43 336.74 289.75 373.09 354.54 448.49 386.41 319.94 296.51 379.12 339.77 353.21 313.49 403.46 375.76 427.81 335.76 435.53 423.84 Solyc07g064500 26.13 37.03 27.06 33.09 24.90 31.58 26.89 30.43 20.65 27.01 22.13 23.41 18.44 24.68 23.41 23.75 22.71 26.91 19.93 23.31 Solyc07g065090 155.86 111.24 99.97 102.96 63.03 64.28 58.58 54.67 84.20 83.08 77.89 70.16 102.84 99.21 90.84 87.05 141.53 115.49 83.91 114.52 Solyc07g065210 175.14 208.07 179.31 193.91 169.77 181.08 147.84 157.00 202.67 243.34 197.89 206.52 168.90 198.51 161.67 173.50 142.07 170.45 137.15 138.42 Solyc07g065500 11.04 13.86 16.69 19.34 26.61 26.46 27.88 33.71 21.29 21.42 22.93 26.34 32.88 36.41 45.28 47.03 39.24 38.89 47.74 48.38 Solyc07g065990 1.58 1.37 2.25 1.59 1.51 1.53 2.15 1.08 1.89 1.43 2.35 0.97 2.64 2.47 4.52 1.81 5.42 2.07 6.82 2.47 Solyc07g066220 26.74 28.90 33.98 38.11 30.64 29.58 38.65 32.80 28.44 27.15 34.73 26.87 24.68 23.94 26.96 24.49 28.65 27.29 29.00 25.15 Solyc08g006520 6.25 7.78 10.14 9.79 9.33 9.14 10.13 14.19 8.72 8.19 9.38 9.51 5.52 4.32 6.11 9.68 4.17 6.86 15.41 12.23 Solyc08g008310 8.90 17.96 11.63 15.88 8.25 13.41 9.90 11.38 5.98 10.80 7.58 7.57 4.07 9.33 4.85 7.02 5.93 11.30 6.36 7.05 Solyc08g036640 3.38 3.48 6.22 7.68 3.41 5.22 5.63 6.11 6.23 7.05 6.86 8.74 6.51 6.36 10.27 11.48 3.63 7.85 11.80 8.40 Solyc08g061910 14.58 18.66 13.29 13.26 21.46 19.36 20.72 21.24 24.65 24.34 19.01 19.27 46.15 46.86 40.22 35.90 40.95 38.99 36.00 30.79 Solyc08g062100 3.25 6.18 8.78 3.78 3.28 4.81 4.73 3.95 7.37 8.90 9.94 4.62 4.43 5.43 6.22 7.43 5.46 7.27 10.10 7.39 Solyc08g065610 16.27 11.67 18.45 11.87 9.96 10.41 15.36 8.54 9.41 8.58 11.75 9.19 21.93 17.18 24.10 16.48 35.49 30.14 32.07 33.66 Solyc08g066490 42.71 36.12 46.11 47.87 30.45 29.19 38.63 37.11 20.93 24.07 28.89 26.92 22.33 22.06 26.24 25.04 29.54 27.29 35.98 35.74 Solyc08g066880 568.58 477.45 394.38 370.51 341.98 376.86 308.24 301.44 448.41 488.01 372.17 362.04 722.34 708.75 588.20 561.82 895.93 779.21 610.42 747.28 Solyc08g067320 16.75 14.19 18.04 15.91 6.96 7.83 12.07 13.65 6.43 5.44 9.36 10.93 22.23 20.02 24.75 27.25 41.98 36.82 38.62 54.52 Solyc08g067610 2.66 1.68 3.72 1.97 1.72 1.24 3.94 2.44 1.14 1.47 3.66 2.65 1.79 1.84 2.69 1.80 2.72 2.53 7.75 3.10 Solyc08g068710 2.70 6.65 1.45 7.09 3.32 6.22 1.82 4.46 2.30 5.76 2.40 4.57 1.41 1.12 0.70 1.21 1.51 0.76 0.42 1.66 Solyc08g074290 362.93 479.81 369.95 401.48 297.51 314.77 260.50 324.47 428.13 402.88 357.35 405.49 404.71 480.39 434.82 387.18 379.60 459.04 427.08 366.44 Solyc08g074630 948.84 754.45 723.87 762.87 774.17 841.52 748.82 904.83 1462.56 1485.13 1314.58 1467.79 1688.39 1572.95 1264.01 1465.39 1181.08 1158.62 1106.24 1228.83 Solyc08g075950 71.02 69.38 89.13 68.26 76.01 74.59 89.23 75.05 73.69 68.86 91.30 73.76 56.14 51.53 63.07 65.43 47.73 41.70 52.60 51.96 Solyc08g076230 33.41 34.71 43.60 44.15 38.35 35.87 42.09 41.47 34.78 32.47 41.16 37.44 29.05 30.68 29.83 33.56 28.28 25.16 32.55 25.31 Solyc08g077060 38.52 28.32 27.27 26.90 12.69 10.20 11.55 9.32 16.34 16.91 14.63 13.56 47.60 41.81 45.16 39.33 41.60 40.43 36.92 35.52 130

RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc08g077230 21.14 17.03 15.50 19.93 13.74 11.79 15.02 17.64 16.13 15.83 18.67 19.86 19.88 18.42 21.02 22.77 20.96 20.28 21.19 24.20 Solyc08g077300 2.38 3.28 2.84 2.36 2.34 4.51 3.09 2.00 2.19 2.23 4.38 1.87 1.47 1.43 2.55 1.66 2.09 3.20 3.99 2.52 Solyc08g077460 32.70 39.48 34.81 31.77 42.61 44.57 40.57 35.49 30.25 31.64 28.09 24.97 27.12 26.92 24.05 23.43 32.34 29.70 28.49 24.99 Solyc08g077530 8.28 10.48 13.84 15.16 33.15 33.96 38.46 42.99 23.06 24.08 24.58 34.44 28.55 34.60 37.92 46.85 36.07 37.18 32.09 58.79 Solyc08g078870 4.58 3.71 3.55 3.51 0.42 1.01 0.62 0.49 0.96 1.73 1.11 0.59 11.53 12.99 11.51 7.07 20.05 15.91 14.67 11.33 Solyc08g079310 2.72 2.19 4.23 3.66 2.95 2.91 5.75 5.57 6.94 6.47 9.43 10.51 17.84 20.84 25.03 19.49 26.99 26.93 36.61 28.86 Solyc08g079830 39.32 39.63 38.89 37.33 58.04 58.66 53.87 47.18 51.76 59.68 48.58 53.25 54.11 63.12 51.97 54.01 45.67 54.97 32.34 42.09 Solyc08g080140 36.26 31.44 31.26 29.64 31.10 27.28 27.35 25.49 31.75 26.40 25.17 26.29 30.07 25.34 27.97 26.58 36.06 24.00 20.35 29.59 Solyc08g081530 38.69 33.88 32.88 35.64 33.87 39.28 30.63 29.92 30.08 31.73 26.74 28.35 28.73 28.11 25.38 27.57 28.41 30.94 22.00 26.04 Solyc08g081960 9.99 9.21 11.78 9.23 16.40 12.81 17.92 15.27 13.61 10.65 12.67 14.86 15.47 11.62 14.97 17.61 15.88 13.60 13.18 14.58 Solyc08g082000 28.72 35.84 42.04 41.88 23.00 24.24 31.05 36.83 37.23 32.69 41.31 40.08 26.50 27.74 29.36 29.66 21.58 26.90 33.03 26.74 Solyc08g082070 1134.61 1440.76 1346.12 1359.96 1282.03 1400.60 1235.99 1249.94 1263.48 1359.41 1231.13 1199.66 1030.84 1193.87 1121.10 1064.22 680.84 820.75 649.69 697.62 Solyc08g082250 48.98 43.52 44.66 40.33 62.81 61.76 51.97 43.99 59.24 54.22 51.97 46.67 79.25 78.20 71.38 69.21 81.58 83.23 63.77 72.16 Solyc08g082820 164.36 169.28 133.84 161.50 153.57 177.97 134.19 139.38 220.44 244.17 192.56 217.87 245.75 267.49 202.68 239.98 201.63 231.28 201.58 201.41 Solyc08g082890 94.65 119.45 114.71 128.39 150.92 158.90 156.89 188.38 203.14 212.79 217.45 243.56 182.01 201.43 188.48 219.73 117.12 137.13 140.47 150.28 Solyc09g005260 30.59 46.85 79.36 68.72 10.22 9.55 17.08 12.20 23.42 16.11 25.45 25.51 116.68 111.44 155.72 115.70 165.19 199.48 215.43 190.15 Solyc09g005610 6.93 3.77 7.32 3.18 2.42 1.97 3.53 1.68 1.97 1.14 1.03 0.83 2.64 1.64 3.20 1.52 5.38 4.15 9.11 4.87 Solyc09g007150 377.12 313.48 265.63 266.52 218.70 202.94 180.71 193.78 267.37 285.86 241.13 229.51 264.80 269.12 227.21 214.66 241.07 209.59 182.71 194.50 Solyc09g007260 16.03 12.95 9.30 11.24 22.19 21.91 17.55 15.24 58.79 59.33 56.36 46.96 39.05 40.40 33.03 33.38 17.82 17.16 14.92 15.24 Solyc09g007790 12.27 11.70 15.92 18.83 36.90 36.62 47.82 47.51 36.12 27.74 39.36 43.11 37.85 32.86 45.81 43.55 54.98 43.48 67.26 51.63 Solyc09g007910 25.73 12.38 15.27 14.78 20.38 15.77 14.75 13.87 29.81 28.99 20.85 23.71 35.32 32.66 23.23 25.15 36.64 23.73 14.97 33.04 Solyc09g008670 28.06 39.82 33.36 41.37 6.23 9.76 6.93 6.31 36.48 53.15 34.06 46.16 62.00 80.18 41.60 41.99 32.89 71.09 55.91 39.76 Solyc09g008770 22.95 11.33 26.59 22.22 27.68 15.30 35.01 19.98 23.64 12.88 32.25 15.89 36.56 24.72 47.70 19.53 62.68 32.06 93.93 31.51 Solyc09g008970 100.15 130.01 109.67 111.69 150.03 218.01 165.11 136.27 165.66 254.65 205.27 178.81 155.41 191.42 130.31 131.84 168.36 209.75 143.38 112.96 Solyc09g009010 25.00 21.21 17.67 19.02 19.55 24.04 16.95 18.24 22.51 25.43 18.03 16.49 16.85 13.19 12.28 15.97 13.45 12.46 8.14 10.35 Solyc09g009620 178.46 260.14 321.15 371.28 115.59 123.88 154.17 182.83 99.37 127.32 162.51 185.54 85.01 110.08 127.82 148.36 31.11 35.64 32.27 46.31 Solyc09g009700 108.54 106.76 87.41 88.69 106.69 106.57 96.19 95.71 85.71 90.14 78.46 82.23 79.58 82.69 75.10 75.63 73.27 73.30 69.73 69.31 Solyc09g010860 18.97 17.18 14.02 13.89 29.52 23.29 21.83 18.55 26.42 26.85 20.50 25.44 33.03 29.80 23.49 25.62 21.12 26.15 19.22 23.15 Solyc09g011220 28.37 22.25 27.45 24.20 27.30 22.48 27.16 22.54 25.55 17.20 19.47 19.08 19.10 15.86 17.23 16.74 18.32 13.51 18.35 14.28 Solyc09g011470 26.13 32.66 42.84 46.39 38.49 39.65 53.03 47.06 42.27 46.38 56.78 55.83 36.09 33.56 39.03 43.20 39.79 44.59 52.86 44.06 Solyc09g011660 7.55 10.00 10.04 9.59 5.32 8.74 9.01 6.74 6.97 9.70 10.51 11.16 11.31 12.73 13.54 14.08 14.96 17.75 27.97 20.93 Solyc09g014480 33.55 38.17 46.94 53.27 52.51 71.82 80.83 83.07 31.68 41.72 45.21 42.28 27.96 33.69 36.27 43.42 30.03 30.96 36.71 40.46 Solyc09g014550 0.71 1.34 10.04 1.23 4.74 3.78 24.47 5.94 2.07 1.15 11.70 2.39 0.27 0.36 0.56 1.01 0.72 1.13 1.48 0.88 Solyc09g018010 68.02 49.73 41.11 46.31 84.38 86.41 66.96 63.65 63.47 70.53 51.61 44.80 91.06 83.94 82.53 72.90 137.92 120.84 69.51 109.53 Solyc09g018280 13.72 15.77 18.36 19.87 23.28 25.66 32.03 29.84 29.21 25.71 32.96 32.61 40.27 40.20 43.70 47.49 48.39 50.06 81.00 63.12 Solyc09g059220 4.65 3.87 7.70 7.54 6.55 4.58 9.58 8.05 7.32 4.81 8.29 9.11 9.63 8.59 11.78 10.75 13.78 11.81 15.16 14.96 Solyc09g061860 58.09 44.25 46.35 46.62 35.87 40.23 31.47 30.60 44.62 54.99 45.80 44.15 52.72 51.44 45.18 42.43 60.61 50.49 36.48 42.84 Solyc09g065170 39.01 48.05 54.01 53.04 12.70 12.25 21.63 22.02 18.08 16.04 28.16 26.35 14.65 19.28 23.21 20.46 14.22 16.82 15.55 17.09 Solyc09g065400 6.63 8.23 9.32 11.37 7.33 9.74 9.32 7.45 8.07 8.05 10.22 9.12 6.93 8.36 9.49 8.69 6.95 9.00 11.15 11.58 Solyc09g065850 24.32 19.44 17.86 24.57 74.64 53.91 49.80 61.50 71.77 53.12 53.96 57.33 104.71 76.16 76.20 78.51 117.58 93.73 79.12 98.92 Solyc09g074100 14.98 11.72 17.53 15.30 19.98 19.69 24.75 20.15 19.23 16.31 23.33 20.76 22.72 19.80 28.24 21.27 21.53 18.17 23.70 22.57 Solyc09g075140 34.97 27.37 36.48 30.97 31.60 33.22 33.36 37.69 33.93 30.96 38.63 39.07 31.19 29.67 33.53 31.88 30.63 25.46 33.36 29.06 Solyc09g075230 96.42 78.74 69.73 66.04 42.10 46.16 44.74 43.79 51.88 56.68 46.13 45.87 56.01 53.17 48.76 48.72 64.55 56.99 38.68 51.00 Solyc09g075550 47.90 54.00 56.01 48.47 46.78 52.38 44.49 45.52 57.47 66.55 60.25 64.69 45.43 59.13 49.25 49.08 38.14 43.64 42.73 37.01 Solyc09g075750 37.72 32.06 28.24 25.92 28.46 29.98 23.44 23.23 57.89 69.09 47.94 48.51 67.82 68.82 48.97 60.46 74.00 67.08 68.52 61.15 Solyc09g075890 30.64 38.38 49.79 57.45 94.86 110.61 123.18 127.11 83.04 77.79 86.85 101.31 126.55 119.01 159.11 172.01 166.21 152.06 197.26 209.10 Solyc09g082340 0.63 1.31 2.72 1.94 0.09 0.16 0.81 0.49 0.10 0.17 0.81 0.82 0.25 0.80 1.19 0.81 0.60 0.61 2.58 3.41 Solyc09g082620 27.39 22.70 20.15 19.38 55.48 46.15 49.77 45.26 42.33 38.53 39.32 33.50 37.48 33.51 30.17 30.29 39.18 30.14 25.22 32.83 131

RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc09g083200 19.81 16.91 22.81 18.68 21.28 19.27 25.62 23.55 16.37 17.73 19.71 18.28 12.96 12.48 16.71 15.83 10.80 12.53 13.44 11.38 Solyc09g083280 22.51 17.56 22.10 22.87 48.08 35.84 42.49 45.83 27.45 23.92 25.31 25.78 25.69 21.69 23.27 25.76 26.36 22.81 27.26 30.75 Solyc09g084450 70.56 57.31 36.96 44.78 117.23 125.05 86.81 113.33 89.19 134.86 71.94 96.36 243.55 270.24 203.59 185.72 383.06 348.73 275.82 304.11 Solyc09g084480 298.90 309.47 312.19 424.87 557.48 789.16 745.91 959.28 481.93 786.47 552.83 823.65 1808.67 2269.20 1898.50 2439.46 2304.45 2425.40 2131.53 3097.48 Solyc09g084490 30.43 32.67 29.70 38.95 44.89 72.78 58.42 85.41 53.08 111.01 67.04 98.61 670.05 1119.59 728.10 989.73 1212.80 1557.53 1112.78 1707.57 Solyc09g089530 46.99 81.24 78.96 50.64 39.47 106.78 116.41 92.63 45.93 131.11 98.65 74.64 342.56 718.18 504.36 519.90 646.49 976.43 582.51 998.14 Solyc09g089540 0.68 0.73 0.40 0.46 2.32 5.21 2.62 3.55 3.53 7.61 3.39 3.97 5.95 8.55 3.53 4.39 6.30 19.47 10.44 14.48 Solyc09g090100 11.41 8.37 12.30 11.67 13.96 11.89 16.75 15.54 15.65 12.91 13.99 14.50 18.19 14.27 17.04 16.84 18.35 16.09 23.41 19.14 Solyc09g090320 81.71 122.70 102.63 111.21 78.11 88.02 67.42 83.08 100.08 98.13 99.23 99.44 80.04 93.45 85.41 80.34 53.75 80.90 73.75 58.17 Solyc09g090390 11.32 10.24 7.32 8.80 13.30 11.95 10.40 8.01 7.26 11.17 6.84 8.00 3.12 7.40 5.85 4.91 6.11 6.49 1.83 1.85 Solyc09g091490 2.61 3.03 3.66 3.90 0.28 0.51 1.00 1.00 0.76 0.16 1.46 1.86 0.41 0.00 0.72 0.42 0.25 0.42 0.13 0.90 Solyc09g091510 15.69 11.55 12.26 11.42 15.41 17.48 17.43 13.48 16.35 14.69 7.62 8.35 44.24 45.28 33.96 33.45 80.73 62.79 43.22 52.80 Solyc09g091810 10.35 7.11 9.57 6.57 10.58 6.68 8.48 6.83 3.48 3.10 3.90 2.31 4.11 3.06 5.42 3.01 5.78 2.92 4.96 5.82 Solyc09g092260 4.93 4.79 8.30 8.96 21.07 19.66 35.36 41.51 44.04 41.31 56.67 61.92 145.08 142.51 185.09 223.96 243.51 224.85 284.60 378.00 Solyc09g092520 21.32 15.16 24.85 34.97 21.59 17.97 33.88 43.99 28.47 30.42 41.77 53.40 71.82 68.62 82.37 94.68 85.78 78.56 131.75 121.84 Solyc09g092690 37.00 50.93 34.47 41.06 45.60 54.83 33.06 39.65 63.67 73.44 54.08 57.43 62.19 71.76 58.45 56.56 51.90 66.04 59.84 41.42 Solyc09g097770 88.04 77.07 91.22 108.41 99.08 101.60 150.87 160.41 44.96 49.79 62.00 68.92 173.03 169.41 226.69 218.77 483.27 409.48 533.03 629.61 Solyc09g097860 66.15 79.24 65.22 73.74 63.87 69.70 65.31 63.76 75.12 83.51 70.47 79.92 50.89 65.09 53.53 52.16 42.73 59.09 53.88 47.19 Solyc09g098360 670.45 792.86 858.25 857.88 764.30 732.45 797.34 839.75 712.31 642.92 725.76 730.82 585.31 573.07 668.30 636.02 515.66 572.24 613.65 555.20 Solyc10g005960 69.62 42.59 46.95 46.86 52.98 46.47 47.41 44.45 49.23 46.91 49.48 43.33 53.14 49.82 48.66 49.44 55.83 44.70 42.07 45.48 Solyc10g007600 14.52 13.64 20.61 21.81 18.93 20.02 27.04 27.58 16.57 20.22 22.71 27.52 43.38 42.75 46.97 49.29 56.87 57.71 66.40 68.14 Solyc10g007800 73.29 54.54 58.08 55.25 108.32 111.97 99.13 88.49 65.20 56.76 55.04 48.30 49.09 48.99 50.38 42.10 59.28 51.92 44.08 45.17 Solyc10g008400 6.83 6.24 5.84 10.00 9.69 14.17 14.63 18.59 9.12 10.24 12.59 15.78 10.83 9.90 14.87 18.81 16.97 10.49 16.36 23.94 Solyc10g008410 161.41 127.00 108.87 102.00 60.66 53.04 49.16 59.60 90.59 88.56 65.62 71.89 100.47 100.28 83.72 74.64 117.93 91.78 96.37 83.22 Solyc10g009320 5.64 2.69 3.95 4.34 2.51 0.69 2.69 1.06 2.86 0.92 1.70 1.59 2.33 0.97 3.34 1.30 1.65 0.99 2.21 2.06 Solyc10g009340 21.70 15.39 23.96 18.73 22.69 20.29 20.67 18.90 24.26 16.24 21.24 19.36 70.13 53.09 65.15 57.59 118.02 83.41 110.13 103.27 Solyc10g012370 49.48 56.74 45.62 44.74 41.50 46.34 38.06 36.45 36.48 39.44 34.14 36.56 43.36 43.12 40.72 40.38 44.36 47.41 42.39 46.18 Solyc10g018870 32.82 23.42 26.84 28.20 32.10 29.70 33.66 30.31 25.05 25.11 28.54 27.67 23.65 19.62 24.21 21.46 27.28 21.11 26.06 25.90 Solyc10g045100 20.52 17.97 18.70 21.48 13.13 10.85 10.67 12.33 20.99 14.38 14.95 18.94 6.47 7.09 6.06 7.08 2.25 1.95 2.67 3.64 Solyc10g045380 28.39 35.53 31.60 28.83 40.52 46.51 42.98 43.11 46.65 63.82 52.31 55.12 54.50 58.41 53.06 52.76 41.88 58.18 52.09 45.79 Solyc10g054910 76.27 72.46 67.74 68.19 117.47 118.06 101.08 101.01 90.71 93.24 83.41 84.07 67.99 68.78 59.65 63.60 65.92 56.60 50.05 56.44 Solyc10g074680 39.99 40.66 29.70 33.18 42.60 42.27 35.89 39.57 52.27 47.82 40.41 43.68 41.88 41.04 42.33 39.74 32.59 29.01 28.37 28.70 Solyc10g076410 4.99 4.19 7.60 7.31 4.04 4.06 5.25 5.80 3.41 2.61 3.47 3.77 1.42 0.97 1.75 2.00 1.20 0.63 1.53 1.21 Solyc10g076600 40.74 46.37 45.32 41.69 53.43 59.90 49.74 48.86 43.84 50.31 43.77 44.79 40.82 49.87 46.05 45.98 32.90 38.49 30.40 34.45 Solyc10g076720 1.91 2.05 2.11 2.21 0.96 2.07 2.23 2.19 1.57 1.02 1.70 1.64 1.26 1.31 3.82 2.41 3.95 4.21 7.63 5.59 Solyc10g076990 74.42 71.71 80.15 71.87 75.72 73.15 81.36 70.83 59.13 59.50 73.33 64.21 64.42 57.42 66.04 60.10 70.20 65.90 71.00 63.95 Solyc10g078370 120.95 108.74 164.95 147.73 344.76 299.29 306.83 288.11 245.52 265.35 267.66 255.60 198.31 185.09 192.90 209.56 128.05 124.05 116.75 122.02 Solyc10g078590 20.27 18.30 24.66 18.25 19.26 20.27 23.43 21.49 19.58 16.64 25.52 18.75 41.39 35.98 46.16 42.28 70.29 59.46 105.05 72.62 Solyc10g078700 71.89 60.82 58.64 54.84 44.94 42.21 38.82 31.74 37.08 40.48 31.98 34.47 31.55 29.78 22.05 26.84 20.52 16.38 11.14 15.77 Solyc10g078740 34.17 30.44 30.74 26.50 30.21 32.44 29.25 28.57 27.28 37.24 27.08 28.29 25.68 32.60 26.80 25.11 26.34 26.08 14.88 23.81 Solyc10g078770 0.65 0.20 3.53 2.08 0.36 0.16 2.92 1.41 0.94 0.73 5.81 0.99 3.41 2.62 10.56 4.95 8.19 2.26 14.38 5.23 Solyc10g078920 18.16 26.98 29.33 24.43 28.12 29.85 38.13 38.47 36.25 35.20 47.10 44.47 51.93 51.52 59.06 57.10 65.29 70.33 98.31 77.17 Solyc10g078990 0.76 0.55 0.90 1.49 0.11 0.71 0.34 0.29 2.50 3.32 6.81 9.14 41.82 47.27 45.72 45.71 23.54 22.31 17.52 20.36 Solyc10g079950 4.76 4.76 5.66 4.96 3.69 3.39 7.70 5.25 7.32 8.18 10.49 7.84 8.17 10.28 12.00 10.27 14.10 17.50 23.91 14.76 Solyc10g080610 15.59 21.07 25.40 27.15 39.41 40.70 51.66 58.61 34.98 35.71 43.69 41.95 83.24 73.19 91.50 94.96 105.50 94.99 148.03 138.45 Solyc10g081260 82.20 67.08 63.68 64.50 55.19 54.04 51.50 48.68 51.45 66.86 52.49 58.30 48.61 46.10 39.24 50.13 41.44 42.14 26.54 38.97 Solyc10g083290 39.77 45.39 33.05 38.80 29.07 30.13 27.14 32.99 52.09 48.61 42.85 52.76 35.60 27.25 24.86 29.36 12.15 14.02 9.71 13.82 Solyc10g083330 5.02 3.87 2.46 2.22 3.32 3.76 1.86 2.28 3.96 3.19 2.40 2.44 5.13 4.36 3.13 3.94 5.72 3.01 3.43 3.73 132

RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc10g083440 92.28 93.85 84.21 88.03 79.60 84.85 80.96 75.43 84.02 81.19 68.67 75.65 132.21 136.21 110.91 121.67 143.18 160.43 134.19 132.06 Solyc10g083760 85.07 73.41 94.64 81.88 102.53 86.33 111.26 101.74 83.30 72.83 88.94 80.12 80.01 71.68 90.18 87.42 93.47 84.60 87.88 85.39 Solyc10g085220 68.22 59.62 55.91 53.17 50.05 59.36 49.00 51.87 65.82 73.15 60.39 60.23 65.89 64.77 58.14 59.11 62.60 59.33 44.12 52.81 Solyc10g085280 17.84 15.38 11.35 15.42 8.34 7.89 5.49 8.03 22.03 22.95 15.84 14.50 13.32 16.99 12.16 13.95 15.60 16.46 11.83 11.45 Solyc10g085420 5.50 5.17 7.91 7.02 5.50 7.82 8.00 8.11 4.32 5.98 6.00 7.22 5.38 6.04 7.33 6.31 5.62 6.45 7.08 9.33 Solyc10g086340 42.00 65.66 51.86 57.61 41.54 47.07 41.86 51.33 54.21 64.11 53.65 60.18 47.33 59.59 51.15 44.53 26.53 40.75 37.72 31.27 Solyc10g086360 56.69 55.47 59.49 62.16 51.78 49.71 58.64 57.73 52.62 53.29 58.59 52.52 57.45 49.19 57.39 61.39 62.07 56.31 85.14 63.45 Solyc10g086570 32.73 37.06 43.69 53.06 75.42 79.83 88.84 104.36 79.20 88.37 91.61 106.93 102.34 119.86 130.71 155.61 123.44 135.72 137.29 157.33 Solyc10g086620 2.73 2.84 3.34 2.76 3.55 3.01 3.58 5.19 9.39 11.16 13.30 16.30 6.13 4.78 5.56 8.82 4.58 4.61 4.58 6.60 Solyc11g006230 347.18 326.15 395.18 397.31 178.33 193.31 261.88 264.28 251.00 268.41 299.17 280.86 99.48 108.49 130.43 130.27 76.96 73.17 80.28 83.87 Solyc11g006750 48.96 50.14 57.05 52.37 42.58 43.13 53.61 50.81 43.38 39.06 50.21 42.35 37.19 34.64 41.72 45.47 41.12 39.91 68.38 46.18 Solyc11g007020 37.77 30.84 31.24 32.66 34.35 30.31 27.16 26.68 32.82 31.41 29.15 30.40 32.73 28.66 27.73 29.61 33.71 33.40 19.63 25.50 Solyc11g007200 28.94 34.30 31.52 31.55 19.53 22.32 21.56 19.14 13.97 22.23 15.34 15.54 32.40 51.41 36.53 32.20 46.96 56.59 43.71 55.38 Solyc11g007930 539.06 607.85 553.62 566.67 608.74 649.95 593.70 602.51 789.16 830.02 816.55 797.45 532.64 572.51 500.55 567.82 472.35 545.68 439.37 516.59 Solyc11g008280 66.20 70.87 72.24 70.52 64.78 71.42 72.35 70.20 52.17 71.27 67.59 66.85 54.46 60.31 61.61 60.16 54.21 59.26 49.81 55.40 Solyc11g010340 39.48 36.57 26.07 26.97 27.36 26.03 20.23 26.33 34.74 31.18 28.55 29.61 13.23 10.40 11.48 14.21 15.58 15.93 13.78 12.32 Solyc11g010430 3.30 0.96 1.54 1.51 3.06 1.44 1.91 2.32 2.22 2.87 2.07 1.32 3.12 1.81 2.24 2.66 3.20 2.95 1.61 2.10 Solyc11g010960 42.19 31.16 32.42 29.10 39.95 38.52 36.87 33.05 52.19 53.34 41.68 45.88 77.04 69.07 61.24 62.92 87.15 71.25 50.15 63.17 Solyc11g011770 28.15 24.72 19.06 21.04 21.24 22.29 20.75 17.67 27.63 24.36 25.59 27.61 24.58 23.48 18.63 19.34 22.06 24.94 18.06 20.15 Solyc11g011920 30.54 22.00 36.10 35.64 9.08 10.96 12.19 13.27 10.24 13.37 16.26 19.67 11.28 17.39 13.32 16.27 31.37 26.36 37.31 35.11 Solyc11g012020 40.80 46.63 40.83 38.93 38.71 42.11 34.53 38.90 35.54 43.07 39.33 38.97 32.03 33.02 29.12 29.81 22.92 27.68 23.48 23.46 Solyc11g012130 289.14 227.60 193.96 188.63 212.13 185.41 173.14 170.23 264.38 273.97 230.80 233.70 222.01 197.02 184.15 196.57 219.55 184.16 145.43 185.96 Solyc11g012240 3.57 3.05 1.18 1.51 0.91 1.73 0.89 1.15 3.74 2.90 2.26 2.89 3.64 3.73 2.77 2.57 4.20 3.45 2.21 2.54 Solyc11g012590 2.67 2.02 3.28 2.37 9.35 5.61 10.32 6.22 5.27 5.07 6.04 4.48 11.78 6.18 9.74 6.61 16.00 8.14 19.50 11.05 Solyc11g013170 96.58 80.33 67.75 83.65 85.64 87.92 84.21 85.44 105.72 106.08 92.22 106.50 104.04 100.10 86.29 109.33 100.95 91.50 66.17 97.40 Solyc11g013290 1.06 2.07 5.17 2.88 2.17 2.34 3.46 2.37 2.56 3.65 3.88 3.44 3.95 3.98 4.96 2.37 2.68 1.47 3.73 2.21 Solyc11g021020 25.18 18.89 15.25 13.55 40.90 40.10 32.99 23.82 44.39 40.54 28.00 31.77 49.48 42.08 36.13 32.15 39.51 30.04 25.55 24.01 Solyc11g021360 0.23 0.15 0.06 0.00 0.07 0.73 0.51 0.10 0.00 0.19 1.05 0.11 0.71 0.64 2.33 0.52 2.17 1.56 3.94 1.54 Solyc11g027840 0.37 0.00 0.65 0.19 1.33 0.52 1.30 1.98 1.30 0.79 2.48 0.98 1.87 2.22 3.15 2.98 6.07 3.03 7.16 4.89 Solyc11g028080 16.50 14.08 13.94 15.76 18.30 13.10 14.97 17.59 13.22 12.08 11.63 13.26 16.25 12.42 10.77 13.33 12.90 11.66 10.81 13.47 Solyc11g040040 10.43 2.19 1.55 8.25 11.07 2.63 3.46 8.64 29.68 11.12 11.78 32.06 65.04 43.50 39.64 64.05 44.99 36.74 31.17 51.34 Solyc11g045530 1.37 1.46 3.04 3.99 3.16 3.72 5.92 6.89 5.17 4.71 8.62 8.19 9.55 9.21 12.03 12.51 6.39 4.86 6.19 7.42 Solyc11g065930 38.72 64.57 50.14 59.25 39.50 68.26 56.66 58.28 33.24 61.79 48.83 52.87 54.91 89.42 69.86 77.34 56.96 84.29 72.93 77.21 Solyc11g066390 36.89 28.45 32.21 26.24 42.65 31.07 32.61 25.74 35.12 28.10 31.12 26.64 22.79 22.20 22.38 18.41 20.02 15.82 13.68 12.59 Solyc11g066670 346.77 342.36 255.45 261.46 155.48 153.58 135.00 151.33 315.92 287.52 241.45 249.93 310.09 311.97 268.72 252.27 342.60 367.37 398.50 290.08 Solyc11g066970 15.06 13.49 13.47 15.85 12.01 12.93 7.98 13.75 20.95 20.29 19.10 20.89 41.50 37.92 38.60 44.21 39.45 43.88 33.89 50.72 Solyc11g068710 10.13 10.21 10.52 10.90 14.94 12.56 15.37 23.20 8.19 8.99 10.74 10.51 12.83 11.78 11.64 16.54 19.01 15.88 18.86 29.35 Solyc11g068750 35.39 46.73 47.95 48.34 31.58 34.72 39.04 41.81 38.40 35.49 47.85 44.36 35.98 36.08 49.68 43.14 40.42 41.75 53.34 45.60 Solyc11g071290 31.65 45.11 40.47 47.85 18.87 21.65 26.71 32.50 44.52 53.84 53.30 73.01 74.53 86.43 76.21 79.48 37.12 59.53 45.38 45.38 Solyc11g071370 3.79 5.12 1.58 1.60 5.65 4.70 2.15 1.76 4.41 5.39 3.59 3.91 5.28 3.52 2.57 3.51 2.66 3.81 2.29 2.08 Solyc11g071380 62.80 76.04 31.51 32.35 44.00 53.36 28.89 30.85 20.89 24.86 21.84 24.03 4.63 4.68 2.51 6.59 1.01 1.94 1.36 2.37 Solyc11g071400 0.11 0.10 0.19 0.27 0.42 0.62 0.63 0.10 0.75 0.62 0.30 0.45 1.09 1.37 0.38 0.12 2.22 3.48 0.68 0.27 Solyc11g071470 194.67 198.27 193.72 210.87 192.29 188.15 221.64 231.88 157.86 156.99 171.10 188.03 94.68 102.97 96.31 110.20 64.79 75.61 65.56 71.62 Solyc11g071480 81.83 66.14 54.06 53.09 66.43 65.15 48.40 65.84 82.82 87.19 72.51 82.85 104.80 101.86 77.30 94.05 93.00 82.49 64.69 75.71 Solyc11g071490 383.83 316.91 296.45 286.91 399.97 382.92 336.88 322.75 345.33 345.82 303.88 273.20 271.97 247.33 221.30 216.45 287.19 235.18 207.14 210.05 Solyc11g071530 2.17 2.61 4.36 4.02 3.31 5.08 5.90 6.02 5.42 5.15 8.61 5.64 6.86 4.49 7.73 5.42 4.12 6.31 9.75 7.41 Solyc11g071540 20.63 26.16 19.60 16.74 19.69 20.97 22.80 17.93 21.00 22.48 22.12 16.48 25.39 29.56 26.49 20.68 24.30 31.06 20.78 18.23 Solyc11g071640 289.19 286.44 205.73 204.85 349.06 360.38 272.46 270.53 319.17 337.37 246.48 243.60 203.45 235.94 187.05 187.12 184.13 209.32 200.90 184.86 133

RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc11g071690 225.60 219.19 259.31 262.33 220.79 215.90 240.69 246.61 208.38 200.19 228.87 230.91 194.61 194.29 236.39 228.29 219.68 201.47 247.79 229.13 Solyc11g071710 14.38 12.60 12.99 13.20 17.03 14.13 15.53 12.12 14.15 15.07 12.52 10.76 14.48 11.62 12.55 8.11 12.94 10.34 6.91 11.38 Solyc11g071730 176.11 243.21 187.88 205.79 177.73 190.92 139.72 156.90 191.49 215.99 160.60 176.12 152.15 172.36 127.51 136.07 97.52 143.63 111.03 90.83 Solyc11g071740 4.93 3.97 6.79 7.96 11.83 10.76 15.37 18.46 12.13 8.14 17.20 18.78 19.94 13.38 21.45 22.43 16.77 16.74 45.98 33.38 Solyc11g071790 65.91 57.46 44.10 48.84 59.89 63.90 46.71 43.40 48.48 54.83 42.69 36.86 45.87 42.29 34.58 30.85 50.00 45.20 27.07 35.47 Solyc11g071810 32.81 21.64 5.28 5.89 9.41 8.66 5.58 5.93 33.88 32.39 6.00 6.10 50.34 49.53 8.66 4.69 57.48 44.96 9.63 6.02 Solyc11g071830 48.22 52.52 24.15 20.88 68.72 87.27 27.17 29.78 80.07 94.75 31.07 35.68 60.23 70.48 30.70 32.78 70.26 82.77 52.95 32.14 Solyc11g072110 6.93 3.93 3.61 8.17 3.95 2.32 3.46 6.80 4.40 2.97 2.58 6.78 13.35 12.94 11.28 11.04 16.18 12.80 18.47 18.40 Solyc11g072120 7.97 4.89 5.80 4.25 4.76 4.41 3.06 4.32 4.31 4.19 1.95 3.05 14.20 12.83 11.19 8.88 19.11 19.73 17.89 15.84 Solyc11g072280 22.27 32.31 28.07 30.30 28.00 29.21 27.45 26.48 27.26 29.99 31.78 30.98 23.07 28.71 22.33 23.15 16.94 23.89 19.24 18.29 Solyc11g073120 3.03 2.51 4.27 3.39 3.40 6.49 5.79 5.01 3.78 4.09 4.64 4.22 3.56 6.55 6.55 4.63 15.60 15.27 31.08 23.59 Solyc12g005250 45.56 56.28 44.89 56.35 45.22 51.71 40.23 49.42 50.72 57.96 53.01 59.76 41.79 51.38 44.26 46.68 32.28 39.82 33.72 28.72 Solyc12g005430 72.31 48.85 44.66 49.10 72.96 72.21 61.57 58.52 55.56 56.89 46.89 50.77 46.30 39.36 34.55 42.16 40.67 32.57 28.11 37.07 Solyc12g005500 1.67 2.68 4.78 2.70 2.09 2.19 3.66 3.10 1.50 1.57 2.64 2.89 1.04 0.64 1.13 0.67 0.32 0.54 0.76 0.19 Solyc12g005700 6.41 10.31 5.87 5.14 31.10 33.44 32.87 27.86 7.95 7.83 7.04 7.16 5.72 9.66 7.88 5.16 9.14 10.98 7.33 8.23 Solyc12g005800 3.30 3.24 1.44 1.71 2.10 2.62 2.63 2.37 3.60 3.68 1.79 3.11 6.83 6.23 3.80 4.92 4.68 4.31 2.67 4.91 Solyc12g005910 18.03 15.33 22.71 15.95 15.63 17.72 19.64 18.81 14.16 12.62 16.69 13.80 13.61 15.69 15.84 17.70 21.67 20.15 31.14 25.16 Solyc12g006460 236.10 245.41 174.09 201.06 188.00 182.36 124.21 165.51 369.08 351.21 267.73 297.74 381.73 376.64 319.45 303.12 392.49 449.40 405.29 319.49 Solyc12g006470 1110.17 1087.43 857.60 898.53 779.38 732.67 584.41 667.63 1162.92 1121.67 840.43 929.11 1525.29 1546.22 1259.69 1280.71 1648.48 1826.59 1945.83 1426.91 Solyc12g007020 50.33 58.81 43.36 57.20 45.60 45.17 39.39 40.86 54.36 56.57 54.04 55.33 47.09 54.24 39.62 44.45 33.91 43.28 34.43 32.76 Solyc12g007160 24.25 19.53 21.10 18.23 30.26 28.16 32.33 23.62 34.07 28.93 34.49 26.00 28.26 24.14 27.56 22.41 25.81 20.12 17.22 21.82 Solyc12g008330 10.62 8.84 11.67 11.32 10.44 7.71 12.52 11.65 8.23 7.64 9.03 7.24 9.26 9.16 10.97 11.61 11.87 7.57 8.60 10.30 Solyc12g008560 1285.34 1558.98 1908.48 1891.54 1771.37 1896.68 2289.11 2183.93 1444.95 1494.45 1729.19 1684.55 1628.49 1798.17 1904.35 2068.42 1926.86 2029.06 2845.21 2612.59 Solyc12g009480 12.22 11.14 9.95 10.68 18.75 13.17 13.90 11.16 22.93 17.88 19.63 18.88 23.86 17.32 18.22 21.28 20.92 16.08 20.05 15.29 Solyc12g009930 21.16 20.29 14.48 20.20 15.19 17.53 12.98 17.02 33.45 33.71 25.74 31.39 77.82 83.47 61.21 57.58 112.73 130.03 94.91 85.20 Solyc12g010650 15.25 11.23 13.40 10.73 15.04 13.17 14.08 10.93 11.83 8.97 10.23 9.59 12.38 9.56 10.16 10.39 10.60 11.17 7.42 7.60 Solyc12g010850 5.14 6.57 4.81 7.31 4.74 4.38 3.56 6.72 5.47 5.90 5.40 6.92 5.42 6.47 4.84 6.19 4.98 6.59 5.59 6.35 Solyc12g011290 100.52 134.26 117.24 123.00 96.23 108.19 91.80 107.51 110.51 120.72 112.39 122.36 104.03 124.42 111.89 106.36 72.19 94.78 86.67 74.73 Solyc12g013710 35.20 28.90 34.10 38.33 15.51 15.12 20.53 19.63 14.78 15.73 18.43 23.12 35.14 34.95 41.07 47.89 58.42 54.52 61.93 71.54 Solyc12g013920 59.21 57.74 69.15 64.72 58.65 52.92 64.87 55.61 55.72 46.75 53.94 46.67 48.96 40.61 53.81 46.04 57.05 53.03 59.26 55.13 Solyc12g014070 12.72 15.91 17.18 17.39 15.12 16.22 17.18 14.38 13.76 16.35 20.20 17.60 19.82 19.39 22.21 19.54 14.10 20.80 23.69 22.88 Solyc12g014480 32.25 30.94 39.87 39.29 32.64 34.03 39.56 34.85 32.84 25.01 35.50 33.64 34.39 29.88 36.40 34.48 39.34 27.67 41.36 37.38 Solyc12g014500 8.81 6.80 3.83 4.77 2.99 2.99 0.69 1.16 8.45 7.83 6.49 7.64 12.56 10.88 11.17 11.01 15.59 11.12 9.33 14.63 Solyc12g015860 128.51 106.40 95.49 87.83 97.20 99.25 83.89 84.23 103.63 126.88 105.74 104.70 111.90 115.12 102.37 99.73 124.72 106.05 82.98 111.68 Solyc12g019320 92.71 82.07 69.48 81.90 95.86 93.92 85.91 94.44 104.50 121.99 104.95 113.55 103.02 95.67 89.28 109.82 83.09 91.70 85.35 87.89 Solyc12g019550 39.04 41.33 47.05 50.59 33.85 40.41 45.94 47.33 39.01 39.66 49.75 49.00 71.43 86.37 89.77 92.78 93.71 98.72 88.76 122.69 Solyc12g040800 2.46 3.89 5.19 4.43 2.97 3.59 5.57 3.22 2.34 2.86 3.77 3.50 3.44 3.95 6.34 4.62 5.92 11.46 8.82 9.59 Solyc12g042720 53.76 49.39 53.29 49.32 52.64 47.36 56.30 47.15 53.52 51.86 56.52 46.27 43.99 42.20 46.51 40.55 48.34 43.91 51.94 47.43 Solyc12g042890 7.25 10.53 10.37 10.54 10.04 7.37 9.83 8.18 11.22 9.38 15.80 14.62 5.30 3.60 6.08 6.29 4.22 6.21 7.42 6.87 Solyc12g044820 1.65 2.93 1.85 2.28 0.84 1.42 1.45 1.29 2.91 5.08 4.70 5.44 4.93 6.56 5.54 8.33 5.43 6.50 5.55 7.70 Solyc12g044850 75.88 72.99 80.59 81.94 77.86 73.45 80.31 86.44 76.00 80.70 77.58 84.28 69.18 77.15 76.34 83.19 73.86 74.33 83.70 79.79 Solyc12g045030 22.84 22.01 24.38 21.96 14.45 12.65 22.30 19.37 10.19 10.51 13.45 12.95 13.70 16.90 19.31 16.13 26.28 17.96 33.04 28.32 Solyc12g056160 3.10 2.04 5.66 5.87 6.59 4.99 5.82 7.24 4.55 4.08 5.67 5.74 4.19 4.07 3.55 5.41 2.80 2.53 3.22 3.39 Solyc12g056560 10.11 9.66 11.07 9.86 7.32 8.09 11.42 7.13 6.51 9.59 10.31 7.52 7.31 9.36 11.33 12.31 9.77 11.28 18.30 13.49 Solyc12g056600 8.06 5.01 3.55 5.23 4.16 4.32 4.00 3.67 4.66 4.34 2.27 2.37 8.96 10.22 6.41 6.51 12.73 11.07 8.02 10.25 Solyc12g056640 26.60 24.30 23.58 26.89 27.90 26.22 24.85 22.51 26.08 25.44 22.82 22.41 24.19 23.98 19.59 22.47 25.68 30.38 19.25 22.63 Solyc12g056650 45.22 38.57 47.07 41.67 35.04 33.88 43.85 35.39 33.47 33.59 37.60 32.63 39.38 33.68 44.81 33.42 41.31 34.61 50.70 40.19 Solyc12g082720 34.89 25.63 27.26 30.86 38.23 25.44 24.78 27.11 49.46 26.36 28.92 34.26 49.41 30.17 38.75 30.12 37.18 29.42 34.14 26.01 134

RPM SYM F&IM 2dpi 4dpi 6dpi Gene ID WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas WT lc fas lc/fas Solyc12g082730 6.24 0.13 1.88 0.66 8.54 0.16 1.90 0.60 9.74 0.52 3.23 0.84 7.22 0.54 3.17 0.65 6.25 0.89 1.91 0.28 Solyc12g087830 19.32 13.60 17.78 13.85 25.52 18.02 20.75 17.93 25.20 24.70 23.90 19.31 33.97 25.31 29.91 25.96 31.55 25.97 41.28 27.35 Solyc12g088300 2.58 4.09 6.52 1.90 2.15 3.84 6.03 2.14 3.03 5.69 6.39 3.16 3.44 4.76 7.29 2.99 3.59 6.67 7.67 2.35 Solyc12g094550 9.42 8.05 10.20 6.95 12.31 10.21 12.86 10.34 9.56 7.07 9.46 6.98 8.03 5.67 7.33 7.49 9.62 8.17 15.43 8.78 Solyc12g095900 11.80 8.11 8.28 9.93 8.56 6.61 12.52 12.35 9.82 8.14 11.10 9.28 10.76 9.26 11.07 10.66 12.64 8.82 12.54 11.25 Solyc12g096710 5.98 4.51 3.82 5.82 3.26 3.05 4.65 6.16 4.55 2.98 3.48 5.18 2.97 3.63 3.70 7.21 5.35 4.61 7.47 7.31 Solyc12g096830 43.57 52.86 53.00 53.13 52.24 57.65 62.76 55.13 42.79 44.73 54.02 43.50 37.88 41.37 47.28 45.65 45.67 52.98 51.50 51.47 Solyc12g098450 0.98 1.24 1.61 2.54 1.35 1.36 1.65 2.08 1.65 2.34 1.95 3.27 0.42 0.55 1.23 1.96 0.50 0.21 0.38 1.64 Solyc12g098900 8.24 7.76 29.11 21.33 6.42 4.96 18.82 8.03 6.09 3.48 14.29 6.52 20.36 12.26 51.92 22.40 70.65 27.90 131.13 43.36 Solyc12g099260 58.69 46.88 37.34 43.35 49.87 45.27 36.09 35.47 50.59 61.39 40.05 42.52 45.85 50.27 39.80 42.90 39.94 40.07 20.50 34.54 Solyc12g099290 62.59 55.87 52.53 54.00 47.91 49.02 41.45 42.28 42.06 51.49 41.60 42.29 36.77 36.30 31.85 36.63 35.71 31.86 19.12 27.84

135

Tomato ID Arabidopsis Arabidopsis gene description Arabidopsis gene name Tomato description Solyc00g007070.2.1 AT5G66010 RNA-binding (RRM/RBD/RNP motifs) family protein NA Heterogeneous nuclear ribonucleoprotein H1 Solyc00g026160.2.1 AT5G23980 Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and cotyledons, but FERRIC REDUCTION OXIDASE 4 (FRO4) Ferric reductase oxidase not flowers. Its transcription is regulated by FIT1. Solyc00g050430.2.1 AT5G65640 bHLH093/NFL encodes a bHLH transcription factor involved in GA mediated control of flowering BETA HLH PROTEIN 93 (bHLHNA93) BHLH transcription factor time. Solyc00g080750.2.1 AT2G01340 Encodes a protein whose expression is responsive to nematode infection. (At17.1) Unknown Protein Solyc01g005210.2.1 AT1G68020 Encodes an enzyme putatively involved in trehalose biosynthesis. (ATTPS6) Alpha alpha-trehalose-phosphate synthase Solyc01g005300.2.1 AT1G68050 Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition FLAVIN-BINDING, KELCH REPEAT, F BOX 1 (FKF1) Flavin-binding kelch domain F box to flowering. protein Solyc01g005420.2.1 AT4G15740 Calcium-dependent lipid-binding (CaLB domain) family protein NA SRC2-like protein Solyc01g006390.2.1 NA #N/A NA Cysteine-rich extensin-like protein-4 Solyc01g006510.2.1 AT5G51970 Encodes a putative sorbitol dehydrogenase that can be thiolated in vitro. SORBITOL DEHYDROGENASE (ATSDH) L-threonine 3-dehydrogenase Solyc01g007860.2.1 AT3G52560 ubiquitin E2 variant 1D-4 UBIQUITIN E2 VARIANT 1D-4 (UEV1D-4) Ubiquitin-conjugating enzyme family protein-like Solyc01g008110.2.1 AT1G11680 putative obtusifoliol 14-alpha demethylase involved in sterol biosynthesis. CYTOCHROME P45NA 51G1 (CYP51G1) Cytochrome P450 Solyc01g010600.2.1 AT1G69780 Encodes a homeodomain leucine zipper class I (HD-Zip I) protein (ATHB13) Homeobox-leucine zipper-like protein Solyc01g010700.2.1 AT1G69800 Cystathionine beta-synthase (CBS) protein NA AKIN gamma Solyc01g014180.2.1 AT1G51200 A20/AN1-like zinc finger family protein NA Zinc finger A20 and AN1 domain- containing stress-associated protein 8 Solyc01g057000.2.1 AT3G11930 Adenine nucleotide alpha hydrolases-like superfamily protein NA Universal stress protein family protein Solyc01g060420.2.1 AT1G67030 Encodes a novel C2H2 zinc finger protein containing only a single zinc finger which plays a key ZINC FINGER PROTEIN 6 (ZFP6) Zinc finger protein 6 role in regulating trichome development by integrating GA and cytokinin signaling. Solyc01g065980.2.1 AT3G16770 Encodes a member of the ERF (ethylene response factor) subfamily B-2 of the plant specific ETHYLENE-RESPONSIVE ELEMENT BINDING Ethylene responsive transcription ERF/AP2 transcription factor family (RAP2.3). PROTEIN (EBP) factor 2b Solyc01g066760.2.1 NA #N/A NA Unknown Protein Solyc01g066880.2.1 AT5G27690 Heavy metal transport/detoxification superfamily protein NA Copper chaperone Solyc01g073640.2.1 AT2G47140 NAD(P)-binding Rossmann-fold superfamily protein SHORT-CHAIN DEHYDROGENASE REDUCTASE 5 Uncharacterized oxidoreductase (SDR5) Mb1385 Solyc01g073770.2.1 AT5G19900 PRLI-interacting factor NA PRLI-interacting factor A Solyc01g079610.2.1 AT3G62600 J domain protein localized in ER lumen. (ATERDJ3B) DNAJ chaperone Solyc01g079980.2.1 AT1G03220 Eukaryotic aspartyl protease family protein NA Xylanase inhibitor Solyc01g080640.2.1 AT3G62700 member of MRP subfamily ATP-BINDING CASSETTE C14 (ABCC14) Multidrug resistance protein ABC transporter family Solyc01g081190.2.1 AT1G64850 Calcium-binding EF hand family protein NA Calcium-binding EF hand family protein Solyc01g081250.2.1 AT3G09270 Encodes glutathione transferase GLUTATHIONE S-TRANSFERASE TAU 8 (GSTU8) Glutathione-S-transferase Solyc01g081450.2.1 NA #N/A NA Unknown Protein Solyc01g087560.2.1 AT5G13710 SMT1 controls the level of cholesterol in plants STEROL METHYLTRANSFERASE 1 (SMT1) 24-sterol C-methyltransferase Solyc01g087570.2.1 AT3G57450 hypothetical protein NA Unknown Protein Solyc01g089910.2.1 AT5G25260 SPFH/Band 7/PHB domain-containing membrane-associated protein family NA Flotillin domain protein Solyc01g090340.2.1 AT2G44840 encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription ETHYLENE-RESPONSIVE ELEMENT BINDING Ethylene responsive transcription factor family. FACTOR 13 (ERF13) factor 1b Solyc01g090410.2.1 AT3G60340 alpha/beta-Hydrolases superfamily protein NA Palmitoyl protein thioesterase family protein Solyc01g090670.2.1 AT2G45000 Encodes a nucleoporin EMBRYO DEFECTIVE 2766 (EMB2766) Nuclear pore glycoprotein p62 Solyc01g091320.2.1 AT4G12110 Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically STEROL-4ALPHA-METHYL OXIDASE 1-1 (SMO1-1) Sterol 4-alpha-methyl-oxidase 2 functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha- methyl oxidase. Solyc01g092950.2.1 AT2G45660 Controls flowering and is required for CO to promote flowering. AGAMOUS-LIKE 2NA (AGL2NA) MADS-box transcription factor 2 Solyc01g095030.2.1 AT5G52660 Encodes RVE6, a homolog of the circadian rhythm regulator RVE8. REVEILLE 6 (RVE6) MYB transcription factor Solyc01g095760.2.1 AT5G49690 UDP-Glycosyltransferase superfamily protein NA UDP-glucosyltransferase Solyc01g096190.2.1 AT4G00900 Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm. ER-TYPE CA2+-ATPASE 2 (ECA2) Calcium-transporting ATPase Solyc01g096320.2.1 AT2G46680 encodes a putative transcription factor that contains a homeodomain closely linked to a leucine HOMEOBOX 7 (HB-7) Homeobox leucine zipper protein zipper motif. Solyc01g096650.2.1 AT5G07040 RING/U-box superfamily protein NA RING finger protein Solyc01g096740.2.1 AT5G13750 zinc induced facilitator-like 1 ZINC INDUCED FACILITATOR-LIKE 1 (ZIFL1) Transporter major facilitator family Solyc01g096810.2.1 AT3G20770 Encodes EIN3 (ethylene-insensitive3), a nuclear transcription factor that initiates downstream ETHYLENE-INSENSITIVE3 (EIN3) Ethylene insensitive 3 class transcriptional cascades for ethylene responses. transcription factor 136

Solyc01g097930.2.1 AT4G14880 Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine O-ACETYLSERINE (THIOL) LYASE (OAS-TL) Cysteine synthase biosynthesis and for the fixation of inorganic sulfide. Required for pollen tube growth and/or ISOFORM A1 (OASA1) fertilization. Solyc01g098190.2.1 AT3G05030 Encodes a vacuolar K+/H+ exchanger essential for active K+ uptake at the tonoplast and involved in SODIUM HYDROGEN EXCHANGER 2 (NHX2) Sodium/hydrogen exchanger regulating stomatal closure. Solyc01g098320.2.1 AT3G57080 Non-catalytic subunit unique to Nuclear DNA-dependent RNA polymerase V (NRPE5) DNA-directed RNA polymerase subunit H Solyc01g098390.2.1 AT5G27320 Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). GA INSENSITIVE DWARF1C (GID1C) GID1-like gibberellin receptor Solyc01g098400.2.1 AT3G21510 Encodes AHP1, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). HISTIDINE-CONTAINING PHOSPHOTRANSMITTER 1 Histidine phosphotransfer protein AHPs function as redundant positive regulators of cytokinin signaling. (AHP1) Solyc01g098930.2.1 AT3G05327 Cyclin family protein NA Cyclin Solyc01g099210.2.1 AT1G55020 lipoxygenase LIPOXYGENASE 1 (LOX1) Lipoxygenase Solyc01g099840.2.1 AT1G56220 Dormancy/auxin associated family protein NA Auxin-repressed protein Solyc01g099970.2.1 AT5G27920 F-box family protein NA F-box/LRR-repeat protein 14 Solyc01g102960.2.1 AT4G10250 Columbia endomembrane-localized small heat shock protein (ATHSP22.NA) class IV heat shock protein Solyc01g103510.2.1 AT1G61580 R-protein L3 B R-PROTEIN L3 B (RPL3B) Ribosomal protein L3-like Solyc01g103590.2.1 AT1G80160 Lactoylglutathione lyase / glyoxalase I family protein GLYOXYLASE I 7 (GLYI7) Glyoxalase/bleomycin resistance protein/dioxygenase Solyc01g104010.2.1 AT1G22030 BPS1-like protein NA F2E2.8 Solyc01g104020.2.1 AT2G41475 Embryo-specific protein 3, (ATS3) EMBRYO-SPECIFIC PROTEIN 3A (ATS3A) Embryo-specific 3 Solyc01g104400.2.1 AT2G02850 Encodes plantacyanin one of blue copper proteins. PLANTACYANIN (ARPN) Blue copper protein Solyc01g105000.2.1 AT5G02600 Heavy metal transport/detoxification superfamily protein SODIUM POTASSIUM ROOT DEFECTIVE 1 (NAKR1) Copper chaperone Solyc01g105410.2.1 AT5G64260 EXORDIUM like 2 EXORDIUM LIKE 2 (EXL2) Os06g0220000 protein Solyc01g108240.2.1 AT4G34410 encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription REDOX RESPONSIVE TRANSCRIPTION FACTOR 1 Ethylene responsive transcription factor 2b factor family. (RRTF1) Solyc01g108320.2.1 AT1G49570 Peroxidase superfamily protein NA Peroxidase Solyc01g108910.2.1 AT2G15890 Encodes CBP1, a regulator of transcription initiation in central cell-mediated pollen tube guidance. MATERNAL EFFECT EMBRYO ARREST 14 (MEE14) COSII_At2g15890 Solyc01g109090.2.1 NA #N/A NA Unknown Protein Solyc01g109280.2.1 AT2G16090 RING/U-box superfamily protein ARIADNE 2 (ARI2) Ariadne-like ubiquitin ligase Solyc01g109480.2.1 AT1G49310 transmembrane protein NA Suspensor-specific protein Solyc01g109500.2.1 AT1G49320 Encodes USPL1, a BURP domain protein targeted to the protein storage vacuoles. UNKNOWN SEED PROTEIN LIKE 1 (USPL1) BURP domain-containing protein Solyc01g109920.2.1 AT4G39130 Dehydrin family protein NA Dehydrin Solyc01g110290.2.1 AT4G34640 Encodes squalene synthase, which converts two molecules of farnesyl diphosphate (FPP) into SQUALENE SYNTHASE 1 (SQS1) Squalene synthase squalene via an intermediate: presqualene diphosphate (PSPP). Solyc01g111630.2.1 AT1G68010 Encodes hydroxypyruvate reductase. HYDROXYPYRUVATE REDUCTASE (HPR) Glyoxylate/hydroxypyruvate reductase B Solyc01g112230.2.1 AT2G23240 AtMT4b is a member of Type 4 metallothionein (MT) genes. ARABIDOPSIS THALIANA METALLOTHIONEIN 4B PGPS/NH21 (ATMT4B) Solyc02g014860.2.1 AT5G23240 DNAJ heat shock N-terminal domain-containing protein DNA J PROTEIN C76 (DJC76) Chaperone protein DnaJ Solyc02g022900.2.1 AT2G34770 encodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell FAH1, ATFAH1 | fatty acid hydroxylase 1 Unknown Protein death. Solyc02g024070.2.1 AT2G34710 Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. PHABULOSA (PHB) Class III homeodomain-leucine zipper Solyc02g031830.1.1 AT4G19950 polyadenylate-binding protein 1-B-binding protein NA Unknown Protein Solyc02g050260.2.1 AT1G50380 Prolyl oligopeptidase family protein NA Protease II Solyc02g055370.2.1 AT4G31690 transcriptional factor B3 family protein NA Transcriptional factor B3 family protein Solyc02g062140.2.1 AT5G66200 Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, ARMADILLO REPEAT ONLY 2 (ARO2) Armadillo/beta-catenin repeat family protein anthers and ovules. Solyc02g062490.2.1 AT1G52820 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein NA 2-oxoglutarate-dependent dioxygenase Solyc02g063380.1.1 NA #N/A NA Unknown Protein Solyc02g063420.2.1 AT5G65660 hydroxyproline-rich glycoprotein family protein NA Hydroxyproline-rich glycoprotein Solyc02g063520.2.1 AT4G37790 Encodes homeobox protein HAT22, member of the HD-Zip II family. (HAT22) Homeobox-leucine zipper protein 22 Solyc02g064560.1.1 AT3G49790 Carbohydrate-binding protein NA Phloem protein Solyc02g064730.2.1 AT2G23090 Uncharacterized protein family SERF NA Expressed protein having alternate splicing products Solyc02g064830.2.1 AT2G14960 encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are (GH3.1) Indole-3-acetic acid-amido synthetase GH3.8 hypersensitive to auxin. Solyc02g067100.2.1 AT5G15510 TPX2 (targeting protein for Xklp2) protein family NA Targeting protein for Xklp2 containing protein expressed Solyc02g069490.2.1 AT3G19820 Involved in the conversion of the early brassinosteroid precursor 24-methylenecholesterol to DWARF 1 (DWF1) FAD linked oxidase domain protein campesterol. Solyc02g069510.1.1 AT1G07090 LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640) LIGHT SENSITIVE HYPOCOTYLS 6 (LSH6) Light-dependent short hypocotyls 1 Solyc02g069600.2.1 AT5G36110 member of CYP716A CYTOCHROME P45NA, FAMILY 716, SUBFAMILY A, Cytochrome P450 POLYPEPTIDE 1 (CYP716A1) 137

