Genes, with Emphasis on the Rep Gene Family

ASIEH RASOOLIZADEH

TRANSCRIPTIONAL ANALYSIS OF TRANOSEMA ROSTRALE ICHNOVIRUS (TrIV) GENES, WITH EMPHASIS ON THE REP GENE FAMILY

Mémoire présenté à la Faculté des études supérieures de l’Université Laval dans le cadre du programme de maîtrise en biologie pour l’obtention du grade de Maître ès Sciences (M.Sc.)

DÉPARTEMENT DE BIOLOGIE FACULTÉ DES SCIENCES ET DE GÉNIE UNIVERSITÉ LAVAL QUÉBEC

2009

RÉSUMÉ

La guêpe endoparasitoïde Tranosema rostrale transmet un ichnovirus (“TrIV”) à son hôte lépidoptère, Choristoneura fumiferana, au moment de la ponte. Ce virus, lequel possède un génome segmenté d’ADNdb et ne peut se répliquer que dans l’ovaire du parasitoïde, est essentiel à la survie de la guêpe immature à l’intérieur de son hôte. Dans une étude antérieure, 86 cadres de lecture ouverts (ORF) ont été identifiés dans le génome de TrIV, dont 35 qui ont pu être affectés à des familles de gènes ichnoviraux connues. La balance n’affichait aucune similitude à des gènes connus. Dans le but d’évaluer (i) la précision de l'annotation du génome de TrIV et (ii) l'importance relative de chaque famille de gènes dans le succès du parasitisme par T. rostrale, une analyse transcriptionnelle de type qPCR a été réalisée chez des larves de C. fumiferana infectées ainsi que dans des ovaires de T. rostrale. Alors que la majorité (91%) des ORF attribués à des familles de gènes connues ont produit des transcrits dans les larves infectées, mais à des niveaux très variables, cette proportion était plus faible (67%) pour un échantillon de 12 ORF non-attribués. Parmi les sept familles de gènes présentes dans le génome de TrIV, la famille rep est la mieux représentée, avec 17 membres; tous se sont avérés être exprimés dans des larves infectées et/ou les ovaires de guêpe. Dans les chenilles infectées, cependant, les transcrits de deux d'entre eux, F1-1 et F1-2, étaient beaucoup plus abondants que ceux des autres gènes rep. De plus, le profil transcriptionnel de la famille rep était clairement différent dans les ovaires de guêpe, où le gène C166-1 a génére le plus abondant des transcrits rep, ce qui suggère que différents membres de cette famille pourraient avoir des fonctions spécifiques dans chaque hôte. L'abondance relative des segments génomiques était plus élevée pour les deux segments portant les trois gènes rep les plus fortement exprimés chez des chenilles infectées, mais la corrélation entre ces deux variables était faible pour les autres gènes rep, suggérant que des facteurs additionnels sont impliqués dans la régulation de l'expression des gènes rep chez les larves infectées. Des différences entre les gènes rep de TrIV ont également été observées en ce qui a trait à l'abondance relative des transcripts dans différents tissus de C. fumiferana, ce qui suggère l’existence de rôles distincts ou d’une spécialisation pour chacun des membres de cette famille à l’intérieur de différents tissus. Lorsqu’on compare les niveaux de transcripts rep, dans des chenilles

infectées, à ceux de gènes appartenant à d'autres familles connues du génome de TrIV, un gène de la famille TrV (TrV1) et un gène rep (F1-1) se sont avérés beaucoup plus fortement transcrits que tous les autres gènes examinés, soulignant l'importance probable de ces deux familles dans la subjugation de C. fumiferana par T. rostrale. Dans les ovaires de guêpe, le profil transcriptionnel était dominé par un gène rep et par un membre d'une famille nouvellement décrite et identifiée parmi des ORF qui n’avaient pu être attribués à des familles connues; ces gènes codent pour les protéines sécrétées affichant un nouveau motif cystéine.

ABSTRACT

The endoparasitic wasp Tranosema rostrale transmits an ichnovirus (“TrIV”) to its lepidopteran host, Choristoneura fumiferana, during parasitization. This virus, which has a segmented dsDNA genome and can replicate only in the wasp’s ovaries, is essential to the survival of the immature wasp within its host. In a prior study, 86 putative open reading frames (ORFs) were identified in the TrIV genome, including 35 that could be assigned to previously recognized ichnoviral gene families. The balance displayed no similarity to known genes. In an effort to assess (i) the accuracy of the TrIV genome annotation and (ii) the relative importance of each gene family in the success of parasitism by T. rostrale, a temporal and tissue-specific qPCR transcriptional analysis was conducted in infected C. fumiferana hosts and T. rostrale wasp ovaries. The majority (91%) of putative ORFs assigned to known gene families were observed to be expressed in infected larvae, albeit at widely varying levels, but this proportion was lower (67%) for a sample of 12 unassigned ORFs. Among the seven known gene families present in the TrIV genome, the rep family is the numerically most important one, with 17 members; all of these were shown to be expressed in infected larvae and/or wasp ovaries. In infected caterpillars, however, two of them, F1-1 and F1-2, had much more abundant transcripts than the others. The rep transcriptional profile was markedly different in wasp ovaries, where the C166-1 gene generated the most abundant rep transcripts, suggesting that different members of this family may have host-specific functions. Relative abundance of genome segments was highest for the two segments bearing the three most highly

iii

expressed rep genes, but the correlation between these two variables was poor for the other rep genes, suggesting that some other factors are involved in the regulation of rep gene expression in infected larvae. Inter-gene differences were also observed in the relative abundance of TrIV rep transcripts in different C. fumiferana tissues, pointing to tissue-specific roles or specialized functions for individual members of this gene family. In comparing rep transcript levels to those of genes belonging to other known TrIV gene families, a TrV (TrV1) and a rep (F1-1) gene clearly outnumbered all other genes examined in infected caterpillars, pointing to the likely importance of these two gene families in host subjugation by T. rostrale. In wasp ovaries, the transcriptional profile was dominated by a rep gene and a member of a newly described family identified among previously unassigned ORFs; these genes encode secreted proteins displaying a novel cysteine motif.

AVANT-PROPOS – FOREWORD

During my graduate studies, I have met several people at Laval University who have shared their knowledge and experience with me to make my work both possible and more pleasant. I take this opportunity to thank them all from the bottom of my heart. More specifically, I would like to thank my co-supervisor, Dr. Michel Cusson. He generously welcomed me to his lab, gave me the opportunity to develop my competences, and provided me with scientific training on a daily basis. Dr. Cusson has a distinct way of dealing with problems and gives his students an opportunity to discover themselves and recognize their abilities. It has always been a great pleasure to share with him new results, and his constant cheering, interest and enthusiasm allowed me to push through and get through several difficult tasks.

I would also like to thank my director, Prof. Conrad Cloutier, for taking time to assess my manuscript and help me get through the Master’s program. I will never forget the first course I took with him, which he (naturally) gave in French, a lovely language that, unfortunately, I do not fully grasp yet; he patiently helped me throughout the semester. Furthermore, I would like to express my gratitude to the members of our laboratory at the Laurentian Forestry Centre (LFC). In particular, I thank Catherine Béliveau and Don Stewart, two molecular biologists who have helped me by providing valuable and friendly guidance during my stay at LFC.

I will also be eternally grateful for the support I received from the few real friends I made at Laval University; their friendly support was much appreciated, and I sincerely thank them all.

Last, but not least, I wish to express my profound gratitude to my parents. Although I am living far away from them, they are always in my heart. The distance did not keep them from providing invaluable advice and generous support. I have always benefited from their gracious words and encouragements, which allowed me, during hard times, to keep moving forward and continue on my career path.

TABLE OF CONTENTS

RÉSUMÉ…………………………………………………………………………………………ii ABSTRACT…………...... iii AVANT-PROPOS – FOREWORD ...... v TABLE OF CONTENTS ...... vi LIST OF FIGURES...... ix LIST OF TABLES ...... xi CHAPITRE 1….INTRODUCTION ...... 1 1.1 La tordeuse des bourgeons de l’épinette, Choristoneura fumiferana ...... 2 1.1.1 Cycle Vital...... 2 1.2 Les parasitoïdes...... 4 1.3 Polydnavirus ...... 4 1.3.1 Classification ...... 5 1.3.2 Cycle Vital...... 6 1.3.3 Organization du genome...... 7 1.3.4 Bracovirus...... 8 1.3.5 Ichnovirus ...... 9 1.4 La guêpe Tranosema rostrale, un parasitoïde de la TBE...... 10 1.4.1 Le polydnavirus de Tranosema rostrale (TrIV) ...... 10 1.5 Objectifs du projet...... 11 1.6 Référence ...... 13 CHAPITRE 2….Tranosema rostrale ichnovirus repeat element genes display distinct transcriptional patterns in caterpillar and wasp hosts...... 18 2.1 Summary ...... 18 2.2 Résumé...... 19 2.3 Introduction...... 20 2.4 Material and methods...... 22 2.4.1 RNA and DNA extraction ...... 22 2.4.2 Reverse transcription and qPCR...... 23 2.4.3 Bioinformatics ...... 24 2.5 Results and Discussion...... 25

2.5.1 Critical assessment of the LRE methodology...... 25 2.5.2 Transcript abundance in parasitized larvae...... 26 2.5.3 Transcript abundance in CF-injected larvae ...... 29 2.5.4 Transcript abundance in wasp ovary and head-thorax complexes...... 30 2.5.5 Gene dosage...... 32 2.5.6 Comparison of TrIV rep proteins and identification of non-polydnaviral rep homologs ...... 34 2.6 References...... 38 CHAPITRE 3….Global transcriptional profile of Tranosema rostrale ichnovirus genes in infected lepidopteran hosts and wasp ovaries...... 42 3.1 Abstract ...... 42 3.2 Résumé...... 43 3.3 Introduction...... 44 3.4 Materials and Methods...... 46 3.4.1 RNA extraction...... 46 3.4.2 cDNA library construction ...... 46 3.4.3 Bioinformatics analyses...... 47 3.4.4 Amplification of ORF-specific cDNAs from the cDNA library ...... 47 3.4.5 Reverse transcription and quantitative real-time PCR (qPCR)...... 48 3.5 Results...... 49 3.5.1 Detection of TrIV transcripts in infected larvae ...... 49 3.5.2 Transcript abundance of TrIV ank, inx, Cys-motif, PRRP and N genes...... 52 3.5.3 Transcript abundance of TrIV “unassigned” genes ...... 53 3.5.4 Comparison of transcript abundance across all TrIV gene families ...... 55 3.5.5 Accuracy of splicing junction predictions ...... 57 3.6 Discussion ...... 58 3.7 References...... 61 CHAPITRE 4….Conclusion ...... 65 4.1 Références...... 70 ANNEXE A…..Effect of TrIV rep gene expression on host gene transcription, as determined by microarray analysis...... 71 A.1 Introduction ...... 71 A.2 Material and methods ...... 72 A.3 Results ...... 73

vii

A.4 Discussion...... 74 A.5 References ...... 75 ANNEXE B…. Supplementary data for chapter 2: ...... 76 ANNEXE C…. Supplementary data for chapter 3:...... 78

viii

LIST OF FIGURES

Figure 1-1 Schéma du cycle vital de la tordeuse des bourgeons de l'épinette...... 3

Figure 1-2 Représentation schématisée du cycle vital de Tranosema rostrale (Laforge, 1999). . 11

Figure 2-2 Transcript levels of 17 TrIV rep genes in naturally parasitized 6th instar larvae, as determined by quantitative real-time RT-PCR using total RNA extracted from four different tissues: FB, fat body; CE, cuticular epithelium; HC, haemocytes; MG, midgut. The larvae were parasitized within 24 h after the molt to the 6th (last) stadium, and the RNA extracted from individual tissues 2 days after parasitization...... 28

Figure 2-4 Transcript levels of 17 TrIV rep genes in T. rostrale ovaries and head-thorax complexes, as determined by quantitative real-time RT-PCR...... 31

Figure 2-5 Assessment of genome segment abundance within the TrIV packaged genome, as determined by quantitative real-time PCR using viral DNA as template...... 33

Figure 2-6 ClustalX alignment of all known and predicted TrIV rep family proteins. Black arrows indicate the positions of conserved cysteine residues...... 36

Figure 2-7 ClustalX alignment of selected ichnoviral rep proteins from TrIV, HfIV, and HdIV, as well as a rep-like protein from the granulovirus HearGV...... 37

Figure 3-2 ClustalW alignment of amino acid sequences deduced from selected TrIV unassigned ORFs that were found to form groups of two or more related proteins. A) Four related proteins

displaying a novel C-terminal cysteine motif (cysteine residues are shown as white letters against black background)...... 54

Figure 3-5 Comparison of transcript abundance among selected representatives of all known TrIV gene families, in adult T. rostrale ovaries...... 56

LIST OF TABLES

Table 3-1 Overall assessment of the expression (detected or not; + or ) of known and predicted TrIV ORFs in TrIV-infected C. fumiferana larvae...... 50

Table 3-2 Differences between predicted and observed splicing junctions for two TrIV spliced genes, TrV3 and a Cys-motif gene...... 57

CHAPITRE 1

INTRODUCTION

Les insectes (classe Insecta) constituent le groupe taxonomique le plus important au sein de l’embranchement des arthropodes. Ils forment également le taxon le plus diversifié, avec plus d’un million d’espèces connues. Bien que la majorité des insectes aient des effets directs ou indirects bénéfiques ou neutres sur l’activité humaine, une faible proportion (<1% de toutes les espèces d’insectes décrites) est considérée comme lui étant nuisible (Gullan et Cranston, 2000 ; Coulson et Witter, 1984). Les insectes nuisibles sont généralement divisés en trois grandes catégories fonctionnelles: (i) ceux qui transmettent des maladies aux humains et aux animaux domestiques, (ii) ceux qui détruisent des produits fabriqués par l’Homme et (iii) ceux qui détruisent ou réduisent la croissance des cultures agricoles et des arbres (Ross, 1965).

Pour la gestion des insectes ravageurs, on a recours à différents produits antiparasitaires tels que les insecticides chimiques et biologiques. La répression des ravageurs forestiers au moyen de pulvérisations d’insecticides chimiques conventionnels a joué un rôle important dans la protection des forêts pendant plusieurs années. Cependant, leurs effets négatifs sur l’environnement et la santé humaine ont graduellement entrainé leur bannissement complet en milieu forestier en Amérique du Nord (Armstrong & Ives, 1995). Maintenant, on tend à utiliser des insecticides microbiens ou des insecticides de synthèse à risques réduits, lesquels ciblent une fonction spécifique aux insectes et ont, par

conséquent, peu ou pas d’effets sur des organismes non-ciblés. Ainsi, des bactéries, des virus, des champignons et des nématodes ont fait l’objet d’évaluations comme agents de lutte biologique (Lacey et al, 2001), et certains ont été homologués et commercialisés. Ces pesticides ont un moindre impact sur l’environnement et la santé humaine. Leur utilisation entraîne donc une réduction des résidus de pesticides conventionnels et contribue à la préservation des ennemis naturels.

1.1 La tordeuse des bourgeons de l’épinette, Choristoneura fumiferana

La tordeuse des bourgeons de l’épinette (TBE), Choristoneura fumiferana (Lepidoptera : Tortricidae), est le ravageur forestier le plus important des forêts de conifères de l’est du Canada. La TBE cause des dommages au cours de sa période larvaire en se nourrissant des bourgeons et des jeunes pousses d’arbres. Une attaque sévère répétée sur plusieurs années peut entraîner la mort des arbres infestés (Armstrong & Ives, 1995). La TBE attaque principalement le sapin baumier (Abies balsamea), mais elle peut aussi causer des damages importants à l’épinette rouge (Picea rubens), l’épinette blanche (Picea glauca) et l’épinette noire (Picea mariana). Les populations de TBE atteignent des niveaux épidémiques de façon cyclique et constituent ainsi une menace pour plus de cinquante millions d’hectares de forêt. Les peuplements gravement affectés prennent une coloration rouille en raison de la présence d’aiguilles desséchées et retenues par des fils de soie tissés par les larves. À l’automne, la majorité des aiguilles mortes sont emportées par le vent et les peuplements ainsi défoliés deviennent grisâtres (Dajoz, 2000).

1.1.1 Cycle Vital

Choristoneura fumiferana a un cycle vital comprenant six stades larvaires (Fig. 1-1). Les papillons s’accouplent vers la mi-juillet et les femelles pondent leurs œufs directement sur les aiguilles de sapin et d’épinette. Suite à l’éclosion de l’œuf, la larve (chenille) de premier stade tisse, dans la cime de l’arbre, un petit abri de soie appelé « hibernacle ».

C’est alors que la chenille mue au deuxième stade larvaire et interrompt son développement jusqu’à la fin de l’hiver ; pendant cette période de dormance appelée diapause, la chenille cesse de se nourrir. En mai, la larve de deuxième stade quitte son hibernacle et mue au troisième stade larvaire, après quoi elle commence à se nourrir de jeunes aiguilles. Généralement, c’est aux stades avancés de développement (4e, 5e et 6e stades) que cet insecte cause le plus de dommages au feuillage. Les larves sont reconnues à leur corps brun (18-24 mm de longueur) et leur tête noire. Au mois de juin, la larve de 6e stade cesse de se nourrir et entreprend la recherche d’un endroit, de préférence la cime des arbres, pour sa pupaison et sa métamorphose. Les papillons adultes émergent vers la fin juin-début juillet (Dajoz, 2000).

Figure 1-1 Schéma du cycle vital de la tordeuse des bourgeons de l'épinette. (https://email.nrcan.gc.ca/exchweb/bin/redir.asp?URL=http://www.srd.gov.ab.ca/forests/health/insec ts/sprucebudworm.aspx

La TBE est attaquée par de nombreux prédateurs et parasitoïdes. La plupart des insectes parasitoïdes font partie de l’ordre des Diptères (mouches et moustiques) et de l’ordre des Hyménoptères (guêpes, abeilles et fourmis). Différents parasitoïdes s’attaquent à différents stades développementaux de la TBE, tels les œufs, les jeunes larves, les larves plus âgées et les pupes (Dajoz, 2000).

1.2 Les parasitoïdes

Les parasitoïdes forment un vaste groupe d’ennemis naturels que l’on peut diviser en deux grandes catégories selon que le développement de leurs stades immatures est complété à l’extérieur (i.e., sur la face externe ; ectoparasitoïdes) ou à l’intérieur de l’hôte (endoparasitoïdes). Dans un cas comme dans l’autre, la parasitoïde entraîne ultimement la mort de son hôte. Les parasitoïdes Hyménoptères appartiennent au sous-ordre des Apocrita, au sein duquel on trouve deux superfamilles. La mieux connue de celles-ci, Ichneumonidea, est composée des familles Ichneumonidae et Braconidae. Les femelles appartenant à ces familles utilisent leur ovipositeur (appendice abdominal) pour parasiter leur hôte (i.e., y pondre un œuf ; Hajek, 2004).

