Molecular Phylogeny of Ateime New World Monkeys(Platyrrhini, Atelinae

Home , Atelinae

Molecular Phylogenetics and Evolution Vol. 12, No. 1, June, pp. 10—30, 1999 Article ID mpev.1998.0574, available online at http://www.idealibrary.com on III E

Molecular Phylogeny of Ateime New World Monkeys (Platyrrhini, Atelinae) Based on y-Globin Gene Sequences: Evidence That Brachyteles Is the Síster Group of Lagothrix Cana M. Meireles,* John Czelusniak,* Maria P. C. Schneider,t Jose A. P. C. Muniz,1 Maria C. Brigido,1 Humberto S. Ferreira,1 and Morris Goodman*,l *Depajment ofAnatomy and Ceil Sio/ogy Wayne State University School of MeU/cine, Detroh Michigan 48201; tDepartamento de Genetica, Universidade Federal do Para, Selem, PA, Brazil; and *Centro Nacional de Primatas, Ananindeua, Para, Brazil

Received February 11, 1 998; revised June 17, 1998

genera form seven monophyletic groups or clades that Nucleotide sequences, each spanning —7 kb of the separated from one anotlier by late Oligocene to middle contiguous y’ and y2 globin genomic loci, were deter Miocene times, i.e., between 25 and 17 Million years mined for seven species representing ali extant genera ago (Ma), asjudged by morphological (fossil and neonto (Atetes, Lagothrix, Brachytetes, and Atouatta) of the logical) evidence (Ford, 1986; Fleagle, 1988; Kay, 1990; New World rnonkey subfamily Atelinae. After aligning Rosenberger et ai., 1990) as well as by molecular DNA these seven ateime sequences with outgroup se evidence (reviewed in Goodman et ai., 1998). The DNA quences from severa! other prirnate (non-ateline) gen evidence from our laboratory (Harada et ai., 1995; parsimony, maxi era, they were analyzed by maximum $chneider et ai., 1996; Goodman, 1996; Barroso et ai., likelihood, and neighbor-joining algorithrns. mum 1997; Goodman et ai., 1998) groups these seven clades Ali three analyzes estimated tlie sarne phylogenetic into three families: Cebidae, consisting of subfamilies relationships: ‘4touatta [Atetes (Brachytetes, Lago Cebinae for tribes Cebini (Cebus) and Saimiriini thrix)]. Brachytetes and Lagothrix are sister-groups Aotinae and Callitrichinae for tribe supported by 100% of bootstrap replications in the (Sairniri), (Aotus), parsirnony ana!yses. Atetes joins this clade, followed C allitrichini; Pitheciidae, consisting of subfamily by the basal genus Atouatta; these joinings were Pitheciinae for tríbes Cailicebini (Caiiicebus) and Pith strongly supported, again with 100% bootstrap values. eciini; and Atelidae, consisting of subfamily Atelinae. This cladistic pattern for the four ateime genera is Our present study focuses on cladistic relationships congruent with that obtained in previous studies utiliz within the subfamily Atelinae. Morphological studies ing €-globin, IRBP, and G6PD nuclear genomic se have provided conflicting results on sister-group rela quences as well as mitochondrial COIl sequences. tionships among the four genera. Rosenberger et ai. Because the number of aligned nucleotide positions is (1990) group Brachyteies and Ateies closest to each mucli larger in the present dataset than in any of these other followed by Lagothrix and then Atouatta. Ford other datasets, mucli stronger support was obtained (1986) lias an unresolved trichotomy involving Ateies, for the cladistic classification that divides subfamily Brachyteies, and Lagothrix, with Aiouatta as sister to Ateiinae into tribes Alouattini (Atouatta) and Atelini, this clade. Kay (1990) lias two sister subclades, one whiie the latter divides mto subtribes Ateima (Atetes) grouping Aiouatta with Brachyteies and the other and Brachyteiina (Brachytetes and Lagothrix). 1999 grouping Lagothrix with Ateies. In contrast to tliese Academic Press conflicting results from morphological studíes, DNA sequence evidence from two nuclear genes have yielded on sister-group relationships among INTRODUCTION congruent results the four ateime genera: Brachyteies sister groups with Recent authoritative listings of livíng primates di Lagothrix into Brachytelina, this subtribe with Ateies vide the New World monkeys or neotropical primates into tribe Atelini, and Atelini with Aiouatta into subfam (infraorder Platyrrhini, superfamily Ceboidea) into 1.5 ily Atelinae. The datasets providing this DNA evidence genera (Groves, 1993; Rowe, 1996). In turn, these consist of aligned 1.8-kb-Iong e-globin locus sequences (Schneider et ai., 1993, 1996; Harada et ai., 1995; Porter et ai., 1995, 1997a,b) and aligned 1.8-kb-long 1 Te whom correspondence should be addressed at Department of interstitial retinol-binding protein gene (IRBP) intron Anatomy and Ceil Biology, Wayne State University School of Medi cine, 550 East Canfield MRB 422, Detroit, Michigan, 48201. Fax: 1 sequences (Harada et ai., 1995; Schneider et ai., 1996; (313) 577-1080. E-mau: [email protected]. Barroso et ai., 1997). In the parsimony analyses carried