Solyc02g070630.2.1 AT1G17080 Ribosomal protein L18ae family NA 60S ribosomal protein L18A Solyc02g070800.2.1 NA #N/A NA Ycf23 protein Solyc02g071740.2.1 AT4G18950 Integrin-linked protein kinase family NA Protein-tyrosine kinase 6 Solyc02g071800.2.1 AT1G07650 Leucine-rich repeat transmembrane protein kinase NA Receptor like kinase, RLK Solyc02g071980.2.1 AT1G29800 RING/FYVE/PHD-type zinc finger family protein NA Actin-binding protein involved in bundling of actin filaments and endocytosis of actin cortical patches activity stimulated by Las17p contains SH3 domain similar to Rvs167p Solyc02g072210.1.1 AT2G42760 DUF1685 family protein NA Unknown Protein Solyc02g077030.2.1 AT4G18550 DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of DAD1-LIKE SEEDING ESTABLISHMENT-RELATED Lipase-like several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. LIPASE (DSEL) Solyc02g077240.2.1 AT5G54960 pyruvate decarboxylase-2 PYRUVATE DECARBOXYLASE-2 (PDC2) Pyruvate decarboxylase Solyc02g077330.2.1 AT5G45950 GDSL-motif esterase/acyltransferase/lipase. NA GDSL esterase/lipase At5g45950 Solyc02g077980.1.1 NA #N/A NA Unknown Protein Solyc02g079240.1.1 NA #N/A NA Unknown Protein Solyc02g079960.2.1 AT1G11530 Encodes a monocysteinic thioredoxin, thioredoxin in which the second cysteine of the redox site is C-TERMINAL CYSTEINE RESIDUE IS CHANGED TO Thioredoxin h replaced by a serine, with low disulfide reductase but efficient disulfide isomerase activity. The A SERINE 1 (CXXS1) mRNA is cell-to-cell mobile. Solyc02g080490.2.1 AT3G21690 MATE efflux family protein NA MATE efflux family protein expressed Solyc02g080880.2.1 AT1G11910 Encodes an aspartic proteinase that forms a heterodimer and is stable over a broad pH range (ph 3- ASPARTIC PROTEINASE A1 (APA1) Aspartic proteinase 8). Solyc02g081070.2.1 AT4G22130 STRUBBELIG-receptor family 8 STRUBBELIG-RECEPTOR FAMILY 8 (SRF8) Receptor like kinase, RLK Solyc02g081120.2.1 AT1G62360 Class I knotted-like homeodomain protein that is required for shoot apical meristem (SAM) SHOOT MERISTEMLESS (STM) Knotted-1-like homeobox protein H1 formation Solyc02g081130.1.1 AT4G22140 PHD finger family protein / bromo-adjacent homology (BAH) domain-containing protein EARLY BOLTING IN SHORT DAYS (EBS) BAH-PHD domain-containing protein Solyc02g081190.2.1 AT1G05010 Encodes 1-aminocyclopropane-1-carboxylate oxidase ETHYLENE-FORMING ENZYME (EFE) 1-aminocyclopropane-1-carboxylate oxidase Solyc02g081480.2.1 AT1G66920 Protein kinase superfamily protein NA Receptor kinase Solyc02g081570.2.1 AT1G65730 Arabidopsis thaliana metal-nicotianamine transporter YSL4 YELLOW STRIPE LIKE 7 (YSL7) Yellow stripe-like protein 2.1 Solyc02g081730.2.1 AT2G26260 Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in 3BETA-HYDROXYSTEROID- Sterol-4-alpha-carboxylate 3-dehydrogenase vitro. DEHYDROGENASE/DECARBOXYLASE ISOFORM 2 decarboxylating (3BETAHSD/D2) Solyc02g081880.2.1 AT1G30910 Molybdenum cofactor sulfurase family protein NA Molybdenum cofactor sulfurase protein-like Solyc02g082260.2.1 AT1G76490 Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate HYDROXY METHYLGLUTARYL COA REDUCTASE 1 Hydroxy-methylglutaryl-coenzyme A reductase biosynthesis and performs the first committed step in isoprenoid biosynthesis. (HMG1) Solyc02g083020.1.1 AT4G35690 hypothetical protein (DUF241) NA CM0216.330.nc protein Solyc02g083030.1.1 AT4G35690 hypothetical protein (DUF241) NA CM0216.330.nc protein Solyc02g083280.2.1 AT4G35770 Senescence-associated gene that is strongly induced by phosphate starvation. SENESCENCE 1 (SEN1) Thiosulfate sulfurtransferase/rhodanese-like domain- containing protein 1 Solyc02g083320.2.1 AT4G35785 RNA-binding (RRM/RBD/RNP motifs) family protein NA RNA-binding protein Solyc02g083520.2.1 AT3G56850 Encodes an ABA-responsive element binding protein with a bZIP domain. ABA-RESPONSIVE ELEMENT BINDING PROTEIN 3 BZIP transcription factor (AREB3) Solyc02g083790.2.1 AT4G36010 Pathogenesis-related thaumatin superfamily protein NA Thaumatin-like protein Solyc02g083860.2.1 AT3G51240 Encodes flavanone 3-hydroxylase that is coordinately expressed with chalcone synthase and FLAVANONE 3-HYDROXYLASE (F3H) Flavanone 3-hydroxylase chalcone isomerases. Regulates flavonoid biosynthesis. Solyc02g083880.2.1 AT2G18420 Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein NA Gibberellin-regulated protein 2 Solyc02g083890.2.1 AT5G66230 Chalcone-flavanone isomerase family protein NA Unknown Protein Solyc02g083950.2.1 AT2G17950 Homeobox gene controlling the stem cell pool. WUSCHEL (WUS) WUSCHEL-related homeobox-containing protein 4 Solyc02g084240.2.1 AT2G18050 encodes a structurally divergent linker histone whose gene expression is induced by dehydration and HISTONE H1-3 (HIS1-3) H1 histone-like protein ABA. Solyc02g084570.2.1 AT4G36220 encodes ferulate 5-hydroxylase (F5H). Involved in lignin biosynthesis. FERULIC ACID 5-HYDROXYLASE 1 (FAH1) Cytochrome P450 Solyc02g085150.2.1 AT4G36600 Late embryogenesis abundant (LEA) protein NA LEA-like protein Solyc02g085920.2.1 AT1G56420 antigenic heat-stable protein NA Homology to unknown gene Solyc02g086180.2.1 AT3G02580 Brassinosteroid biosynthetic enzyme, catalyzes delta7 sterol C-5 desaturation step. STEROL 1 (STE1) Sterol C-5 desaturase Solyc02g086650.2.1 AT3G01550 phosphoenolpyruvate (pep)/phosphate translocator 2 PHOSPHOENOLPYRUVATE (PEP)/PHOSPHATE Glucose-6-phosphate/phosphate translocator 2 TRANSLOCATOR 2 (PPT2) Solyc02g087120.2.1 AT3G28150 Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family . TRICHOME BIREFRINGENCE-LIKE 22 (TBL22) Leaf senescence protein-like Solyc02g087240.2.1 AT5G08530 51 kDa subunit of complex I 51 KDA SUBUNIT OF COMPLEX I (CI51) NADH-quinone oxidoreductase F subunit family protein Solyc02g087270.2.1 AT3G23880 F-box and associated interaction domains-containing protein NA F-box family protein Solyc02g087780.2.1 AT5G15140 Galactose mutarotase-like superfamily protein NA Aldose-1-epimerase-like protein Solyc02g088100.2.1 AT2G03090 member of Alpha-Expansin Gene Family. EXPANSIN A15 (EXPA15) Expansin Solyc02g088130.1.1 AT3G29034 transmembrane protein NA Unknown Protein 138

Solyc02g089080.2.1 NA #N/A NA Rapid alkalinization factor 5 Solyc02g089210.2.1 AT1G69120 Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. APETALA1 (AP1) MADS box transcription factor Solyc02g089620.2.1 AT5G38710 Methylenetetrahydrofolate reductase family protein NA Proline dehydrogenase Solyc02g090490.2.1 AT4G37050 Patatin-related phospholipase A. Expressed in the floral gynaecium and is induced by abscisic acid PATATIN-LIKE PROTEIN 4 (PLP4) Patatin-like protein 3 (ABA) or phosphate deficiency in roots. Solyc02g091700.2.1 AT5G65660 hydroxyproline-rich glycoprotein family protein NA Hydroxyproline-rich glycoprotein Solyc02g092240.2.1 AT5G67620 DUF4228 domain protein NA Os10g0352000 protein Solyc02g092290.2.1 AT5G02910 F-box/RNI-like superfamily protein NA F-box/LRR-repeat protein At5g02910 Solyc02g092480.2.1 AT2G14820 A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NAKED PINS IN YUC MUTANTS 2 (NPY2) Phototropic-responsive NPH3 family protein NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. Solyc02g092530.2.1 AT4G37560 Acetamidase/Formamidase family protein NA Formamidase Solyc02g092550.2.1 AT5G67420 Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. LOB DOMAIN-CONTAINING PROTEIN 37 (LBD37) LOB domain protein 38 Solyc02g093370.2.1 AT3G27570 Sucrase/ferredoxin-like family protein NA Sucrose cleavage protein-like Solyc02g093760.2.1 AT3G27330 zinc finger (C3HC4-type RING finger) family protein NA Tripartite motif-containing 25 Solyc02g094120.2.1 AT3G01910 Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum SULFITE OXIDASE (SOX) Sulfite oxidase cofactor. Solyc02g094280.2.1 AT3G27020 Arabidopsis thaliana metal-nicotianamine transporter YSL6 YELLOW STRIPE LIKE 6 (YSL6) Oligopeptide transporter Solyc03g005010.2.1 AT3G27180 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein NA Uncharacterized RNA methyltransferase Solyc03g005420.1.1 AT5G25260 SPFH/Band 7/PHB domain-containing membrane-associated protein family NA Flotillin domain protein Solyc03g005450.2.1 AT4G24010 encodes a protein similar to cellulose synthase CELLULOSE SYNTHASE LIKE G1 (CSLG1) Cellulose synthase Solyc03g006350.2.1 AT2G33835 Encodes a zinc finger domain FRIGIDA-ESSENTIAL 1 (FES1) Zinc finger CCCH domain-containing protein 27 Solyc03g006360.2.1 AT2G33830 Dormancy/auxin associated family protein DORMANCY ASSOCIATED GENE 2 (DRM2) Auxin-repressed protein Solyc03g006490.2.1 AT4G27450 aluminum induced protein with YGL and LRDR motifs NA Aluminum-induced protein-like Solyc03g007200.1.1 AT5G16990 molecular function has not been defined, was shown involved in oxidative stress tolerance. The NA Oxidoreductase zinc-containing alcohol dehydrogenase mRNA is cell-to-cell mobile. family Solyc03g007500.2.1 AT5G53280 An integral outer envelope membrane protein (as its homolog PDV2), component of the plastid PLASTID DIVISION1 (PDV1) Unknown Protein division machinery. Solyc03g007610.2.1 AT1G79940 J domain protein localized in ER membrane. Mutants have defective pollen germination. (ATERDJ2A) Chaperone protein dnaJ Solyc03g019820.2.1 AT1G17810 beta-tonoplast intrinsic protein (beta-TIP) mRNA, complete BETA-TONOPLAST INTRINSIC PROTEIN (BETA-TIP) Aquaporin Solyc03g020060.2.1 NA #N/A NA Proteinase inhibitor II Solyc03g020080.2.1 NA #N/A NA Proteinase inhibitor II Solyc03g025390.2.1 AT4G23420 NAD(P)-binding Rossmann-fold superfamily protein NA Retinol dehydrogenase 12 Solyc03g026020.2.1 AT5G62020 member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. HEAT SHOCK TRANSCRIPTION FACTOR B2A Heat stress transcription factor (HSFB2A) Solyc03g026070.1.1 AT4G00730 Encodes a homeodomain protein of the HD-GLABRA2 group. Involved in the accumulation of ANTHOCYANINLESS 2 (ANL2) Homeobox-leucine zipper protein ATHB-8 anthocyanin and in root development. Solyc03g031890.2.1 AT5G56550 Encodes OXIDATIVE STRESS 3 (OXS3)， involved in tolerance to heavy metals and OXIDATIVE STRESS 3 (OXS3) Cold induced protein-like oxidative stress. Solyc03g031970.2.1 AT5G37020 Encodes a member of the auxin response factor family. AUXIN RESPONSE FACTOR 8 (ARF8) Auxin response factor 8-1 Solyc03g032190.2.1 AT1G20610 Cyclin B2 CYCLIN B2;3 (CYCB2;3) Cyclin B2 Solyc03g033590.1.1 AT4G34760 SAUR-like auxin-responsive protein family SMALL AUXIN UPREGULATED RNA 5NA Auxin-induced SAUR-like protein (SAUR5NA) Solyc03g034400.2.1 AT1G71140 MATE efflux family protein NA Multidrug resistance protein mdtK Solyc03g043740.2.1 AT5G65660 hydroxyproline-rich glycoprotein family protein NA Hydroxyproline-rich glycoprotein Solyc03g044840.1.1 AT5G28780 PIF1 helicase NA Helicase-like protein Solyc03g058160.2.1 AT2G41940 Encodes a zinc finger protein containing only a single zinc finger. ZINC FINGER PROTEIN 8 (ZFP8) EPF-type Cis2-His2 zinc finger transcription factor Solyc03g063600.2.1 AT3G57550 guanylate kinase GUANYLATE KINASE (AGK2) Guanylate kinase Solyc03g081230.1.1 AT5G53730 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family NDR1/HIN1-LIKE 26 (NHL26) NHL1 Solyc03g081240.2.1 AT5G24470 Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological PSEUDO-RESPONSE REGULATOR 5 (PRR5) Pseudo response regulator events Solyc03g082370.1.1 AT5G54165 Avr9/Cf-9 rapidly elicited protein NA Avr9/Cf-9 rapidly elicited protein 65 Solyc03g082600.2.1 AT5G53560 Encodes a cytochrome b5 isoform that can be reduced by AtCBR, a cytochrome b5 reductase. CYTOCHROME B5 ISOFORM E (CB5-E) Cytochrome b5 Solyc03g082890.2.1 AT5G53490 thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 THYLAKOID LUMENAL 17.4 KDA PROTEIN (TL17) Pentapeptide repeat protein kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Solyc03g082920.2.1 AT5G42020 Luminal binding protein (BiP2) involved in polar nuclei fusion during proliferation of endosperm (BIP2) Heat shock protein nuclei. Solyc03g083000.2.1 AT2G46550 transmembrane protein NA AT2G46550 protein Solyc03g083730.1.1 AT5G62360 Plant invertase/pectin methylesterase inhibitor superfamily protein NA Pectinesterase Solyc03g083770.1.1 AT5G62360 Plant invertase/pectin methylesterase inhibitor superfamily protein NA Pectinesterase Solyc03g093140.2.1 AT3G47420 Encodes a Pi starvation-responsive protein AtPS3. GLYCEROL-3-PHOSPHATE PERMEASE 1 (G3Pp1) MFS family major facilitator transporter glycerol-3- phosphate cation symporter Solyc03g095370.2.1 NA #N/A NA Unknown Protein 139