Les insectes hôtes réagissent à la présence de corps étrangers tels les œufs d’un endoparasitoïde en les « encapsulant », c’est-à-dire en les couvrant de plusieurs couches d’hémocytes, une réaction qui est généralement accompagnée d’une mélanisation de la capsule. Cette réponse est connue sous le nom d’encapsulement (Asgari, 2007). Toutefois, certains parasitoïdes ont développé des moyens de se protéger contre cette réaction ou même de l’inhiber. Plusieurs facteurs naturels qui sont injectés dans la larve hôte au moment de la ponte, tels des venins, des protéines ovariennes, et des particules pseudovirales, sont impliqués dans la protection de l’œuf et de la jeune larve contre la réponse immunitaire de l’hôte. Alors que certains de ces facteurs protègent la guêpe immature de façon passive, d’autres participent à l’inhibition active de la réponse immunitaire de l’hôte. Par exemple, les œufs de Braconidae, au moment de leur éclosion, libèrent des cellules géantes connues sous le nom de « tératocytes » ; ces cellules ont été impliquées dans la suppression de la réponse immunitaire de l’hôte (Asgari, 2007). Certains virus ont un effet semblable.

1.3 Polydnavirus

Parmi les agents transmis par certaines guêpes endoparasitoïdes à leur hôte pour inhiber l’encapsulation, on compte les polydnavirus (PDV), lesquels constituent un groupe de

virus uniques en raison de l’association mutualiste obligatoire qu’ils forment avec certaines guêpes endoparasitoïdes des familles Braconidae et Ichneumonidae. Le génome des polydnavirus est constitué de plusieurs segments génomiques circulaires d’ADNdb ; cette particularité génomique est d’ailleurs à l’origine de leur nom (Polydisperse DNA Virus). Les PDV sont transmis à l’hôte Lépidoptère au moment de l’oviposition, et l’expression de certains de leurs gènes est essentielle au succès du développement de l’œuf et de la larve de guêpe dans la chenille hôte (Stoltz, 1993; Krell et al., 1982; Turnbull & Webb, 2002).

1.3.1 Classification

Les virus sont classifiés en fonction de la nature de leur génome (ADN ou ARN, simple ou double brin, linéaire ou circulaire, segmenté ou non, etc.), de la morphologie de leur virion, de leur spectre d’hôtes, et de leur cycle vital. Le "International Committee on Taxonomy of Viruses" (ICTV) reconnait présentement les PDV comme formant une famille distincte, les Polydnaviridae, laquelle inclut les seuls virus (connus) possédant un génome segmenté composé d’ADN circulaire double brin. Tel que mentionné ci-dessus, les PDV sont associés à certaines guêpes des familles Braconidae et Ichneumonidae; l’ICTV reconnait de ce fait deux genres, les Bracovirus (BV) et les Ichnovirus (IV). Bien qu’ils partagent de nombreuses caractéristiques, les IV et les BV semblent avoir des origines évolutives distinctes (Whitefield, 2002; Bezier et al., 2009). Chez les Braconidae et les Ichneumonidae, quatre (Cheloninae, Microgastrinae, Cardiochilinae et Miracinae) et deux (Campoleginae et Banchinae) sous-familles, respectivement, ont été identifiées comme contenant des guêpes porteuses de PDV (Stoltz et al, 1995a). Bien que les virus associés aux quatre sous-familles de Braconidae semblent avoir un ancêtre commun (Bezier et al., 2009), il pourrait en être autrement des virus associés aux deux sous- familles d’Ichneumonidae (Lapointe et al., 2007).

1.3.2 Cycle Vital

Le génome des PDV est intégré au génome de la guêpe hôte sous forme de provirus; la transmission du virus à travers la population de guêpes est donc mendélienne (verticale) (Fleming et Summers, 1986; Stoltz et al., 1986; Stoltz, 1990, Fleming & Krell, 1993).

Le cycle vital des PDV comporte deux volets (ou deux "bras"): le premier est constitué de la réplication et de la transmission, alors que le deuxième est constitué de l’infection et de l’expression des gènes viraux dans l’hôte Lépidoptère (Stoltz, 1993). La réplication du génome viral est confinée à une portion spécialisée des ovaires de la guêpe, le « calice », lequel est situé à la jonction des ovarioles et de l’oviducte latéral. La réplication commence au stade pupal du développement de la guêpe femelle, en réponse à des changements dans les titres d’ecdystéroïdes. Bien que les connaissances sur le mécanisme de réplication des PDV demeurent pour l’instant limitées, selon le scénario le plus probable, des groupes de segments proviraux sont excisés des chromosomes de la guêpe, puis amplifiés pour former des épisomes circulaires par un mécanisme du type « rolling circle » (Webb, 1998 ; Marti et al, 2003). Il y a alors encapsidation dans le noyau, où les particules virales acquièrent leur première (IV) ou unique (BV) enveloppe. Les virions migrent alors vers la membrane cytoplasmique pour être libérées dans la lumière de l’oviducte. Là, les virions forment la fraction particulaire du « fluide du calice » (CF), dans lequel baignent les œufs de la guêpe (Stoltz & Vinson, 1977 ; Kroemer & Webb, 2004).

Les bracovirus sont libérés dans l’oviducte par la lyse des cellules épithéliales du calice, alors que les ichnovirus sont libérés par exocytose. C’est ainsi que les ichnovirus acquièrent une deuxième membrane unitaire, celle-ci étant constituée d’une portion d’épithélium du calice (Norton et al., 1975; Stoltz & Vinson, 1977; Stoltz & Vinson, 1979; Stoltz et al., 1976).

Au moment de l’oviposition, la guêpe transmet le virus à la chenille hôte. Il n’y a pas de réplication virale chez celle-ci, mais l’expression de gènes viraux entraîne la production de protéines qui sont impliquées dans la protection des œufs et des larves de guêpe contre

la réponse immunitaire de la chenille hôte ainsi que dans la régulation développementale de la chenille hôte (Stoltz, 1993; Stoltz & Vinson, 1977; Stoltz et al, 1986; Tanaka & Vinson, 1991). Ainsi, c’est l’expression de gènes polydnaviraux qui permet à la guêpe de compléter son développement larvaire, et c’est la survie de la guêpe qui permet la transmission du génome proviral à la génération suivante.

1.3.3 Organization du genome

Bien que le génome de tous les PDV soit constitué de segments circulaires d’ADNdb, le nombre (~25 à > 100) et la taille (~2 à 42 kb) des segments génomiques varient d’une espèce à l’autre (Tanaka et al, 2007; Krell et al., 1982; Fleming, 1992). La taille du génome des polydnavirus est difficile à estimer de façon précise, mais on sait qu’ils sont typiquement de grande taille (187 à 567 kb), polymorphiques, qu’ils contiennent une proportion importante d’ADN non-codant (70%) et qu’ils sont dépourvus de gènes nécessaires à la réplication ou à l’élaboration des protéines structurales de la capside. Puisque la réplication est confinée à l’ovaire de la guêpe, les gènes de rréplication ne sont présents que dans le génome de la guêpe (i.e. ne sont pas encapsidés). D’ailleurs, une équipe vient d’identifier, dans les génomes de guêpes porteuses, des gènes d’origine nudivirale encodant des protéines structurales de BV (Bezier et al., 2009). Les gènes polydnaviraux peuvent donc tous être qualifiés de gènes de virulence, i.e., qui induisent des pathologies chez la chenille hôte (Tanaka et al., 2007).

Dans un génome polydnaviral les segments génomiques ne sont pas présents en quantités équimolaires, ce qui entraîne des différences de dosage génique pouvant affecter le niveau d’expression de certains gènes chez les chenilles infectées. Bien que l’expression des gènes polydnaviraux ait été étudiée principalement chez les larves parasitées, certains de ces gènes sont aussi exprimés chez la guêpe porteuse. On reconnait d’ailleurs trois classes de gènes polydnaviraux: les gènes de classe I, qui sont exprimés chez la guêpe durant la réplication du virus, ceux de classe II, qui sont exprimés chez l’hôte parasité, et ceux de classe III, qui sont exprimés à la fois chez la guêpe et chez son hôte lépidoptère (Theilmann & Summers, 1988; Kroemer & Webb, 2004). Les guêpes « infectées » (ou

« porteuses ») étant asymptomatiques, on comprend que les gènes de la classe II, dont l’expression est responsable des effets pathologiques observés chez la chenille hôte, aient reçu plus d’attention que ceux des autres classes (Kroemer & Webb, 2004). Il faut cependant noter que les gènes de virulences identifiés chez les BV et les IV sont, pour la majorité, distincts les uns des autres.

1.3.4 Bracovirus

Les virions des bracovirus sont constitués de nucléocapsides cylindriques de diamètre uniforme mais de longueur variable. Les virions sont composés d’une ou de plusieurs nucléocapsides, enveloppées par une membrane unitaire simple. Des analyses ont montré que chaque nucléocapside contient un seul segment génomique, et que la longueur de la nucléocapside est vraisemblablement proportionnelle à la taille du segment génomique qu’elle contient (Albrecht et al., 1994; Beck et al., 2007).

Chez les PDV de façon générale, les gènes se sont diversifiés en familles, et le génome d’un virus contient typiquement plusieurs familles de gènes. Pour les BV, on en a recensé dix: EP-1, egf, glc, HP, PTP, cyst, BV-like et Rec-like, crp (ou Cys) et ank. Seules ces deux dernières familles sont communes aux IV et aux BV (Kroemer & Webb, 2004). Certaines de ces familles contiennent des gènes qui codent pour des protéines affichant des similitudes significatives à d’autres protéines eucaryotiques déjà caractérisées. C’est le cas, par exemple, des protéines Egf-motif du BV de Microplitis demolitor (MdBV). Ces gènes génèrent des transcrits épissés qui codent pour des protéines homologues aux facteurs de croissance épidermique, lesquels sont riches en cystéines (Strand et al., 1997; Trudeau et al., 2000). Cette similitude a permis de formuler des hypothèses quant à leur fonction et de les évaluer.

1.3.5 Ichnovirus

Sur la base des connaissances actuelles, les génomes d’IV comportent plus de 20 segments génomiques dont la taille individuelle varie entre 2 et 28 kb. La taille totale du génome est estimée à 250-300 kb. Les nucléocapsides d’ichnovirus de guêpes campoplégines sont de forme lenticulaire et de taille relativement uniforme (~85 nm x 330 nm), et sont individuellement enveloppés de deux membranes unitaires (Stoltz, 1993; Stoltz et al, 1995a ; Webb, 1998). Chaque nucléocapside est de taille suffisante pour contenir le génome complet, bien que cette hypothèse n’ait pas encore été évaluée expérimentalement. Les nucléocapsides d’ichnovirus de guêpes banchines sont de taille plus petite et de longueur plus variable, et peuvent être enveloppés individuellement ou en groupes (Lapointe et al., 2007).

Comme chez les BV, on reconnait plusieurs familles de gènes chez les IV de guêpes campoplégines: Cys, rep, ank, inx, PRRP, TrV, et N. De façon étonnante, les familles de gènes des IV de guêpes banchines s’apparentent davantage à celles des BV (pour plus de détails, voir Lapointe et al., 2007). Les fonctions des gènes de certaines familles sont connues (ou on a une bonne idée de ce qu’elles semblent être) en raison de la similitude des protéines encodées à d’autres protéines eucaryotiques déjà caractérisées. C’est le cas, par exemple, des ankyrines (ank), des innexines (inx) et des protéines Cys-motif (Cys) ; toutes ces protéines semblent être impliquées dans la dépression du système immunitaire de l’hôte (Kroemer & Webb, 2004). Par contre, d’autres ne présentent aucune similitude à des protéines connues ou n’affichent aucun motif reconnaissable. C’est le cas, par exemples, des protéines des familles TrV et rep. Les gènes ichnoviraux rep (repeat element protein) sont ainsi nommés parce qu’ils contiennent des motifs d’éléments répétés imparfaits de ~540 bp (Theilmann & Summers, 1988). Ils représentent la famille de gènes ichnoviraux la plus hautement conservée et la mieux représentée (50% des gènes assignés) chez les quatre espèces étudiées (Tanaka et al. 2007; Volkoff et al. 2002; Galibert et al. 2006). Des études antérieures suggèrent qu’ils encodent des protéines non- sécrétées de fonction inconnue (Tanaka et al, 2007).

1.4 La guêpe Tranosema rostrale, un parasitoïde de la TBE

Parmi les parasitoïdes qui attaquent communément la TBE dans la région de Québec, on compte la guêpe Tranosema rostrale (Brischke) (Hymenoptera : Ichneumonidae : Campopleginae). Il s’agit d’un endoparasitoïde solitaire capable de pondre dans tous les stades post-diapausants de son hôte, avec une préférence pour les stades 3 à 5 (Cusson et al., 1998b).

1.4.1 Le polydnavirus de Tranosema rostrale (TrIV)

La guêpe ichneumone T. rostrale pond ses œufs dans la cavité abdominale de son hôte principal, la TBE. Au moment de la ponte, la guêpe femelle injecte dans son hôte une dose de polydnavirus, lequel est connu sous le nom de Tranosema rostrale ichnovirus (TrIV). Contrairement à d’autres IVs caractérisés à ce jour, TrIV ne semble pas jouer un rôle important dans la suppression de la réponse immunitaire cellulaire de l’hôte. Toutefois, il inhibe très fortement la métamorphose (Doucet et Cusson, 1996a, b). Dans l’hôte parasité, les gènes viraux sont exprimés, ce qui mène à des changements qui permettent aux œufs et larves de guêpe d’achever leur développement (Doucet et Cusson, 1998 a, b). Le parasitisme débute à la fin mai dans la région de Québec et le développement post-embryonnaire comprend trois stades larvaires qui durent environ 14 jours à 20°C. Au premier stade larvaire, les larves se nourrissent des tissus de l’hôte (Cusson et al, 1998a). À la fin du troisième stade, les larves de T. rostrale quittent leur hôte et tissent un cocon dans lequel elles entreprennent la pupaison et la métamorphose. La guêpe adulte émerge du cocon au bout de 9 à 10 jours; en forêt, cela correspond à la fin juin-début juillet. Quelques jours après l’émergence, les adultes sont prêts pour la reproduction et on croit qu’une ou deux autres générations additionnelles se produisent au cours du reste de l’été sur des hôtes autres que la TBE (Fig. 1-2) (Cusson et al., 1998a). Plus de 80% du génome de TrIV a été séquencé et sa taille totale est estimée à environ 250 kb. L’analyse du génome de TrIV indique la présence de représentants de chacune

des familles connues de gènes d’ichnovirus. Le génome de TrIV contient aussi une famille, TrV, qui semble lui être unique (Tanaka et al., 2007).

Puppupee dan s adulte cdansocon

ponte

larve

œuf Polydnavirus

Figure 1-2 Représentation schématisée du cycle vital de Tranosema rostrale (Laforge, 1999).

Le génome de TrIV contient au moins 17 cadres de lecture ouverts (« open reading frames » ou ORF) encodant des protéines rep; les gènes sont situés sur 10 segments génomiques différents (Tanaka et al., 2007). Tel que mentionné ci-dessus, la fonction de ces gènes est inconnue. Parce qu’ils représentent la famille de gènes ichnoviraux la plus hautement conservée et la mieux représentée chez les quatre espèces étudiées, on peut supposer que leur fonction au cours du parasitisme est d’une d’importance fondamentale.

1.5 Objectifs du projet

Cette étude a d’abord été entreprise dans le but d’explorer les fonctions possibles des gènes rep chez les deux hôtes de TrIV, la chenille de TBE parasitée et la guêpe T. rostrale. Dans un premier temps, j’ai réalisé une étude en q-RT-PCR pour quantifier les transcrits des 17 gènes rep de TrIV chez des larves de TBE parasitées par T. rostrale ou injectées du virus TrIV, ainsi que dans des tissus spécifiques de larves parasitées et des ovaires de guêpes. En réalisant cette étude, j’espérais que les patrons de transcription

observés fournissent des indices sur la fonction possible des gènes rep. Ces analyses sont présentées au Chapitre II.

Au Chapitre III, je compare l’expression des gènes rep à celle de plusieurs autres gènes de TrIV identifiés lors de l’annotation du génome (Tanaka et al., 2007). À cette fin, j’ai d’abord construit une banque d’ADNc en utilisant de l’ARN extrait de chenilles infectées. En utilisant des amorces spécifiques pour chaque ORF, j’ai tenté d’amplifier chaque gène par PCR à partir de la banque d’ADNc. Les amplicons ont alors été clonés pour séquençage; dans les cas de gènes épissés, cette approche a permis de déterminer si les jonctions d’épissage avaient été prédites correctement. En complément, j’ai évalué les niveaux de transcrits pour les mêmes ORF dans des larves de TBE parasitées ou injectées de virus ainsi que dans des ovaires guêpe, par qPCR. Cette étude, a permis de comparer l’importance relative de chaque famille de gènes en termes de niveaux d’expression.

La conclusion générale, présentée au Chapitre IV, aborde des thèmes qui n’ont pu faire l’objet d’un traitement approfondi dans les deux chapitres précédents. J’y explore aussi quelques unes des façons dont la recherche sur les familles de gènes de PDV pourrait mener à la mise au point de nouveaux outils de lutte contre les ravageurs.

A l’Annexe A, je présente le travail que j’ai entrepris dans le but d’évaluer, par analyse «microarray», l’impact de la sur-expression d’un gène rep, dans des cellules de TBE, sur la modulation de l’expression des gènes de TBE. L’objectif de ce travail était d’identifier les voix métaboliques affectées par les gènes rep, ce qui pourrait fournir d’autres indices sur leurs fonctions. Au moment de compléter la rédaction du présent mémoire, l’analyse microarray n’avait pas encore été menée; ainsi, l’Annexe A décrit la procédure utilisée pour la sur-expression d’un gène rep dans des cellules de TBE en culture. Les Annexes B et C, quant à elles, contiennent des données supplémentaires relatives aux articles reproduits dans les Chapitres II et III, respectivement.

1.6 Références

1. Albrecht, A., Wyler, T., Pfister-Wilhelm, R., Heiniger, P., Hurt, E., Gruber, A., Schumperli, D. & Lanzrein, B., (1994) Polydnavirus of the parasitic wasp Chelonus inanitus (Braconidae): characterization, genome organization and time point of replication. J. Gen. Virol. 75, 3353-3363.

2. Armstrong, J.A. & Ives, W.G.H. (1995). Introduction. Insectes forestiers ravageurs au Canada. Armstrong J.A. et Ives, W.G.H., Eds. Ressources naturelles Canada, Ottawa.

3. Asgari, S. (2007). Endoparasitoid venom proteins as modulators of host immunity and development. In Rivers, D. and Yoder, J. (Ed.), Recent Advances in the Biochemistry, Toxicity, and Mode of Action of Parasitic Wasp Venoms (pp. 57- 73) India: Research Signpost.

4. Beck, M. H., Inman, R. B. & Strand, M. R. (2007). Microplitis demolitor bracovirus genome segments vary in abundance and are individually packaged in virions. Virology. 359, 179-189.

5. Bézier, A., Annaheim, M., Herbinière, J., et al. (2009). Polydnaviruses of braconid wasps derive from an ancestral nudivirus. Science. 323, 926 – 930.

6. Coulson, R., Witter, J. (1984). Forest entomology, ecology, and management. New York: John Wiley. 669 pp.

7. Cusson, M., Barron, J.R., Goilet, H., Régnière, J. & Doucet, D. (1998a). Biology and status of Tranosema rostrale (Hymenoptera: Ichneumonidae), a parasitoid of the eastern spruce budworm (Lepidoptera: Tortricidae). Ann. Entomol. Soc. Am. 91, 87-93.

8. Cusson, M., Lucarotti, C., Stoltz, D., Krell, P. & Doucet, D. (1998b). A polydnavirus from the spruce budworm parasitoid, Tranosema rostrale (Ichneumonidae). J. Invertebr. Pathol. 72, 50-56.