MOLECULAR PHYLOGENY OF NEW WORLD MONKEYS 11 out on these two datasets Atelini is well supported by TABLE 1 but weakly supported by IRBP E-globin sequences Species Exarnined, Codes, Collecting Sites, and the sequences, and Brachytelina is oniy weakiy supported GenBank Accession Numbers of the y Sequences by each of the two datasets. In our present study with 7-kb-long contiguous y’- and y2-globin locus sequences, GenBank we gain further congruent DNA evidence and quite accession Species Code Collecting site number Ref. strong statistical support for the brachytelan (Lago thrix, Brachyteies), atelin (Atetes, Brachytelina), and From this study ateime Atouatta, Atelini) clades. Ateles geoffroyi Age Zoo in Santa Ana, AF030092 1 A previous study established that in the stem-sirnian CA primate lineage, ancestral to tlie platyrrhine (New Ateies paniscus Apa CENP, Ananin- AF030093 1 deua, Para, World monkey) and catarrhine (Old World monkey and Brasil hominoid) branches ofAnthropoidea, a tandem duplica Lagothrix lagotricha Lia Zeo in Los Angeles, AFO3 0094 1 tion of a 5-kb DNA fragment containing the -y-globin CA gene produced the linked y’ and y2 loci (Fitch et ai., Brachyteies arach Bar CPRJ, Rio de AF030098 1 1991). The tandem duplication resulted from an un noides Janeiro, Brazil Atouatta caraya Aca Zoo in Los Angeles, Af03 0095 1 equal crossover between two homologous Li repetitive CA elements, one (Lia) that was upstream ofthe ancestral Aiouatta beizebul Abe CENF Ananiiideua, AF030096 1 anthropoid -y gene and the other (Lib) that was down Para, Brazil stream ofit. The crossover produced the tandem dupli Aiouatta senicutus Ase Zoo in Los Angeles, AF030097 1 CA cate 5’-Lia-y’-Liba-y2-Lib-3’, stretching over a 10-kb From literature genomic region (Fitei et ai., 1991). However, in au Cebus aibifrons°° Cal Unknown M81409 2 ancestor ofthe four ateime genera, a i.8-kb deletion in Macaca mutatta°’ Mmu Unknown J03938 3 the upstrearn -y1 locus removed most of exon 2, ali of Homo sapiensOG Rsa Unlmown J00179 4 intron 2 and exon 3, and >0.6 kb of the 3’ ftanking Tarsius syrahtaoe Tsy Duke Primate M81411 5 1991; Meireles et ai., 1995). In Center, Durham, sequence (Fitch et ai., NC establishing that ali four ateline genera share this deletion, Meireles et ai. (1995) used the polymerase Note. OG, Out Group; CENP, “Centro Nacional de Primatas;” CPRJ, chain reaction (PCR) to amplify from the y’ locus a “Centro de Primatologia do Rio de Janeiro.” References: (1) Meireles >0.4-kb fragment that consisted of sequence at the 5’ (1997); (2) Hayasaka et ai. (1993); (3) Slightom et ai. (1988); Fitch et et ai. (1980); Shen et ai. (1981); Rogan et ai. deletion. The corresponding ai. (1991); (4) Slightom and 3’ borders of the (1987); (5) Koop et at. (1989); Hayasaka et ai. (1993). region that was PCR amplified by the sarne pair of primers from the intact -y2 locus consisted of a >2.i-kb fragrnent. These -y1 and -y2 PCR-amplified fragments genera of the ateime clade (see Tabie 1): Atetes geof were obtained and sequenced from two Atetes species, froyi, Atetes paniscus; Lagothrix tagotricha; Brachyte and three Alouatta one Lagothrix, one Brachytetes, les arachnoides; Aio uatta caraya, Aiouatta beizebui, another species. For each species we have now added and Atouatta senicutus. In the recommended taxonomic 4.5 kb of sequence by sequencing ali the intergenic arrangement of Mittermeier et ai. (1988), A. beizebui sequence region between y’ and -y2 and by extending the and A. senicutus are members of the Atouatta senicutus upstream ofy’ to about 0.2 kb 5’ ofthe Lia element. species group, whereas A. caraya is the sole member ofthe Although gene conversions between the -y’ and the y2 Atouatta caraya species group. The -y-giobin sequences for occurred in loci over certain oftheir homologous regions the seven ateime species were determined by C.M.M. earlier periods of platyrrhine evolution as weli as more durrng the course ofher Ph.D. thesis work (Meireles, 1997). ai., 1997), recently in most platyrrhine clades (Chiu et The DNA ftom Ateies geoffivyi, Alouatta caraya, Alouatta conver the results of our present study show almost no senicuius, and Lagothrix iagotricha were gifts from K sions between the two -y loci within the Atelinae, possibly Neiswanger, who purffled DNA from fibroblasts using the because of the extensive deletion in the early ancestral extraction procedure of Beil et ai. (1981). Tie DNA from sequence ateime -y’ gene. Thus, we could treat each ateime Ateies paniscus, Brachytetes arachnoides, and Aiouatta over virtually all ofits regions as orthologous to those ofthe beizebul was purffied from biood using tie extraction very other ateline species. On doing so, we obtain a procedure of Sambrook et ai. (1989). Ateies geoffroyi is from strongly supported species phylogeny. the hdividua1 designated Age 2 in our previous study (Meireies et ai., 1995), in which we presented results for MATERIAL AND METHODS two individuais frorn the species Ateies geoffroyi. Sampie Description and DNA Extraction Primers and PCR Protocois Genomic DNA was isolated from peripheral blood In the previous study (Meireles et ai., 1995) with cells of seven captive monkeys representing the four genomic DNAs from these seven ateime species, the 12 MEIRELES ET AL. primers Ri (5’-AATGTGGAAGATGCTGGG-3’) and R2 length was counted as a single nucleotide substitution, (5’ -GTTTGTTGCTCAGACATGAC-3’) were used to am i.e., NS. To obtain the bootstrap values for nodes of a plify by the polymerase chain reaction the >0.4-kb -y1 MP tree we carried out 2000 bootstrap replications with and >2.i-kb y2 fragments that extend downstream one shuffle per replication. Parsimony strength of from exon 1 to the noncoding 3’ fianking region (see grouping (SOG) values were estimated using the Fig. 1). In the present study, additional regions from PTRFC, PTRALL, SURF, and CONSEN parsimony the linked y’ and y2 loci of the seven ateime species programs (written by John Czelusniak, Wayne State were amplified by PCR (see Fig. 1). Primers Hi (5’- University, Detroit, MI). A SOG value for an interior CTTTCCCACCCACCCTTAGATTG-3’) and H2 (5’- node of an MP tree is the minimal number of extra CTAGGAGCCTGTGAGATTGAA-3’) and primers Cl substitutions required to break up the clade defined by (5’ -CCTAGGCAGAGCAGACCCAAG-3’) and Rlc were that node. Such SOG numbers for the interior nodes of used to amplify the upstream regions of ‘y’ (-1.8 kb) an MP tree were first used by Goodman et ai. (1982, and y2 (—1.7 kb), respectively. The intergenic region 1985) and are equivalent to the decay index of Bremer (—1 kb) was amplified by the R2c and Cic primer pair. (1988). The informative positions wíth shared derived The following PCR conditions were employed: initial substitutions (synapomorphies) were established using denaturation, 94°C-3’, 30 cycles; 94°C-1’, 40—50°C-i’, PAUP (Phylogenetic Anaiysis Using Parsimony) ver 65°C-3’; final extension, 65°C-lo’. sion 4.0 (written by David Swofford, Illinois Natural History Survey, ChampaignfUrbana, IL). Using PAUP, Ctoning and $equencing ML analysis was carried out by the HKY model. Following agarose gel electrophoresis, the amplified Because ML analysis required much longer computer fragments were purified and isolated using the Qiaex II runs compared to either MP or NJ analysis, only 100 gel extraction kit (Qiagen). The purifled DNA frag bootstrap replications rather than 2000 were per ments were cioned into pGEM-T Vector System 1 formed to obtain the bootstrap values for the ML tree. (Promega) and transformed into Escherichia coii host SOG values for the interior nodes of the ML tree were JM1O9 (Promega) according to the protocol supplied by estimated by finding for each node the tree with the the vendors. Using helper phage M13K07 (Promega), least decrease in likelihood score that broke up the single-stranded DNAwas prepared from selected clones, clade defined by that node. purified by PEG-NaC1 precipitation followed by plienol Pairwise divergence values were estimated by the chloroform extraction and ethanol precipitation, and two-parameter method of Kimura (1980) and used to then sequenced using the Sequenase version 1.0 kit generate the NJ tree (Saitou and Nei, 1987). We then (United States Biochemical) of the dideoxy chain used the model of local molecular clocks (Goodman, termination method (Sanger et ai., 1977). The nucleo 1986; Bailey et ai., 1991, 1992; Schneider et ai., 1993) tide sequence representing each ateime species was with the fossil evidence on ateimes (Stirton, 1951; derived from sequencing at ieast three clones for each MacFadden, 1990; McKenna and Beli, 1998) to convert amplified PCR product from that species. the percentages of sequence change on branches of the NJ tree into estimates of divergence times among the Sequence Aiignment and Phytogenetic Anatyses ateime iineages. The GenBank Accession Numbers for the sequences that were aligned are listed in Table 1. These sequences RESULTS are the 7 ateime sequences and 4 known corresponding sequences from Cebus atbifrons, Macaca muiatta, Homo y-Giobin Gene Sequences sapiens, and Tarsius syrichta (Bailey et ai., 1992). To align Figure 1 compares the structures ofthe iinked -y’ and these 11 sequences, we used the Ciustal V computer y2 loci of Cebus albifrons and Ateies geoffroyi. The most program (Higgens et ai., 1992) for aligning multiple notable difference is the i.8-kb deletion within the -y’ sequences and then perfected the alignment by eye using locus of Ateies geoffroyi. This deletion apparently oc the ESEE sequence editor (Cabot and Beckenbach, curred in the stem ateime lineage, as it is found in 1989). In accounting for indeis (insertions/deletions), the Aio uatta, Ateies, Lagothrix, and Brachyteies (the four gaps piaced in sequences greatly increased sequence corre extant ateime genera) but not in other platyrrhines spondence in the ungapped portions ofthe alignment. (Meireles et ai., 1995; Chiu et ai., 1996, 1997). The 11 Phylogenetic anaiyses on the aligned sequences were aiigned nucleotide sequences (from the seven ateimes performed using the methods of Maximum Parsimony and the four outgroups), with the gaps that account for (MP), Maximum Likelihood (ML), and Neighbor índels, span 9669 alignment positions bordered at 5’ Joining (NJ). MP analysis was carried out by the and 3’ (ends) by primers Ri and R2, respectiveiy DNAPARS, SEQBOOT, and CONSENSE programs of (Fig. 2). These aligned sequence positions consist of the PHYLIP package, version 3.5c (Felsenstein, 1989). farthest upstream noncoding region (1—78); Lia repeti In the aligned sequences used with these programs the tive eiement (79—202); -y’ iocus—5’ noncoding region gaps were so coded that each indel regardless of its (203—1642), exon 1 coding region (1643—1734), intron 1 MOLECULAR PHYLOGENY OF NEW WORLD MONKEYS 13