Solyc03g096660.1.1 AT5G06060 NAD(P)-binding Rossmann-fold superfamily protein NA Dehydrogenase/reductase SDR family member 4 Solyc03g096730.2.1 AT2G39770 Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. CYTOKINESIS DEFECTIVE 1 (CYT1) GDP-D-mannose pyrophosphorylase 1 Solyc03g096760.1.1 AT5G24660 response to low sulfur 2 RESPONSE TO LOW SULFUR 2 (LSU2) Unknown Protein Solyc03g096880.2.1 AT3G21295 Tudor/PWWP/MBT superfamily protein NA Unknown Protein Solyc03g096900.2.1 AT1G54130 This gene appears to be at least partially redundant with RSH2 (At3g14050). RELA/SPOT HOMOLOG 3 (RSH3) GTP pyrophosphokinase Solyc03g096930.2.1 AT3G16090 Encodes one of the Arabidopsis homologs of the yeast/human Hrd1 protein: AT3G16090 (Hrd1A), HOMOLOG OF YEAST HRD1 (Hrd1A) RING finger protein AT1G65040 (Hrd1B). Involved in ERAD (Endoplasmic reticulum-associated degradation). Solyc03g096940.2.1 AT3G03100 NADH:ubiquinone oxidoreductase, 17.2kDa subunit NA NADH ubiquinone oxidoreductase subunit Solyc03g096960.2.1 AT1G08580 hypothetical protein NA Pm52 protein Solyc03g096990.2.1 AT1G64940 member of CYP89A CYTOCHROME P45NA, FAMILY 87, SUBFAMILY A, Cytochrome P450 89A2 POLYPEPTIDE 6 (CYP89A6) Solyc03g097010.2.1 AT3G03070 NADH-ubiquinone oxidoreductase-like protein NA NADH dehydrogenase Solyc03g097030.2.1 AT1G65060 encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the 4-COUMARATE:COA LIGASE 3 (4CL3) 4-coumarate CoA ligase general phenylpropanoid pathway. Solyc03g097060.2.1 AT5G16890 Exostosin family protein NA Exostosin family protein Solyc03g097150.2.1 AT5G16760 Encodes a inositol 1,3,4-trisphosphate 5/6-kinase. INOSITOL (1,3,4) P3 5/6-KINASE 1 (ITPK1) Inositol-tetrakisphosphate 1-kinase 1 Solyc03g097230.1.1 AT3G02910 AIG2-like (avirulence induced gene) family protein NA Protein containing AIG2-like domain Solyc03g098010.2.1 AT3G17790 Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and PURPLE ACID PHOSPHATASE 17 (PAP17) Acid phosphatase not phosphite (Phi) in roots and shoots. Solyc03g098710.1.1 AT1G17860 Kunitz family trypsin and protease inhibitor protein NA Kunitz-type proteinase inhibitor A4 Solyc03g098730.1.1 AT1G17860 Kunitz family trypsin and protease inhibitor protein NA Kunitz trypsin inhibitor Solyc03g098790.1.1 AT1G73325 Kunitz family trypsin and protease inhibitor protein NA Kunitz-type protease inhibitor Solyc03g111140.2.1 AT5G03860 Encodes a protein with malate synthase activity. MALATE SYNTHASE (MLS) Malate synthase Solyc03g111410.2.1 AT3G53310 AP2/B3-like transcriptional factor family protein NA B3 domain-containing protein Os01g0905400 Solyc03g111640.2.1 AT5G63190 MA3 domain-containing protein NA Eukaryotic translation initiation factor 4 gamma 2 Solyc03g111710.2.1 AT5G63160 BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by BTB AND TAZ DOMAIN PROTEIN 1 (bt1) Speckle-type POZ protein the 26S proteosome pathway. Solyc03g111820.2.1 AT3G01680 Encodes a protein localized to phloem filaments that is required for phloem filament formation. SIEVE-ELEMENT-OCCLUSION-RELATED 1 (SEOR1) Sieve element-occluding protein 3 Solyc03g112540.2.1 AT5G50130 NAD(P)-binding Rossmann-fold superfamily protein NA Retinol dehydrogenase 12 Solyc03g112590.2.1 AT5G03340 ATPase, AAA-type, CDC48 protein CELL DIVISION CYCLE 48C (ATCDC48C) Cell division protease ftsH homolog Solyc03g113620.2.1 AT1G74840 Homeodomain-like superfamily protein NA MYB transcription factor Solyc03g113800.2.1 AT1G74920 ALDH10A8 encodes a protein that has not been functionally characterized ALDEHYDE DEHYDROGENASE 1NAA8 Betaine aldehyde dehydrogenase (ALDH1NAA8) Solyc03g114090.1.1 AT5G40250 RING/U-box superfamily protein NA RING finger protein Solyc03g115650.2.1 AT1G69410 Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding EUKARYOTIC ELONGATION FACTOR 5A-3 (ELF5A- Eukaryotic translation initiation factor 5A genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. 3) Solyc03g115990.1.1 AT3G47520 Encodes a protein with NAD-dependent malate dehydrogenase activity, located in chloroplasts MALATE DEHYDROGENASE (MDH) Malate dehydrogenase Solyc03g116390.2.1 AT3G15670 Late embryogenesis abundant protein (LEA) family protein LATE EMBRYOGENESIS ACCUMULATING 76 Late embryogenesis abundant protein (LEA76) Solyc03g116520.1.1 AT1G15385 unknown protein,Protein of unknown function DUF761 NA Unknown Protein Solyc03g116670.2.1 AT5G20190 Tetratricopeptide repeat (TPR)-like superfamily protein NA TPR domain protein Solyc03g116870.2.1 AT1G15980 encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic PHOTOSYNTHETIC NDH SUBCOMPLEX B 1 (PnsB1) Glycosyl transferase family 9 electron flow around photosystem I to produce ATP. Solyc03g117230.1.1 AT1G80580 encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription NA Ethylene responsive transcription factor 12 factor family. Solyc03g117440.2.1 AT5G51280 DEAD-box protein abstrakt NA ATP dependent RNA helicase Solyc03g118890.2.1 AT1G18030 Protein phosphatase 2C family protein NA Serine/threonine phosphatase family protein Solyc03g120500.2.1 AT4G29080 phytochrome-associated protein 2 (PAP2) PHYTOCHROME-ASSOCIATED PROTEIN 2 (PAP2) Auxin responsive protein Solyc03g120690.2.1 AT3G16120 Dynein light chain type 1 family protein NA Dynein light chain 1 cytoplasmic Solyc03g121010.2.1 NA #N/A NA Unknown Protein Solyc03g121090.2.1 AT5G56550 Encodes OXIDATIVE STRESS 3 (OXS3)， involved in tolerance to heavy metals and OXIDATIVE STRESS 3 (OXS3) Cold induced protein-like oxidative stress. Solyc03g121850.2.1 AT1G05950 hypothetical protein NA Aleurone layer morphogenesis protein Solyc03g121970.1.1 AT1G54200 DNA mismatch repair Msh6-like protein NA Unknown Protein Solyc03g123390.2.1 AT1G17430 alpha/beta-Hydrolases superfamily protein NA Hydrolase Solyc03g123430.2.1 AT1G72570 Integrase-type DNA-binding superfamily protein NA AP2-like ethylene-responsive transcription factor At1g16060 Solyc03g123540.2.1 AT1G54050 HSP20-like chaperones superfamily protein NA class II heat shock protein Solyc03g123710.2.1 NA #N/A NA Unknown Protein Solyc04g005070.2.1 AT1G52190 Encodes a low affinity nitrate transporter NRT1/ PTR FAMILY 1.2 (NPF1.2) Peptide transporter 140

Solyc04g005250.2.1 AT5G15380 Encodes methyltransferase DOMAINS REARRANGED METHYLASE 1 (DRM1) DNA Solyc04g005380.2.1 AT1G69260 ABI five binding protein ABI FIVE BINDING PROTEIN (AFP1) Ninja-family protein Os03g0214200 Solyc04g007470.2.1 AT1G68190 B-box zinc finger family protein B-BOX DOMAIN PROTEIN 27 (BBX27) CONSTANS-like zinc finger protein Solyc04g007690.2.1 AT1G70940 A regulator of auxin efflux and involved in differential growth. PIN-FORMED 3 (PIN3), SlPIN3 Auxin efflux carrier Solyc04g007950.2.1 AT2G01660 Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules PLASMODESMATA-LOCATED PROTEIN 6 (PDLP6) Cysteine-rich repeat secretory protein 12 through the plasmodesmata. Solyc04g007970.2.1 AT1G70660 MMZ2/UEV1B encodes a protein that may play a role in DNA damage responses and error-free MMS ZWEI HOMOLOGUE 2 (MMZ2) Ubiquitin-conjugating enzyme E2 variant 1 post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. Solyc04g008330.1.1 AT3G53160 UDP-glucosyl transferase 73C7 UDP-GLUCOSYL TRANSFERASE 73C7 (UGT73C7) Glucosyltransferase Solyc04g009900.2.1 AT1G08650 Encodes a phosphoenolpyruvate carboxylase kinase that is expressed at highest levels in leaves. PHOSPHOENOLPYRUVATE CARBOXYLASE KINASE Calcium-dependent protein kinase 2 Expression is induced by light. 1 (PPCK1) Solyc04g011350.2.1 AT3G55410 2-oxoglutarate dehydrogenase, E1 component NA 2-oxoglutarate dehydrogenase E1 component Solyc04g011430.2.1 AT3G46460 ubiquitin-conjugating enzyme 13 UBIQUITIN-CONJUGATING ENZYME 13 (UBC13) Ubiquitin-conjugating enzyme 13 E2 Solyc04g011530.2.1 AT2G20390 cytochrome oxidase complex assembly protein NA Os04g0129600 protein Solyc04g011550.2.1 NA #N/A NA Unknown Protein Solyc04g011770.2.1 NA #N/A NA Unknown Protein Solyc04g014480.2.1 AT5G37670 HSP20-like chaperones superfamily protein NA class I heat shock protein 3 Solyc04g014520.1.1 AT1G55230 proteinase inhibitor I4, serpin (DUF716) NA Plant viral-response family protein Solyc04g014730.2.1 AT1G12050 Encodes a fumarylacetoacetase that converts fumarylacetoacetate to acetoacetate and fumarate and FUMARYLACETOACETATE HYDROLASE (FAH) Fumarylacetoacetase is likely to be involved in tyrosine catabolism. Solyc04g014830.1.1 AT4G17230 Encodes a scarecrow-like protein (SCL13). Member of GRAS gene family. SCARECROW-LIKE 13 (SCL13) GRAS family transcription factor Solyc04g015200.2.1 AT5G47810 phosphofructokinase 2 PHOSPHOFRUCTOKINASE 2 (PFK2) 6-phosphofructokinase 2 Solyc04g015620.2.1 AT2G41810 imidazolonepropionase (Protein of unknown function, DUF642) NA Os01g0611000 protein Solyc04g016120.2.1 NA #N/A NA Unknown Protein Solyc04g016180.2.1 AT2G41640 Glycosyltransferase family 61 protein NA Glycosyltransferase Solyc04g025610.1.1 NA #N/A NA Unknown Protein Solyc04g040220.2.1 AT2G41370 Encodes BOP2, a cytoplasmic and nuclear-localized NPR1 like protein with BTB/POZ domain and BLADE ON PETIOLE2 (BOP2) NPR1-like protein ankyrin repeats. Solyc04g049920.2.1 AT3G54770 Encodes a putative RNA binding protein that is localized in the nucleus and affects ABA-regulated ABA-REGULATED RNA-BINDING PROTEIN 1 (ARP1) RNA binding protein-like seed germination of Arabidopsis. Solyc04g051280.2.1 AT1G65090 nucleolin NA F16G16.9 protein Solyc04g051350.2.1 AT2G21790 encodes large subunit of ribonucleotide reductase RIBONUCLEOTIDE REDUCTASE 1 (RNR1) Ribonucleoside-diphosphate reductase Solyc04g054340.1.1 AT5G65207 hypothetical protein NA Unknown Protein Solyc04g054740.2.1 AT5G10170 myo-inositol-1-phosphate synthase isoform 3. MYO-INOSITOL-1-PHOSPHATE SYNTHASE 3 (MIPS3) Inositol-3-phosphate synthase Solyc04g054990.2.1 AT4G39730 Lipase/lipooxygenase, PLAT/LH2 family protein PLAT DOMAIN PROTEIN 1 (PLAT1) Lipoxygenase homology domain-containing protein 1 Solyc04g056610.2.1 AT5G55610 isopentenyl-diphosphate delta-isomerase NA Genomic DNA chromosome 5 P1 clone MDF20 Solyc04g064620.2.1 AT1G21460 Nodulin MtN3 family protein (SWEET1) RAG1-activating protein 1 homolog Solyc04g070980.2.1 AT2G07050 Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to CYCLOARTENOL SYNTHASE 1 (CAS1) Lanosterol synthase cycloartenol. Solyc04g071360.2.1 AT1G76890 encodes a plant trihelix DNA-binding protein (GT2) Transcription factor Solyc04g071660.2.1 NA #N/A NA Unknown Protein Solyc04g071900.2.1 AT1G71695 Peroxidase superfamily protein NA Peroxidase Solyc04g072880.2.1 AT5G27620 core cell cycle genes The mRNA is cell-to-cell mobile. CYCLIN H;1 (CYCH;1) RNA polymerase II holoenzyme cyclin-like subunit Solyc04g074730.1.1 NA #N/A NA Unknown Protein Solyc04g075000.1.1 AT1G28390 Protein kinase superfamily protein NA Serine/threonine protein kinase Solyc04g076090.1.1 AT4G24620 The PGI1 gene encodes the plastid phospho-glucose (Glc) isomerase. PHOSPHOGLUCOSE ISOMERASE 1 (PGI1) Glucose-6-phosphate isomerase 2 Solyc04g076100.2.1 AT4G24610 pesticidal crystal cry8Ba protein NA Genomic DNA chromosome 5 P1 clone MNA5 Solyc04g077150.2.1 AT1G10030 ergosterol biosynthesis protein HOMOLOG OF YEAST ERGOSTEROL28 (ERG28) Erg28 like protein expressed Solyc04g077490.2.1 AT4G37750 ANT is required for control of cell proliferation and encodes a putative transcriptional regulator AINTEGUMENTA (ANT) AP2-like ethylene-responsive transcription factor similar to AP2. At1g16060 Solyc04g078060.1.1 AT1G75810 transmembrane protein NA Small hydrophobic protein Solyc04g078200.2.1 AT5G59845 Gibberellin-regulated family protein NA Gibberellin-regulated family protein Solyc04g078880.2.1 AT5G42900 cold regulated protein 27 COLD REGULATED GENE 27 (COR27) Genomic DNA chromosome 5 P1 clone MBD2 Solyc04g079130.2.1 AT5G42700 AP2/B3-like transcriptional factor family protein NA B3 domain-containing protein At5g42700 Solyc04g079570.1.1 AT3G50410 Arabidopsis Dof protein containing a single 51-amino acid zinc finger DNA-binding domain OBF BINDING PROTEIN 1 (OBP1) Dof zinc finger protein Solyc04g079860.1.1 AT3G50760 Encodes a protein with putative galacturonosyltransferase activity. The mRNA is cell-to-cell GALACTURONOSYLTRANSFERASE-LIKE 2 (GATL2) Glycosyltransferase family GT8 protein mobile.

141

Solyc04g080040.2.1 AT1G75100 Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin- J-DOMAIN PROTEIN REQUIRED FOR CHLOROPLAST UBA/TS-N domain protein uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. ACCUMULATION RESPONSE 1 (JAC1) Solyc04g080130.2.1 AT3G50700 zinc finger protein, similar to maize Indeterminate1 (ID1) INDETERMINATE(ID)-DOMAIN 2 (IDD2) Zinc finger protein Solyc04g080300.2.1 AT1G75180 Erythronate-4-phosphate dehydrogenase family protein NA 2-hydroxyacid dehydrongenase Solyc04g080660.2.1 AT1G19640 Encodes a S-adenosyl-L-methionine:jasmonic acid carboxyl methyltransferase that catalyzes the JASMONIC ACID CARBOXYL Carboxyl methyltransferase 4 formation of methyljasmonate from jasmonic acid. METHYLTRANSFERASE (JMT) Solyc04g082050.2.1 AT4G35750 SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein NA Cellular retinaldehyde-binding/triple function C- terminal Solyc04g082060.2.1 AT2G17030 F-box SKIP23-like protein (DUF295) NA F-box family protein Solyc04g082100.1.1 NA #N/A NA Unknown Protein Solyc04g082200.2.1 AT1G20450 Encodes a gene induced by low temperature and dehydration. EARLY RESPONSIVE TO DEHYDRATION 1NA Dehydrin (ERD1NA) Solyc04g082740.2.1 AT1G20870 Encodes an anti-silencing factor that prevents gene repression and DNA hypermethylation. INCREASED DNA METHYLATION 3 (IDM3) Heat shock protein-like protein Solyc04g082820.2.1 AT1G76510 ARID/BRIGHT DNA-binding domain-containing protein NA ARID/BRIGHT DNA-binding domain-containing protein Solyc05g005160.2.1 AT1G60810 One of the three genes encoding subunit A of the trimeric enzyme ATP Citrate lyase ATP-CITRATE LYASE A-2 (ACLA-2) ATP-citrate lyase A-2 Solyc05g005570.2.1 AT1G70370 polygalacturonase 2 POLYGALACTURONASE 2 (PG2) BURP domain-containing protein Solyc05g005920.2.1 AT1G52190 Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the NRT1/ PTR FAMILY 1.2 (NPF1.2) Peptide transporter phloem of the major veins of leaves. Solyc05g005950.2.1 AT1G52190 Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the NRT1/ PTR FAMILY 1.2 (NPF1.2) Solute carrier family 15 member 4 phloem of the major veins of leaves. Solyc05g005960.2.1 AT1G52190 Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the NRT1/ PTR FAMILY 1.2 (NPF1.2) Peptide transporter 1 phloem of the major veins of leaves. Solyc05g005980.2.1 AT1G52190 Encodes a low affinity nitrate transporter NRT1/ PTR FAMILY 1.2 (NPF1.2) Solute carrier family 15 member 4 Solyc05g006160.2.1 AT5G14920 Encodes a GASA domain containing protein that regulates increases in plant growth through GA- A-STIMULATED IN ARABIDOPSIS 14 (GASA14) Gibberellin-regulated protein 2 induced and DELLA-dependent signal transduction Solyc05g006740.2.1 AT1G10370 Encodes GSTU17 (Glutathione S-Transferase U17). . EARLY-RESPONSIVE TO DEHYDRATION 9 (ERD9) Glutathione S-transferase Solyc05g006820.2.1 AT1G10350 DNAJ heat shock family protein NA Chaperone protein dnaJ 2 Solyc05g007150.2.1 AT1G14360 UDP-galactose transporter 3 UDP-GALACTOSE TRANSPORTER 3 (UTR3) UDP-galactose transporter 3 Solyc05g008120.2.1 AT1G71000 Chaperone DnaJ-domain superfamily protein NA Chaperone protein dnaJ Solyc05g008140.2.1 NA #N/A NA Unknown Protein Solyc05g009310.2.1 AT1G25440 B-box type zinc finger protein with CCT domain-containing protein B-BOX DOMAIN PROTEIN 15 (BBX15) Zinc finger protein CONSTANS-LIKE 16 Solyc05g009420.1.1 AT1G68440 transmembrane protein NA Unknown Protein Solyc05g010260.2.1 AT3G02360 6-phosphogluconate dehydrogenase family protein 6-PHOSPHOGLUCONATE DEHYDROGENASE 2 6-phosphogluconate dehydrogenase decarboxylating (PGD2) Solyc05g013460.2.1 AT1G12950 root hair specific 2 ROOT HAIR SPECIFIC 2 (RHS2) Multidrug resistance protein mdtK Solyc05g014000.2.1 AT1G67750 Pectate lyase family protein NA Pectate lyase Solyc05g014260.2.1 AT1G67710 Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B RESPONSE REGULATOR 11 (ARR11) Response regulator 11 ARRs in the cytokinin signaling pathway. Solyc05g014280.2.1 AT4G27670 Encodes Hsp21, a chloroplast located small heat shock protein. HEAT SHOCK PROTEIN 21 (HSP21) Heat shock protein Solyc05g014470.2.1 AT1G13440 The expression level of GAPC-2 is upregulated in Arabidopsis seedlings exposed to cadmium. GLYCERALDEHYDE-3-PHOSPHATE Glyceraldehyde 3-phosphate dehydrogenase DEHYDROGENASE C2 (GAPC2) Solyc05g015390.2.1 AT1G67360 Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue LD-ASSOCIATED PROTEIN 1 (LDAP1) REF-like stress related protein 1 growth and development and in drought stress responses. Solyc05g015420.2.1 AT1G67340 HCP-like superfamily protein with MYND-type zinc finger NA MYND finger family protein expressed Solyc05g015750.2.1 AT1G24260 Member of the MADs box transcription factor family. SEP3 is redundant with SEP1 and 2. SEPALLATA3 (SEP3) Transcription factor MADS-box 2 Solyc05g017760.2.1 AT5G48230 Encodes an acetoacetyl-CoA thiolase ACETOACETYL-COA THIOLASE 2 (ACAT2) Acetyl-CoA C-acetyltransferase Solyc05g024160.2.1 AT5G50850 Transketolase family protein MACCI-BOU (MAB1) Pyruvate dehydrogenase E1 component subunit beta Solyc05g025820.2.1 AT2G05940 Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4 RPM1-INDUCED PROTEIN KINASE (RIPK) ATP binding / serine-threonine kinase Solyc05g032680.2.1 AT2G30650 ATP-dependent caseinolytic (Clp) protease/crotonase family protein NA Enoyl-CoA-hydratase Solyc05g045670.2.1 AT1G61800 glucose6-Phosphate/phosphate transporter 2. GLUCOSE-6-PHOSPHATE/PHOSPHATE Glucose-6-phosphate/phosphate translocator 2 TRANSLOCATOR 2 (GPT2) Solyc05g046270.2.1 AT5G54585 hypothetical protein NA Unknown Protein Solyc05g051330.1.1 AT5G28040 DNA-binding storekeeper protein-related transcriptional regulator NA Transcription regulator Solyc05g052030.1.1 AT5G07580 encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription (ERF1NA6) Ethylene responsive transcription factor 1a factor family. Solyc05g052240.2.1 AT5G05270 Chalcone-flavanone isomerase family protein CHALCONE ISOMERASE LIKE (CHIL) Chalcone--flavonone isomerase Solyc05g052940.2.1 AT5G02060 Uncharacterized protein family (UPF0497) CASP-LIKE PROTEIN 5B1 (CASPL5B1) UPF0497 membrane protein At5g02060 Solyc05g053160.2.1 AT1G04560 AWPM-19-like family protein NA Plasma membrane associated protein 142