9. Dajoz, R. (2000). Insects and Forests, the Role and Diversity of Insects in the Forest Environment. Intercept Ltd, New York.

10. Doucet D, Cusson M. (1996a). Alteration of developmental rate and growth of Choristoneura fumiferana parasitized by Tranosema rostrale: role of the calyx fluid. Entomol. Exp. Appl. 81, 21-30.

11. Doucet D, Cusson M. (1996b). Role of calyx fluid in alterations of immunity in Choristoneura fumiferana larvae parasitized by Tranosema rostrale. Comp. Biochem. Physiol. 114, 311-317.

12. Fleming, J.G.W. (1992). Polydnaviruses: mutualists and pathogens. Annu. Rev. Entomol. 37, 401-425.

13. Fleming, J.G.W & Krell, P.J. (1993). Polydnavirus organization. In parasites and pathogens of insects (Edited by Beckage N.E., Thampson, S.N. and Federici, B. A.), Vol, 2, 189-225.

14. Fleming J.G.W. & Summers M.D. (1986). Campoletis sonorensis endoparasitic wasps contain forms of C. sonorensis virus DNA suggestive of integrated and extrachromosomal polydnavirus DNAs. J. Virol. 57, 552-562.

15. Galibert, L., Devauchelle, G., Cousserans, F., Rocher, J., Cérutti, P., Barat- Houari, M., Fournier, P. & Volkoff, A. N. (2006). Members of the Hyposoter didymator Ichnovirus repeat element gene family are differentially expressed in Spodoptera frugiperda. J. Virol. 3, 48.

16. Gullan, P.J. & Cranston, P.S. (2000). The insects: An outline of entomology, second edition. Blackwell Science Ltd, Eds., USA.

17. Hajek, A.E. (2004). Natural enemies: an introduction to biological control. Cambridge University Press. Cambridge, UK.

18. Krell P.J., Summers M.D. & Vinson S.B. (1982). Virus with a multipartite superhelical genome from the inchneumonid parasitoid, Campoletis sonorensis. J. Virol. 43, 859-870.

19. Kroemer, J. A. & Webb, B. A. (2004). Polydnavirus genes and genomes: emerging gene families and new insights into polydnavirus replication. Annu. Rev. Entomol. 49, 431-456.

20. Lacey, L.A., Frutos R., Kaya H.K. & Vail, P. (2001). Insect pathogens as biological control agents: Do they have a future? Biol. Control. 21, 230-248.

21. Laforge, M. (1999). Expression des gènes du polydnavirus de Tranosema rostrale chez La tordeuse des bourgeons de L’épinette, Choristoneura fumiferana. Mémoire de maîtrise, Faculté des études supérieures de l’Université Laval.

22. Lapointe, R., Tanaka K., Barney, W. E., Whitfield, J. B., Banks, J. C, Béliveau, C., Stoltz, D., Webb, B. A., and Cusson M. (2007). Genomic and Morphological Features of a Banchine Polydnavirus: Comparison with Bracoviruses and Ichnoviruses. J. Virol. 81, 6491-6501.

23. Marti, D., Grossniklaus-Burgin, C., Wyder, S., Wyler, T. & Lanzrein, B. (2003). Ovary development and polydnavirus morphogenesis in the parasitic wasp Chelonus inanitus. I. Ovary morphogenesis, amplification of viral DNA and ecdysteroid titres. J. Gen. Virol. 84, 1141–1150.

24. Norton, W.N., Vinson, S.B. & Stoltz, D.B. (1975). Nuclear secretory particles associated with the calyx cells of the inchneumonid parasitoid Campoletis sonorensis (Cameron). Cell Tissue. Res. 162, 195-208.

25. Stoltz, D.B., Beckage, N.E., Blissard, G.W., Fleming, J.G.W., Krell, P.J., Theilmann, D.A., Summers, M.D. & Webb, B.A. (1995a). Family Polydnaviridae. Virus Taxonomy. Murphy, F.A., Fauquet, C.M., Bishop, D.H.L., Ghabrial, S.A., Jarvis, A.W., Martelli, G.P., Mayo, M.A. & Summers, M.D., Eds. Springer- Verlag, New York.

26. Stoltz, D., Shen, X.-R., Boggis, C. & Sisson, G. (1995b). Molecular diagnosis of Kashmir bee virus infection. J. Apic Res. 34, 153–160.

27. Stoltz, D. B. (1993). The polydnavirus life cycle. In Parasites and Pathogens of Insects, 1, 80-101. Edited by N. Beckage, S. N. Thompson & B. A. Federici. San Diego, CA: Academic Press.

28. Stoltz, D.B. (1990). Evidence for chromosomal transmission of polydnavirus genomes. Can. J. Microbiol. 36, 538-543.

29. Stoltz, D. B., Guzo, D. & Cook, D. (1986). Studies on polydnavirus transmission. Virology. 155, 120-131.

30. Stoltz, D.B. and Vinson S.B. (1979). Viruses and parasitism in insects. Adv. Virus Res. 24, 125-171.

31. Stoltz, D.B., & Vinson, S.B. (1977). Baculovirus-like particles in the reproductive tracts of female parasitoid wasps. II. The genus Apanteles. Can. J. Microbiol. 23, 28-37.

32. Stoltz, D.B., Vinson, S.B. & MacKinnon E.A. (1976). Baculovirus-like particles in the reproductive tracts of female parasitoid wasps. Can. J. Microbiol. 22, 1013- 1023.

33. Strand, M.R., Witherell, R.A. and Trudeau, D. (1997). Two Microplitis demolitor polydnavirus mRNAs expressed in hemocytes of pseudoplusia includens contain a common cysteine-rich domain. J. Virol. 71, 2146-2156.

34. Tanaka, K., Lapointe, R., Barney, W. E., Makkay, A. M., Stoltz, D., Cusson, M. & Webb, B. A. (2007). Shared and species-specific features among ichnovirus genomes. Virology. 363, 26-35.

35. Tanaka, T. and Vinson, S.B. (1991). Depression of prothoracic gland activity of Heliothis virescens by venom and calyx fluids from the parasitoid, Cardiochiles nigriceps. J. Insect. Physiol. 37, 139–144.

36. Theilmann, D. A. & Summers, M. D. (1988). Identification and comparison of Campoletis sonorensis virus transcripts expressed from four genomic segments in the insect hosts Campoletis sonorensis and Heliothis virescens. Virology. 167, 329-341.

37. Trudeau, D., Witherell, R.A., Strand, M.R. (2000). Characterization of two novel Microplitis demolitor polydnavirus mRNAs expressed in Pseudoplusia includens haemocytes. J. Gen. Virol. 81, 3049– 3058

38. Turnbull M, Webb B. (2002). Perspectives on polydnavirus origines and evolution. Adv. Virus Res. 58, 203-54.

39. Webb, B.A. (1998). Polydnavirus biology, genome structure, and evolution. In Insect Viruses. Miller, L.K. & Ball, L.A., Eds. Plenum Publishing Corporation, New York.

40. Whitfield, J.B. (2002). Estimating the age of the polydnavirus/braconid wasp symbiosis. PNAS. 99, 7508-7513.

41. Volkoff, A. N., Béliveau, C., Rocher, J., Hilgarth, R., Levasseur, A., Duonor- Cérutti, M., Cusson, M. & Webb, B. A. (2002). Evidence for a conserved polydnavirus gene family: ichnovirus homologs of the CsIV repeat element genes. Virology. 300, 316-331.

CHAPITRE 2 Tranosema rostrale ichnovirus repeat element genes display distinct transcriptional patterns in caterpillar and wasp hosts1

2.1 Summary

The endoparasitic wasp Tranosema rostrale transmits an ichnovirus (IV) to its lepidopteran host, Choristoneura fumiferana, during parasitization. As shown for other IVs, the segmented dsDNA genome of the T. rostrale virus (TrIV) features several multigene families, including the repeat element (rep) family, whose products display no known similarity to non-IV proteins, except for a homolog encoded by the genome of the Helicoverpa armigera granulovirus; their functions remain unknown. This study applied linear regression of efficiency analysis to the real-time PCR quantification of transcript abundance for all 17 TrIV rep open reading frames (ORFs), in parasitized and virus- injected C. fumiferana larvae, as well as in T. rostrale ovaries and head-thorax complexes. Although transcripts were detected for most rep ORFs in infected caterpillars,

1 This chapter appeared in the June 2009 issue of Journal of General Virology. Rasoolizadeh, A., Béliveau C., Stewart D., Cloutier C., & Cusson M. (2009). Tranosema rostrale ichnovirus repeat element genes display distinct transcriptional patterns in caterpillar and wasp hosts. J. Gen. Virol. 90 (6), 1505-1514.

two of them clearly outnumbered the others in whole larvae, with a tendency for levels to drop over time after infection. The genome segments bearing the three most highly expressed rep genes in parasitized caterpillars were present in higher proportions than other rep-bearing genome segments in TrIV DNA, suggesting a possible role for gene dosage in the regulation of transcription level. TrIV rep genes also showed important differences in the relative abundance of their transcripts in specific tissues (cuticular epithelium, fat body, haemocytes, and midgut), implying tissue-specific roles for individual members of this gene family. Significantly, no rep transcripts were detected in T. rostrale head-thorax complexes whereas some were abundant in ovaries. There, the transcriptional pattern was completely different from that observed in infected caterpillars, suggesting that some rep genes have wasp-specific functions.

2.2 Résumé

La guêpe endoparasitoïde Tranosema rostrale transmet un ichnovirus (“TrIV") à son hôte lépidoptère, Choristoneura fumiferana, au moment de la ponte. TrIV possède un génome segmenté à ADN double-brin circulaire, lequel contient des gènes appartenant à plusieurs familles, dont la famille repeat element (rep). Les produits de ces gènes n’ont pas d’homologues connus à l’extérieur des ichnovirus, à l'exception de protéines encodées par le génome du granulovirus d’Helicoverpa armigera; leurs fonctions demeurent inconnues. La présente étude a appliqué la méthode LRE à l’analyse RT-PCR en temps réel (qPCR) pour quantifier l'abondance des transcrits de 17 gènes rep de TrIV chez des larves de C. fumiferana parasitées par T. rostrale ou injectées du virus, ainsi que dans les ovaires et le complexe tête-thorax de T. rostrale. Alors que des transcrits ont été détectés pour la majorité des gènes rep dans des chenilles infectées, deux d'entre eux avaient des transcrits beaucoup plus abondants que ceux des autres gènes rep dans des larves infectées, avec une tendance à la baisse des niveaux au fil du temps après l'infection. Les segments génomiques portant les trois gènes rep qui étaient exprimés le plus fortement dans les chenilles parasitées étaient présents, dans l'ADN de TrIV, en proportions plus élevées que les autres segments génomiques portant des gènes rep, ce qui suggère un rôle possible pour le dosage des gènes dans la régulation du niveau de transcription.

L’abondance relative des transcripts de chaque gène rep de TrIV s’est avérée variable parmi quatre tissus larvaires de C. fumiferana (épithélium cuticulaire, corps gras, hémocytes et intestin moyen), ce qui suggère des rôles distincts ou la spécialisation de ces gènes à l’égard des différents tissus. Bien qu’aucun transcrit de gène rep n’ait été détecté dans le complexe tête-thorax de T. rostrale, certains étaient abondants dans les ovaires. Là, le patron de transcription était complètement différent de celui observé chez des chenilles infectées, ce qui suggère que certains gènes rep ont des fonctions spécifiques à la guêpe.

2.3 Introduction

Hymenopteran endoparasitoids deposit their eggs within the haemocoele of arthropods, most of which are insects (Eggleton & Belshaw, 1993). To protect their eggs from detection by the host immune system and to provide an appropriate developmental and physiological milieu for survival of their immature progeny within the host, female wasps typically inject their eggs along with various materials capable of disguising the egg surface and/or altering host physiology. For example some members of the families Ichneumonidae and Braconidae transmit, to their caterpillar hosts, a virus that is essential for survival of the immature wasp within the parasitized insect (reviewed in Stoltz, 1993). These viruses, known as polydnaviruses (PDVs), feature a segmented, circular dsDNA genome, with individual genome segments varying in size and genetic content. A copy of the viral genome is present as a provirus within the wasp’s chromosomes, thus providing a mechanism for the vertical transmission of PDVs within parasitoid populations. Viral replication is restricted to the calyx region of the wasp ovary, from which virions are released into the lumen of lateral oviducts. There, they form the particulate fraction of the "calyx fluid" (CF). During oviposition a female wasp injects one or more eggs, along with CF and other secreted proteins and venom, into the lepidopteran host. Although no viral replication occurs in parasitized caterpillar, expression of PDV genes causes developmental and immune dysfunctions that protect the egg and wasp larvae from encapsulation by host hemocytes and/or lead to retardation or arrest of host

metamorphosis, thus providing more time for the wasp larva to complete its development in advance of host pupation (reviewed in Kroemer & Webb, 2004; Stoltz, 1993).

PDV genes are divided into three large categories based on whether they are expressed in the carrier wasp (class I), the infected caterpillar (class II) or both (class III; Theilmann & Summers, 1988). Because of their potentially major significance in the success of parasitism, class II genes have been studied more extensively than those of the other two groups. A number of these genes encode proteins displaying motifs or structural and sequence features observed in previously characterized eukaryotic proteins. Based on these similarities, it has been possible to generate and test hypotheses about their likely functions. Such an approach has led to proposed functions for various PDV genes (e.g., the vankyrins; Falabella et al., 2007; Kroemer & Webb, 2005; Thoetkiattikul et al., 2005).

Other PDV genes, however, display no known similarity to other eukaryotic or viral (non-PDV) genes, rendering their functional analysis more difficult. Such is the case of the repeat element (rep) gene family, the largest gene family identified to date in the genus Ichnovirus (PDVs associated with ichneumonid wasps). These genes consist of imperfectly conserved repeats of ~540-bp arranged either singly or in direct tandem arrays (Theilmann & Summers, 1987). Members of the rep gene family encode non- secreted proteins that are conserved among several ichnovirus species (Tanaka et al., 2007; Volkoff et al., 2002; Webb et al., 2006). Expression of rep genes has been detected in both parasitoids and their parasitized hosts (Galibert et al., 2006; Theilmann & Summers, 1988). The Tranosema rostrale ichnovirus (TrIV) genome contains at least 17 different ORFs identified as belonging to the rep gene family; they are located on 10 different genome segments (Tanaka et al., 2007). In an earlier study, two TrIV rep genes (TrFrep1 and TrFrep2) were shown to be expressed from TrIV genome segment F (Volkoff et al., 2002; this genome segment has been renamed F1 and the two rep genes it contains are now referred to as F1-1 and F1-2; Tanaka et al., 2007). As a first step towards elucidating the function(s) of these gene products, we initiated a study of the temporal and tissue-specific transcription of all known and putative TrIV rep genes. A similar study of 10 rep genes from the ichnovirus of Hyposoter dydimator (HdIV) has

revealed important differences in gene-specific transcript abundance, but minor differences in host and tissue specificity (Galibert et al., 2006). Using a recently developed and powerful qPCR approach (Rutledge and Stewart, 2008a, b), the present study examines transcriptional patterns in the host Choristoneura fumiferana, either naturally parasitized by T. rostrale or injected with its CF, as well as in the wasp’s ovaries and head-thorax complexes. We also examine the possible effect of gene dosage (i.e. relative genome segment abundance) on rep gene transcription. Finally, we present new bioinformatics analyses conducted with the intent of detecting rep homologs among more recent GenBank entries.

2.4 Material and methods

2.4.1 RNA and DNA extraction

Within 24 h after the moult to the last (6th) instar, C. fumiferana larvae were either parasitized once by T. rostrale or injected with 0.5 female-equivalent (FE) of T. rostrale calyx fluid (CF), as described (Doucet & Cusson, 1996 a, b). For each sampling point [1, 3 and 5 d post-parasitization (p.p.) or post-injection (p.i.)], total RNA was extracted and pooled from 3-5 whole C. fumiferana larvae, using the TRIZOL reagent (Invitrogen), according to the manufacturer’s instructions (Béliveau et al., 2000). RNA was also extracted from fat body (FB), cuticular epithelium (CE), midgut (MG) and haemocytes (HC) obtained from a pool of 3-5 larvae 48 h after parasitization. In addition, total RNA was extracted and pooled from five ovary pairs dissected from post-emergence 5-10 day- old T. rostrale females, using the QIAshredder and RNeasy Mini Kit (Qiagen), according to the manufacturer’s instructions. The head-thorax complexes of the same five females were also subjected to total RNA extraction using the TRIZOL reagent.

TrIV DNA was extracted from the CF of 16 T. rostrale female wasps as described (Stoltz et al., 1986). The DNA was first ethanol-precipitated and then resuspended in 100 μl TE, pH 7.6.

2.4.2 Reverse transcription and qPCR

To remove DNA contaminants from RNA extracts, 500 ng of total RNA was treated with 2 U amplification-grade DNase I (Invitrogen) for 15 min at 25°C. We ran controls with no reverse transcriptase for the four most highly transcribed ORFs and detected no significant amplification, indicating the absence of genomic DNA contamination in the extracts. RNA (500 ng) from parasitized and CF-injected C. fumiferana larvae, as well as from T. rostrale head-thorax complexes, and 200 ng RNA from ovarian tissue was reverse-transcribed using 0.5 µg of an oligo(dT) primer and 200 U Superscript II RNase H- reverse transcriptase (Invitrogen). The reaction was carried out in 1x PCR buffer, with 0.5 mM of each dNTP and 40 U of RNAguard ribonuclease inhibitor (Amersham Biosciences), at 42˚C for 50 min.

For qPCR analysis, four primers were initially designed for each rep gene, using diverse regions among aligned rep nucleotide sequences. These four primer pairs were used to assess primer performance and quantitative precision. Initial amplification tests were conducted on reverse-transcribed RNA obtained from parasitized C. fumiferana larvae. A single primer pair was then selected for each rep gene (see Supplementary data in Annexe B), based upon high amplification efficiency and lack of non-specific amplification products, and used for the analysis of the remaining samples.

PCR amplifications were carried out on aliquots of individual RT reactions containing cDNA in amounts equivalent to 2.5 ng RNA, except for ovarian samples, which contained amounts of cDNA equivalent to 1 ng RNA. Four replicate amplification reactions containing 500 nM of each primer were conducted for each sample, using an MX3000P spectrofluorometric thermal cycler (Stratagene) and QuantiTectTM SYBR Green PCR Kit (Qiagen), initiated with a 15-min incubation at 95˚C, followed by a cycling regime of 95˚C, 10 s and 65˚C, 2 min. Each run was completed with a melting curve analysis to confirm the specificity of amplification and absence of primer dimers. Amplification efficiency was determined for each amplification reaction using LRE (“linear regression of efficiency”) analysis, and the number of target molecules calculated using lambda genomic DNA as a quantitative standard (Rutledge & Stewart, 2008a, b).

LRE is a powerful methodology recently developed for modeling real-time qPCR amplification. It provides absolute target amounts without the need to produce standard curves and can generate absolute accuracies of < ±25%, while displaying single molecule sensitivity.

To assess the proportion, within a TrIV DNA extract, of each rep gene-bearing genome segment, the same qPCR approach was applied directly to 0.01 ng of TrIV DNA, using one of the primer pairs designed for transcript quantification for each genome segment (see Supplementary data in Annexe B).