Cebus albifrons 3’ noncoding regions of the two locí (3793—4181 and 8892—9669 in Fig. 2) ali showed a history free of gene 1 gamma 2 gamma conversions in both platyrrhines and catarrhines. The Lia exi ex2 ex3 Li ba cxl ex2 ex3 Llb 51 fl Ii ri ir ri regions that showed gene conversions between y’ and y2 loci extended from about 900 bp 5’ ofthe transcrip R2 tional start point (Tsp) to about 100 bp 3’ of the termínation codon. However, except for two recent gene f conversions (one inAtetesgeoffroyi -y genes, the other in L911 Atouatta senicutus -y genes) involving only short ] stretches ofsequence, there was absence of gene conver R2c Rlc sions within the ateime clade. The species-specific Ateles geoffroyi Ateles geoffroyi conversion extended from 17 bp 5’ to 1 kb 183 bp 3’ of the Tsp (positions 1573—1795 and 6898— 7120 of the Atetes geoffroyi sequence in Fig. 2); in thís yg1obin gene region from Cebus atbzfrons FIG. 1. Map of the sequence replaced its y’ paralogue, as (capuchin monkey) and Ateles geoffroyi (spider monkey) showing the conversion, -y2 locations of PCR primers. The gap in the Atetes geoffroyi -y’ locus evident from the differences between -y1 and y2 loci in represents the 1.8-kb deletion shared by ali ateime genera (Meireles this sequence region in the other ateime species. The etat., 1995). specíes-specific Ato uatta seniculus conversion extended from 166 to 171 bp 3’ ofthe Tsp (posítions 1778—1783 (1735—1859), exon 2 5’ portion (1860—1911), i.8-kb and 7103—7108 of the Atouatta senicutus sequence in ateime deletion (1912—3792), 3’ noncoding region be Fig. 2); again -y2 sequence replaced its -y1 paralogue. tween ateime deletion and Ato uatta insertion (3793— 3849), Ato uatta monomeric Alu insertion (3850—3997), Phytogenetic Inferences Using y Sequences and remaining 3’ noncoding region (3998—5284); Liba MP analysis was carried out on (1) the fuli dataset of repetitive element (5285—5373); -y2 locus—5’ noncoding aligned sequences shown in Fig. 2; (2) a dataset in region (5374—6967), exon 1 coding region (6968—7059), which (within the -y’ region ofthe alignment) the Ateies intron 1 (7060—7184), exon 2 (7185—7407), intron 2 geoffroyi sequence over positions 1573—1795 and the and 3’ (7408—8655), exon 3 coding region (8656—8784), Atouatta senicutus sequence over positions 1778—1783 This dataset of aligned noncoding region (8785—9669). were removed from the fuil dataset, as these particular sequences spanning 9669 nucleotide positions is avail sequences (although within the y’ region of the aiign able at our Web site address (http://ns.med.wayne.edu). ment) are actually the -y2 sequences that replaced their To determine the regions over which gene conver y’ paraiogues in the species-specificAtetesgeoffroyi and sions occurred between the y’ and -y2 loci, we aligned Ato uatta senicutus conversions, respectively; and (3) a these paralogously related loci against one another, i.e., dataset restricted to those 5’ and 3’ noncoding regions the -y’ and y2 sequences from positions 156—4181 and ofthe aiigned sequences that have a history free of gene 5358—9669, respectively, in Fig. 2 were aligned agahist conversions in both platyrrhines and catarrhines (i.e., one another. Gene conversion regions were then identi positions 1—663, 3793—4181, 5285—5959, and 8892— fied by the site-by-site parsimony procedure described MP tree for each of these three datasets in Fitch et ai. (1990). Because the distal 3’ noncoding 9669). The the sarne cladistic relationships: Atetes geof region of the -y2 locus (extending from the y2 location of depicted joined together; Lagothrix primer R2 to the Llb repetitive element) has not yet froyi and Ateles paniscus then were joined been sequenced in the seven ateimes of this study, the and Brachytetes joined together and distal 3’ noncoding region of the y1 locus (extending by Atetes; Atouatta beizebul and Ato uatta senicutus from the y’ location of R2 to Liba, i.e., positions joined together and then were joined by Atouatta 4183—5357 in Fig. 2) was not included in the paralogous caraya; Ato uatta and the Atetes ILagothrix IBrachyteles alignment. In addition to the sequence upstrearn of Lia ciade joined together. The fuli dataset and the second and thus outside the -y’ locus, the Lia and Liba dataset (that trimmed of the short Atetes geoffroyi and elements, the distal 5’ noncoding regions within the -y’ Ato uatta senicutus -y2 sequences witbin the -y’ region) and y2 loci (203—663 and 5374—5959 in Fig. 2), and the did not differ in the support provided for these ateime

FIG. 2. Aligned DNA sequences extending from prirner Hi upstream ofthe -y1 gene te primer R2 downstrearn ofthe y2 gene. PCR primers are shown above the top une; those shown for H2, R2, and Cl are actuaily H2c, R2c, and Clc, i.e., the reverse complements. The 11 aligned DNA sequences are from the seven ateime and four non-ateline prirnate species listed ia Tabie 1. Dot means sarne as the nucleotide in the top (Age) une and dash or contiguous dashes designate a gap that is required because ofan indei (insertionldeletion) in one or more mernbers ofthe aligned sequences. The outgroup sequences from Cal, Mmu, Hsa, and Tsy within the region ofthe 1.8-kb atehne deletion are not shown here because they were previously published in Bailey et ai. (1992). 14 METRE LES ET AL.

CTTTCTCA000ACCCTTAOATTG Hi

.- - Apa -. .-- -. .

.- . -.. .C Lia -. .-- -.

.- -. . . Bar -. .-- -. . T .-T. .C

. Aca -..-- A T. .-. ..-. .CC..- G.C T.---. .C Abe C. .CT A T CC..- GG.C T. .--. . .C Ase C. .CT A T CC..- GG.C T. .--.. .C

Cai --.-T A -. . .TATTGA 0. .T -. . .C T..G. tsu T -..-- A G.A -...TACTGA...G....C...T C....C..TT..A T.... Hsa T T -..-- A O -...TACTGA..AG....C...T C....C..T...A Tsy

LiA Ends> Age

Apa - T - A. Lia - T -

Bar - -

-- C Aca C O - C A

Abe C O - C- C A C

Ase C O - C- C A C

Cai - O A - T..A...CC O.. A...- T CT - A O O... .AC C

C .C. . .0 OT. lisa A... - T T. .OCA .- O OC. .AAC Tsy 2og————+——2ig————+——22g————,——23o————+-—24o

Age

- Apa - T

Lia - -- T TT

Bar C - -- TT T Aca C O C A... .TT O.. .T.. Abe A CC O C A... .TT O.. .T.. Ase A C O C A... .TT O.. .T.. TT T. .O.T C Cai . .0 - O -c C T. .A. .T

.. Mmii CC- AO.. .T. .TC T.A-. . .O.AO. . . .CC.C. .0 AA. .TT T CC lisa CC- C C A.T.A O C.CT TT T O CC Tsy

Age

Apa O - - A A

- - A Lia C - -

- . . - A - C. Bar C -

Aca C.O O T C. . .- A

abe C.O O T C. . .- A Ase C.O....-.O T C...- A

- A.O...A..A.. Cai - TO -.T A..A ltiiu ----.C A.C.AA O.. .C Te O -.A. .00. .A. .AC.C A.O..CA

lisa OAO ----.C A.C.AA. .T TC.C. . .0 -.A. .0.. .A. .AC.O A.O. . .A Tsy

Age

Apa -

Lia C. . .- - A Bar A T.- A Aca C C T T.- Abe C C T T.- Ase C C T T.-

Cai O.. .G. .0 - Mmii C.. .T.A.O C..A C A C.O...O.00C T.. .O..O

Hsa C e.. .T.A.O C C C.O. . .0.00 -. .0 A Tsy

Age flTCCATOCAA- -ACAC- -OTCTTATOTCTTAOAATACOATTCCTTOAOAAOTOAACCTAOCATT’TATACATOATAATflATTC-AATCCACAOCACCTGT--CAA-OAOCATflTATCA

. - Apa --... -- - --. . .