Solyc05g053490.2.1 AT3G24040 Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein NA Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6- N-acetylglucosaminyltransferase 7 Solyc05g053890.1.1 AT5G12890 UDP-Glycosyltransferase superfamily protein NA Glucosyltransferase-like protein Solyc05g054320.2.1 AT4G02340 alpha/beta-Hydrolases superfamily protein NA Epoxide hydrolase Solyc05g054340.2.1 AT1G59780 NB-ARC domain-containing disease resistance protein NA Cc-nbs-lrr, resistance protein Solyc05g054350.2.1 AT4G02340 alpha/beta-Hydrolases superfamily protein NA Epoxide hydrolase Solyc05g054840.2.1 NA #N/A NA Chromosome 21 open reading frame 59 Solyc05g055010.2.1 AT3G04500 RNA-binding (RRM/RBD/RNP motifs) family protein NA RNA-binding protein Solyc05g055240.2.1 AT5G04760 Duplicated homeodomain-like superfamily protein NA Myb family transcription factor Solyc05g056110.2.1 AT5G13570 Encodes DCP2 with mRNA decapping activity. DECAPPING 2 (DCP2) mRNA-decapping enzyme 2 Solyc05g056170.2.1 AT3G53260 Encodes phenylalanine lyase. PHENYLALANINE AMMONIA-LYASE 2 (PAL2) Phenylalanine ammonia-lyase Solyc05g056390.2.1 AT1G23100 GroES-like family protein NA chaperonin Solyc06g005160.2.1 AT1G07890 Encodes a cytosolic ascorbate peroxidase APX1. ASCORBATE PEROXIDASE 1 (APX1) Ascorbate peroxidase Solyc06g005390.1.1 AT2G28720 Histone superfamily protein NA Histone H2B Solyc06g005750.2.1 AT1G07420 Arabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA. STEROL 4-ALPHA-METHYL-OXIDASE 2-1 (SMO2-1) Sterol 4-alpha-methyl-oxidase 2 Solyc06g006000.2.1 AT4G37300 maternal effect embryo arrest 59 MATERNAL EFFECT EMBRYO ARREST 59 (MEE59) Unknown Protein Solyc06g007180.2.1 AT3G47340 encodes a glutamine-dependent asparagine synthetase GLUTAMINE-DEPENDENT ASPARAGINE SYNTHASE Asparagine synthase 1 (ASN1) Solyc06g007440.2.1 AT2G30360 Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family. SOS3-INTERACTING PROTEIN 4 (SIP4) CBL-interacting protein kinase 16 Solyc06g007580.1.1 AT3G07350 sulfate/thiosulfate import ATP-binding protein, putative (DUF506) NA Plant-specific domain TIGR01615 family protein Solyc06g008980.2.1 AT4G02800 GRIP/coiled-coil protein (MADA1) Unknown Protein Solyc06g009020.2.1 AT2G47730 Encodes glutathione transferase belonging to the phi class of GSTs. GLUTATHIONE S-TRANSFERASE PHI 8 (GSTF8) Glutathione S-transferase Solyc06g009380.2.1 AT5G62960 UDP-N-acetylglucosamine-N-acetylmuramyl-pyrophosphoryl-undecaprenol N-acetylglucosamine NA mRNA clone RAFL24-05-D16 protein Solyc06g036290.2.1 AT5G52640 Encodes a cytosolic heat shock protein AtHSP90.1. AtHSP90.1 interacts with disease resistance HEAT SHOCK PROTEIN 9NA.1 (HSP9NA.1) Heat shock protein 90 signaling components SGT1b and RAR1 and is required for RPS2-mediated resistance. The mRNA is cell-to-cell mobile. Solyc06g048960.2.1 AT3G03300 Encodes a Dicer-like protein that functions in the antiviral silencing response in turnip-crinkle virus- DICER-LIKE 2 (DCL2) Ribonuclease 3-like protein 3 infected plants but not in TMV or CMV-strain-Y-infected plants. Solyc06g050130.2.1 AT3G56310 Melibiase family protein NA Alpha-galactosidase-like protein Solyc06g050600.2.1 AT5G01660 influenza virus NS1A-binding protein NA Kelch-like protein Solyc06g050930.2.1 AT3G11040 Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENDO-BETA-N-ACETYGLUCOSAMINIDASE 85B Endo beta n-acetylglucosaminidase (ENGase85B) Solyc06g051680.1.1 AT2G40080 Encodes a novel nuclear 111 amino-acid phytochrome-regulated component of a negative feedback EARLY FLOWERING 4 (ELF4) ELF4-like protein loop involving the circadian clock central oscillator components CCA1 and LHY. Solyc06g053830.2.1 AT3G23050 Transcription regulator acting as repressor of auxin-inducible gene expression. INDOLE-3-ACETIC ACID 7 (IAA7) Auxin responsive protein Solyc06g053910.2.1 AT3G22970 hypothetical protein (DUF506) NA Plant-specific domain TIGR01615 family protein Solyc06g054640.1.1 AT2G38820 DNA-directed RNA polymerase subunit beta-beta protein, putative (DUF506) NA Plant-specific domain TIGR01615 family protein Solyc06g059740.1.1 AT1G77120 Catalyzes the reduction of acetaldehyde using NADH as reductant. ALCOHOL DEHYDROGENASE 1 (ADH1) Alcohol dehydrogenase 2 Solyc06g059930.2.1 AT3G14520 Encodes a sesterterpene synthase responsible for the biosynthesis of the tricyclic sesterterpene (+)- TERPENE SYNTHASE 18 (TPS18) Sesquiterpene synthase 1 thalianatriene with a 11-6-5 fused ring system. Solyc06g060010.2.1 AT5G23960 Encodes a sesquiterpene synthase involved in generating all of the group A sesquiterpenes found in TERPENE SYNTHASE 21 (TPS21) Alpha-humulene/ the Arabidopsis floral volatile blend. Solyc06g060610.2.1 AT1G62620 Flavin-binding monooxygenase family protein NA Flavin-containing monooxygenase family protein Solyc06g061240.2.1 AT4G17900 PLATZ transcription factor family protein NA Zinc-binding family protein Solyc06g062680.1.1 AT4G34110 Putative poly-A binding protein. POLY(A) BINDING PROTEIN 2 (PAB2) Polyadenylate-binding protein 2 Solyc06g065030.2.1 AT1G10950 Encodes an Arabidopsis Transmembrane nine (TMN) protein. TRANSMEMBRANE NINE 1 (TMN1) Transmembrane 9 superfamily protein member 3 Solyc06g065050.1.1 AT1G72100 late embryogenesis abundant domain-containing protein / LEA domain-containing protein NA Transmembrane protein 205 Solyc06g065360.2.1 AT1G35660 erythroid differentiation factor-like protein NA Erythroid differentiation-related factor 1-like protein Solyc06g065630.2.1 AT5G11320 Belongs to the YUC gene family. Encodes a predicted flavin monooxygenase YUC4 involved in YUCCA4 (YUC4) Monooxygenase auxin biosynthesis and plant development. Solyc06g065970.1.1 AT2G45180 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein NA Cortical cell-delineating protein Solyc06g066420.2.1 AT5G56550 Encodes OXIDATIVE STRESS 3 (OXS3)， involved in tolerance to heavy metals and OXIDATIVE STRESS 3 (OXS3) Cold induced protein-like oxidative stress. Solyc06g067980.2.1 NA #N/A NA Unknown Protein Solyc06g068160.2.1 AT1G15330 Cystathionine beta-synthase (CBS) protein NA 5&apos-AMP-activated protein kinase subunit gamma-3 Solyc06g068270.2.1 AT1G49390 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein NA 1-aminocyclopropane-1-carboxylate oxidase 1 Solyc06g068500.2.1 AT1G80920 A nuclear encoded soluble protein found in the chloroplast stroma. (J8) Chaperone protein DnaJ 1 143

Solyc06g068680.2.1 AT5G47910 NADPH/respiratory burst oxidase protein D (RbohD). RESPIRATORY BURST OXIDASE HOMOLOGUE D Respiratory burst oxidase-like protein (RBOHD) Solyc06g069120.2.1 AT1G68490 translocase subunit seca NA Unknown Protein Solyc06g069630.2.1 AT1G13940 T-box transcription factor, putative (DUF863) NA Unknown Protein Solyc06g069730.2.1 AT3G47470 Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII LIGHT-HARVESTING CHLOROPHYLL-PROTEIN Chlorophyll a-b binding protein 4, chloroplastic cab proteins. COMPLEX I SUBUNIT A4 (LHCA4) Solyc06g069790.2.1 AT1G74670 Gibberellin-regulated family protein GA-STIMULATED ARABIDOPSIS 6 (GASA6) Gibberellin-regulated protein Solyc06g071890.2.1 AT5G20090 Uncharacterized protein family (UPF0041) MITOCHONDRIAL PYRUVATE CARRIER 1 (MPC1) Brain protein 44-like protein Solyc06g072840.2.1 AT3G03150 hypothetical protein NA Seed specific protein Bn15D1B Solyc06g073190.2.1 AT3G59480 pfkB-like carbohydrate kinase family protein FRUCTOKINASE 4 (FRK4) Fructokinase-like Solyc06g073350.2.1 AT2G31500 member of Calcium Dependent Protein Kinase CALCIUM-DEPENDENT PROTEIN KINASE 24 (CPK24) Calcium-dependent protein kinase 2 Solyc06g074060.1.1 AT2G27250 #N/A NA Unknown Protein Solyc06g074090.2.1 AT1G50430 Mutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a DWARF 5 (DWF5) Sterol reductase dwarf phenotype. Solyc06g074110.2.1 AT2G27230 Encodes a nuclear-localized transcriptional activator LONESOME HIGHWAY (LHW) Uncharacterized basic helix-loop-helix protein At1g64625 Solyc06g074390.2.1 AT4G33790 Encodes an alcohol-forming fatty acyl-CoA reductase ECERIFERUM 4 (CER4) Fatty acyl coA reductase Solyc06g074530.1.1 AT1G08250 Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. AROGENATE DEHYDRATASE 6 (ADT6) Prephenate dehydratase Solyc06g074750.1.1 AT1G08170 Histone superfamily protein NA Histone H2B Solyc06g075170.1.1 AT5G60680 transcription initiation factor TFIID subunit (Protein of unknown function, DUF584) NA Arabidopsis thaliana genomic DNA chromosome 5 P1 clone MOK16 Solyc06g075520.2.1 AT1G75270 dehydroascorbate reductase 2 DEHYDROASCORBATE REDUCTASE 2 (DHAR2) Dehydroascorbate reductase 1 Solyc06g075540.2.1 AT3G45740 hydrolase family protein / HAD-superfamily protein NA Phosphatidyl synthase Solyc06g075550.2.1 AT1G07870 Protein kinase superfamily protein NA Serine/threonine kinase Solyc06g075580.2.1 AT3G45850 P-loop containing nucleoside triphosphate hydrolases superfamily protein NA Kinesin-5 Solyc06g076020.2.1 AT5G02500 encodes a member of heat shock protein 70 family. HEAT SHOCK COGNATE PROTEIN 7NA-1 (HSC7NA- heat shock protein 1) Solyc06g076210.1.1 AT1G13790 Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA FACTOR OF DNA METHYLATION 4 (FDM4) X1 methylation Solyc06g076280.1.1 AT1G07530 Encodes a member of the GRAS family of transcription factors. SCARECROW-LIKE 14 (SCL14) GRAS family transcription factor Solyc06g076320.1.1 AT5G59510 ROTUNDIFOLIA like 5 ROTUNDIFOLIA LIKE 5 (RTFL5) DVL13 Solyc06g076400.2.1 AT2G29380 highly ABA-induced PP2C protein 3 HIGHLY ABA-INDUCED PP2C GENE 3 (HAI3) Protein phosphatase 2C Solyc06g082070.2.1 AT5G58600 Belongs to a large family of plant-specific genes of unknown function. POWDERY MILDEW RESISTANT 5 (PMR5) Os06g0207500 protein Solyc06g083040.2.1 AT4G12910 serine carboxypeptidase-like 20 SERINE CARBOXYPEPTIDASE-LIKE 2NA (scpl2NA) Serine carboxypeptidase 1 Solyc06g083270.2.1 AT3G25160 ER lumen protein retaining receptor family protein NA ER lumen retaining receptor family-like protein Solyc07g005440.1.1 AT4G30960 Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. SOS3-INTERACTING PROTEIN 3 (SIP3) CBL-interacting protein kinase 9 Solyc07g005710.2.1 AT2G24030 #N/A NA Unknown Protein Solyc07g005760.2.1 AT5G48930 At5g48930 has been shown to encode for the hydroxycinnamoyl-Coenzyme A shikimate/quinate HYDROXYCINNAMOYL-COA SHIKIMATE/QUINATE Hydroxycinnamoyl CoA shikimate/quinate hydroxycinnamoyltransferase (HCT) both synthesizing and catabolizing the HYDROXYCINNAMOYL TRANSFERASE (HCT) hydroxycinnamoyltransferase hydroxycinnamoylesters (coumaroyl/caffeoyl shikimate and quinate) involved in the phenylpropanoid pathway. Solyc07g006500.2.1 AT2G18700 Encodes an enzyme putatively involved in trehalose biosynthesis. TREHALOSE PHOSPHATASE/SYNTHASE 11 (TPS11) Alpha alpha-trehalose-phosphate synthase Solyc07g006550.2.1 NA #N/A NA Unknown Protein Solyc07g006570.2.1 AT1G26820 Encodes ribonuclease RNS3. RIBONUCLEASE 3 (RNS3) S8-RNase Solyc07g006680.1.1 AT3G26040 HXXXD-type acyl-transferase family protein NA Hydroxycinnamoyl CoA quinate transferase Solyc07g007400.2.1 AT1G15740 Leucine-rich repeat family protein NA Leucine-rich repeat-like protein Solyc07g007690.2.1 AT5G33280 Voltage-gated chloride channel family protein CHLORIDE CHANNEL G (CLCG) Voltage-gated chloride channel Solyc07g008180.2.1 AT2G26580 plant-specific transcription factor YABBY family protein YABBY5 (YAB5) YABBY-like transcription factor CRABS CLAW- like protein Solyc07g008250.2.1 AT2G25490 Encodes an F-box protein involved in the ubiquitin/proteasome-dependent proteolysis of EIN3. EIN3-BINDING F BOX PROTEIN 1 (EBF1) SCF E3 ubiquitin ligase complex F-box protein grrA Solyc07g008410.2.1 AT3G26590 MATE efflux family protein NA Multidrug and toxin extrusion protein 1 Solyc07g008570.2.1 AT5G50400 purple acid phosphatase 27 PURPLE ACID PHOSPHATASE 27 (PAP27) Purple acid phosphatase Solyc07g014670.2.1 AT5G10600 member of CYP81K CYTOCHROME P45NA, FAMILY 81, SUBFAMILY K, Cytochrome P450 POLYPEPTIDE 2 (CYP81K2) Solyc07g017780.2.1 AT2G18960 Encodes a plasma membrane proton ATPase. H(+)-ATPASE 1 (HA1) H-ATPase Solyc07g019460.2.1 AT4G30210 Encodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the P45NA REDUCTASE 2 (ATR2) Cytochrome P450 NADPH-reductase phenylpropanoid general pathway. Solyc07g032670.1.1 NA #N/A NA Unknown Protein Solyc07g040680.2.1 AT2G26150 member of Heat Stress Transcription Factor (Hsf) family. HEAT SHOCK TRANSCRIPTION FACTOR A2 (HSFA2) Heat stress transcription factor A3 144

Solyc07g041730.2.1 AT5G45550 Encodes a gene product involved in both sporogenesis and gametogenesis and is required for the MOB1-LIKE (MOB1-like) Mps one binder kinase activator-like 1A normal progression of megasporogenesis and microsporogenesis. Solyc07g041900.2.1 AT3G45310 Cysteine proteinases superfamily protein NA Cathepsin L-like cysteine proteinase Solyc07g042560.2.1 AT3G43210 Encodes a kinesin TETRASPORE. Required for cytokinesis in pollen. TETRASPORE (TES) Kinesin-like protein Solyc07g043120.1.1 AT3G21790 UDP-Glycosyltransferase superfamily protein NA UDP-glucosyltransferase Solyc07g043400.1.1 NA #N/A NA Unknown Protein Solyc07g043420.2.1 AT5G24530 Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility DOWNY MILDEW RESISTANT 6 (DMR6) 2-oxoglutarate-dependent dioxygenase to downy mildew. Solyc07g043460.2.1 AT3G14610 putative cytochrome P450 CYTOCHROME P45NA, FAMILY 72, SUBFAMILY A, Cytochrome P450 POLYPEPTIDE 7 (CYP72A7) Solyc07g043480.1.1 AT3G50740 UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates UDP-GLUCOSYL TRANSFERASE 72E1 (UGT72E1) UDP-glucose glucosyltransferase sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism. Solyc07g043490.1.1 AT2G15490 UDP-glycosyltransferase 73B4 UDP-GLYCOSYLTRANSFERASE 73B4 (UGT73B4) UDP-glucosyltransferase family 1 protein Solyc07g043500.1.1 AT5G49690 UDP-Glycosyltransferase superfamily protein NA UDP-glucosyltransferase Solyc07g044970.1.1 NA #N/A NA ATP-binding protein Solyc07g045350.2.1 AT5G48230 Encodes an acetoacetyl-CoA thiolase ACETOACETYL-COA THIOLASE 2 (ACAT2) Acetyl-CoA C-acetyltransferase protein Solyc07g049450.2.1 AT1G04980 Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within PDI-LIKE 2-2 (PDIL2-2) Thioredoxin/protein disulfide isomerase the thioredoxin (TRX) superfamily. Solyc07g049690.2.1 AT4G15440 Encodes a hydroperoxide lyase. HYDROPEROXIDE LYASE 1 (HPL1) Cytochrome P450 Solyc07g052480.2.1 AT3G21720 Encodes a glyoxylate cycle enzyme isocitrate lyase (ICL). ISOCITRATE LYASE (ICL) Isocitrate lyase Solyc07g053120.2.1 AT4G03230 G-type lectin S-receptor-like Serine/Threonine-kinase NA Serine/threonine-protein kinase receptor Solyc07g053200.2.1 AT1G11360 Adenine nucleotide alpha hydrolases-like superfamily protein NA Universal stress protein Solyc07g053360.2.1 AT2G42560 late embryogenesis abundant domain-containing protein / LEA domain-containing protein LATE EMBRYOGENESIS ABUNDANT 25 (LEA25) Seed biotin-containing protein SBP65 Solyc07g053540.1.1 AT1G03870 fasciclin-like arabinogalactan-protein 9 (Fla9) FASCICLIN-LIKE ARABINOOGALACTAN 9 (FLA9) Fasciclin-like arabinogalactan protein 4 Solyc07g055050.2.1 AT2G31040 Encodes an integral thylakoid protein that facilitates assembly of the membranous part of the CONSERVED ONLY IN THE GREEN LINEAGE 16NA ATP synthase I-like protein chloroplast ATPase. (CGL16NA) Solyc07g055720.2.1 AT1G06460 ACD32.1 encodes an alpha-crystallin domain containing protein with homology to small heat shock ALPHA-CRYSTALLIN DOMAIN 32.1 (ACD32.1) Heat shock protein Hsp20 proteins. Solyc07g056310.2.1 AT2G30933 Carbohydrate-binding X8 domain superfamily protein NA Glucan endo-1 3-beta-glucosidase 4 Solyc07g061730.2.1 AT1G30040 Encodes a gibberellin 2-oxidase that acts on C-19 gibberellins. AtGA2OX2 expression is responsive GIBBERELLIN 2-OXIDASE (GA2OX2) Gibberellin 2-oxidase to cytokinin and KNOX activities. Solyc07g061750.2.1 AT1G03670 Ankyrin repeat containing protein NA Ankyrin repeat family protein-like Solyc07g061800.2.1 AT1G17100 SOUL heme-binding family protein HAEM-BINDING PROTEIN 1 (HBP1) Heme-binding protein 2 Solyc07g061940.2.1 AT3G48560 Catalyzes the formation of acetolactate from pyruvate, the first step in valine and isoleucine CHLORSULFURON/IMIDAZOLINONE RESISTANT 1 Acetolactate synthase biosynthesis. (CSR1) Solyc07g062560.2.1 AT1G29140 Pollen Ole e 1 allergen and extensin family protein NA Pollen allergen Phl p 11 Solyc07g063050.1.1 AT4G13530 transmembrane protein NA Unknown Protein Solyc07g063310.2.1 AT1G52920 Encodes a plasma membrane localized ABA receptor G PROTEIN COUPLED RECEPTOR (GPCR) LanC-like protein 2 Solyc07g063410.2.1 AT4G27410 Encodes a NAC transcription factor induced in response to desiccation. It is localized to the nucleus RESPONSIVE TO DESICCATION 26 (RD26) NAC domain protein IPR003441 and acts as a transcriptional activator in ABA-mediated dehydration response. Solyc07g063430.2.1 AT1G52870 Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein NA Mpv17 protein Solyc07g063540.2.1 AT2G20820 hypothetical protein NA Unknown Protein Solyc07g063640.1.1 AT4G10265 Wound-responsive family protein NA Wound induced protein Solyc07g063690.1.1 AT5G54490 Encodes a PINOID (PID)-binding protein containing putative EF-hand calcium-binding motifs. PINOID-BINDING PROTEIN 1 (PBP1) Calcium-binding EF hand family protein Solyc07g063850.2.1 AT5G54510 Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. DWARF IN LIGHT 1 (DFL1) Indole-3-acetic acid-amido synthetase GH3.8 Solyc07g064150.2.1 AT1G54290 Translation initiation factor SUI1 family protein NA Translation initiation factor SUI1 Solyc07g064500.2.1 AT3G20500 purple acid phosphatase 18 PURPLE ACID PHOSPHATASE 18 (PAP18) Purple acid phosphatase Solyc07g065090.1.1 AT5G06860 Encodes a polygalacturonase inhibiting protein involved in defense response. POLYGALACTURONASE INHIBITING PROTEIN 1 Polygalacturonase inhibitor protein (PGIP1) Solyc07g065210.2.1 AT3G20150 Kinesin motor family protein NA Kinesin motor family protein Solyc07g065500.1.1 AT4G14540 nuclear factor Y, subunit B3 NUCLEAR FACTOR Y, SUBUNIT B3 (NF-YB3) Nuclear transcription factor Y subunit B-3 Solyc07g065990.1.1 NA #N/A NA Unknown Protein Solyc07g066220.2.1 AT5G56270 Encodes WRKY transcription factor 2, a zinc-finger protein. WRKY DNA-BINDING PROTEIN 2 (WRKY2) WRKY transcription factor 35 Solyc08g006520.1.1 AT4G31730 Glutamine dumper1 is a putative transmembrane protein. GLUTAMINE DUMPER 1 (GDU1) GDU1 Solyc08g008310.2.1 AT4G23850 AMP-dependent synthetase and ligase family protein LONG-CHAIN ACYL-COA SYNTHETASE 4 (LACS4) Long-chain-fatty-acid-CoA ligase Solyc08g036640.2.1 AT1G30135 jasmonate-zim-domain protein 8 JASMONATE-ZIM-DOMAIN PROTEIN 8 (JAZ8) Protein TIFY 5A Solyc08g061910.2.1 NA #N/A NA Unknown Protein Solyc08g062100.1.1 NA #N/A NA Unknown Protein Solyc08g065610.2.1 AT4G32940 Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases GAMMA VACUOLAR PROCESSING ENZYME Vacuolar processing enzyme-1b (GAMMA-VPE) Solyc08g066490.2.1 AT2G25790 Leucine-rich receptor-like protein kinase family protein STERILITY-REGULATING KINASE MEMBER 1 Receptor like kinase, RLK (SKM1) 145