To evaluate the accuracy of the measurements made here using LRE analysis, we applied the “limiting dilution assay” (LDA; Wang & Spadoro, 1998) approach to three of our samples, and compared the estimates obtained with each method. Briefly, based on values determined by LRE, samples were diluted so that each of 20 replicate aliquots would contain ~1 copy of cDNA or genomic DNA. As dictated by Poisson distribution, a large proportion of aliquots will not contain a target molecule, and will fail to produce an

amplification profile. The average number of molecules per aliquot (Nav) can be calculated using the equation:

 nil  av  LnN    total 

where nil is the number of amplification reactions failing to produce an amplification profile and total is the total number of reactions [see Rutledge & Stewart, 2008b for additional details about LDA]. Multiplication of Nav by the dilution factor provides the LDA estimate.

2.4.3 Bioinformatics

To explore the possibility that sequences recently deposited in GenBank may be homologous to ichnoviral rep genes, all TrIV rep proteins were submitted to a Blastp

analysis. Alignments of amino acid sequences were performed with CLUSTAL-X (Thompson et al., 1997) using default settings.

2.5 Results and Discussion

2.5.1 Critical assessment of the LRE methodology

To assess the reliability of the qPCR estimates made in this study using the LRE approach, target quantities in three of our samples were determined using both LRE and LDA analysis. The LDA method generated estimates that were congruent with those obtained by LRE analysis, for one DNA and two RNA samples (Table 2-1), confirming the accuracy of the LRE methodology. In addition, amplification efficiencies were high and uniform across all 17 rep genes, in all treatment groups, and across all 10 TrIV

genome segments, with maximal amplification efficiencies (Emax; see Rutledge & Stewart 2008a,b) of 101.3 ± 1.7% and 101.5 ± 1.5% (mean ± SD) for transcript and genome segment abundance, respectively. Thus, in assessing transcript levels for large multi-gene families such as those found in PDVs or for measuring the relative abundance of many PDV genome segments, application of the LRE approach to qPCR determinations provides unprecedented accuracy, and substantially improves analytical throughput over methods requiring the production of standard curves for each DNA examined.

Table 2-1 Critical assessment of the accuracy of LRE-based qPCR determinations (Rutledge and Stewart, 2008a,b) by comparison with estimates obtained by application of the “limiting dilution assay” (LDA) method (Wang and Spadoro, 1998). Three example runs are shown here, two for transcript levels and one for viral DNA (“Sample id”). Nil: number of amplification reactions failing to produce an amplification profile; Nav, mean number of molecules per aliquot (see Material and Methods for details). The LRE values reported here for transcripts (first two) are the copy number/2.5 ng of total RNA, while the value for C166 genomic DNA is the number of genome segments/0.01 ng of DNA (i.e., the concentrations at which the LRE measurements were made).

Sample id LRE values Dilution factor Nil Nav LDA values F1.1, 3-d.p.p. 40,297 40,000 7 1.05 41,993

F1.1, 3-d.p.i. 137,822 140,000 8 0.92 128,281

C166 DNA 19,338 20,000 6 1.20 24,079

2.5.2 Transcript abundance in parasitized larvae

TrIV rep genes displayed important differences in gene-specific, time-dependent and tissue-specific levels of transcripts in naturally parasitized last-stadium C. fumiferana larvae. In whole caterpillars, transcripts were detected for almost all genes examined, but transcript abundance was generally low [< 550 transcripts/ng total RNA] except for F1-1 (~16,000 at 3 days p.p.) and, to a lesser extent, F1-2 (~2,200 at 1 days p.p.; Fig 2-1). Whether these differences in transcript abundance among rep genes are indicative of their relative importance in the subjugation of C. fumiferana hosts is not clear, but the strong predominance of F1-1 transcripts suggests that the product of this gene plays a vital role in the success of parasitism.

Levels of rep gene transcripts were not stable during the course of parasitism and tended to decrease by > 50% between the first (day 1) and last (day 5) sampling points p.p., although three genes (most notably F1-1) displayed higher levels of transcripts at 3 d p.p. than at the other two sampling times (Fig 2-1). A temporal pattern of expression similar to that observed here for F1-1 was reported earlier for another TrIV gene, TrV1, in parasitized C. fumiferana larvae (Béliveau et al., 2000). Differences in temporal patterns of expression among viral genes, in a given host, have been observed for other PDVs, including examples where maximal transcript levels were seen several days after oviposition (e.g., Ibrahim et al., 2007). Although such differences suggest that individual PDV gene products may target specific phases of parasitism, the observed transcriptional patterns may be dictated, at least in part, by the stability of the viral genome segments from which transcripts are generated, a variable that could differ considerably according to whether or not the developing wasp larva feeds on infected tissues supporting viral gene expression (Beck et al., 2007).

Figure 2-1 Transcript levels of 17 TrIV rep genes in naturally parasitized C. fumiferana 6th instar larvae, as determined by quantitative real-time RT-PCR using total RNA extracted from whole caterpillars, 1, 3 and 5 days post-parasitization (p.p.). Larvae were parasitized within 24 h after the molt to the 6th (last) stadium. Actual transcript numbers are provided above each bar for values  50. Each value presented here is the mean of four technical replicates carried out on an RNA extract obtained from a pool of 3-5 parasitized larvae. Error bars: SD.

In our investigation of tissue-specific transcription at 2 d p.p., the overall gene-specific pattern of transcript abundance (Fig 2-2) was similar to that observed in whole larvae (Fig 2-1), but with some notable exceptions. For example, in the four tissues examined, F1-2 displayed lower proportions of transcripts relative to F1-1 than in whole larvae, while the opposite trend was observed for F3-2. This suggests that the tissues supporting high levels of F1-2 transcription were not sampled in the present study, whereas some of the sampled tissues were enriched for F3-2 transcripts. More significantly, TrIV rep genes exhibited important differences in their tissue specificity: whereas F1-1 transcripts were most abundant in C. fumiferana cuticular epithelium and fat body, corroborating earlier assessments made by northern blot analysis (Volkoff et al., 2002), the transcripts of several other genes were at higher levels in haemocytes (B2-2, C7-2, F3-2) or the midgut (C4-2, D5-2, D6-1 , F1-2) than in the other three tissues (Fig 2-2). These results are in contrast with those obtained by Galibert et al. (2006), who found that the fat body and cuticular epithelium of parasitized Spodoptera littoralis hosts had the highest levels of HdIV rep transcripts for all 10 rep ORFs examined, followed by nervous tissue, which was not investigated in the present study. It remains to be seen whether the observed

trend in HdIV rep gene expression was influenced by the choice of rep ORFs that were studied, as we now know that the HdIV genome contains many additional rep genes (A.- N. Volkoff, personal communication). Thus, this apparent difference between the two biological systems could be due to a gene sampling bias.

Tissue-specific differences in polydnavirus gene transcript abundance in parasitized hosts have also been observed for ichnovirus ank genes (Kroemer & Webb, 2005) and bracovirus PTP genes (Gundersen-Rindal & Pedroni, 2006; Provost et al. 2004). Such tissue-specific expression suggests that the diversity of genes within a given PDV gene family may be associated with the existence of tissue-specific roles for different family members in the caterpillar hosts, or that some of these related gene products, while having the same function, are more effective in one tissue than in another. Irrespective of its functional significance, tissue-specific variation in transcript levels implies that there exist tissue-specific host factors modulating the transcription of specific rep genes.

2.5.3 Transcript abundance in CF-injected larvae

The TrIV rep transcript levels observed in CF-injected larvae (Fig 2-3) displayed gene- specific and time-dependent differences similar to those observed for parasitized whole larvae (Fig 2-1), with the exception that absolute transcript levels were generally much higher than those observed at equivalent sampling times in parasitized larvae, particularly 1 d after treatment (> 85 times higher in the case of F1-1), indicating that the virus dose contained in 0.5 FE of CF is much higher than that injected by a female wasp during natural parasitization. As a point of comparison, the dose of virus injected by the wasp Microplitis demolitor into its host has been estimated to be between 0.04 and 0.005 FE of CF per ovipositional event (Beck et al., 2007).

Figure 2-3 Transcript levels of 17 TrIV rep genes in 6th instar larvae injected with 0.5 FE of T. rostrale calyx fluid, as determined by quantitative real-time RT-PCR using total RNA extracted from whole caterpillars, 1, 3 and 5 d post-injection (p.i.). Larvae were injected within 24 h after the molt to the 6th (last) stadium. Actual transcript numbers are provided above each bar for values < 2,000. Each value presented here is the mean of four technical replicates carried out on an RNA extract obtained from a pool of 3-5 injected larvae. Error bars: SD.

Another difference between patterns found for parasitized and CF-injected larvae was the rise seen in F1-1 transcript abundance on 3 d p.p., an increase that was not observed in injected caterpillars, although absolute levels of F1-1 transcripts were higher in the latter than in the former group, at all three sampling points. With few exceptions, transcript levels decreased substantially from day 1 to days 3 and 5 p.i., suggesting that the unusually high inoculum injected in larvae may have triggered, in the host, faster clearance or breakdown of some viral DNA than in parasitized caterpillars. The present qPCR findings for F1-1 (= TrFrep1) are in agreement with an earlier assessment made by northern blot analysis which showed F1-1 to be transcribed at much higher levels in CF- injected larvae than in parasitized caterpillars (Volkoff et al., 2002).

2.5.4 Transcript abundance in wasp ovary and head-thorax complexes

The pattern of TrIV rep gene transcription in T. rostrale ovaries was markedly different from that seen in naturally parasitized or CF-injected C. fumiferana larvae. Whereas F1-1 and F1-2 were the most highly expressed rep genes in infected caterpillars (Figs 2-1, 2-2 and 2-3), transcripts generated from these two genes displayed low abundance in wasp ovaries compared with other genes such as C166-1, the transcript levels of which were by far the highest (Fig 2-4).

Interestingly, the C3-1 gene, whose transcription was barely detectable in infected caterpillars (Figs 2-1, 2-2 and 2-3), was the second most highly transcribed gene in wasp ovaries. In addition, the transcript levels of C3-2, C7-2, D5-2 and F3-2, which were modest in infected C. fumiferana larvae (Figs 2-1, 2-2 and 2-3), varied between ~5,000 and 10,000 per ng total RNA in wasp ovaries (Fig 2-4). In comparison, all TrIV rep genes had undetectable or very low transcript levels in wasp head-thorax complexes (Fig 2-4).

Figure 2-4 Transcript levels of 17 TrIV rep genes in T. rostrale ovaries and head-thorax complexes, as determined by quantitative real-time RT-PCR. Total RNA was extracted from five ovary pairs dissected from post- emergence 5-10 day-old T. rostrale females and from the head-thorax complexes of the same females. Each value presented here is the mean of four technical replicates carried out on each RNA extract. Actual transcript numbers are provided above each bar for values < 500. Error bars: SD.

Using northern blot analysis, Theilmann and Summers (1988) provided the first report on the transcription of CsIV rep genes in C. sonorensis female reproductive tissues. These authors observed that some rep genes were transcribed exclusively in the parasitized host while others produced transcripts only in wasp ovaries or in both hosts. The quantitative transcriptional data provided here for 17 TrIV rep genes in both parasitized hosts and wasp ovaries are in agreement with that earlier finding. The distinct transcriptional patterns of rep genes in T. rostrale ovaries (Fig 2-4) and parasitized or CF-injected larvae (Figs 2-1, 2-2 and 2-3) suggest that individual rep genes may play either wasp- or caterpillar-specific roles. In contrast, HdIV rep1 was the most highly expressed rep gene in both infected caterpillar hosts and wasp ovaries (Galibert et al., 2006), suggesting that the host-specific expression reported here may not apply to all ichnoviruses. With respect to TrIV, the observation that some rep genes may be expressed only in the wasp (e.g., C3-1) raises the questions as to (i) why such genes are found in a packaged virus meant to be delivered to the lepidopteran host and (ii) whether there are additional, unpackaged

rep genes in the T. rostrale genome, expressed only in wasp ovaries. Of course, the possibility exists that some of the TrIV rep genes that were found to be weakly expressed in parasitized C. fumiferana larvae would be expressed strongly in other lepidopteran hosts (e.g., C. rosaceana; Cusson et al., 1998) or tissues not sampled yet, including genes that were found here to be expressed only in the ovary. Additionally, it is not quite clear whether rep genes that are expressed in the wasp ovary are transcribed from episomal or chromosomal DNA, or both. Interestingly, none of the rep genes that were found to be expressed in T. rostrale ovaries were transcribed at significant levels in the other wasp tissues examined (Fig 2-4), thus suggesting an ovary-specific role for those that are transcribed in that tissue. Given that rep gene products are not predicted to be secreted, rep proteins expressed in wasp ovaries are not expected to be released in the lumen of the oviduct for subsequent injection into the caterpillar during parasitization. For this reason, their expression in the ovary suggests that they could play a role in virus replication, a hypothesis that could be tested by following developmental changes in ovarian rep transcript abundance in pupae, the stage at which virus replication begins (Marti et al., 2003; Webb & Summers 1992).

2.5.5 Gene dosage

In earlier work examining the relationship between the abundance of PDV gene transcripts and the proportion of the genome segments bearing these genes within the packaged viral genome, no clear correlation between the two variables was observed (Beck et al., 2007; Galibert et al., 2006). Here, the three most highly expressed TrIV rep genes in parasitized caterpillars, F1-1, F1-2 and C166-1 (Fig 2-1), were found to be borne by the two most abundant TrIV genome segments (Fig 2-5), suggesting that gene dosage, in this particular instance, may have some impact on transcript abundance.

Yet, when all TrIV rep genes were considered, we observed no significant correlation between transcript levels and the proportion of the originating genome segments. Clearly, factors other than, or in addition to, gene dosage affect transcript levels, including possible differences in promoter strength, the presence or absence of host factors that

may affect the transcription of individual rep genes and/or differences in mRNA stability. For example, there were important differences in the abundance of F1-1 and F1-2 transcripts, which are generated from genes present on the same genome segment. Integration of genome segment F1 into the lepidopteran host genomic DNA could also be a factor resulting in the enhancement of F1-1 and F1-2 transcription. Although the integration of genome segment F1 has not been demonstrated in the parasitized host, it clearly occurs in infected C. fumiferana CF-124T cells in culture (Doucet et al., 2007). Such an integrational event would permit sustained expression of the integrated genes when titers of episomal DNA go down. The question of whether other rep-containing genome segments undergo integration into C. fumiferana genomic DNA remains to be examined.

Figure 2-5 Assessment of genome segment abundance within the TrIV packaged genome, as determined by quantitative real-time PCR using viral DNA as template. The same primer pairs used for transcript quantification were used to quantify genome segments. C166 and C289 are contigs associated with genome segments that have not been cloned and that remain partially sequenced (Tanaka et al., 2007). Error bars: SD.

2.5.6 Comparison of TrIV rep proteins and identification of non- polydnaviral rep homologs

A ClustalX alignment of all 17 deduced TrIV rep proteins revealed regions that are well conserved across all members of this family, including five cysteine residues that are present in all proteins except C7-2; the latter lacks the second and third cysteines, and its N terminus is substantially truncated relative to the other TrIV rep proteins (Fig 2-6). The most conserved region is observed in the vicinity of the fifth cysteine residue (Fig 2-6), comprising a segment of ~18 amino acids that also appears well conserved among rep proteins from other ichnoviruses, including those of Hyposoter fugitivus (HfIV) and HdIV (Fig 2-7). A blastp search using all TrIV rep proteins as query sequences revealed the existence of two putative rep homologs in the granulovirus of Helicoverpa armigera (HearGV), the genome of which has recently been sequenced and annotated (Harrison & Popham, 2008). One of these two proteins, hear76, has only 70 amino acid residues and displays a modest level of similarity to ichnoviral rep proteins (e.g., blastp expect value of 0.36 for similarity to TrIV F3-1); however, the other predicted protein, hear75, has 171 amino acid residues, contains 4 of the 5 conserved cysteine residues referred to above, and shows significant similarity to many ichnoviral rep proteins, most notably within the aforementioned highly conserved region (Fig. 2-7).

Blastp expect values for similarity between hear75 and ichnoviral rep proteins varied between 6e-09 and 3e-05 for HfIV-D3-2 and TrIV-F3-1, respectively. No rep homologs have been detected in the other baculovirus genomes sequenced to date; thus, their presence in HearGV may well be the result of lateral gene transfer from an ichnovirus genome (Harrison & Popham, 2008).

As observed in earlier analyses of rep proteins, no conserved domains were detected in any of the 17 TrIV representatives of this family, with the exception of F1-2, in which a PIWI-like domain was detected in the region comprised between residues 60 and 150, but with a low (0.001) expect value. The same protein was also found to display a modest level of similarity to a bacterial transposase (accession number: ABM04822) within its C terminus, an interesting observation given that TrIV genome segment F1 has been shown

to spontaneously integrate into the genome of C. fumiferana cells in culture, through an unidentified mechanism (Doucet et al., 2007).

Although the new bioinformatics analyses performed here provided few new insights into the function(s) of rep genes, the presence of rep homologs in the recently sequenced genome of a granulovirus could eventually provide an indirect means of assessing their role through the production of a HearGV rep knock-out, followed by an assessment of this genetic alteration on viral replication or other aspects of the infection cycle. Deployment of this strategy, however, would require the prior development of an efficient in vitro system for HearGV.

In summary, the present study suggests that the very high level of diversification seen within the ichnoviral rep gene family may have evolved in response to the necessity to fine-tune the function(s) and/or effectiveness of rep proteins for expression in different hosts and tissues. Given that rep genes encode proteins that are not secreted and that some of them are expressed at relatively high levels in wasp ovaries without any overt pathological consequence, the possibility exists that their function has more to do with cell homeostasis (in IV- or GV-infected lepidopteran cells or in ovarian wasp cells supporting viral replication) than virulence. Some PDV-encoded proteins are secreted and display deleterious effects on other cells (e.g., Béliveau et al., 2003); because PDVs do not replicate in the lepidopteran host, sustained viral gene expression for the duration of immature parasitoid development is predicted to require a mechanism preventing infected cells from being negatively affected by secreted PDV proteins and/or suppressing breakdown of viral DNA and transcripts by host cells. Some Campoletis sonorensis ichnovirus (CsIV) ank gene products appear to have such a function given that they have been shown to delay lysis of baculovirus-infected cells (Fath-Goodin et al., 2006). We are currently examining the effect of TrIV rep gene expression on C. fumiferana host cell gene expression, with the aim of identifying the pathway(s) targeted by rep proteins.

Figure 2-6 ClustalX alignment of all known and predicted TrIV rep family proteins. Black arrows indicate the positions of conserved cysteine residues. Asterisks (*), double dots (:) and single dots (.) above letters in the alignments denote identical residues, and conserved and semi-conserved substitutions, respectively. GenBank accession numbers: C7-1, BAF45598; C7-2, BAF45599; D5-1, BAF45610; D5-2, BAF45611; C289-1, BAF45769; C3-2, BAF45588; F3-2, BAF45626; F3-3, BAF45627; F3-1, BAF73402; C4-1, BAF45589; C4-2, BAF45590; B2-2, BAF45579; C3-1, BAF45585; D6-1, BAF45614; F1-1, AAN32723; F1-2, ACJ72220; C166-1, BAF45767.