Lia --....-- A --...A..A

Bar --... .AT A T --.. .-. .A

Aca --. .. --A O.T A T 00...-. .A C..

Abe --. . . .--A O.T O.. .A T 00...-. .A C.. Ase A O.T A T 00...-. .A C..

Cai --. . . .-- C C T T.O. . .C. .TA. .A .C. .C..

Mmii TT. . .T-- A e C A T. .0.. .T. .T C--. . .A. .A.. .C. .CT.

Hsa AT. . .T-- A C.A A T T. .T.T. . .O--T. .A C. .C.. Tsy MOLECULAR PHYLOGENY OF NEW WORLD MONKEYS 15

Age G - Apa O A - Lia -..... - . . - O —

-...... Bar O T O Aca -....T..- O.. .T T Ate -. . . .T. O...- T ABe -....T..- C T G O .A.- T Cai - T.A. O... .C A.- 1’ 0... .CC A . .TC.A C A * -...... O A T O... .CC A T. . C Hsa -...... CO.G. .T Tsy

Age A Apa -- A Lia .- O A A Bar -- o.. A C Aca .- O.. AA C Ate .- O.. - AA Age .- TO.. - O A.TT A C. .0 Cai .- O . . TO.. O CT. .A O.. .A. . .A T. .C Wnu .AA C AA. .C A A . TO.. A O T. .A O T. . .C Hea .AA AA. . .0.0. .A Tsy

- -TAAAAACT Age ---. - Apa C - O ---. A - Lia - O ---. -.. . .T O -. .T A Bar ---. ---. A -... .A Aca A.. . . - ---. A - Ate A.... - ---. A - Age A.... - --- T. O A - Cai ..T O -- T T A.. .A .T. . .A T. .T Mntu C T. .T. ir... .T. . . .A A ATT.00. . .C T A T. . .A T Hga 0. .T. .T.----. . . .A A Tsy —i040 i050————+—i060——-—+—i070———-+—iOBO ————+-—970————+——BBO————.——99O————+—i000—-——+—iQiO————.—i020————.—i030

Age A -. Apa A A -. Lia 7 A A A A -- Bar -- A AO C -. Aca 7 A A A.C C -. Ate 7 A A A.C C -. Age T A T C A C C. Cai C...T A CO T. . .A.A. .0.7 C C -.C. C T G A .0.07 70 7.. .A.A. .0.7 C C A. .-AC. Hsa T O. .0 A T Tey

OAAAAATTTOA Age OOCCTCACT00AAC7AOAOAA0AAOAAG07AAAACA-ic Lnraaaaç.aa-rr.crLg-TarAnt-rarLaTnLsaaatiaaacratcaaaas.aua&aGA

Apa - 7 Lia - C 7 ---. - Bar - C A 7.. .-----. Aca O - C A T.. . .7... -----. Ate O - C A T. . . .7... -----. - C Age . .A O G T. . .-----. Cai O A - C.O.- O 7 T.A.TTAOA 0.. Minu O -C A.- C O C C G C OA 7 T.A.TTAOA 0.. Hsa O.. .C. . .-C 0.. .A.C Tsy ————+—i2iO

Age T Apa 7 -.7 C T Lia --....-.T -....C..T Bar -.7 C C O -. Aca A.T.-.T. .- O Ate --....-.T C C o Ase --.7 7 T.... Cai --. . . .0.7 C 7 O..T T.00..C.A A ---....O.A O C A A T O..T Oca ....C....T.00..C.A A --....O.A O C Tey

FIG. 2— Continued

Continued 2— FIG.

3B00————+—38i0————+—3B20——--+—3B30——-—+—3B40

————+-3730——--+-3740-———+—3750————+—3760————+—3770————÷—37B0————-.—37B0

Tsy

A T C .00

TCTCAOCCCTTOTOAOOCTOTAC0000AOOTTOAOOTOTTAOAOATCAOAOCAOOAAACAOOTTTflCTTTCCA Usa

T A .0 OC

. . TCTCAGTCCTTOTOAOOCTCTAT0000AOGTTOAOOTOTTAOAOATCAOAOCAOOAAACAOATTflTCTTTCCA bRio

TC .0 C. CT

. TCATAOCCCTTOTOAOOCTCTTT0000TACTTCAOOTOTTAOAOATCAOAOCAOOAAACAOATTTTTTTTTT. Cai

Asa

Aba

Ara

Bar

Lia

Apa

TTAOTTTCATTAACTATAOTOAA000ATCCTTACTTTACTAAOOAACT

Age

ands> deletion

2000————+—20i0————÷—202O-—-—+—2030————+—2040 ————+—1930———-+-1940————+—i950————+—iB6Q————+—i970————÷—i9BO————+—iBBO

Tsy

Usa

/ /

bRio

/ / -

Cai

Aba

Ave

Bar

Lia

Apa

Age

in Ateimas of i.8-kb

i8BO————+—iBO——-—+—l9OO-———+—l9iO—-——+—l92O

i8lO————+-1B20—-——+—i830————+—iB4O————+—l850————+—iB6O————+—lB7O

Tsy

CCTOTCCTC

-. T.C. O .- . . .T C. Usa

CCTOTCCTC

-. C O

T .T CA.T.

btsu .

OCCTOTCCTC

- AT TC Cai

- Asa

T - Aba

1’

- Ara

- C Bar

C C Lia

- Apa

Age

H2 TTCAATCTCACAOOCTCCTAO

i760————÷—i770————+—17B0————+—i790————+—iSOO ————+—i690————+-1700————+—i7iØ————+—i720————+—1730————+—i740————+—1750

Tsy

C.. .0... --C C..

. A

A A Usa

.0.. .--C C.. .A A..

- A A bRio

O... .C O... --C

C Cal

O... .C.CAOGC. - A .

Asa

C --C O A A

Aba

C --C O A A

Ara

C --C

O A Bar

C T--C A

.0 Lia

C --C

- Apa

-TTOOCAAAAOTTCAOOC

Age

ganstai

i650————+—1660————+—1670————+—16B0 i640

-———+—1570----+—i580——-—+—1590————÷—i600————+—1610————+—i620————,—i630

Tsy

.C O.

O .0 T. C . TC.O Usa

A AO O..C

T...O....O C C.O ltsu

A .T A. .0 .A. A.. TTT Cai

T O .T A. Asa

T O T A Aba

T O T A Ara

T .T T. Bar

- T Lia

T - Apa

Age

ganesai

CA? TATA

i520————+—i530————+—i540————÷—1550————÷—i560 ————÷—i450————+—i460————.—i470————.—i4Bo————+—i4gO————+—iBOO————+—i5iO

Tsy

O.. .0 C. AO.. .-.C

A O O Usa

O.. C..G

AO...-.C

O T O Iteu

CA. O .ACA

C A O O Cai

A .T A...

Asa

A .T A...

Aba

A .T A...

Ave

T O A

Bar

T T A

Lia

A Apa

ACTCCACCCMGGGTTAGCCAGCCTTGCCTTGACCAATAACCTTGACAAGGCAACCTTGACCAATAGP Age

CCAAT CCAAT CACCC

MEWELESETAL. 16 MOLECULAR PRYLOGENY OF NEW WORLD MONKEYS 17

Apa - - . --

Lia . . . .-

Bar - .C.

. Aca . - .

Aba . . . .

Asa - . . .