Solyc08g066880.2.1 AT4G28940 Phosphorylase superfamily protein NA 5&apos-methylthioadenosine/S- adenosylhomocysteine nucleosidase Solyc08g067320.1.1 AT2G34430 Photosystem II type I chlorophyll a/b-binding protein LIGHT-HARVESTING CHLOROPHYLL-PROTEIN Chlorophyll a/b binding protein COMPLEX II SUBUNIT B1 (LHB1B1) Solyc08g067610.2.1 AT1G15520 ABC transporter family involved in ABA transport and resistance to lead. Localizes to plasma ATP-BINDING CASSETTE G4NA (ABCG4NA) ATP-binding cassette transporter membrane. Solyc08g068710.1.1 AT2G39030 Encodes a protein that acts as an ornithine N-delta-acetyltransferase N-ACETYLTRANSFERASE ACTIVITY 1 (NATA1) N-acetyltransferase Solyc08g074290.2.1 AT4G31340 myosin heavy chain-like protein NA BRI1-KD interacting protein 129 Solyc08g074630.1.1 NA #N/A NA Polyphenol oxidase Solyc08g075950.1.1 AT3G13960 Growth regulating factor encoding transcription activator. GROWTH-REGULATING FACTOR 5 (GRF5) Growth-regulating factor 3 Solyc08g076230.1.1 AT2G35550 basic pentacysteine 7 BASIC PENTACYSTEINE 7 (BPC7) GAGA-binding transcriptional activator Solyc08g077060.2.1 AT1G32540 Encodes a protein with 3 plant-specific zinc finger domains that acts as a positive regulator of cell LSD ONE LIKE 1 (LOL1) Zinc finger protein LSD1 death. Solyc08g077230.2.1 AT4G18020 Encodes pseudo-response regulator 2 (APRR2) that interacts with a calcium sensor (CML9). (APRR2) Two-component response regulator ARR11 Solyc08g077300.2.1 AT5G26667 encodes a uridine 5'-monophosphate (UMP)/cytidine 5'-monophosphate (CMP) kinase. (PYR6) Adenylate kinase Solyc08g077460.2.1 AT1G32740 SBP (S-ribonuclease binding protein) family protein NA S-ribonuclease binding protein SBP1 Solyc08g077530.2.1 AT4G17090 Encodes a beta-amylase targeted to the chloroplast. CHLOROPLAST BETA-AMYLASE (CT-BMY) Beta-amylase Solyc08g078870.1.1 AT2G45180 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein NA Proline-rich protein Solyc08g079310.2.1 AT4G12320 member of CYP706A CYTOCHROME P45NA, FAMILY 7NA6, SUBFAMILY Cytochrome P450 A, POLYPEPTIDE 6 (CYP7NA6A6) Solyc08g079830.2.1 AT1G12520 Copper-zinc superoxide dismutase copper chaperone (delivers copper to the Cu-Zn superoxide COPPER CHAPERONE FOR SOD1 (CCS) Cu/Zn-superoxide dismutase copper chaperone dismutase). Solyc08g080140.2.1 AT1G63000 nucleotide-rhamnose synthase/epimerase-reductase NUCLEOTIDE-RHAMNOSE SYNTHASE/EPIMERASE- dTDP-4-dehydrorhamnose reductase REDUCTASE (NRS/ER) Solyc08g081530.2.1 AT1G63940 monodehydroascorbate reductase 6 MONODEHYDROASCORBATE REDUCTASE 6 Reductase (MDAR6) Solyc08g081960.1.1 AT4G23750 encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription CYTOKININ RESPONSE FACTOR 2 (CRF2) Ethylene-responsive transcription factor 4 factor family. Solyc08g082000.2.1 AT5G53220 hypothetical protein NA Genomic DNA chromosome 5 TAC clone K19E1 Solyc08g082070.2.1 AT4G11080 Encodes a protein containing three copies of the HMG (high mobility group)-box domain. 3XHIGH MOBILITY GROUP-BOX1 (3xHMG-box1) TOX high mobility group box family member 4 Solyc08g082250.2.1 AT1G64390 glycosyl hydrolase 9C2 GLYCOSYL HYDROLASE 9C2 (GH9C2) Endoglucanase 1 Solyc08g082820.2.1 AT5G28540 Encodes the luminal binding protein BiP, an ER-localized member of the HSP70 family. (BIP1) Heat shock protein Solyc08g082890.2.1 AT2G16720 Encodes a member of MYB3R- and R2R3- type MYB- encoding gene family that acts as a repressor MYB DOMAIN PROTEIN 7 (MYB7) MYB transcription factor of flavonol biosynthesis. Solyc09g005260.2.1 AT3G51860 cation exchanger 3 CATION EXCHANGER 3 (CAX3) Calcium/proton exchanger Solyc09g005610.2.1 AT1G58330 transcription factor-like protein (ZW2) BZIP transcription factor Solyc09g007150.2.1 AT5G02790 Glutathione S-transferase family protein GLUTATHIONE TRANSFERASE L3 (GSTL3) Glutathione S-transferase Solyc09g007260.2.1 AT2G28550 related to AP2.7 RELATED TO AP2.7 (RAP2.7) AP2-like ethylene-responsive transcription factor At1g79700 Solyc09g007790.1.1 AT5G03230 senescence regulator (Protein of unknown function, DUF584) NA Arabidopsis thaliana genomic DNA chromosome 5 P1 clone MOK16 Solyc09g007910.2.1 AT2G37040 Encodes PAL1, a phenylalanine ammonia-lyase. PHE AMMONIA LYASE 1 (pal1) Phenylalanine ammonia-lyase Solyc09g008670.2.1 AT3G10050 first enzyme in the biosynthetic pathway of isoleucine L-O-METHYLTHREONINE RESISTANT 1 (OMR1) Threonine ammonia-lyase biosynthetic Solyc09g008770.2.1 AT2G36640 Encodes putative phosphotyrosine protein EMBRYONIC CELL PROTEIN 63 (ECP63) Group 3 late embryogenesis abundant protein Solyc09g008970.1.1 AT3G10020 plant/protein NA Unknown Protein Solyc09g009010.2.1 AT5G03760 encodes a beta-mannan synthase (ATCSLANA9) Cellulose synthase-like C1-2 glycosyltransferase family 2 protein Solyc09g009620.1.1 AT3G52770 ZPR3 is a small-leucine zipper containing protein. ZPR3 | protein bindind Unknown Protein Solyc09g009700.2.1 AT5G03610 GDSL-motif esterase/acyltransferase/lipase. NA GDSL esterase/lipase At5g03610 Solyc09g010860.2.1 AT2G37640 member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (EXP3) Expansin (Kende et al, 2004. Plant Mol Bio). Solyc09g011220.2.1 AT2G39770 Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. CYTOKINESIS DEFECTIVE 1 (CYT1) GDP-D-mannose pyrophosphorylase 3 Solyc09g011470.2.1 AT5G02020 Encodes a protein involved in salt tolerance, names SIS (Salt Induced Serine rich). SALT INDUCED SERINE RICH (SIS) Unknown Protein Solyc09g011660.2.1 AT3G53990 Encodes universal stress protein (USP). Functions as a molecular chaperone under heat shock and UNIVERSAL STRESS PROTEIN (ATUSP) Universal stress protein 1 oxidative stress conditions. Solyc09g014480.1.1 AT5G06870 Encodes a polygalacturonase inhibiting protein involved in plant defense response. POLYGALACTURONASE INHIBITING PROTEIN 2 Polygalacturonase inhibitor protein (PGIP2) Solyc09g014550.2.1 AT5G28010 Polyketide cyclase/dehydrase and lipid transport superfamily protein NA Major latex-like protein Solyc09g018010.2.1 AT2G38530 Involved in lipid transfer between membranes and plays a role in maintaining the integrity of the LIPID TRANSFER PROTEIN 2 (LTP2) Non-specific lipid-transfer protein cuticle-cell wall interface. Solyc09g018280.1.1 AT5G01820 Encodes a CBL-interacting serine/threonine protein kinase. SERINE/THREONINE PROTEIN KINASE 1 (SR1) Calcium/calmodulin-dependent protein kinase type 1 Solyc09g059220.1.1 AT2G31490 neuronal acetylcholine receptor subunit alpha-5 NA Unknown Protein 146

Solyc09g061860.2.1 AT3G07020 encodes a 3beta-hydroxy sterol UDP-glucosyltransferase. STEROL GLUCOSYLTRANSFERASE (SGT) / SlSGT2 Sterol 3-beta-glucosyltransferase Solyc09g065170.1.1 NA #N/A NA GA2 Solyc09g065400.1.1 AT3G63220 Galactose oxidase/kelch repeat superfamily protein NA Kelch-like protein 14 Solyc09g065850.2.1 AT5G43700 Auxin inducible protein similar to transcription factors. AUXIN INDUCIBLE 2-11 (ATAUX2-11) Auxin responsive protein Solyc09g074100.2.1 AT1G51310 tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase NA tRNA-specific 2-thiouridylase mnmA Solyc09g075140.2.1 AT3G62860 alpha/beta-Hydrolases superfamily protein (MAGL12) Lipase-like protein Solyc09g075230.1.1 AT1G02816 pectinesterase (Protein of unknown function, DUF538) NA POT family domain containing protein expressed Solyc09g075550.2.1 AT1G02730 Encodes a gene similar to cellulose synthase. It's expression is cell cycle dependent and it appears to CELLULOSE SYNTHASE-LIKE D5 (CSLD5) Cellulose synthase-like D6 function in cell plate formation. Solyc09g075750.1.1 AT5G26230 Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene MEMBRANE-ASSOCIATED KINASE REGULATOR 1 Unknown Protein family. (MAKR1) Solyc09g075890.2.1 AT2G32150 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein NA Pyrimidine 5&apos-nucleotidase Solyc09g082340.2.1 AT3G22640 cupin family protein (PAP85) Vicilin-like protein Solyc09g082620.2.1 AT4G14723 EPIDERMAL PATTERNING FACTOR-like protein CHALLAH-LIKE 2 (CLL2) EPIDERMAL PATTERNING FACTOR-like protein 4 Solyc09g083200.2.1 AT2G23770 Encodes a putative LysM-containing receptor-like kinase LYK4. LYSM-CONTAINING RECEPTOR-LIKE KINASE 4 Nod factor receptor protein (LYK4) Solyc09g083280.2.1 AT5G43700 Auxin inducible protein similar to transcription factors. AUXIN INDUCIBLE 2-11 (ATAUX2-11) Auxin responsive protein Solyc09g084450.2.1 AT2G38870 Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase NA Chymotrypsin inhibitor-2 inhibitor family. Solyc09g084480.2.1 AT2G38870 Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase NA Proteinase inhibitor I inhibitor family. Solyc09g084490.2.1 AT2G38870 Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase NA Proteinase inhibitor I inhibitor family. Solyc09g089530.2.1 AT2G38870 Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase NA Proteinase inhibitor I inhibitor family. Solyc09g089540.2.1 AT2G38870 Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase NA Proteinase inhibitor I inhibitor family. Solyc09g090100.2.1 AT1G04400 Blue light receptor mediating blue-light regulated cotyledon expansion and flowering time. CRYPTOCHROME 2 (CRY2) Cryptochrome 2 Solyc09g090320.1.1 AT4G14330 P-loop containing nucleoside triphosphate hydrolases superfamily protein NA Kinesin like protein Solyc09g090390.1.1 NA #N/A NA Unknown Protein Solyc09g091490.1.1 AT1G11950 Transcription factor jumonji (jmjC) domain-containing protein NA Transcription factor jumonji domain-containing protein Solyc09g091510.2.1 AT5G13930 Encodes chalcone synthase (CHS), a key enzyme involved in the biosynthesis of flavonoids. TRANSPARENT TESTA 4 (TT4) Chalcone synthase Solyc09g091810.1.1 AT3G24770 #N/A CLE41 Unknown Protein Solyc09g092260.2.1 AT4G13830 DnaJ-like protein (J20); nuclear gene DNAJ-LIKE 2NA (J2NA) Chaperone protein dnaJ 20 Solyc09g092520.2.1 AT3G23730 xyloglucan endotransglucosylase/hydrolase 16 XYLOGLUCAN Xyloglucan endotransglucosylase/hydrolase 8 ENDOTRANSGLUCOSYLASE/HYDROLASE 16 (XTH16) Solyc09g092690.2.1 AT5G48570 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (ROF2) Peptidyl-prolyl cis-trans isomerase Solyc09g097770.2.1 NA #N/A NA Cell wall protein Solyc09g097860.2.1 AT4G14150 Microtubule motor kinesin PAKRP1/Kinesin-12A. Together with PAKRP1L/Kinesin-12B, serve as PHRAGMOPLAST-ASSOCIATED KINESIN-RELATED Kinesin-like protein linkers of the plus ends of antiparallel microtubules in the phragmoplast. PROTEIN 1 (PAKRP1) Solyc09g098360.2.1 AT5G06360 Ribosomal protein S8e family protein NA Ribosome biogenesis protein NSA2 Solyc10g005960.1.1 AT5G55730 Encodes fasciclin-like arabinogalactan-protein 1 (Fla1). fla1 mutants show defects in shoot FASCICLIN-LIKE ARABINOGALACTAN 1 (FLA1) Fasciclin-like arabinogalactan protein 10 regeneration. Solyc10g007600.2.1 AT3G14420 Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction GLYCOLATE OXIDASE 1 (GOX1) L-lactate dehydrogenase during nonhost resistance. The mRNA is cell-to-cell mobile. Solyc10g007800.2.1 AT2G42840 Encodes a putative extracellular proline-rich protein is exclusively expressed in the L1 layer of PROTODERMAL FACTOR 1 (PDF1) Meiosis 5 vegetative, inflorescence and floral meristems and the protoderm of organ primordia. Solyc10g008400.1.1 AT4G03510 RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane- RING MEMBRANE-ANCHOR 1 (RMA1) RING finger protein 5 anchoring domain that is involved in the secretory pathway. Solyc10g008410.1.1 AT4G03510 RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane- RING MEMBRANE-ANCHOR 1 (RMA1) RING finger protein 5 anchoring domain that is involved in the secretory pathway. Solyc10g009320.2.1 AT2G46640 Encodes TAC1 (Tiller Angle Control 1). Influences axillary branch growth angle. TILLER ANGLE CONTROL 1 (TAC1) Unknown Protein Solyc10g009340.1.1 AT2G46600 Calcium-binding EF-hand family protein NA Calmodulin Solyc10g012370.2.1 AT3G61440 Encodes a cysteine synthase isomer CysC1. The isomer is however less effective in cysteine CYSTEINE SYNTHASE C1 (CYSC1) Cysteine synthase biosynthesis. Solyc10g018870.1.1 AT1G34770 Encodes a nuclear localized, structural subunit of the SMC 5/6 complex and a non- SMC element. (NSE3) Melanoma-associated antigen G1 Solyc10g045100.1.1 AT3G05170 Phosphoglycerate mutase family protein NA Phosphoglycerate mutase Solyc10g045380.1.1 AT2G44260 DUF946 family protein (DUF946) NA Vacuolar protein sorting protein 62 Solyc10g054910.1.1 AT2G16600 Encodes cytosolic cyclophilin ROC3. ROTAMASE CYP 3 (ROC3) Peptidyl-prolyl cis-trans isomerase 147