Figure 2-7 ClustalX alignment of selected ichnoviral rep proteins from TrIV, HfIV, and HdIV, as well as a rep- like protein from the granulovirus HearGV. Black arrows indicate the positions of conserved cysteine residues; the grey arrow points to the third conserved cysteine residue, which is replaced by an alanine in the HearGV rep-like protein. Asterisks (*), double dots (:) and single dots (.) above letters in the alignments denote identical residues, and conserved and semi-conserved substitutions, respectively. GenBank accession numbers: HfIV-D3-2, BAF45718; HfIV- D10-2, BAF45741; TrIV-F3-1, BAF73402; HdIV-rep5, AAR89177; HearGV-hear75, ABY47766.

Acknowledgements

The authors thank AN Volkoff for fruitful discussions about the work of her group on HdIV rep genes and D Stoltz for helpful comments on an earlier version of the manuscript. This research was supported by grants from the Canadian Forest Service (CFS) and a Discovery grant from the Natural Sciences and Engineering Research Council of Canada to MC.

2.6 References

1. Beck, M. H., Inman, R. B. & Strand, M. R. (2007). Microplitis demolitor bracovirus genome segments vary in abundance and are individually packaged in virions. Virology. 359, 179-189.

2. Béliveau, C., Laforge, M., Cusson, M. & Bellemare, G. (2000). Expression of a Tranosema rostrale polydnavirus gene in the spruce budworm, Choristoneura fumiferana. J. Gen. Virol. 81, 1871-1880.

3. Béliveau, C., Levasseur, A., Stoltz, D. & Cusson, M. (2003). Three related TrIV genes: comparative sequence analysis and expression in host larvae and Cf-124T cells. J Insect Physiol 49, 501-511.

4. Cusson, M., Barron, J. R., Goulet, H., Régnière, J. & Doucet, D. (1998). Biology and status of Tranosema rostrale (Hymenoptera: Ichneumonidae), a parasitoid of the eastern spruce budworm (Lepidoptera: Tortricidae). Ann. Entomol. Soc. Am. 91, 87-93.

5. Doucet, D. & Cusson, M. (1996a). Alteration of developmental rate and growth of Choristoneura fumiferana parasitized by Tranosema rostrale: role of the calyx fluid. Entomol. Exp. Appl. 81, 21-30.

6. Doucet, D. & Cusson, M. (1996b). Role of calyx fluid in alterations of immunity in Choristoneura fumiferana larvae parasitized by Tranosema rostrale. Comp. Biochem. Physiol. 114A, 311-317.

7. Doucet, D., Levasseur, A., Béliveau, C., Lapointe, R., Stoltz, D. & Cusson, M. (2007). In vitro integration of an ichnovirus genome segment into the genomic DNA of lepidopteran cells. J. Gen. Virol. 88, 105-113.

8. Eggleton, P. & Belshaw, B. (1993). Comparisons of dipteran, hymenopteran and coleopteran parasitoids: provisional phylogenetic explanations. Biol. J. Linn. Soc. 48, 213-226.

9. Falabella, P., Varricchio, P., Provost, B., Espagne, E., Ferrarese, R., Grimaldi, A., Eguileor, M., Fimiani, G., Ursini, M. V. & other authors (2007). Characterization of the IκB-like gene family in polydnaviruses associated with wasps belonging to different braconid subfamilies. J. Gen. Virol. 88, 92-104.

10. Fath-Goodin, A., Gill, T. A., Martin, S. B., & Webb, B. A. (2006). Effect of Campoletis sonorensis ichnovirus Cys-motif proteins on Heliothis virescens larval development. J. Insect. Physiol. 52, 576-585.

11. Galibert, L., Devauchelle, G., Cousserans, F., Rocher, J., Cérutti, P., Barat- Houari, M., Fournier, P. & Volkoff, A. N. (2006). Members of the Hyposoter didymator Ichnovirus repeat element gene family are differentially expressed in Spodoptera frugiperda. J. Virol. 3, 48.

12. Gundersen-Rindal, D.E. & Pedroni, M. J. (2006). Characterization and transcriptional analysis of protein tyrosine phosphatase genes and an ankyrin repeat gene of the parasitoid Glyptapanteles indiensis polydnavirus in the parasitized host. J. Gen. Virol. 87, 311-322.

13. Harrison, R. L. & Popham, H. J. R. (2008). Genomic sequence analysis of a granulovirus isolated from the Old World bollworm, Helicoverpa armigera. Virus Genes 36, 565-581.

14. Ibrahim, A. M., Choi, J.Y., Je, Y.H., Kim, Y. (2007). Protein tyrosine phosphatases encoded in Cotesia plutellae bracovirus: sequence analysis, expression profile, and a possible biological role in host immunosuppression. Dev. Comp. Immunol. 31, 978-990.

15. Kroemer, J. A. & Webb, B. A. (2004). Polydnavirus genes and genomes: emerging gene families and new insights into polydnavirus replication. Annu. Rev. Entomol. 49, 431-456.

16. Kroemer, J. A. & Webb, B. A. (2005). IκB-related vankyrin genes in the Campoletis sonorensis ichnovirus: temporal and tissue-specific patterns of

expression in parasitized Heliothis virescens lepidopteran hosts. J. Virol. 79, 7617-7628.

17. Marti, D., Grossniklaus-Bürgin, C., Wyder, S., Wyler, T., & Lanzrein, B. (2003). Ovary development and polydnavirus morphogenesis in the parasitic wasp Chelonus inanitus. I. Ovary morphogenesis, amplification of viral DNA and ecdysteroid titres. J. Gen. Virol. 84, 1141-1150.

18. Provost, B., Varricchio, P., Arana, E., Espagne, E., Falabella, P., Huguet, E., La Scaleia, R., Cattolico, L., Poirié, M., & other authors. (2004). Bracoviruses contain a large multigene family coding for protein tyrosine phosphatases. J. Virol. 78, 13090-13103.

19. Rutledge, R. G. & Stewart, D. (2008a). A kinetic-based sigmoidal model for the polymerase chain reaction and its application to high-capacity absolute quantitative real-time PCR. BMC Biotechnol. 8, 47.

20. Rutledge, R. G. & Stewart, D. (2008b). Critical evaluation of methods used to determine amplification efficiency refutes the exponential character of real-time PCR. BMC. Mol. Bio. 9, 96.

21. Stoltz, D. B. (1993). The polydnavirus life cycle. In Parasites and Pathogens of Insects, Vol. 1, pp. 80-101. Edited by N. Beckage, S. N. Thompson & B. A. Federici. San Diego, CA: Academic Press.

22. Stoltz, D. B., Guzo, D. & Cook, D. (1986). Studies on polydnavirus transmission. Virology. 155, 120-131.

23. Tanaka, K., Lapointe, R., Barney, W. E., Makkay, A. M., Stoltz, D., Cusson, M. & Webb, B. A. (2007). Shared and species-specific features among ichnovirus genomes. Virology. 363, 26-35.

24. Theilmann, D. A. & Summers, M. D. (1987). Physical analysis of the Campoletis sonorensis virus multipartite genome and identification of a family of tandemly repeated elements. J. Virol. 61, 2589-2598.

25. Theilmann, D. A. & Summers, M. D. (1988). Identification and comparison of Campoletis sonorensis virus transcripts expressed from four genomic segments in the insect hosts Campoletis sonorensis and Heliothis virescens. Virology. 167, 329-341.

26. Thoetkiattikul, H., Beck, M. H. & Strand, M. R. (2005). Inhibitor κB-like proteins from a polydnavirus inhibit NF-κB activation and suppress the insect immune response. Proc. Natl. Acad. Sci.USA. 102, 11426-11431.

27. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic. Acids. Res. 24, 4876-4882.

28. Volkoff, A. N., Béliveau, C., Rocher, J., Hilgarth, R., Levasseur, A., Duonor- Cérutti, M., Cusson, M. & Webb, B. A. (2002). Evidence for a conserved polydnavirus gene family: ichnovirus homologs of the CsIV repeat element genes. Virology 300, 316-331.

29. Wang, Z. & Spadoro, J. (1998). Determination of target copy number of quantitative standards used in PCR-based diagnostic assays. In Gene Quantification pp. 31-43. Edited by F. Ferré. Boston: Birkhäuser.

30. Webb, B. A., Strand, M. R., Dickey, S. E., Beck, M. H., Hilgarth, R. S., Barney, W. E., Kadash, K., Kroemer, J. A., Lindstrom, K. G. & other authors (2006). Polydnavirus genomes reflect their dual roles as mutualists and pathogens. Virology 347, 160-174.

31. Webb, B. A. & Summers, M. D. (1992). Stimulation of polydnavirus replication by 20-hydroxyecdysone. Experientia 48, 1018-

CHAPITRE 3 Global transcriptional profile of Tranosema rostrale ichnovirus genes in infected lepidopteran hosts and wasp ovaries1

3.1 Abstract

The ichnovirus TrIV, transmitted by the endoparasitic wasp Tranosema rostrale to its lepidopteran host during oviposition, replicates asymptomatically in wasp ovaries and causes physiological dysfunctions in parasitized caterpillars. The need to identify ichnoviral genes responsible for disturbances induced in lepidopteran hosts has provided the impetus for the sequencing and annotation of ichnovirus genomes, including that of TrIV. In the latter, 86 putative genes were identified, including 35 that could be assigned to recognized ichnoviral gene families. With the aim of assessing the relative importance of each TrIV gene, as inferred from its level of expression, and evaluating the accuracy of the gene predictions made during genome annotation, the present study builds on an earlier qPCR quantification of transcript abundance of TrIV rep ORFs, in both lepidopteran and wasp hosts, extending it to other gene families as well as to a sample of

1 This chapter has been accepted for publication in the journal Virologica Sinica, and is to be included in a special issue on insect viruses. Rasoolizadeh A, Dallaire F, Stewart D, Beliveau C, Cusson M, Global transcriptional profile of Tranosema rostrale ichnovirus genes in infected lepidopteran hosts and wasp ovaries. Virologica Sinica in press.

unassigned ORFs. We show that the majority (91%) of putative ORFs assigned to known gene families are expressed in infected larvae, while this proportion is lower (67%) for a sample taken among the remaining ORFs. Selected members of the TrV and rep gene families are shown to be transcribed in infected larvae at much higher levels than genes from any other TrIV gene family, pointing to their likely involvement in host subjugation. In wasp ovaries, the transcriptional profile is dominated by a rep gene and a member of a newly described gene family encoding secreted proteins displaying a novel cysteine motif, which we identified among previously unassigned ORFs.

3.2 Résumé

L’ichnovirus TrIV est transmis par la guêpe endoparasitoïde Tranosema rostrale à son hôte lépidoptère, Choristoneura fumiferana, au moment de la ponte. TrIV se réplique de façon asymptomatique dans les ovaires de T. rostrale et entraîne des perturbations physiologiques chez les chenilles parasitées. La nécessité d'identifier les gènes responsables des perturbations induites par les ichnovirus chez les hôtes lépidoptères a donné l'impulsion initiale au séquençage et à l'annotation de trois génomes ichnoviraux, y compris celui de TrIV. Chez ce dernier, on a identifié 86 gènes, dont 35 qui ont pu être attribués à des familles de gènes ichnoviraux déjà connues. Dans le but d'évaluer l'importance relative de chaque famille de gènes de TrIV, tel qu’estimée par le niveau d'expression de chaque gène, et d'évaluer l'exactitude des prédictions géniques faites au moment de l'annotation du génome, nous avons bonifié une étude précédente, laquelle portait sur la quantification des transcrits des gènes rep de TrIV chez l’hôte lépidoptère et la guêpe, en l'étendant à d'autres familles de gènes, ainsi qu’à un échantillon de gènes non-attribués (i.e., qui n’ont pas d’homologues connus). Nous montrons que la majorité (91%) des gènes attribués à des familles de gènes connues sont exprimés dans les larves infectées, cette proportion étant plus faible (67%) pour un échantillon les gènes non- attribués. Certains membres des familles TrV et rep se sont avérés être transcrits, dans les larves infectées, à des niveaux beaucoup plus élevés que les gènes des autres familles, suggérant un rôle important pour ces deux familles dans la subjugation de l'hôte. Dans les ovaires de T. rostrale, le profil transcriptionnel était dominé par un gène rep ainsi que par

un gène d'une famille nouvellement identifiée parmi les gènes non-attribués ; ces gènes codent pour des protéines qui sont sécrétées et qui affichent un nouveau motif cystéine.

3.3 Introduction

The complex and singular life cycle of polydnaviruses (PDVs) has fascinated biologists ever since these unusual viral entities were first reported in the scientific literature. As such, they have raised countless questions, many of which have been addressed through experimental work focusing on the elucidation of their functions and origins.

PDVs are dsDNA viruses whose genome is made up of multiple circular segments. Their replication is confined to the ovaries of some endoparasitic wasps, where viral DNA is generated from a copy of the viral genome permanently maintained within the wasp genome. Virions are assembled in the nuclei of ovarian calyx cells and subsequently released into the lumen of the oviducts. They are later injected into a lepidopteran host during the process of parasitization (i.e., egg laying); in this host, no viral replication takes place but expression of PDV genes induces immune and developmental disturbances that are essential to the successful completion of wasp development. For this reason, the association of PDVs with parasitic wasps has been described as mutualistic (14, 22).

Recent endeavors in the area of PDV genome sequencing and annotation (7, 12, 16, 23, 26) have generated a wealth of data and new hypotheses about the evolution of these intriguing insect viruses, as well as new questions about the diversification and functions of the new putative genes identified in their genomes.

In the three campoplegine ichnoviruses (IV) (PDVs associated with ichneumonid wasps of the subfamily Campopleginae) whose genomes have been sequenced [Campoletis sonorensis IV (CsIV), Hyposoter fugitivus IV (HfIV) and Tranosema rostrale IV (TrIV); 23, 26], approximately half of the predicted ORFs have been assigned to previously described or characterized gene families, such as those encoding proteins that display significant sequence or structural similarity to proteins found in other organisms (inx,

ank, and Cys-motif), while members of the remaining families were identified on the basis of similarity to previously characterized IV transcripts (rep and TrV families) or because of the demonstrated existence of related putative ORFs among two or more IV genomes (N, PRRP). All other putative ORFs, which constitute the remaining half, could not be readily assigned to specific gene families as they did not display similarity to known proteins (“unassigned” ORFs).

Annotation of the TrIV genome revealed the presence of several gene families. The repeat element family (rep) is the largest with 17 members, followed by the TrV family (7 members), N family (4 members), inx family (3 members), ank family (2 members), Cys-motif (1 member) and PRRP (1 member). The remaining putative ORFs (59%) could not be assigned to any known family (23).

In earlier studies, we assessed the transcription of selected TrIV genes from the rep (TrFrep1; 25) and TrV (TrV1, TrV2 and TrV4; 1, 2, 5) families in the lepidopteran host Choristoneura fumiferana by Northern blot analysis. More recently, we conducted a detailed qPCR analysis of the abundance of all 17 TrIV rep transcripts, in both lepidopteran and wasp hosts (19). This study indicated that two TrIV rep genes, F1-1 and F1-2 (= TrFrep1 and TrFrep2), are expressed at much higher levels than all other members of this family in infected C. fumiferana larvae. In addition, the rep transcriptional profile seen in T. rostrale ovaries was found to be markedly different from that observed in infected caterpillars.

For the present study, we wanted to extend the latter qPCR analysis to other putative ORFs identified during annotation of the TrIV genome, so as to assess the accuracy of our gene predictions and to generate a global transcriptional profile for a large sample of TrIV genes across all known families and among unassigned genes. Here, we show that a high proportion of genes identified during annotation are expressed in either the caterpillar or wasp (ovaries) host, but that some members of the TrV and rep families are expressed at much higher levels in infected caterpillars than genes from any other TrIV gene family examined, suggesting that selected members of these two families play a critical role in host subjugation. Similarly, the transcripts generated by another rep gene

and a previously unassigned gene clearly outnumber all other TrIV transcripts in wasp ovaries. This previously unassigned gene is shown to belong to a new family of four genes encoding secreted proteins expressed almost exclusively in wasp ovaries and displaying a novel cysteine motif.

3.4 Materials and Methods

3.4.1 RNA extraction

Choristoneura fumiferana larvae were either parasitized by T. rostrale within 24 h after the molt to the last instar or injected with 0.5 female equivalents (FE) of calyx fluid (CF), as described (9, 10). Total RNA was extracted from five larvae of each group 3 d post- parasitization (p.p.) or post-injection (p.i.), using TRIZOL reagent (Invitrogen), according to the manufacturer’s instructions (1). In addition, total RNA was extracted and pooled from five ovary pairs dissected from post-emergence 5-10 day-old T. rostrale females, using the QIAshredder and RNeasy Mini Kit (Qiagen), according to the manufacturer’s instructions.

3.4.2 cDNA library construction

A cDNA library was constructed as described (19) using RNA extracted from CF- injected C. fumiferana larvae. Briefly, 3 µg of total RNA was reverse-transcribed using an oligo-dT primer with the following sequence: TTTTGTACAAGC (T)16, followed by synthesis of the second cDNA strand and ligation of an adaptor; the latter was used for amplification of the cDNA using an adaptor-specific primer (ASP; 5´- CTAATACGACTCACTATAGGGC-3´) in conjunction with the oligo dT primer. PCR amplification was performed using 0.1 µM of primers, 0.3 mM of each dNTP and 1.5 U of Taq platinum High Fidelity (Invitrogen) in 1x PCR High Fidelity buffer (Invitrogen),

containing MgSO4 (2 mM). The conditions consisted of a first heating step at 94ºC for 2 min, and then 20 cycles of 94ºC, 30 s; 55ºC, 1 min; 68ºC, 5 min.

3.4.3 Bioinformatics analyses

To determine whether some of the TrIV ORFs that had not been assigned to a known gene family (23) could form new families, we conducted local blast (Blastp) searches against a TrIV unassigned ORF data base, followed by a multiple amino acid sequence alignment performed by ClustalW2, subsequently adjusted manually for one of the identified families. For amino acid composition analysis and signal peptide predictions, we used ProtParam3 and SignalP4, respectively. Disulfide bond predictions were made using the Scratch Protein Predictor5.

3.4.4 Amplification of ORF-specific cDNAs from the cDNA library

To determine which of the putative ORFs identified in the genome of TrIV were expressed in TrIV-infected larvae, we first conducted PCR amplifications of predicted TrIV ORFs from the above cDNA library. Primers were designed within the coding sequence of each putative ORF (Supplemental Data in Annexe C Table C-1). Two µl of a 25x dilution of the cDNA library was used for PCR amplification, with 0.25 µM of each primer and 0.2 mM of each dNTP, in 1x PCR buffer. After a hot start at 94ºC for 3 min, PCR was carried out by addition of 2 U of Tag DNA polymerase at 80ºC. The rest of the cycling conditions were as follows: 30 cycles of 94ºC, 45 s; 48ºC, 45 s; 72ºC, 1 min; and a final extension step at 72ºC for 5 min. The amplification products were then cloned into pGEM-T easy vector (Promega) according to the manufacturer’s instructions and subjected to sequence analysis.

2 http://www.ebi.ac.uk/Tools/clustalw2/index.html 3 http://www.expasy.ch/tools/protparam.html 4 http://www.cbs.dtu.dk/services/SignalP/ 5 http://www.ics.uci.edu/~baldig/scratch/

3.4.5 Reverse transcription and quantitative real-time PCR (qPCR)

To remove DNA contaminants from RNA extracts, 500 ng of total RNA was treated with 2 U amplification-grade DNase I (Invitrogen) for 15 min at 25°C. We ran no-RT controls for the four most highly transcribed ORFs and detected no significant amplification, pointing to the virtual absence of genomic DNA contamination in the extracts. 500 ng RNA from parasitized and CF-injected C. fumiferana larvae, and 200 ng RNA from ovarian tissue was reverse-transcribed using 0.5 µg of an oligo(dT) primer and 200 U Superscript II RNase H- reverse transcriptase (Invitrogen). The reaction was carried out in 1x PCR buffer, with 0.5 mM of each dNTP and 40 U of RNAguard ribonuclease inhibitor (Amersham Biosciences), at 42˚C for 50 min.