Cai .. .TGTTTT

Mmu . - - .GTTTT

Hsa . . . .ATflT Tsy 3930————+—3940 3950 3960 ————+—3950——--+-3960————-i-—3970————+—3B80————+—3890————±—3900————+—39i0-———+—3920

insertion ends> Ag AA000TTGATGCATACPTATGGAAGTGAAATTAATCCATGCCCTCAA000TGCAGACTGGTCAGAGCATTTCAAGGAAGAGA Apa - C.C C Lia O GC C Bar C C -. . TC Aca CGTGAGCACCGCACCGGCCCCTACTAAGGAACTTTTC C TC C Aba CG1GAGCACTGCACCGGCCCCTACTAAGGAACTTTTC CA TC C Asa CGT0AOCACCGCACCGGCCCCTACTAAGGAACTTTTC T C G C. - . .C C Cai C--- . . C 9?.. . .C . . .T G.C. .AA. .G.C 1hau 0. - .T. - . .C.A O - - .G.C. .AA. .0 C. .A.. Haa . .9? O.. Tsy 4050————+—4060——-—+—4070————+—4080 ————+—3970—-——+—3980—-——+—3990————+—4000 40i0 —4020————÷—4030-———+-4040

GTCATG’rCTGAGCAACAAAC R2

Age ATTCATTGTAAGCTTCTGGAgAAAAT000AACTT GA000AGCAGA000TCACAAGTCAGCATCAgPGTGrCATGTCTGAGCAACAAACCAGCACTGTCCAATGAAAA O Apa TC G Lia Bar 9? Aca .C T Abe .C T Ase .C O Cai .CG G.G.G O.. - .AGGTGAAGGAAAT TA C O. .0 AG Mau CC A.G.G.GG. - . .G.. - .AGGTGAAGGAAAT C C.. . .0. .G.A 0.. .AG MBa CC A.-.G.00... .0... .AGGTGAAGGAAAT A Tsy -——-÷-4090

Age A Apa ---9? Lia O 9? Bar G P0 9? C Aca C G P0 9? C Aba G TG C Ase O O A O Cai C -G C....C A..O..G T T. . A G Mau ... .A.O. . . .0.. .9? O .0 0.0 A O C. . .A A HBa .A.. . .0... .0.. .T O Tsy

Age Apa A Lia A C Bar A A C A O A.... Aca O A.... Aba O A.... Asa - A C OA O A Cai C. . . .9? C O A.AT C.G. . . .C Ci GOA O Mmu . .C.. .C T O.. .9? GOA C. .0 O lisa C 9? 9? AT C CT O Psy

Age Apa C O.. Lia O Bar 9? AO Aca A A... .C. . . .C Aba O. .A A... .C.. . .C

Asa A A... .C. . . .C . . O 9?.. .A.. .CC 9? A Cai CA. . .C O C.A. . . .C. .C 00 . .A .CA C.T. .-TGG Mau .TC. . .0 C.AC. . .C. .C O Haa O .TA .CA C.T. .-T0O O Tsy

FIG. 2—Coniinued 18 MEIRELESETAL.

Age -TAA Apa Lia C A A Bar T C Ara C C C.--... Aba c Ase a Cai .. . .C A C A O AA...

Ibtu ....0 ---- A 0..C....C C....A..A O AA...

Hea ...... ----... .0.. .C. . .A C T. .C C. . . .C C. . . .A. .A A. .0 AA... Te ————+—4570————+—45Bg————+—459g——-—+—4600————i-—46i0————.—462g————+—4630————+—4640————+—4650 4660————+—4670——-—+—4680

Age Apa T Lia Bar T T Ara C T C

Abe T. . . .C T C Asa T. . . .C T C Cai A A T T CA.T C

tsu A C C CT.. .A A A.T C.0. . .CT 0.C..

Hsa . . . .C C T. .C.T A.A A A.T C.O TG Te

Age - - AAGCCT000CCCTTCTCTCTTnCCrCGATTTCAC- -TTTTTTCTTCAATATACTTTAGTTTTOTAATOTCTTTACATACAGTOAAATGTTAAGTTCTTCCTTTATTTTTCTATC-- -

Apa ---- T

Lia ---- T O C C. .. .T. .TAT Bar T ---- o C T. .TAT

Ara T ---- C. . .0 A 0 T. .TGT

Aba T ---- C. . .C A C T. .TGT

Asa ---- T C. . .C A C T. .TGT

Cal O A T. .-. . . .T.T TAAT O T O O T. .CAC

tsu A -. . . .T.T T.CTA- O 00 C.G. . . .T C T A T. .TTT

Hsa AT O..-... .T.T. .A. . .TA----. CO OC G. . . .T C T A T. .TTT Te

Age Ap Lia C----. Bar C----.

Ara C----.. . . .T T

Aba C----. . . . .T T A

Asa C----. . .. .T T Cai C---- 0. .A T O u CGTTT. .C C CT AT A AC AT T. Hsa CTTTT C A AA A CA... Te)’

CCTAGGCAGAGCAG

Age CTCACTCCCATTGCACAATTCACACT-- --TTCCTTTTTTTTTTCTTTTTTAAGTGAAAGCAAGTTTATAAAAAA GTGAAAGAATAAATGAATAGCAACTTCCTA000AOAGCAG

Apa ---- o

Lia C T ---- T. . . .--

Bar ---- . . -- T.. -

Ara ---- . . . -- T. A---- -

Aba - T A---- -

Asa T.. .---- T - T A - Cai T . . .T A o.. Iteu A TT 0... .TTCT. . .T. .0. .00.. .T TTAGT. . .A TTAAA. .A. .0 CO. .T A T..

Hsa A T . . . 0... .TTCT. .T. .0.CC. .T --AOT.. .A T . . . .0 0. .T A T.. Tsy

ACCCAAG Ci Age ACCCAA000TT ATTTTTCGCTAGTATGCTAAGAAÀGGTGGAGATTATTTATGCCGCCCATTTATAGACCATAAAAATQAACTTCCTGCTGTTOACAT Apa Lia C C Bar O T O A Ara A. .A O A CTA. . .0 Aba A. .A O A CTA. . .0 Asa A. .A O A CTA. . .0

Cai C . A.A. .T GG. - O A

!tsu -...... C.GCTCQTTGCCGATTTTTOTTGTT AA AC. . . .O.T T. . .0 GAT A C... Hsa . .A C.ACTGGTTOCCOATTTTTATTOTT AA AC. . . .0.T T T OAT A C... Tsy

FIG. 2—Conlinued MOLECULAR PHYLOGENY OF NEW WORLD MONKEYS 19

Age GGCATTGTTTTTTCTTTTAATTTTATTTCATTTTAATTT-- - - -CCAAGGTACATGTGCAAGATATACAGGCGTTflACAT000-TAAATGTGTATCTi’TCi’OGCCCTTTA000AgCTCT Apa -

- T Lia CA

- T Bar e

------0.0 e Aca C. . A C. 0.0 - C

- e Ase A e. .----- 0.0

.00. .T. . . .T.A - e Cai e... .0 T.. . .C.T. . .AATTT 0. 0.. .0.0 T.0 -C e T T. --.. . -e C.T.. .AATTT

- O T O. HBa T C C.T. . .AATTT.G 0.. .0.0 T.0 A Tsy O. .AAATAA.TOCCCA A.. .A. .P T

Age Apa Lia T. .C O T

Bar T. . .T e Aca T T O 5 5 Abe 5 5 O Ase 5 5 O 5 Cai 5 5. .0 T btsu C..A...O..T..T e ..A O T..00 - lisa T A A A O T..00 5 5

. 5.0 O.OCA. .-. .TA 5 O... .5 isy C.AT.A. . ..0.. .0. .TCSOCA A.. .A A. .C. .T.T ————+—54i0————+—5420————+—5430————+—5440————+—5450————+—5460————+—5470————+—54B0 5490————+—B500————÷—55i0————+—5520

Age OCATC CAATAAACCAOATTTCAACAOCTSCSOOCATCATAATCTOOCOAO Apa -

Lia - Bar - Ara A.... - A.. M,e A.... - A.. Ase A.... - O A.. Cai .C. .. .0.. - A.. .A..

-. . . AO.---. .A. .A.. Iflu A.C. . .A. .C.0.T

. .0..-.. .A. . .C.O T A. .A.. BBa . .C. .0... Tsy T.C. .TAATOAAATOCACAOOTAACTTCSTAAOCTOCTTCTTTATATOATCATOAACTCTOACCACA000AAAOT. . .C. .O.C. .C... .C.AT.T. . .A.TT O. .T.A. .A.A

Age

Apa -

. - Lia . .5 O AA. .A

Bar O -

---- - O. .C Ara C. . . .