Solyc10g074680.1.1 AT3G54220 Encodes a member of a novel family having similarity to DNA binding proteins containing basic- SCARECROW (SCR) SCARECROW leucine zipper regions Solyc10g076410.1.1 AT2G38310 Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory PYR1-LIKE 4 (PYL4) Abscisic acid receptor PYL4 components of ABA receptor) family proteins with 14 members. Solyc10g076600.1.1 AT3G51840 Encodes a short-chain acyl-CoA oxidase, ACYL-COA OXIDASE 4 (ACX4) Acyl-CoA dehydrogenase Solyc10g076720.1.1 NA #N/A NA Unknown Protein Solyc10g076990.1.1 AT1G08680 A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. ARF GAP-LIKE ZINC FINGER-CONTAINING PROTEIN Arf-GAP domain and FG repeats-containing ZIGA4 (ZIGA4) protein 1 Solyc10g078370.1.1 AT1G73590 Encodes an auxin efflux carrier involved in shoot and root development. PIN-FORMED 1 (PIN1);SlPIN9 Auxin efflux carrier Solyc10g078590.1.1 AT5G18130 transmembrane protein NA Unknown Protein Solyc10g078700.1.1 AT3G57920 Encodes a putative transcriptional regulator that is involved in the vegetative to reproductive phase SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 15 Squamosa promoter-binding protein transition. (SPL15) Solyc10g078740.1.1 AT2G05990 Encodes enoyl-ACP reductase a component of the fatty acid synthase complex. MOSAIC DEATH 1 (MOD1) Enoyl reductase Solyc10g078770.1.1 AT5G06760 Encodes LEA4-5, a member of the Late Embryogenesis Abundant (LEA) proteins LATE EMBRYOGENESIS ABUNDANT 4-5 (LEA4-5) Seed maturation protein LEA 4 Solyc10g078920.1.1 AT5G06690 Encodes a thioredoxin (WCRKC1) localized in chloroplast stroma WCRKC THIOREDOXIN 1 (WCRKC1) Thioredoxin-like 5 Solyc10g078990.1.1 AT2G41940 Encodes a zinc finger protein containing only a single zinc finger. ZINC FINGER PROTEIN 8 (ZFP8) Zinc finger-like protein Solyc10g079950.1.1 AT2G15490 UDP-glycosyltransferase 73B4 UDP-GLYCOSYLTRANSFERASE 73B4 (UGT73B4) UDP-glucosyltransferase HvUGT5876 Solyc10g080610.1.1 AT1G15670 Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, KISS ME DEADLY 2 (KMD2) Kelch-like protein 14 that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Solyc10g081260.1.1 AT3G03620 MATE efflux family protein NA Multidrug resistance protein mdtK Solyc10g083290.1.1 AT3G52600 cell wall invertase 2 CELL WALL INVERTASE 2 (CWINV2) Beta-fructofuranosidase insoluble isoenzyme 2 Solyc10g083330.1.1 AT2G36220 hypothetical protein NA Calcium/calmodulin protein kinase Solyc10g083440.1.1 AT5G17050 encodes a anthocyanidin 3-O-glucosyltransferase which specifically glucosylates the 3-position of UDP-GLUCOSYL TRANSFERASE 78D2 (UGT78D2) UDP flavonoid 3-O-glucosyltransferase the flavonoid C-ring. Solyc10g083760.1.1 AT3G10050 first enzyme in the biosynthetic pathway of isoleucine L-O-METHYLTHREONINE RESISTANT 1 (OMR1) Threonine dehydratase biosynthetic Solyc10g085220.1.1 AT5G34940 The protein is predicted (WoLF PSORT program) to be membrane-associated. GLUCURONIDASE 3 (GUS3) Mitochondrial carrier protein expressed Solyc10g085280.1.1 AT3G11340 Encodes a glucosyltransferase that conjugates isoleucic acid and modulates plant defense and UDP-DEPENDENT GLYCOSYLTRANSFERASE 76B1 UDP-glucosyltransferase senescence. (UGT76B1) Solyc10g085420.1.1 AT5G01750 LURP-one-like protein (DUF567) NA Os03g0816700 protein Solyc10g086340.1.1 AT2G37420 ATP binding microtubule motor family protein NA Kinesin-5 Solyc10g086360.1.1 AT3G53670 hypothetical protein NA BRI1-KD interacting protein 130 Solyc10g086570.2.1 AT5G02160 transmembrane protein NA Palmitoyltransferase PFA4 Solyc10g086620.1.1 AT5G06060 NAD(P)-binding Rossmann-fold superfamily protein NA Tropinone reductase Solyc11g006230.1.1 AT5G28640 Encodes a protein with similarity to mammalian transcriptional coactivator that is involved in cell ANGUSTIFOLIA 3 (AN3) Calcium-responsive transactivator proliferation during leaf and flower development. Solyc11g006750.1.1 AT5G04750 F1F0-ATPase inhibitor protein NA Unknown Protein Solyc11g007020.1.1 AT3G54250 Encodes mevalonate diphosphate decarboxylase MEVALONATE 5-DIPHOSPHATE DECARBOXYLASE Diphosphomevalonate decarboxylase-like protein 2 (MDD2) Solyc11g007200.1.1 AT3G56240 CCH protein belongs to a family of eukaryotic proteins that participate in intracellular copper COPPER CHAPERONE (CCH) Copper chaperone homeostasis by delivering this metal to the secretory pathway Solyc11g007930.1.1 AT1G07790 Encodes a histone 2B (H2B) protein. (HTB1) Histone H2B Solyc11g008280.1.1 AT3G10410 SERINE CARBOXYPEPTIDASE-LIKE 49 SERINE CARBOXYPEPTIDASE-LIKE 49 (scpl49) Serine carboxypeptidase Solyc11g010340.1.1 AT1G72210 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (BHLHNA96) BHLH transcription factor Solyc11g010430.1.1 AT5G65400 alpha/beta-Hydrolases superfamily protein NA Ovarian cancer-associated gene 2 protein homolog Solyc11g010960.1.1 AT4G39330 cinnamyl alcohol dehydrogenase 9 CINNAMYL ALCOHOL DEHYDROGENASE 9 (CAD9) Alcohol dehydrogenase Solyc11g011770.1.1 AT5G16560 Encodes a KANADI protein (KAN) that regulates organ polarity in Arabidopsis. KANADI (KAN) Myb family transcription factor-like Solyc11g011920.1.1 AT5G17330 Encodes one of two isoforms of glutamate decarboxylase. The mRNA is cell-to-cell mobile. GLUTAMATE DECARBOXYLASE (GAD) Glutamate decarboxylase Solyc11g012020.1.1 AT4G05520 Encodes AtEHD2, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis EPS15 HOMOLOGY DOMAIN 2 (EHD2) EH-domain-containing protein 1 (AtEHD1, At3g20290). Solyc11g012130.1.1 AT3G27200 Cupredoxin superfamily protein NA Blue copper protein Solyc11g012240.1.1 AT3G51970 acyl-CoA sterol acyl transferase 1 ACYL-COA STEROL ACYL TRANSFERASE 1 (ASAT1) Wax synthase isoform 3 Solyc11g012590.1.1 AT2G35760 Uncharacterized protein family (UPF0497) CASP-LIKE PROTEIN 2B2 (CASPL2B2) UPF0497 membrane protein 12 Solyc11g013170.1.1 AT1G77670 Pyridoxal phosphate (PLP)-dependent transferases superfamily protein NA Aminotransferase Solyc11g013290.1.1 AT5G18410 distorted trichomes and exhibits a diffuse actin cytoskeleton PIROGI 121 (PIR121) Cytoplasmic FMR1 interacting protein 1 Solyc11g021020.1.1 NA #N/A NA Proteinase inhibitor Solyc11g021360.1.1 NA #N/A NA Unknown Protein Solyc11g027840.1.1 AT1G35420 alpha/beta-Hydrolases superfamily protein NA Carboxymethylenebutenolidase homolog Solyc11g028080.1.1 AT1G09645 transmembrane protein NA Unknown Protein Solyc11g040040.1.1 AT3G19850 Phototropic-responsive NPH3 family protein NA Phototropic-responsive NPH3 family protein Solyc11g045530.1.1 AT1G31320 LOB domain-containing protein 4 LOB DOMAIN-CONTAINING PROTEIN 4 (LBD4) LOB domain protein 4 148

Solyc11g065930.1.1 AT4G34890 Encodes a xanthine dehydrogenase, involved in purine catabolism. XANTHINE DEHYDROGENASE 1 (XDH1) Xanthine dehydrogenase/oxidase Solyc11g066390.1.1 AT2G28190 Encodes a chloroplastic copper/zinc superoxide dismutase CSD2 that can detoxify superoxide COPPER/ZINC SUPEROXIDE DISMUTASE 2 (CSD2) Superoxide dismutase radicals. Solyc11g066670.1.1 AT2G36770 UDP-Glycosyltransferase superfamily protein NA UDP-glucosyltransferase Solyc11g066970.1.1 AT2G27740 RAB6-interacting golgin (DUF662) NA cDNA clone J033118E13 full insert sequence Solyc11g068710.1.1 AT2G36090 F-box family protein NA F-box family protein Solyc11g068750.1.1 AT2G27300 NTM1-like 8 NTM1-LIKE 8 (NTL8) NAC domain protein IPR003441 Solyc11g071290.1.1 AT1G32780 GroES-like zinc-binding dehydrogenase family protein NA Alcohol dehydrogenase Solyc11g071370.1.1 AT1G05750 Encodes a pentatricopeptide repeat protein required for editing of rpoA and clpP chloroplast PIGMENT DEFECTIVE 247 (PDE247) Pentatricopeptide repeat-containing protein transcripts. Solyc11g071380.1.1 AT2G27250 #N/A NA Unknown Protein Solyc11g071400.1.1 AT3G14470 NB-ARC domain-containing disease resistance protein NA Lrr, resistance protein fragment Solyc11g071470.1.1 AT5G48930 encode for the hydroxycinnamoyl-Coenzyme A shikimate/quinate hydroxycinnamoyltransferase HYDROXYCINNAMOYL-COA SHIKIMATE/QUINATE Hydroxycinnamoyl CoA shikimate/quinate (HCT) both synthesizing and catabolizing the hydroxycinnamoylesters (coumaroyl/caffeoyl HYDROXYCINNAMOYL TRANSFERASE (HCT) hydroxycinnamoyltransferase-like protein shikimate and quinate) involved in the phenylpropanoid pathway. Solyc11g071480.1.1 AT5G48930 encode for the hydroxycinnamoyl-Coenzyme A shikimate/quinate hydroxycinnamoyltransferase HYDROXYCINNAMOYL-COA SHIKIMATE/QUINATE Hydroxycinnamoyl CoA shikimate/quinate (HCT) both synthesizing and catabolizing the hydroxycinnamoylesters (coumaroyl/caffeoyl HYDROXYCINNAMOYL TRANSFERASE (HCT) hydroxycinnamoyltransferase-like protein shikimate and quinate) involved in the phenylpropanoid pathway. Solyc11g071490.1.1 AT1G36240 Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein NA Ribosomal protein L30 Solyc11g071530.1.1 AT1G70190 ribosomal protein L7/L12 domain-containing protein NA 50S ribosomal protein L12-2 Solyc11g071540.1.1 AT2G02955 maternal effect embryo arrest 12 MATERNAL EFFECT EMBRYO ARREST 12 (MEE12) Unknown Protein Solyc11g071640.1.1 AT5G20950 Encodes a beta-glucosidase involved in xyloglucan metabolism. (BGLC1) Beta-D-glucosidase Solyc11g071690.1.1 AT3G43590 zinc knuckle (CCHC-type) family protein NA Cellular nucleic acid binding protein Solyc11g071710.1.1 AT3G44020 thylakoid lumenal P17.1 protein NA DnaJ-like zinc-finger protein Solyc11g071730.1.1 AT3G44050 P-loop containing nucleoside triphosphate hydrolases superfamily protein NA Kinesin-like protein Solyc11g071740.1.1 AT1G76650 calmodulin-like 38 CALMODULIN-LIKE 38 (CML38) Calmodulin-like protein Solyc11g071790.1.1 AT1G08480 predicted to encode subunit 6 of mitochondrial complex II SUCCINATE DEHYDROGENASE 6 (SDH6) Unknown Protein Solyc11g071810.1.1 AT1G08465 Member of the YABBY family of Arabidopsis proteins involved in the abaxial cell fate YABBY2 (YAB2) CRABS CLAW specification in lateral organs Solyc11g071830.1.1 AT3G44110 homologous to the co-chaperon DNAJ protein from E coli (J3) Chaperone protein dnaj Solyc11g072110.1.1 AT1G55290 encodes a protein whose sequence is similar to oxidoreductase, 2OG-Fe(II) oxygenase (F6'H2) 1-AMINOCYCLOPROPANE-1- CARBOXYLATE OXIDASE-like protein Solyc11g072120.1.1 AT1G55290 encodes a protein whose sequence is similar to oxidoreductase, 2OG-Fe(II) oxygenase (F6'H2) 2-oxoglutarate-dependent dioxygenase Solyc11g072280.1.1 AT5G51600 Mutant has defective roots. Essential for giant cell ontogenesis. Role in organizing the mitotic PLEIADE (PLE) Microtubule-associated protein MAP65-1a microtubule array during both early and late mitosis in all plant organs. Solyc11g073120.1.1 AT3G46130 Encodes a putative transcription factor (MYB48) that functions to regulate flavonol biosynthesis MYB DOMAIN PROTEIN 48 (MYB48) MYB transcription factor primarily in cotyledons. Solyc12g005250.1.1 AT4G21270 Encodes a kinesin-like motor protein heavy chain. Loss of function mutations have reduced fertility KINESIN 1 (ATK1) Kinesin-like protein and are defective in spindle formation in male meiosis. Solyc12g005430.1.1 AT3G26040 HXXXD-type acyl-transferase family protein NA Acyltransferase-like protein Solyc12g005500.1.1 AT1G03860 prohibitin 2 PROHIBITIN 2 (PHB2) Prohibitin Solyc12g005700.1.1 AT2G32280 Encodes a member of a plant-specific gene family that is required for embryo provasculature VASCULATURE COMPLEXITY AND CONNECTIVITY Unknown Protein development. (VCC) Solyc12g005800.1.1 AT1G01380 ETC1 is involved in trichome and root hair patterning in Arabidopsis. ENHANCER OF TRY AND CPC 1 (ETC1) MYB transcription factor MYB73 Solyc12g005910.1.1 AT5G42570 B-cell receptor-associated 31-like protein NA B-cell receptor-associated protein 31-like containing protein Solyc12g006460.1.1 AT2G32440 ent-kaurenoic acid hydroxylase (KAO2) ENT-KAURENOIC ACID HYDROXYLASE 2 (KAO2) Cytochrome P450 Solyc12g006470.1.1 AT3G22200 Genetically redundant with POP3;mediates pollen tube guidance. POLLEN-PISTIL INCOMPATIBILITY 2 (POP2) Aminotransferase-like protein Solyc12g007020.1.1 AT4G13370 serine/arginine repetitive matrix protein, putative (DUF936) NA cDNA clone J033084B06 full insert sequence Solyc12g007160.1.1 AT3G49290 One of four ABI-like proteins. ABL INTERACTOR-LIKE PROTEIN 2 (ABIL2) Protein ABIL1 Solyc12g008330.1.1 NA #N/A NA Unknown Protein Solyc12g008560.1.1 NA #N/A NA Unknown Protein Solyc12g009480.1.1 AT2G26660 SPX domain-containing protein 2 (SPX2) SPX DOMAIN GENE 2 (SPX2) Xenotropic and polytropic retrovirus receptor Solyc12g009930.1.1 AT2G15490 UDP-glycosyltransferase 73B4 UDP-GLYCOSYLTRANSFERASE 73B4 (UGT73B4) UDP-glucuronosyltransferase 1-6 Solyc12g010650.1.1 AT5G07900 Mitochondrial transcription termination factor family protein NA Mitochondrial transcription termination factor family protein Solyc12g010850.1.1 AT1G06320 hypothetical protein NA Unknown Protein Solyc12g011290.1.1 AT1G72250 Di-glucose binding protein with Kinesin motor domain-containing protein NA Kinesin Solyc12g013710.1.1 AT5G54190 light-dependent NADPH:protochlorophyllide oxidoreductase A PROTOCHLOROPHYLLIDE OXIDOREDUCTASE A Protochlorophyllide reductase (PORA) Solyc12g013920.1.1 AT5G53940 Yippee family putative zinc-binding protein NA Yippee family protein 149

Solyc12g014070.1.1 AT1G53190 Encodes a RING-type E3 ligase that positively regulates CIN-like TCP activity to promote leaf TIE1-ASSOCIATED 33 RING-TYPE E3 LIGASE 1 RING-finger protein-like development by mediating the degradation of the TCP repressor TIE1. (TEAR1) Solyc12g014480.1.1 AT4G22320 golgin family A protein NA cDNA clone 002-156-B04 full insert sequence Solyc12g014500.1.1 AT5G55250 Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. IAA CARBOXYLMETHYLTRANSFERASE 1 (IAMT1) S-adenosyl-L-methionine salicylic acid carboxyl methyltransferase-like protein Solyc12g015860.1.1 AT4G17190 Encodes a protein with farnesyl diphosphate synthase activity, which catalyzes the rate limiting step FARNESYL DIPHOSPHATE SYNTHASE 2 (FPS2) Farnesyl pyrophosphate synthase in isoprenoid biosynthesis. Solyc12g019320.1.1 AT3G26590 MATE efflux family protein NA Multidrug resistance protein mdtK Solyc12g019550.1.1 AT1G21500 hypothetical protein NA Unknown Protein Solyc12g040800.1.1 AT1G48590 Calcium-dependent lipid-binding (CaLB domain) family protein C2-DOMAIN ABA-RELATED 5 (CAR5) C2 domain-containing protein Solyc12g042720.1.1 AT4G22000 tyrosine sulfotransferase-like protein NA Unknown Protein Solyc12g042890.1.1 AT3G15650 alpha/beta-Hydrolases superfamily protein NA Acyl-protein thioesterase 2 Solyc12g044820.1.1 AT3G21250 member of MRP subfamily ATP-BINDING CASSETTE C8 (ABCC8) Multidrug resistance protein ABC transporter family Solyc12g044850.1.1 AT1G55160 WAS/WASL-interacting family protein NA Unknown Protein Solyc12g045030.1.1 AT3G55310 NAD(P)-binding Rossmann-fold superfamily protein NA Short-chain dehydrogenase/reductase family protein Solyc12g056160.1.1 AT5G41610 member of Putative Na+/H+ antiporter family CATION/H+ EXCHANGER 18 (CHX18) Cation/H Solyc12g056560.1.1 AT1G76770 HSP20-like chaperones superfamily protein NA Unknown Protein Solyc12g056600.2.1 AT1G52340 Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA DEFICIENT 2 (ABA2) Short chain alcohol dehydrogenase ABA-aldehyde during ABA biosynthesis. Solyc12g056640.1.1 AT4G09810 Nucleotide-sugar transporter family protein UDP-RHA/UDP-GAL TRANSPORTER 5 (URGT5) Integral membrane protein like Solyc12g056650.1.1 AT1G22770 Together with CONSTANTS (CO) and FLOWERING LOCUS T (FT), GIGANTEA promotes GIGANTEA (GI) Tomato GIGANTEA 2 flowering under long days in a circadian clock-controlled flowering pathway. Solyc12g082720.1.1 NA #N/A NA Unknown Protein Solyc12g082730.1.1 AT5G65930 encodes a novel member of the kinesin superfamily of motor proteins. recessive mutations have ZWICHEL (ZWI) Kinesin-like calmodulin binding protein reduced number of trichome branches. Solyc12g087830.1.1 AT1G26310 Floral homeotic gene encoding a MADS domain protein homologous to AP1. Enhances the flower CAULIFLOWER (CAL) MADS box transcription factor to shoot transformation in ap1 mutants. Solyc12g088300.1.1 AT4G33800 hypothetical protein NA Unknown Protein Solyc12g094550.1.1 AT1G76250 transmembrane protein NA AT1G76250-like protein Solyc12g095900.1.1 AT2G25930 Encodes a nuclear protein that is expressed rhythmically and interacts with phytochrome B to EARLY FLOWERING 3 (ELF3) Early flowering 3 control plant development and flowering through a signal transduction pathway. Solyc12g096710.1.1 AT5G48380 Encodes a BAK1-interacting receptor-like kinase named BIR1. BAK1-INTERACTING RECEPTOR-LIKE KINASE 1 Receptor like kinase, RLK+N209KK208:T208 (BIR1) Solyc12g096830.1.1 AT1G05680 Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects URIDINE DIPHOSPHATE GLYCOSYLTRANSFERASE UDP-glucosyltransferase family 1 protein auxin homeostasis. 74E2 (UGT74E2) Solyc12g098450.1.1 AT4G13800 magnesium transporter NIPA (DUF803) NA DUF803 domain membrane protein Solyc12g098900.1.1 NA #N/A NA Late embryogenesis abundant protein D-29 Solyc12g099260.1.1 AT3G06650 One of the two genes encoding subunit B of the trimeric enzyme ATP Citrate lyase ATP-CITRATE LYASE B-1 (ACLB-1) ATP citrate lyase a-subunit Solyc12g099290.1.1 AT3G66658 Encodes a putative aldehyde dehydrogenase. ALDEHYDE DEHYDROGENASE 22A1 (ALDH22a1) Aldehyde dehydrogenase

150