For qPCR analysis, four primers were initially designed for each TrIV gene, using diverse regions among aligned nucleotide sequences. These four primer pairs were used to assess primer performance and quantitative precision. Initial amplification tests were conducted on reverse-transcribed RNA obtained from parasitized C. fumiferana larvae. A single primer pair was then selected for each gene (see Supplemental Data in Annexe C Table 2), based upon high amplification efficiency and lack of non-specific amplification products, and used for the analysis of the remaining samples.

PCR amplifications were carried out on aliquots of individual RT reactions containing cDNA in amounts equivalent to 2.5 ng RNA, except for ovarian samples, which contained amounts of cDNA equivalent to 1 ng RNA. Four replicate amplification reactions containing 500 nM of each primer were conducted for each sample, using an MX3000P spectrofluorometric thermal cycler (Stratagene) and QuantiTect TM SYBR Green PCR Kit (Qiagen), initiated with a 15-min incubation at 95˚C, followed by a cycling regime of 95˚C, 10 s and 65˚C, 2 min. Each run was completed with a melting curve analysis to confirm the specificity of amplification and absence of primer dimers. Amplification efficiency was determined for each amplification reaction using LRE (“linear regression of efficiency”) analysis, and the number of target molecules calculated using lambda genomic DNA as a quantitative standard (20, 21; see 19 for details).

3.5 Results

3.5.1 Detection of TrIV transcripts in infected larvae

As a first step towards determining which of the known and putative TrIV genes are expressed in infected C. fumiferana hosts, we conducted ORF-specific PCR amplifications from a cDNA library constructed using RNA from TrIV-injected C. fumiferana last-instars, 3 d p.i. Using this approach, transcripts were detected for 77% of all assigned TrIV ORFs, while only 42% for the 12 unassigned ORFs that we sampled generated amplification products (Table 3-1). These proportions increased to 91% and 67%, respectively, when the presence of gene-specific transcripts was assessed using the more sensitive qPCR-LRE approach (Table 3-1). Thus, the vast majority of TrIV genes assigned to specific families during genome annotation were found to be expressed in TrIV-infected C. fumiferana larvae; for unassigned genes, this proportion was lower, based on the present sample. Furthermore, as indicated in the quantitative analyses presented below, some TrIV genes were found to be expressed almost exclusively in T. rostrale ovaries.

Table 3-1 Overall assessment of the expression (detected or not; + or ) of known and predicted TrIV ORFs in TrIV-infected C. fumiferana larvae. The list of genes includes all those assigned to known IV gene families and 12 of 51 predicted ORFs that could not originally be assigned to a family (23)6

Gene family id ORF id Alter. name PCR1 qPCR1

B2-1 + +

C3-1  +

C3-2 + +

C4-1 + +

C4-2  +

C7-1  +

C7-2 + +

C166 Rep166 + +

Rep C289  +

D5-1 + +

D5-2  +

D6-1 + +

F1-1 TrFrep1 + +

F1-2 TrFrep2 + +

F3-1 + +

F3-2 + +

F3-3 + +

C1-1 Ank 1 + + Ankyrin C1-2 Ank 2 + +

Cys-motif C111-1 Cys + +

6 Two approaches were used to make this assessment: (i) PCR amplification of gene-specific cDNAs from a library constructed from 6th instar larvae, 3 d after injection (p.i.) of 0.5 FE of T. rostrale calyx fluid, and (ii) qPCR transcript quantification using total RNA obtained from similar larvae at 3 d p.i.; a given gene was considered as expressed if we detected ≥ 4 transcripts/ng total RNA. This threshold was chosen on the basis of results obtained for “no-RT” controls (RNA samples for which the reverse transcription step was omitted), where the median value was 4 copies (presumably contaminating genomic DNA). See Figs. 1, 3, 4 and 5 for quantitative data.

C6-1 Inx 1  

D4-1 Inx 2 + + Innexin E1-2 Inx 3 + +

B1-1 N 1 + +

D7-1 N 2 + + N family F2-1 N 3 + +

F2-2 N 4 + +

PRRP F1-6 PRRP + +

G2-1 TrV 1 + +

G3-1 TrV 2 + +

G2-2 TrV 3 + +

TrV  TrV 4 + +

G3-2 TrV 5  

D1-2 TrV 6  

C107 TrV 7 + +

A1-1 + +

C3-1  

C3-3  

C111-2  

C116-2 OSSP 3 + +

C289-2  + Unassigned ORFs G5-1 OSSP 2 + +

G5-2  

G5-3 OSSP 4 + +

G5-4 OSSP 1 + +

F2-3 B 1  +

F2-4 B 2  +

3.5.2 Transcript abundance of TrIV ank, inx, Cys-motif, PRRP and N genes

Although none of the 11 TrIV genes identified as belonging to the ank, inx, Cys-motif, PRRP and N families displayed very high levels of transcripts in either infected C. fumiferana hosts or T. rostrale ovaries ( 3,000 transcripts/ng total RNA), six of them had more abundant transcripts in wasp ovaries than in parasitized caterpillars, including two ank, two inx and two N genes (Fig. 3-1).

Figure 3-1 qPCR determination of transcript levels of 11 TrIV putative genes (23), distributed among five gene families, in C. fumiferana 6th instar larvae, 3 d following natural parasitization by T. rostrale (3 d p.p.) or injection of 0.5 FE T. rostrale calyx fluid (3 d p.i.), as well as in T. rostrale adult ovaries. Larvae were parasitized or injected within 24 h after the moult to the 6th instar. For each measurement, total RNA was extracted and pooled from 5 larvae or 5 ovary pairs dissected from 5-10 day-old females. Actual transcript numbers are provided above each bar for values < 100. Each value presented here is the mean of four technical replicates carried out on each RNA extract. Error bars: SD.

With the exception of the C6-1 and D4-1 inx genes, this inter-host difference was less pronounced when the comparison was made with transcript levels measured in virus-

injected caterpillars, presumably as a result of the supra-physiological viral dose present in 0.5 FE of calyx fluid (19). Interestingly, the only member of the Cys-motif family identified in the TrIV genome was expressed at very low levels (< 200 transcripts/ng total RNA) in both infected caterpillars and wasp ovaries, while transcript abundance for the single TrIV representative (F1-6) of the PRRP gene family (23) was moderate (~700- 3000 transcripts/ng total RNA) in the three samples examined (Fig. 3-1).

3.5.3 Transcript abundance of TrIV “unassigned” genes

Prior to generating estimates of transcript abundance for a sample of genes among the 51 unassigned TrIV ORFs identified earlier (23), we wanted to determine whether some of these genes formed families; given that PDV genes tend to fall within families of related coding regions, we reasoned that putative ORFs that had clear relatives within the TrIV genome were more likely than orphan ORFs to be real genes (i.e., transcribed DNA). Local Blastp analyses led to the identification of three small groups of related proteins encoded by unassigned ORFs (Fig 3-2). The first of these groups contains four members, all of which display a novel C-terminal cysteine motif. The longer G5.1 protein has two copies of the Cx7Cx3Cx3Cx7Cx3Cx3Cx7C motif, which is identical to that seen in the C166.2 protein. A variant of the latter motif (Cx6Cx3Cx3Cx3Cx3Cx7Cx3Cx3Cx3Cx3- 4Cx7C) is observed in the G5.3 and G5.4 proteins, with 10 out of the 11 cysteine residues predicted to form disulphide bonds. A putative signal peptide cleavage site was identified in all four proteins, which are therefore predicted to be secreted (Fig 3-2A). A Blastp analysis indicated that these proteins are unique to TrIV. Two other pairs of ORFs were found to be either highly (F2.3, F2.4 and Fig. 3-2B) or moderately (F1.4 and D6.3; Fig 3- 2C) related.

Thus, to obtain a preliminary assessment of the transcriptional activity of TrIV unassigned genes, we measured transcript levels for six ORFs randomly selected among those that were considered orphans and for six others that appeared to belong to a gene family (i.e., those presented in Fig 3-2A and 3-2B). Interestingly, five of the six orphan ORFs had barely detectable transcripts, whether in infected hosts or in wasp ovaries,

while the remaining orphan gene had low but detectable quantities of transcripts in wasp ovaries (~500 copies/ng total RNA). In contrast, the four members of the family shown in Fig 3-2A displayed moderate levels of transcripts (~2,000-12,000 copies/ng total RNA) in wasp ovaries, while being expressed at very low levels in infected caterpillars (Fig 3- 3). For this reason, these proteins are here assigned to a new TrIV gene family, designated “Ovary-Specific Secreted Proteins” (OSSPs). The other two related proteins examined were also expressed almost exclusively in wasp ovaries, but at lower levels than those measured for OSSPs.

Figure 3-2 ClustalW alignment of amino acid sequences deduced from selected TrIV unassigned ORFs that were found to form groups of two or more related proteins. A) Four related proteins displaying a novel C-terminal cysteine motif (cysteine residues are shown as white letters against black background). The arrow indicates the position of the putative signal peptide cleavage site. B) Two very similar proteins encoded by unassigned ORFs found on genome segment F2. This group is here designated “unassigned family B”. C) Two proteins encoded by unassigned ORFs and displaying modest similarity. For B) and C), identical residues are shown as white letters against dark gray background, while similar residues are shown as black letters against light gray background.

Figure 3-3 qPCR determination of transcript levels of 12 TrIV putative ORFs selected among 51 unassigned ORFs (23), in C. fumiferana 6th instar larvae, 3 d following natural parasitization by T. rostrale (3 d p.p.) or injection of 0.5 FE T. rostrale calyx fluid (3 d p.i.), as well as in T. rostrale adult ovaries. Putative genes are here clustered according to whether they are orphan or belong to a family (“OSSP” and “unassigned family B”; see caption of Fig. 2). For each measurement, total RNA was extracted and pooled from 5 larvae or 5 ovary pairs dissected from 5- 10 day-old females. Larvae were parasitized or injected within 24 h after the molt to the 6th instar. Actual mean transcript numbers are provided above each bar for values < 100. Each value presented here is the mean of four technical replicates carried out on each RNA extract. Error bars: SD.

3.5.4 Comparison of transcript abundance across all TrIV gene families

To estimate the relative importance of each gene family with respect to the abundance of their transcripts in infected caterpillars and wasp ovaries, we selected, for each family, the gene for which the highest level of transcripts had been measured in TrIV-injected C. fumiferana last-instar larvae, 3 d p.i., or in adult wasp ovaries (Figs 3-4 and 3-5). In infected caterpillars, TrV family, which encodes a secreted protein, was by far the most highly transcribed TrIV7 gene, with nearly 300,000 copies/ng total RNA (Fig 3-4). The rep family came second in this ranking, with the F1-1 gene (TrFrep1) producing ~52,000 transcripts/ng total RNA. In comparison, ank-2, PRRP and inx-3 generated transcript quantities varying between ~1,000 and 3,000 copies, while all others produced < 1,000 copies /ng total RNA (Fig 3-4).

7 TrV1 from TrV gene family

Figure 3-4 Comparison of transcript abundance among selected representatives of all known TrIV gene families, in C. fumiferana 6th instar larvae, 3 d following injection of 0.5 FE T. rostrale calyx fluid (3 d p.i.). Larvae were injected within 24 h after the molt to the 6th instar. For each family, we show the value obtained for the most highly transcribed gene in infected caterpillars. For each qPCR measurement, total RNA was extracted and pooled from 5 larvae. Actual transcript numbers are provided above each bar for values < 50,000. Each value presented here is the mean of four technical replicates carried out on each RNA extract. Error bars: SD. Data for TrFrep1 are from Rasoolizadeh et al. (19).

Figure 3-5 Comparison of transcript abundance among selected representatives of all known TrIV gene families, in adult T. rostrale ovaries. For each family, we show the value obtained for the most highly transcribed gene in wasp ovaries. For each qPCR measurement, total RNA was extracted and pooled from 5 ovary pairs dissected from 5-10 day- old females. Actual mean transcript numbers are provided above each bar for values < 10,000. Each value presented here is the mean of four technical replicates carried out on each RNA extract. Error bars: SD. Data for rep166 are from Rasoolizadeh et al. (19).

In wasp ovaries, a rep gene (C166.1 or rep166) dominated the transcriptional profile, with nearly 90,000 copies/ng total RNA, followed by OSSP1, which had ~12,000 copies (Fig 3-5). For all other genes, transcript abundance was ≤ 1,000 copies/ng total RNA, except for ank-2, which generated ~2,800 copies (Fig 3-5).

3.5.5 Accuracy of splicing junction predictions

In the course of annotating the TrIV genome, seven genes were identified as being spliced (Cys-motif, TrV1, TrV2, TrV3, TrV4, TrV5 and TrV6), all of which are predicted to encode secreted proteins (23). The splicing junctions of three of these, TrV1, TrV2, and TrV4 had been confirmed in earlier studies (1, 2). Here, we attempted the cDNA cloning and sequencing of the remaining four genes to determine if they were indeed spliced and whether the splicing junctions had been predicted correctly. We were not able to amplify TrV5 and TrV6 from our cDNA library or by qPCR (Table 3-1), suggesting that these two very small putative ORFs (they encode proteins of 74 and 56 amino acid residues, respectively) may well be pseudogenes. However, we were able to clone the cDNAs of the Cys-motif and TrV3 genes, both of which were confirmed to contain two exons and one intron, although the length of the first exon had been incorrectly predicted in both cases (Table 3-2); corrections have now been made to the appropriate GenBank entries.

Table 3-2 Differences between predicted and observed splicing junctions for two TrIV spliced genes, TrV3 and a Cys-motif gene. The values presented here are nucleotide ranges encompassing each exon (reverse complement) on their respective genome segments (G2 and c111). For both genes, differences between predicted and observed junctions were at the level of exon 1 (bold letters).

Gene id Exon 1 Exon 2 Accession number Predicted Expressed Predicted Expressed TrV3 3543..3785 3537..3785 3201..3233 3201..3233 AB291160 Cys-motif 1622..1774 1667..1774 1190..1408 1190..1408 AB291215

3.6 Discussion

Transcriptional analysis often constitutes a first step towards identifying the function of a gene. The present study, along with an earlier one focusing on rep genes (19), provides a global assessment of transcript abundance, in both infected lepidopteran hosts and carrier wasp ovaries, for more than half of the genes identified in the genome of the ichnovirus TrIV (23). As such, this analysis makes it possible to evaluate the likely importance of genes within each of the known ichnovirus gene families, as may be inferred from their observed levels of expression.

The quantitative data presented in Fig 3-4 confirm earlier assessments made by Northern analysis (1, 2, 5) to the effect that TrV1 is, by far, the most highly expressed TrIV gene in infected C. fumiferana larvae, with transcript levels almost six times higher than those of the most highly expressed rep gene, TrFrep1. In comparison, genes from all other families are expressed at levels >15 times lower than those of TrFrep1 (Fig 3-4). These results suggest that genes from the TrV and rep families, and more specifically TrV1 and TrFrep1, encode products that are likely to be required for induction of developmental arrest, which is the principal physiological perturbation observed in TrIV-infected C. fumiferana hosts (9, 10).

The Cys-motif gene family (8) has ten representatives in the CsIV genome (26), some of which are abundantly expressed in parasitized Heliothis virescens larvae (3, 4). In this host, their protein products appear to play a role in both immune suppression (6, 17) and developmental disturbances (13). In comparison, we detected only one member of this family in the TrIV genome (23), and its expression was here observed to be very low in the three samples we examined (Fig 3-1). These results support our earlier hypothesis (23) that Cys-motif genes may no longer be required by T. rostrale to achieve successful parasitism, inasmuch as TrIV has little or no impact on the cellular immune response of C. fumiferana hosts (9, 10). However, it has been noted earlier that Cys-motif and TrV genes appear to have a common ancestor (1), but that TrV proteins lack the characteristic cysteine motif (C…C…CC…C…C) of CsIV Cys-motif gene products, which may be

essential to achieve host immune dysfunction, while it may not be required for induction of developmental arrest.

The only other ichnovirus gene family that has been extensively examined with respect to transcript abundance is the ank (or vank) family in CsIV (15). Although transcript levels of the seven known CsIV ank genes were not compared to those of other CsIV genes, all but one were readily detectable by Northern blot analysis of RNAs extracted from parasitized H. virescens larvae, and two of the protein products could be detected by either Western blot analysis or immunofluorescence assays (15). In addition, using an rq- RT-PCR strategy, transcripts of all seven genes could be quantified in parasitized larvae, and transcripts could also be detected at low levels in female wasps (15). In the present study, the two known TrIV ank genes were expressed at higher levels in wasp ovaries than in parasitized C. fumiferana hosts at 3 d p.p. (Fig 3-1), but transcript abundance was below 3,000 copies/ng total RNA in both hosts. Our sampling time may not have been optimal for the detection of TrIV ank transcripts in C. fumiferana, although CsIV ank mRNA levels were typically maximal at 3 d p.p. in parasitized H. virescens larvae (15). In addition, the higher transcript levels observed in female wasps, compared to parasitized caterpillars, may be due, at least in part, to the fact that we limited our analyses to wasp ovaries, thereby generating an RNA sample enriched in TrIV transcripts, as the ovaries appear to be the only tissue supporting significant TrIV gene transcription in the T. rostrale host (19). Nonetheless, the data presented here suggest that TrIV ank genes play a limited role in altering C. fumiferana host physiology.

It has been known for many years that some ichnovirus genes are expressed in the reproductive tract of female wasp carriers (4, 24), although the functional significance of such expression has not been elucidated. As reported earlier (19) one of the 17 TrIV rep genes, rep166 (C166.1), was transcribed at relatively high levels in T. rostrale ovaries, while transcript abundance of TrIV genes associated with other ichnovirus families identified prior to the present study, including the TrV family, was much lower (Fig 3-5). However, transcript levels of OSSP1, one of the four members of a novel TrIV gene family (Fig 3-2), were sufficiently high (~12,000 copies/ng total RNA) to make us consider the possible role of this protein in the biology of T. rostrale. Since OSSPs are

predicted to be secreted, they could accumulate in the lumen of the oviduct prior to being injected into the lepidopteran host during oviposition. Their C-terminal cysteine motif is clearly distinct from that of ichnovirus Cys-motif proteins, but the disulfide bonds they are predicted to form should ensure their stability until injection in the lepidopteran host, in which they could play a role in host regulation before TrIV gene expression begins. Unlike OSSP1, rep166 is not a secreted protein, and is therefore not predicted to accumulate in the ovarian fluid. For this reason, we have suggested that it may play a role in virus replication (19). Hypotheses regarding the roles of these two proteins are currently being addressed experimentally.

In addition to generating a global profile of TrIV gene transcription in infected C. fumiferana larvae, the present study provides an assessment of gene predictions made during annotation of the TrIV genome (23). Overall, these predictions were accurate, particularly in the case of ORFs that could be assigned to known ichnovirus gene families (Table 3-1), although small errors were made in identifying the splicing junctions of two genes (Table 3-2). With respect to “unassigned” ORFs, our predictions appear to have been somewhat less accurate, particularly for “orphan” putative genes, although this conclusion is based on a relatively small sample of genes. It should also be pointed out that the few genes that escaped detection in the present study could well be expressed in other lepidopteran hosts of T. rostrale.