- O. C. . . . ---- .C

Ase e.... ---- - O. .C

Cai 5 A 5... .T A... .0 - A T A O.

. .A. . . . T.A. .C C. .5 iteu . .T A O T O.A O.. .C. .C. .0

. . A. .C 5. .T lisa . .TA A 5 O.A O.. .C. .A. .C.C Psy O. .AA. .5 C---. TOCCTO.TAAOAO.A. . .C A.TATOOC ——-—÷-5650————+—5660-—-—+—5670————+—5680————+—5690 B700————+—57i0————+—5720————+—5730—-——+—5740————+—5750————+—5750

Age Apa O C A Lia e A Bar O C A A

Ara ---- C A A A. Abe ---- C .C A

Ase ---- C A A A

Cai .A A O O.. .C C A e.. - A IBsu C. .5.. .A A. .0. .C.C.O e A C 5. .CT.. .C C.O.O... .CACA HBa 5. .5.. .A A. .0. .C.C.A e A.A A A.. .T. .C C. . .OT. . .C.CA

. . .1’ O .T.---A ‘PBy T.T. . .C. . .55 A. .0. .C. . .0... .CCC. .C. .00CT. .C A i’.. .5. es A. .AO.

Age 5 TTCTTACATATSAOAATAAOATTCCCT000AAOTO--AACCSAO CTTTPASACATOATAATTAATTCTAATCCACAOTACCTOCCAA

.- . --. .. .C. Apa

Lia --. ... .C.C. .0 Bar 50

Ara . --. Abe . --.

. Ase --.

Cai -- O

O 50.0 A --. .A.C A 00.0 lisa e A TO.C O A --. .A A

Tsy AOOAAOOAAAOOAOOTOCrTTCTAA.O.-.T e. .so.. .AA 50 TAOACCTAA.A -. .-. .00T. . . .C. .A -.AOT.T 5890————+-5900-—-—+—5910 5920-———+—5930——-—÷—5940————÷—5950-———+—5960————+—5970————÷—5980————÷—5990————÷—6000

FIG. 2—Continued 20 MEIRELESETAL.

Age

Apa C -

Lia T C - T A

Bar AC - T

Ara O -

O -

Ase T O - Cai .A 0 O A C ltsu T T0.0. .T. . .A -T O AC.C C C A. .A.A. Hsa T T TG.G .T.G. O OT O AC.C O C

Tsy O T. . .T...C..TG.G .T.G. GT. .C .0 TA.GC. . . .C 00 CT.O.T CC..

Age CATAAACA-CCTGAACATGGAAACAAATATTTTTQCTQAGATQAQGCAGACATGATTCACTTOAAACAGGTACAGATAAO TAGATATTGAAOTAAOGATTCAOTCTTAT

Apa -

Lia .. . .T.A.- T TTACAGATAAO

Bar .. . .T. . . - T C

Ara .. . .T. . . - A T

Abe .. . .T. . . - A T

Ase .0. .T. . .- A T

Cai ... .T...- O O C.. . .T GA A .. . .0 O C

OBsu --. .3’.. .T 3’ T.C 3’. .A AA. . .0 T.T. .C. . .T . .C O AO

. lisa . .. .C.T.- 3’ T -. .A AA. . .T T.T. .C. . .T O O C. .AG

Tsy T. .CC.T.C. .TOT. .CAC. . . .C. .G.O.C . . .C AA C. . . .T. .T.T TA.A. .A C. . .00 O C. .G 6i30 —6i40—-——+—6i50————+—6i60————÷—6i70————+—6i80————+—6i90 6200————+—62i0————+—6220————+—6230————+—6240

Age

Apa - - 3’

Lia - O O 3’ - 3’..

Bar - O T - 3’..

. Ara - T. . .G O -. . .T 3’..

- 3’.. .0 O -.. . .T 3’..

. Ase - T. . .G O -. . .3’ 3’..

Cai - O T...O C - 3’..

itu -.A.C.C T.CA ---. .OC.T. . .0 A C 3’ CA.A-A. . .0 T. .T.T..

Hsa ... .TO-.A.C.C A... .G 0... .3’.. .OA AC A.T A.. .OT. . . .A... .T... .T..

Tsy .. . .TTA. ..CC. . . .OCC O TO T. . .GA. .C TO.OC -T. .ACC.-.. .O.T. .A. .CA.C TO. .. .ATO...TA. ————+—6250————+—6260 6270————+—6280————±—6290————+—6300 63i0————+—6320————+—6330————.—6340 63B0 6360

Age AAOA-TAAGTATAOCACTT- - -CTTTAAAAACCAATOCTTACTAAAAOAOACTAAAAC- -TTGTCCCATCAAAAATCCTGGA-CCTATGCCTAAAACACATTOCACAATCCAAAAACTTT

Apa .. . . ------

Lia .. . .- CTT -- -

Bar .. . . - CTT -- -

Ara .. . . -C CTT O O -- -

Abe .. . .-C CTT O O -- -

Age . . . .-C CTT O O -- -

Cai . . . . ------T CC

ltnu .. . .- T O. .-- O - 0.OT CCO

Hsa . .A.-G TTT.C. . .0 C. .. .A. . .0 O.T-- O - 3’ CTG

. . Tsy . .A.A.C. . .3’ AOT.C. . .0 C. .. .A.. .0 .T T.T. .AC 0.0.0. .3’ 3’..- . .00A. .CT TTO ————+—6370————+—6380—--—+—6390————÷—6400————+—64i0————.—6420————+—6430————+—6440————+—6450 6460————+—6470————+—6480

Age TCAAAAATTGTCACATOCTCTAATTOTAATCTTT-AOGCCTCACTOGAACTAAAOA-CAAGAAOOTAAAAAA- -OGCTGACAOA-OAAOTCC000TACATTCTATOOT000AGAAAOAAA

Apa - T- -- -

Lia - O... - -- - T

Bar O...- O...- -- -

Ara - O..O- --..O - T

Abe - O..G- -- - 3’

Age - O..O- -- - 3’

Cai A O. .AOA 3’ T CC O 0.. .AO C.-- -. . .T.. .3’... .T O itiu OT 3’.. .C.T CC- 0.. .0...- AA A.A 3’... .TC O.

Hsa OT 3’. .OC.T. . .A. .AC- 0.. .C. . .- C- A.A 3’... .TCC A O.

Tsy . ..OTT...TOTCT.G...T. .0. .T AC- 3’... .COT. .O.A.-T T. . .0....-- A.- G.TAA.OT A.AA. . .

Age

Apa . . .T - Lia 3’ C A.- Bar T C A.- Ara C C A.- Abe C C A.- Ase C C A.-

Cai C. . . .A. . .00A A.. .T CCAA. .T C A.AC-G. .CT A T.C iBsu C OGA A.. .0 C A A A.- C C lisa C GOA A.C.0 C C A A A.A C C

Tsy C. .A.C. . .0 .A.. . .0 A.. .O.T. .A.. .T.O T. .A C. .3’ AC- CT.T. .A T.CA.A 3’. .3’.. .C ————+—66i0———-+—6620————+—6630————+—6640————÷—6650————+—6660————+—6670 66B0————+—6690————+—6700————+—67i0————+—6720

FIG. 2—Continued MOLECULAR PHYLOGENY OF NEW WORLD MONKEYS 21

CACCC CCAAT CCAAT

- -CAAGGCAACCTTGACCAATAGTCT7AOAG7ATCG Age AOTOCAAAPATCTOCCTGAAACTOTCCCTGGCTAAACTCCACCCAT000TTGGCCAGCCTTOCCTT0ACCAATA0CTTTGA - -. Apa -. - - -

A....-. . ----. Lia

---- A Bar 7...-.. . O Ara 07 A.C. . -. .