Acknowledgements

This research was supported by grants from the Canadian Forest Service (CFS) and a Discovery grant from the Natural Sciences and Engineering Research Council of Canada to MC.

3.7 References

1. Béliveau C, Laforge M, Cusson M, Bellemare G. (2000). Expression of a Tranosema rostrale polydnavirus gene in the spruce budworm, Choristoneura fumiferana. J. Gen. Virol. 81, 1871-1880

2. Béliveau C, Levasseur A, Stoltz D, Cusson M. (2003). Three related TrIV ichnovirus genes: comparative sequence analysis, and expression in host larvae and Cf-124T cells. J. Insect. Physiol. 49, 501-511.

3. Blissard G W, Smith O P, Summers M D. (1987). Two related viral genes are located on a single superhelical DNA segment of the multipartite Campoletis sonorensis virus genome. Virology. 160, 120-134.

4. Blissard G W, Theilmann D A, Summers M D. (1989). Segment W of Campoletis sonorensis virus: Expression, gene products, and organization. Virology. 169, 78- 89.

5. Cusson M, Béliveau C, Laforge M, Bellemare G, Levasseur A, Stoltz D. (2001). Hormonal alterations and molecular mechanisms underlying the induction of host developmental arrest by endoparasitic wasps, In: Endocrine Interactions of Parasites and Pathogens. (J.P. Edwards and R.J. Weaver, eds). BIOS Scientific Publishers, Oxford, 111-121.

6. Cui L, Soldevila A, Webb B W. (1998). Expression and hémocytes-targeting of a Campoletis sonorensis polydnavirus cysteine-rich gene in Heliothis virescens larvae. Arch. Insect. Biochem. Physiol. 36, 251-271.

7. Desjardins C A, Gundersen-Rindal D E, Hostetler J B, Tallon L J, Fadrosh D W, Fuester R W, Pedroni M J, Haas B J, Schatz M C, Jones K M, Crabtree J, Forberger H, Nene V. (2008). Comparative genomics of mutualistic viruses of Glyptapanteles parasitic wasps. Genome. Biol. 9,183.

8. Dib-Hajj S D, Webb B A, Summers M D. (1993). Structure and evolutionary implications of a cysteine-rich Campoletis sonorensis polydnavirus gene family. Proc. Natl, Acad. Sci. USA. 90, 3765-3769.

9. Doucet D, Cusson M. (1996a). Alteration of developmental rate and growth of Choristoneura fumiferana parasitized by Tranosema rostrale: role of the calyx fluid. Entomol. Exp. Appl. 81, 21-30.

10. Doucet D, Cusson M. (1996b). Role of calyx fluid in alterations of immunity in Choristoneura fumiferana larvae parasitized by Tranosema rostrale. Comp. Biochem. Physiol. 114, 311-317.

11. Einerwold J, Jaseja M, Hapner K, Webb b, Copié V. (2001). Solution structure of the carboxyl-terminal cysteine-rich domain of the VHv1.1 polydnaviral gene product: comparison with other cysteine knot structural folds. Biochemistry. 40, 14404-14412.

12. Espagne E, Dupuy D, Huguet E, Cattolico L, Provost B, Martins N, Poirie M, Periquet G, Drezen J M. (2004). Genome sequence of a polydnavirus: insights into symbiotic virus evolution. Science. 306, 286-289.

13. Fath-Goodin A, Gill T A, Martin S B, Webb BA. (2006). Effect of Campoletis sonorensis ichnovirus cys-motif proteins on Heliothis virescens larval development. J. Insect. Physiol. 52, 576-585.

14. Kroemer J A, Webb B A. (2004). Polydnavirus genes and genomes: emerging gene families and new insights into polydnavirus replication. Annu. Rev. Entomol. 49, 431-456.

15. Kroemer J A, Webb B A. (2005). Iκβ-related vankyrins genes in the Campoletis sonorensis Ichnovirus: temporal and tissue-specific patterns of expression in parasitized Heliothis virescens lepidopteran hosts. Virology. 79, 7617-7628.

16. Lapointe R, Tanaka K, Barney W, Whitfield J, Banks J, Béliveau C, Stoltz D,

Webb B A, Cusson M. ( 2007). Genomic and morphological features of a

banchine polydnavirus: a comparison with bracoviruses and ichnoviruses. J. Virol. 81, 6491-6501.

17. Li X, Webb B A. (1994). Apparent functional role for cysteine-rich polydnavirus protein in suppression of insect cellular immune response. Virology. 68, 7482- 7489

18. Matz M V. (2000). Amplification of representative cDNA samples from microscopic amounts of invertebrate tissue to search for new genes. In: Green Fluorescent Protein: Applications and protocols (Hicks, B.W., E.d.), 1-21, Humana Press Inc., Totowa, NJ.

19. Rasoolizadeh A, Béliveau C, Stewart D, Cloutier C, Cusson M. (2009). Tranosema rostrale ichnovirus repeat element genes display distinct transcriptional patterns in caterpillar and wasp hosts. J. Gen. Virol. 90: 1505 - 1514

20. Rutledge R G, Stewart D. (2008a). A kinetic-based sigmoidal model for the polymerase chain reaction and its application to high-capacity absolute quantitative real-time PCR. BMC. Biotechnol. 8, 47.

21. Rutledge R G, Stewart D. (2008b). Critical evaluation of methods used to determine amplification efficiency refutes the exponential character of real-time PCR. BMC Mol. Biol. 9, 96.

22. Stoltz D B. (1993). The polydnavirus life cycle. In Parasites and Pathogens of Insects. 1, 80-101. Edited by N. Beckage, S. N. Thompson & B. A. Federici. San Diego, CA: Academic Press.

23. Tanaka K, Lapointe R, Barney W, Makkay A, Stoltz D, Cusson M. Webb B A. (2007). Shared and species-specific features among ichnovirus genomes. Virology. 363, 26-35.

24. Theilmann D A, Summers M D. (1988). Identification and comparison of Campoletis sonorensis virus transcripts expressed from four genomic segments in

the insect hosts Campoletis sonorensis and Heliothis virescens. Virology. 167, 329-341.

25. Volkoff A N, Béliveau C, Rocher J, Hilgarth R, Levasseur A, Duonor-Cérutti M, Cusson M, Webb B A. (2002). Evidence for a conserved polydnavirus gene family: ichnovirus homologs of the CsIV repeat element genes. Virology. 300, 316-331.

26. Webb B A, Strand M R, Dickey S E, Beck M H, Hilgarth R S, Barney W E, Kadash K, Kroemer J A, Lindstrom K G. (2006). Polydnavirus genomes reflect their dual roles as mutualists and pathogens. Virology. 347, 160-174.

CHAPITRE 4 Conclusion

Les résultats des analyses transcriptionnelles présentées dans ce mémoire suggèrent que l’identification des gènes réalisée au moment de l’annotation du génome de TrIV (Tanaka et al., 2007) était, dans l’ensemble, assez juste. En effet, il s’avère que la plupart des gènes identifiés sont exprimés, soit chez des larves de C. fumiferana parasitées par T. rostrale ou injectées du virus TrIV, ou dans les ovaires de la guêpe, mais à des niveaux qui varient considérablement. À ma connaissance, cette étude est la première à générer un profil d'expression, par qPCR, pour l’ensemble des gènes d’un polydnavirus, à la fois chez l’hôte infecté et dans l’ovaire de la guêpe porteuse.

Pour la réalisation des analyses transcriptionnelles qui sont présentées ici, j'ai utilisé, pour chaque temps d’échantillonnage, un seul échantillon biologique. Cet échantillon représente un pool d'ARN obtenu de plusieurs individus, lequel j’ai divisé en quatre aliquots. C’est à partir de ces aliquots que j'ai fait des évaluations séparées des niveaux de transcrits. Cette forme de réplication, connue sous le nom de "réplication technique", estime la variabilité associée à la technique de quantification (sources de variation possibles: appareils, réactifs, expérimentateur, etc), par opposition à la variation biologique inter-individuelle.

En raison de la faible quantité de transcrits associés à certains des gènes étudiés, chez les larves ou les guêpes, et également en raison du temps limité pour compléter le travail, le choix a été fait de mettre en commun les ARN de plusieurs insectes et de renoncer à la réplication biologique, où deux ou plusieurs réplicats biologiques sont obtenus. Bien que

des comparaisons entre des mesures faites à partir de pools d’ARN n’auraient pas fourni d'information sur la variation inter-individuelle, de telles comparaisons auraient donné des informations supplémentaires sur la répétabilité de l'ensemble de la procédure de quantification. Ainsi, dans des études futures sur la transcription des gènes de TrIV, il vaudrait la peine d’investir les ressources nécessaires pour que de tels réplicats soient obtenus.

Deux familles des gènes de l’ichnovirus TrIV, TrV et rep, se sont avérées être les plus importantes du point de vue de l’abondance des transcrits de certains de leurs membres chez des chenilles parasitées. Bien que des transcrits aient été détectés pour presque tous les gènes étudiés dans l’un ou l’autre des deux hôtes, les niveaux élevés observés pour certains membres des familles TrV et rep suggèrent que ces deux familles de gènes jouent des rôles cruciaux dans le succès du parasitisme de C. fumiferana par T. rostrale.

Parmi les membres de la famille rep, TrFrep1 s’est avéré être beaucoup plus fortement exprimé que les autres gènes rep, et ses transcripts étaient plus abondants dans l’épithélium cuticulaire et le corps gras de l’hôte que dans les deux autres tissus examinés. Toutefois, des différences ont été observées dans l'abondance relative des transcrits de chaque gène rep dans les quatre tissus à l’étude, ce qui suggère l'existence de rôles spécifiques pour différents gènes rep dans ces tissus au cours du parasitisme.

Dans les ovaires de T. rostrale, le profil d'expression des gènes rep s’est avéré clairement différent de celui observé dans les chenilles infectées. Alors que TrFrep1 était le gène rep le plus fortement exprimé chez les larves de C. fumiferana infectées, ses transcrits étaient à des niveaux très faibles dans l’ovaire de T. rostrale, alors que les transcrits d'un autre gène rep, C166-1, étaient présents à des niveaux très élevés dans ce tissu. Ces différents patrons de transcription des gènes rep entre les ovaires de la guêpe et chez la chenille hôte suggèrent que certains gènes rep pourraient jouer des rôles spécifiques à la guêpe alors que d’autres seraient spécifiques à la chenille. Comme la réplication ichnovirale ne se produit que dans les ovaires de la guêpe porteuse, il semble plausible que les gènes rep qui y sont exprimés soient impliqués dans la réplication du génome viral, bien que cette hypothèse reste à vérifier.

Dans l'évaluation de l'expression d'autres gènes de TrIV, y compris ceux des familles inx, ank, Cys-motif, PRRP, N et TrV, des transcrits ont été détectés pour la plupart des gènes étudiés chez des larves infectées, mais, à l'exception de TrV1, ces niveaux se sont avérés beaucoup plus faibles que ceux mesurés pour TrFrep1. Cette observation soulève la question à savoir si ces gènes, comme ceux de la famille rep qui sont transcrits à des niveaux très faibles, jouent un rôle important au cours du parasitisme de C. fumiferana par T. rostrale et, si non, pourquoi leur présence dans le génome de TrIV est nécessaire. Toutefois, il faut souligner ici que l'expression de ces gènes chez C. fumiferana a été évaluée à un seul temps d’échantillonnage (3 jours après l'infection) et qu'ils pourraient être exprimés plus fortement à d'autres moments après la ponte ou chez des chenilles appartenant à d'autres espèces hôtes.

Parce que les segments génomiques des polydnavirus ne sont pas présents en quantités équimolaires dans le génome viral, l'abondance relative de chaque segment pourrait avoir un impact sur le niveau d'expression des gènes qu’ils portent, particulièrement dans la chenille hôte, où le virus ne se réplique pas. Dans les analyses présentées au Chapitre 2, les gènes rep exprimés le plus fortement chez des chenilles infectées, TrFrep1, TrFrep2 et C166-1, sont portés par les deux segments génomiques les plus abondants, parmi les dix segments de TrIV qui contiennent des gènes rep, soit F1 et C166, ce qui suggère un impact possible de l’abondance relative des segments génomiques sur l'expression des gènes qu’ils portent. Toutefois, il n'y avait pas de corrélation évidente entre les niveaux de transcrits et l'abondance des segments génomiques pour les autres gènes rep. Ainsi, il semble que d'autres facteurs, en plus de l'abondance relative des segments génomiques, soient impliqués dans le contrôle des niveaux d’expression de ces gènes, dont la force du promoteur, la stabilité des segments génomiques et des transcrits, ainsi que l'intégration possible de segments génomiques ichnoviraux au génome de l'hôte (Doucet et al., 2007).

Dans le cadre d’analyses locales de type Blastp, où chaque cadre de lecture ouvert (« ORF ») non-assigné (à une famille de gènes connue) a été utilisé pour interroger la base de données des séquences ORF non-assignées du génome de TrIV, trois groupes d’ORF apparentés ont été identifiés. L’un d’entre eux est constitué de quatre membres affichant un motif cystéine ainsi qu’un peptide signal. Fait intéressant, ces gènes

semblent être exprimés presqu’exclusivement dans les ovaires de la guêpe. Sur la base de ces deux observations, il a été prédit que ces protéines sont sécrétées dans la lumière des oviductes latéraux ; c’est pour cette raison qu’elles ont été nommées « Ovary-Specific Secreted Proteins (OSSP). On peut envisager que les ponts disulfure formés entre les résidus cystéine des protéines ont pour effet d’accroître leur stabilité et leur longévité suivant leur injection présumée dans l'hôte lépidoptère. Leur fonction réelle dans le contexte du parasitisme demeure inconnue, mais l'hypothèse selon laquelle elles sont injectées dans l’hôte pendant la ponte pourrait être évaluée à l'aide de méthodes immunologiques. Dans l'hôte lépidoptère, les OSSP pourraient contribuer à limiter l’encapsulation des œufs de guêpes dans la chenille hôte et/ou lancer le processus menant à l'arrêt du développement de la chenille hôte avant que ne débute l'expression des gènes de TrIV à partir des virions injectés. Dans une première étape visant à évaluer cette hypothèse, des interactions possibles entre les OSSP et les protéines hôtes pourraient être étudiées en utilisant des approches telles que l’analyse par GST-pull-down, suivie par l'identification des protéines impliquées dans cette interaction. Une fois ces protéines identifiées, des hypothèses testables quant à la fonction des OSSP pourraient être développées et évaluées. De plus, l'impact des résidus cystéine sur la structure de la protéine et sa stabilité pourrait être évalué par modélisation moléculaire et mutagenèse dirigée.

Puisque parmi les membres de la famille rep de TrIV, TrFrep1 est celui qui est exprimé le plus fortement chez des chenilles parasitées, une étude visant l’identification de la fonction de ce gène a été entreprise. Cette étude fait appel à l’approche microarray. Tel que mentionné dans les sections précédentes, les gènes rep codent pour des protéines non-sécrétées, et certains sont exprimés presqu’exclusivement dans les chenilles hôtes, alors que d'autres sont spécifiques à l’ovaire de guêpe. L’arrêt du développement de l’hôte et la suppression de sa réponse immunitaire cellulaire sont les deux effets principaux attribués aux polydnavirus au cours du parasitisme. Toutefois, contrairement à d'autres polydnavirus caractérisés par d'autres équipes de recherche au cours des dernières années, TrIV ne semble pas jouer un rôle important dans l’inhibition active de la réponse immunitaire cellulaire de l’hôte, bien qu’il entraîne des perturbations prononcées de sa métamorphose (Cusson et al., 2000). Ainsi, dans nos tentatives visant à

identifier la fonction des gènes rep, le gène TrFrep1 a été exprimé dans des cellules de C. fumiferana en culture (CF-203), avec l'intention d'évaluer les effets de sa sur-expression sur l’expression des gènes des cellules hôtes ; ces analyses devient être complétées dans les mois suivant le dépôt final du présent mémoire. Si la protéine TrFrep1 module l'expression de gènes chez l'hôte, l'identification de ces gènes par l’analyse microarray permettra d'identifier les sentiers métaboliques dans lesquels les gènes modulés sont impliqués. Sur la base de cette information, nous devrions être en mesure de formuler des hypothèses testables quant à leur rôle potentiel dans le succès du parasitisme par T. rostrale.

L'étude de l'expression des gènes de TrIV chez des chenilles de C. fumiferana parasitées par T. rostrale, ainsi que dans l’ovaire de la guêpe, est une méthode parmi d'autres pour entreprendre l’élucidation des stratégies utilisées par ce virus pour perturber la régulation hormonale et l’initiation de la métamorphose chez les hôtes parasités. Lorsque les fonctions des gènes principaux auront été identifiées, certains pourraient s'avérer utiles dans le développement de nouveaux agents de lutte biologique pour la répression des populations de C. fumiferana dans les forêts canadiennes. Étant donné que l'infection par TrIV nécessite que le virus soit injecté dans une chenille par une guêpe, ce virus ne pourrait être utilisé comme ingrédient actif d’un insecticide viral, pour lequel l'infection par voie orale doit être possible. Toutefois, certains gènes de TrIV pourraient être utilisés pour modifier génétiquement des baculovirus insecticides, que ce soit pour améliorer leur efficacité ou leur spectre d'hôtes. Certains gènes de TrIV pourraient aussi être utilisés pour le génie génétique des arbres hôtes, afin d'accroître leur résistance aux défoliateurs (Gill et al., 2006).

4.1 Références

1. Doucet, D., Levasseur, A., Béliveau, C., Lapointe, R., Stoltz, D. & Cusson, M. (2007). In vitro integration of an ichnovirus genome segment into the genomic DNA of lepidopteran cells. J. Gen. Virol. 88, 105-113.

2. Cusson, M., Laforge, M., Miller, D., Cloutier, C. & Stoltz, D. (2000).Functional significance of parasitism-induced suppression of juvenile hormone esterase activity in developmentally delayed Choristoneura fumiferana larvae. Gen. Comp. Endocr. 117, 343-354.

3. Gill TA, Fath-Goodin A, Maiti II, Webb VA. (2006). Potential uses of Cys-motif and other polydnavirus genes in biotechnology. Adv. Virus. Res. 68, 393–426.

4. Tanaka K, Lapointe R, Barney W, Makkay A, Stoltz D, Cusson M. Webb B A. (2007). Shared and species-specific features among ichnovirus genomes. Virology. 363, 26-35.

ANNEXE A

Effect of TrIV rep gene expression on host gene transcription, as determined by microarray analysis

A.1 Introduction

In the course of assessing the transcription patterns of Tranosema rostrale ichnovirus (TrIV) genes in infected Choristoneura fumiferana larvae, we observed that some members of the TrV and rep gene families were the most highly transcribed genes in infected larvae (Rasoolizadeh et al., 2009 a, b). These two gene families show no similarity to other eukaryotic or viral (non-PDV) genes, and their functions during parasitism have yet to be identified (Theilmann & Summers, 1987; Tanaka et al., 2007). The rep gene family is the largest family within the TrIV genome, with 17 ORFs. These genes consist of imperfectly conserved repeats of ~540-bp, and encode non-secreted proteins (Theilmann & Summers, 1987). Among the TrIV rep family members, one gene, TrFrep1, is expressed much more abundantly in parasitized larvae than all other members of this family (Rasoolizadeh et al., 2009 a), suggesting that it likely plays an important role in the course of parasitism. In an effort to identify the function of rep genes in TrIV- infected C. fumiferana larvae, we undertook a study of the effect of rep gene expression on host gene transcription, using microarray analysis. Here, we transfected C. fumiferana CF-203 cells (Sohi et al., 1993) with either an empty expression vector or a vector containing the TrFrep1 coding region. Total RNA was then extracted from the CF-203 cells 24 and 48 h following transfection, with the intent of using it to assess modulation of host gene expression through microarray analysis. At the time of writing this appendix,

the latter analysis had not yet been completed, but I here report on vector construction and TrFrep1 transcript quantification after transfection.