.----. O A.C. .-. Aba 07 A.C. .. . O Asa 07

C. . -. . ---- A 7 Cai

C. .. A tnu .A 7 O T C. .. A C Hsa .A 7 O C.CA. .GCCC . Tsy .A CO... .7 TTCT 7 C C. .7... .A O ____.._6730____+_6740____+_6750————+—6760————+—6770————+—67B0————+—6790 6B00————+—6810 6B20————-t—6830——-—÷—6840

TATA CAP Age OGTOAO-CCC00000CCOGT000TOOCTA000- -ATOA_-AGAATAAAAOOAAGCACCCTCTATCAOTTCCACATACTC0CTCTGAAACOWT0A0ATTATCAATAA0CTCCTT0TCC

- .--- Apa -. . .A....0.-- --... T. . A.... --. . . .--- T Lia - 7...- A. Bar C --. . . . ---. T A.... Ara C O 7 --.. . .---. T A.... Aba C O T --.. . .---. O 7 A.... Asa C O 7 --. . . .--- T A.T A.... --. . . Cai O - 7 .---O C.O C T...O....O A.... ttsu O .A....C.O.-C..C --....- C T. . .0 A.... .--- TC.O lisa A O. .A. . .C.O.-C. .C --...... 0 O A-T. .7 A OO.C CAA... Tsy O..A.. ..CT AAAO.TCAA. . . .CAA T 6950 6960

Apa A --. Lia A --.7 C 7

Bar A A --. C -

Ara A C.CA.O.. .- C 7 7

Aba A O... .C.CA.O.. .- C T 7

Asa A C.CA.O.. .- C T 7 Cai A O. O... .C AT TC

. 7 C C... Itru A.. .A C. . .0 C CA.?. .7 O

. T.C. . . .- C... Hsa A C. . .0.--. C. . .TC. .7 O

. --.. . . .C. . . .7 .. .7.?. .A C... Tsy A.. .AT.T. .A-.--. . .C. .A.0. .A.CT. . .CA.T A A? C.T.

Age Apa Lia Bar Ara 7 C C... Aba 7 C A C... Asa 7 C C... Cai O C T T.C C...

Minu O .7. .0. .0 C.A.O. . .0. .0.00. .0. .00. .0 0. .0 CC.A. .CCC.AA. . .CC.C CC .TC.C... Hsa 7 C.A O A AA 7. .C... Tsy A A O T..T O C AA...A...T...O A O.T ——--+—72i0————+—7220————+—7230————+—7240 7250————+—7260————÷—7270 7280————+—7290——-—+—7300————+—73i0————+—7320

A 0. .T.. . .A lisa .. .C. .. .0 C A Tsy .CAC.TA.0 C A.ATG Ci’. .7 AnA 70 A CAC C. .-. .7 ———-+-7330————+—7340—-——÷—7350————+—7360————.—7370 —73B0———-+—7390————+—7400————+—74i0——-—+—7420 7430——-—+—7440

FIG. 2— Continued 22 MEIRELES ET AL.

Age

Apa e -

Lia TC -

Bar ..-....TC 0 -

Aca PCA..G T 0 0 -

TCA. .0.--- T O O -

Ase TCA..0 T 0 O -

. . Cai TC. . .G 0.. .0. .A A.. .0 0...- .- O -

Itnu ..C....TCA..OC T....A...G..G C...C T....O...G - C 0 0 A

Bsa TC. . .00 T. . . .A. . .0 O.. .0. .0...- C O O A

tsy TCAO.O.00. .00A.T C.CA.A. . .0 ATC. .00.C.T. .0 O--.GA 0.0... .OA.A CC.. .AT. . . .0.0 OA

Age CTGOACTOAOACCCAGTOGTAA700TTPA000CCTACOOA000CCTCTAAAAA000AOA000ACAACT- - - -TT000TTTOAOAAAAOAOTTOTOGAAATOAOGACAATOA-- -CTTTTC

Apa ----. ---.

Li ----. ---.

Bar A --—-. ---.

Aca ---- e e ---.

Abe ----. e ---.

Ase ----. e ---.

Cai 0 e T O T. . .----. O

. . tuu . .0 O.A A O.. .0 0.----.. .A.A. . . .C AO A ---.

lisa .. . .0 C A O O.. .0 ----.. .A AO A ---.

‘PBy . . .AO AO... .C. .0 .A.. .AT A T.TAO. .-O A O.OAAO. .AA A.. .0.0.0.-. .T .00.OA.000 O

Age -000AT Apa

Lia - - O

Bar e - - 0.0 Aca -.C....- O O e A- Abe -.C....- O 0 A- Ase -.C....- O O A-

Cai --- O -. . . .T.- O 0.0 A-

Mmii T. .C -. . . .CAA 00... .0 A.O 0.0 O A-

lisa T.TC -. . . .CAC CT TO. .. .00 A 0.0 0.0 A-

Tsy T. .00 A. .A... .-OT TT. . . .T--. AACCT--. . . .0-O... .A.A. . .A O... .A. . .A.T.T.A.CA

Age ATATT000TCAATCAAA0000--- -AOAA000T00000CCAAACATATATTOCTAA0000A000ATGOAATTA00000ACACAT

Apa O ----.

Lia O ---- O A C

Bar O ---- O A

Aca O. .0 --...-. .00.- CA O

00. .0 --. . .-. .0.. - AA O

ABe O. .0 ----. . .-. .OAA- AA O

Cai O.T ----. .. .AC O O... .CA T Mmii C. .0 ----0 e A O.---OT. .0 C.A. .-.C BBa O ----O e C.A. .-.C

. Tsy A-T.AO. .OTAOAAAOAA C.OA TO.O.O.. .0 O.. .C.A. . - .0.. .T O.OCACATACTOCTA000CCAOACATOOA000TCATOC

Age Apa Lia Bar Aca Abe Ase Cai Mm lisa Tsy ———-÷—7930--——÷—7940————÷—7950————÷—7960————÷—7970————+—79B0————+—7990 8000————÷—80i0————+—8020—-——+—B030————÷—8040

Age Ap Lia Bar Aca Abe Ase Cai Mmii lisa Tsy 000A0000ATT0000000AA0000AA000A000000A00000A000000AOOATCAC000AOCCCAOOI

FIG. 2—Continued 23 MOLECULAR PHYLOGENY OF NEW WORLD MONKEYS

- Apa T C A. Lia .A C A.A. .- Ba C - Ac .T T C A.C Ate .T .T P C - As G.CT G. .CA .T C.C.. .C. .. .7 Cai G.TC .. O CC G. .CA .T CA.T.TCA C T. .-.C I(iuu .C T C T... .-.T G CC A.G. .CA O. H5 .T . . . .A.AAA T T. .T C. . . .GGA.AA.GC. .A. .C.. ACAGAGTGAAACTCCAATTCAAAATAAAATAAAGTAAA.T AT. . .T C.. .C Tsy 8260————+—8270————+—82B0 ____+_8i7O____+_8i8g____+_8i9O____+_82OO____+—82iO————+—B22O————+—B23O——+824O-+B25O

TATGTGTGCTTTTTTTTTTGTGTGTGTGT GAGCATGTGTTTC Age AATAGAAACATTTGTCCTGGAGTAGAPTTTTPA-GTCAGTTGTGAGTGTGTGTATG CC.. .G.G.G - T O..- Apa .PGTG TG.G.G.G.G . .. .0 - O. Lia TO.. .G.G.G . . . .G - O Bar A . . . .0 O. .TGTGTGTG TO. . .G.G.G Aca A G - C GTGTGTOTGTGT. . . .G .TGTGTGTGTG TG. . .0.0.0 - O. Ate A G C .TGTGTGTGTG TG.. .G.G.G . .. .G Ase A G - C 0. GAGA C A C.C. .T O. .TGTGTGTGTG.G. . . .C.TGCA Cai AC. .0 GA.A.C. .00.. .T O. .TGTGTGTGTG.G. .C.C. .GC Bsu . . .T CO. .A C. . .0 GA.A C.C. .T 0. .TGTGTGTGTG.G. Oca . . .T 00 .GAA.AA.O .C OT.T. .TGTTGTTGTTTTTAT. Tsy .. .T.O.G. . .A C .0

Age - CA Apa C.... Lia - Bar A A - A - - C Aca C C.. . .0 ---- C C A - Abe C O C A - ---- C Ase C

- C A Cai A AO T..G A -A.... btsu T C O C...A..T .TO A A.... . A O O... Oca C. .C C CA. . .0.0 . .TG.O.T A. .T.A. .T.. .T T . AA G.CC. .0.. .A. Tsy AO .T.AOT. . . .A.TGA. . . .GT. . .GAT