A.2 Material and methods

The TrFrep1 coding region was amplified by PCR using the following primers: 5´ CGTTTCCATGGGCATTATCATTATCATCGGGT 3´) and 5´ TTTTAGCACAGCGGCCGCACA 3´ (NcoI and NotI restriction sites are underlined). PCR amplification was performed using 0.25 µM of each primer, 0.2 mM of each dNTP, in 1x PCR buffer. After a hot start at 94°C for 3 min, PCR was carried out by addition of 2 U of Taq DNA polymerase at 80°C. The rest of the cycling conditions were as follows: 30 cycles of 94°C, 45 s; 48°C, 45 s; 72°C, 1 min; and a final extension step at 72°C for 5 min. PCR products were cloned into pGEM-T Easy (Promega) vector and sequenced. Subsequently, the fragment was subcloned into the GFP-PE38 lepidopteran expression vector (a gift of D. Theilmann, AAFC, Summerland, B.C.) using the two aforementioned restriction enzymes, effectively replacing the GFP insert (Fig. 1). A C. fumiferana cell line (CF-203) was transfected with the expression vector carrying TrFrep1, as well as with the empty vector as a control. Cells were seeded into six-well plates and grown to 60-70% confluence and transfected with 3 µg DNA/well using the ExGEN500 transfection reagent (Fermentas, ON, Canada) as described in the manufacturer’s protocol. Twenty-four and 48 h following transfection, total RNA was extracted using TRIZOL reagent (Invitrogen) according to the manufacturer’s instructions. To verify the expression of TrFrep1 in transfected cells, we quantified its transcripts using the q-PCR- LRE approach of Rutledge and Stewart (2008 a, b) and the set of primers designed for this gene in a previous study (Rasoolizadeh et al. 2009a).

A.3 Results

q-PCR analyses revealed high levels (~60,000-75,000 copies/ng RNA) of TrFrep1 transcripts in cells transfected with the TrFrep1-EP38, and a virtual absence of transcripts in those transfected with the empty vector (Table 1). Each value shown here is the mean of three biological replicates.

Table A. 1 Mean number of transcripts (± SD) in CF203 cells, one day and two days after transfection with the TrFrep1-PE38 vector or the empty PE38 vector.

Mean No. of transcripts / ng total RNA ± SD Days after transfection TrFrep1-PE38 Empty PE38

1 73,095 ± 18513 3 ± 0 2 59,058 ± 13245 0 ± 0

PE38 3'

The correct GFP -PE38 construct 6216 bp

GFP

Transcription start site IE2 PE38 5'

Figure A. 1 The TrFrep1 coding region cloned into the PE38 lepidopteran expression vector using two restriction enzymes (NcoI and NotI), replacing the GFP insert.

A.4 Discussion

The present data indicate that transfection of C. fumiferana CF-203 cells with an expression vector carrying the TrFrep1 coding region generated high levels of TrFrep1 transcripts in those cells, while these transcripts were absent from cells transfected with the empty vector. These RNA samples are therefore ideally suited for a microarray analysis of the modulation of host gene expression by TrFrep1.

Among all 17 TrIV rep genes, TrFrep1 was shown earlier to have the most abundant transcripts in parasitized C. fumiferana larvae, suggesting that it plays an important role in the success of parasitism by T. rostrale (Rasoolizadeh et al., 2009a). If TrFrep1 expression modulates host gene expression, it should be possible to identify, using microarray analysis, the metabolic pathway(s) in which the modulated genes are involved. On the basis of this information, we should be able to generate testable hypotheses about the proteins with which the TrFrep1 protein interacts and therefore identify the function(s) of rep genes. Thus, the RNAs that were extracted from transfected cells will now be used for the production of labeled cDNAs and hybridization on a C. fumiferana DNA chip containing ~5000 genes. This analysis will be performed in the laboratory of a collaborator of the Canadian Forest Service in Sault Ste. Marie.

Acknowledgments

I thank Daniel Doucet and Tim Ladd (Great Lakes Forestry Centre, Sault Ste. Marie) for the transfection of CF-203 cells, and Catherine Béliveau (Laurentian Forestry Centre, Quebec City) for guidance in cloning the TrFrep1 coding region in the GFP-EP38 vector.

A.5 References

1. Rasoolizadeh, A., Béliveau C., Stewart D., Cloutier C., & Cusson M. (2009a). Tranosema rostrale ichnovirus repeat element genes display distinct transcriptional patterns in caterpillar and wasp hosts. J. Gen. Virol. 90, 1505-1514

2. Rasoolizadeh, A., Dallaire, F., Stewart, D., Béliveau, C & Cusson, M. (2009b). Global transcriptional profile of Tranosema rostrale ichnovirus genes in infected lepidopteran hosts and wasp ovaries. J. Virologica Sinica, in press.

3. Rutledge, R. G. & Stewart, D. (2008a). A kinetic-based sigmoidal model for the polymerase chain reaction and its application to high-capacity absolute quantitative real time PCR. BMC. Biotechnol. 8, 47.

4. Rutledge, R. G. & Stewart, D. (2008b). Critical evaluation of methods used to determine amplification efficiency refutes the exponential character of real-time PCR. BMC. Mol. Biol. 9, 96.

5. Sohi, S. S., Lalouette, W., MacDonald, J. A., Gringorten, J. L., & Budau, C. B. (1993). Establishment of continuous midgut cell lines of spruce budworm (Lepidoptera: Tortricidae) [abstract I-1001]. In Vitro Cell Dev. Biol. 29A (3).

6. Tanaka, K., Lapointe, R., Barney, W. E., Makkay, A. M., Stoltz, D., Cusson, M. &Webb, B. A. (2007). Shared and species-specific features among ichnovirus genomes. Virology. 363, 26-35.

7. Theilmann, D. A. & Summers, M. D. (1987). Physical analysis of the Campoletis sonorensis virus multipartite genome and identification of a family of tandemly repeated elements. J. Virol. 61, 2589-2598.

ANNEXE B

Supplementary data for chapter 2:

Tranosema rostrale ichnovirus repeat element genes display distinct transcriptional patterns in caterpillar and wasp hosts

Table B-1 List of primer pairs used for q-PCR quantification of 17 TrIV rep transcripts and 10 rep gene-bearing TrIV genome segments. For quantification of genome segments harboring more than one rep gene, the single primer pair used is identified (*). For rep gene id, we used the name of the genome segment (e.g. C3), followed by the ORF number (e.g. C3-2). C166 and C289 denote ORFs that are on contigs 166 and 289 (i.e., partial sequences of an unidentified genome segment).

rep gene id 5´ 3´primer sequence Orientation

CTC ATC TGA ATA CGA TAA GAC AGC TCG TAC TCC Reverse B2-2 CTC TAG CGA CAG CGA ACA GAC GAC T Forward GGT ATA AGC GCC ATT GTT CGG CCA T Reverse C3-1*

CTG TGA ACA TGC GCC GAG CAT G Forward GCA GAT CAA AGT ATT CTC CAG AAT TTT CAA CCA AGT TTC Reverse C3-2

CGA TTT GCT TCC TGC CCT TGT CAT CT Forward GCA CGC TCA TGT TGC GAA AAT GAA TTG TT Reverse C4-1*

TGC AAT TAC GGA CAC TTC CAT CAT TAT TGC TAT CTA C Forward GGA GAA GTG ATG ACG GAG AAG TGG TAA GAA A Reverse C4-2

TCA CCT GCT AAA CAA AGA CGG GCA AC Forward CAA CAG AAT CGC AGG TTC CAA ATA ATT GCC T Reverse C7-1*

CCT GTT CCA CGA CGG TGA AGA GTT TGA TA Forward

GC CCG TCT GAA AGT GAA CAA TAT CAC A Reverse C7-2

CCT TCA GTG GAC GAG TGC GGA AAT Forward AGA ATC GCT GGT TCC AGA TAA CGG AGC Reverse C166-1

CTC CTG TGG AAA GGA CAG CCC AGA TA Forward AGA TAA CAC ACG CAT TCG GCG TAT TGA AAG Reverse C289-1

CCG CGT TCT CAT CAA CAC GGA CTC Forward GCA CAG AAG GAA TCA GGT AAT ATT TCA ACC AGT ATC T Reverse D5-1*

CCT GCC AAT GTT ACC GGA TGA ACG T Forward GA ATT TGT CCA TCG CTG ACG CGT C Reverse D5-2

CC CTG GAG AAC AGA AGA AGT TTT CAT CAA TTC Forward AAT TTG CAT AAC TGC CCA CTG TAT AAT AAA AGT CCA Reverse D6-1

CCA TTA TTG TGC CTT GCA CCT TGG GTC Forward TGT AAC AGA ATC GCA CGT TCC AGG TAT AAC TTG Reverse F1-1*

ATC CTG CTC TTG TCA CTA CAA TAT CCC GG Forward CCT AGT GGG ACA TTG CAC GGC A Reverse F1-2

ATC ACT ATT GTG CAA CGC ACG TTG AGT C Forward GGA GAC GAA TCG AGT TAG CCA GGT AAC GAT T Reverse F3-1*

ACA ACG GGC GAG GTA GTG AGA TAA TTG TTG Forward GCA CGA TCG AGG TAC TCA AGA CAA TGT CC Reverse F3-2

CGA CGA GCA ATG TGG TGA AAA ATT TGT GAG G Forward TGA ATC GAG TTG ACC AGG CAT AGG GTG Reverse F3-3

GGC GAG GTG GTG AAA GAT TTG TTG CA Forward

ANNEXE C

Supplementary data for chapter 3:

Global transcriptional profile of Tranosema rostrale ichnovirus genes in infected lepidopteran hosts and wasp ovaries

Table C-1 Oligonucleotide sequence and orientation of primers designed for PCR amplification of TrIV putative ORFs from a cDNA library.

Gene id 5´  3´ primer sequence Orientation Accession number

ACGTCGCGAATACTCTCAAC Forward rep-B2 AB291141 ATCCGGTATTGATTCTCTCATCTG Reverse

ATGCTGGAATATAATGCCACGC Forward rep-C3-1 AB291143 TTCGGCCATGAGGTCATTG Reverse

ATCACGGTGCACGTTCAT Forward rep-C3-2 AB291143 TTGAAGAGTAATCCACCGCA Reverse

ATGCAGCTCTGTCTCCTTC Forward rep-C4-1 AB291144 GCGTACTTGCACTGTCGA Reverse

TTCGATCCGTCAAGACCAG Forward rep-C4-2 AB291144 TCATAGCTGCACGCTCATG Reverse

AATATCGCTGCTGCCGTC Forward rep-C7-1 AB291147 TGCAACAGAATCGCAGGT Reverse

TGAAGCCTTCAGTGGACG Forward rep-C7-2 AB291148 GACATGCTGTTGACCATCGA Reverse

GCATCAGGAGCTTCGCTAAT Forward rep-C166 AB291213 CAGTTATCAACATCGGTGCG Reverse

ATGTGTCGACGCCACAGT Forward rep-C289 AB291214 ACAGATAACACACGCATTCG Reverse

CCAATAACGTTGCCGCTG Forward rep-D5-1 AB291153 CAGTATCTAACGTGTACCGAGC Reverse

CCAATAACGTTGCCGCTG Forward rep-D5-2 AB291153 TGTAAGCTTCGATACGCTTGTG Reverse

ATGGGAGACGCACGTCTT Forward rep-D6 AB291154 ACGAGCGTACTTCAGCCA Reverse

ATGATGTCACCGCAGAAC Forward rep-F1-1 AF421353 TGTAGTGACAAGAGCAGGATG Reverse

ATGGATAATTGTAAGTTGGGC Forward rep-F1-2 AF421353 GAACACAGACGATAGGAACGA Reverse

CCGGYAGATRTAATTCTYYACATGG Forward rep-F3 AB291158 RCATGTGTCGACGGAAGG Reverse

ATGGAAMTTTCCRAAATTGMAGAACT Forward Ankyrin family AY940454 * TAGGCTCCYTCGKYGTCA Reverse

ATGTCTCGGACAATGAAACTT Forward Cys-motif protein AB291215 ACTGTTCGCCAAACGGA Reverse

CTTYCGTYTGCATTACAAAWTMACAG Forward AB291146 * Innexin family AB291152 CAATCWCCRATSYGWAGCTTGT Reverse AB291156

CMKATKTTSAACMAGCTGCAR Forward AB291140 * N family CACWGATGAGATATCGAGAATTYACAC Reverse AB291155 AB291157

ATGGTTCATATTCTGCGGTCA Forward PRRP protein AF421353 TCAATACTTCGGTCTTTCTTGTTG Reverse

ATCGGCGTCAATGTCTCC Forward TrV3 AB291160 TGCAGATGACAATCCGTAGAATG Reverse

ATGAACATGACGTGGGTCAT Forward TrV5 AB291161 GTAGCAGCCAGAACAATACCT Reverse

CGCAGTGCAAACTTGTCAG Forward TrV6 AB291149 GGGACAGTGAAGGGTGATATT Reverse

TCGTCGCAGTGGTAATGG Forward TrV7 AB291164 GGTAGCTCCAATACTGGCT Reverse

TCACGAGTCAGCATACGAG Forward A1-unassigned AB291138 CCTCTTGGTTGCAGGTGT Reverse

GCGATGCAAGTAGCCAGT Forward C3-1-unassigned AB291143 ACCGAGCATATCATCACCG Reverse

GTATAAGCGCCATTGTTCGG Forward C3-2-uassigned AB291143 ATTCGGAGGGATCTCCTATCC Reverse

TGCATACCATGTGGCAGG Forward C166-unassigned AB291213 GGAATACATCTGGCTGCA Reverse

AGCTATGAGGTTCGAGCTA Forward C289-unassigned AB291214 CACACGCATTCGGCGTAT Reverse

ACGCACGGAATATTGTAGCG Forward C111-unassigned AB291215 CGGCATGACTTCGTGACT Reverse

ATGAATCTTTTTTGGGTTGC Forward G5 1 unassigned AB291163

TTATTTGCATCCATTTCCAAC Reverse

TTTCCAGCCAGAGCTTCGACGGA Forward G5.2 unassigned AB291163 TGGTATAGCATTTCGCTCGATC Reverse

GAGCTTCTCTGGATTATGA Forward G5.3-unassigned AB291163 TTTACCGTAATGTGACATGG Reverse

GAAGCTTTCCTGGATTATCA Forward G5.4-unassigned AB291163 TTACCGTAATGTGACAGGT Reverse

TCTTGTCTGCAGACAGAT Forward F2.3 unassigned AB291157 GTATATAAAGGGCTGGCTC Reverse

ACCCGATGGACTTACTAT Forward F2.4 unassigned AB291157 GGGGTATATAAGCGCTAATCT Reverse

* Because of the high level of within-family nucleotide identities, only one set of primers could be designed for each of these families. The PCR products, which formed distinct bands on agarose gels, were analysed and sequenced individually.

Table C-2 Oligonucleotide sequence and orientation of primers designed for quantitative real time RT-PCR (qPCR) amplification of TrIV putative ORFs. Note: for primers used for rep genes, see Annexe B.

Gene id 5´  3´ primer sequence Orientation Accession number

TGGTCGTCACCGCATCTCATCGTG Forward A1-unassigned AB291138 AATCCTCTTGGTTGCAGGTGTGAAACTT Reverse

CATTATGAGATTTCGATGCGACTGCACAGT Forward

C3-1-unassigned AB291143 GGTATGTGTGTCTGTTTGACACTGCGTT Reverse

CGTGCTCCCAACAATAATGGTGAAAGTGG Forward

C3-2-uassigned AB291143 TTAGACAGCCTAAAACCCATATTCGGAGG Reverse

CTGAATGCAGACGCAGCCCTCG Forward

C166-unassigned AB291213 GATCGGAACGTTTCCTCCGGGAATACAT Reverse

TCATCAACACGGACTCTTTGCTACCTGT Forward

C289-unassigned AB291214 TAAAGACTTTGAGGGAGCTTCACCACC Reverse

TCACGGTCACTCATTGTTCGTAAAGAGC Forward

C111-unassigned AB291215 ACTTCGTGACTTGCCGAGCTGAAC Reverse

CTTCTACGGCCGATGTTTGACAATGTTGG Forward

G5.1-unassigned AB291163 CAATTTGCGCGACAGGTGGCCATA Reverse

CTGTGATAAAATAAAGGCCAGGTGCCAAG Forward

G5.2-unassigned AB291163 GGTGGTAATTGGGTATAACACATGCCTGGA Reverse

TCTCAACGCTGTGATAAAATAAAGGCCAGG Forward

G5.3-unassigned AB291163 GTGGTAATTGGGTATAACACATGCCTGGAC Reverse

ACGCTGTGGTAGAATGAAGGCCGAA Forward

G5.4-unassigned AB291163 GTAATCCGGCATCGCAATAAATGTCTCCAC Reverse

GCATCGTCACGATACCCGGTATACAAGT Forward

F2.3-unassigned AB291157 GCACTCGGGTATATAAAGGGCTGGCTC Reverse

TCGCCATGATACCCGGTATACGAGA Forward

F2.4-unassigned AB291157 CGCTGCGGGGTATATAAGCGCTAATCT Reverse

GGATCGACCCACCATTCCATGCTATA Forward

C2-ankyrin-1 AB291142 GCCTACACAACCACAATGCAAGATCGC Reverse

ACTACAAATAAAAAACTACAGTGGTGAGTTTCCCA Forward

C2-ankyrin-2 AB291142 GCCGTCTGTCGAGCATAATTTCTCACATTC Reverse

GGATTCTATCAAGCCCTGCTGCCAAG Forward

Cys-motif protein AB291215 GCCAAACGGAATCCTATATTCACGACGC Reverse

AGATTTTATGGGTTTCGGTCAAACAATATGAATACTGC Forward

C6-innexin AB291146 CGGGATTCTAAATTTACTCACTCAAATCAGGGTTA Reverse

CCTCAATCAGATTCTACAGTTTTCGATCATCGTGC Forward

E1-innexin AB291156 CACTGTTGAAACGCTGAGCGATACGAA Reverse

CAATTAGGGTTTACGAGTTTCGGTCATCGAGT Forward

D4-innexin AB291152 CGCAAAGCATAGAAAGTGGTTTCAAACATGACG Reverse

GCCAGACGTTAGACAATTATTGTTTGATGCTTGAC Forward

B1-N family AB291140 GGGAAGTTTACTGTTGAGTGCTGGAGATGCTTTTC Reverse

GCTTGTAAGCATGTATAACTCCGCCTCC Forward

D7-N family AB291155 CGTAGAACTGCTACAGTTGGTGAATCGC Reverse

GTACCTTCGGGATCGCTTGCTGTAAGA Forward

F2-N family 1 AB291157 AGTTGATAAAATGTCTGTTGTAATGCGTTCGCTAG Reverse