Age T. Apa - A 7. Lia - T. Bar - C O 7. Aca - C O 7. Ate - C O T. Ase - A C.. . .0 T C.T C 7. Cai - O

-. 7.. .A.C C. .7 7. )tsa 7 C .70 T. . .A.C C. .C. . .A 7. Oca 7 C 70 . C.T .A.C.T. . .C. .C.C... .7 .TT O A... .0. .-.CA. . .CC.AA. .C.AG. .A. .-T 7 Tsy . . .O-.C C. .. .AA O

Exon 3 ends> Poiy-A Signai

- AAAATAATAAAACTATTCTGCTTAGAGATCACACOTG Age OCCCTGOCCTCCAOATACCACTOAAGCCCC-TOCCCATGATOCAOAGCTTTCAAOGAGTGGCTTTATTCTOCAAOCAATA-

---. Apa 7 -

---. Lia O -

---. Bar O -

---. Aca O. .T. . -

---. Ate O. .T. .- Ase O. .7. .7 ---. A.. Cai O O A A C.--- A A.. --- 7 Meu 7 CC.... - CA TA T O A.. Oca 7 00.7.7- 7 TA ---b A.. .A.AT. .O.AC...... 0.. .CA 7 O. .ATA.C. .C A Tsy OACA. .A. . .T CC....- C. .AT C.

FIG. 2—Contjnued

2—Conflnued FIO.

.00AT

.ATTT.

.C.O.T .

. . CC.A.

.CA.T.

. .TCA.-. .

TO.AOAOACAATOGTTAAO .0

.0... . .TTT. .0.0.. .A. . . . A.

Tsy

.2.000A. .2 .AC.

O...

.0 A..

C. . C T

. O

Hsa

.00A. A.

.T.

C.O

‘2

.C. . C ‘2.. TA.O

. O )ttu

---T

.0...

.2 0. O A

‘2

C.O. 1’ Cai

A A

‘2 Asa

A A

.A Aba ..

A A

‘2

Aca -

0.0

‘2 Bar

0.0 T

‘2 Lia

Apa

-C

TOPOCAGACTOOTCACAOCATTTCOAOGAAOAOACCTCATTATAAOCTTCA0000020000A-

CATOCCTAAOAAA000mTTAATTCCATOCCCTTAAO Age

. Tsy .

. lisa .-

!tnu .--- .

A. Cai

Asa . .-

. Aba .-

. Aca .-

Bar . .---

Lia . .-

Apa .

02 Age

.2. .C.

.22.2. .2.. . . .OA.T.C.

.2...

.T.CA.CACAO-.

G.T--’2.

.C -TTOC.CTTCC A.. o.’2C .A.o.t O.. .00 . Tsy

.2.

C’r.A.e.. .2 .C.A. .A.O. . . .2.. .C T. .TO A.

‘2... AT. .AO . Hsa

.2.

.C.

.2. .C.. C. .2 A. . . O .TO.T .TO

‘2.--.... ‘2... AO e ltnu

C....T ‘2 ‘2 ‘2..-

O e Cai

e - t..- e

Asa

C ‘2..-

- Aba

‘2 C -....-

e Aca

‘2 -

T..- ‘2 Bar

C - 1’..-

Lia

. . . -

. -. Apa

Age

.A..

C..

.0. .O.----A

.C.

.AA

. CAOCAA.O.t.T.A

.AA.C.T-.OAOA.O.

.T. C.

OA.

.A .0

...... A. . .T.AO.. . . Tsy

.T AflO... O

A.. .0 A

T TC O .C HBa

----

--..T 0....-....C AA Sênu

A.. ----O

O A Cai

o ----

Asa

O ----

Aba

O ----

Aca

----. A

Bar

A ----.

Lia

----. C

Apa

-CAOCAOAGTAOgAAOGAT - -

CTOOTgGOAAOAAAOACCTCTATAOAACAGOACTCTTCAOAAACAOATOOPTT000AOAOAT0000AAATOTTCAOTOAAOACCT000TOCTOOATTO- Age

OC.

.AOA.

O...

.A.O-AAOAAC.

A .0.. . .A.

. .ACAA

.AOG.

.A.

---.

.T.O. . ATTT. O . . . . .T.C AT. Tsy

.OA.T... A..-.

e .C A..

CA-- 2 C lisa

.C .0. .T. .T... .T. A.

. .T.C

.GA. .C. A.. .A

O.. . AA--

CC IBsu

O- A C.A.

.A.C

. -- g C Cai

O-

O.. .A

C - -- .T Asa

G-

O.. .A

£2 - -- .T Aba

O- O.. .A

-- - .T Aca

o- A

-- Bar

O- A

-- Lia

-- A Apa

-OTTTGATGAGCAAATAAAATAACTAAGCAGTACAOAAACTTGTACAT000AGTTCTGCA-GT000AGGAAAAT-GTGTAOGAOAAAT OCtCCTTATTTATTTTTACATGAOATGT000- Age

8910————+—B92g————+—B930————÷—8940————+—B950————÷—8960————+—B970————+—8980————+—B990---—.-9000

.0...

.TGTG

.GTG.GTA.A. .GTG.T.

.T. . .0. .OiCTGTG. .0. .A.

A.ACT..

. .AT.C A.. .TT . . .CATGT.C TT. .C T.T.C. Tsy

.GTT

0..

A .0..

.A.T0

.A.

A . .TT

--TT.ACAT. .C.C .T.

. .T. lisa .. ..

.T .00..

A TG.T .0

A...

C A .T

-TT.A.AT.. .

.C.C .T.

.T.

&su . . . .

G....T

A...TG....CA

A --.T - T....C Cai

T..T A O

- -- Asa

T..T A..A O

A -- - Aba

T..T

- A - -- Aca

T A O -

- -- Bar

A T

A O

-- Lia

- - -- Apa

-CCflGTCCTTT-AAAArATGTGAGCCACm000TTT-ATGTTGATGGATGCATGTATGTGTGTTTCTGCATACCTACOTGTGTTTGTOGTGTGTGCAT ATTGTCGTCAGTTAflflT- Age

Ai. ET MEIRELES 24 ______

MOLECULAR PHYLOGENY OF NEW WORLD MONKEYS 25

GTCATG’CTGAGCAACAAAC R2

Age TTAGGTGAAAGAAAPGAATCTGCAAAAGG’OCACAAGTCAGCATCAGTGCGTCATGTCTGAGCAACAAAC Apa Lia G C B&r O C Aca C G C Me C G C Ase C O c G.. . . C.T Cai . . . .A T. .G T A.. .0.0 O. .CAT. .TG G.G.. A... .G.. lisa T A.. .0.0 0. .CÃT. .T AT.C G.. Tsy G O G CC... .GA. . . .0. .CC -——-+—9610 9620 9630 9640 9650————*—9660————*————

FIG. 2— Continued clades, and they provided two to three times as Figure 3 shows the MP tree with bootstrap and $OG many synapomorphíes (Table 2) for tliese clades as did values for the fuil dataset and also for the dataset the third dataset (that restricted to those noncoding restricted to those noncoding sequences that in their regions of the aligned sequences that show absence of history were never involved in gene conversions either gene conversions in both branches ofAnthropoidea). in platyrrhines or in catarrhines. The tree for the fuli dataset has a nucleotide substitution score of 3122 and a consistency index of 0.93, wliereas tlie tree for the TABLE 2 restricted dataset lias a score of 943 and a consistency the sarne as for the fuli dataset, i.e., 0.93. y-Globin Nucleotide Positions” with Synapomorphies index that is for Different Ateime Clades The nurnbers beiow the lines represent bootstrap vai ues as percentages, whule nurnbers above these lines Atetesgeoffroyi/Atetespaniscus (45): 102, 325 326, 685, 710H, 721, represent SOG values. The nurnbers not in parentlieses 1019, 1139, 1244, 4035, 4062, 4634”, 4825, 4863, 4915, 4918— the values obtained from the fuli dataset, wliereas 5372H, 6125, 6178”, 6289, 635$, 6380— are 4925, 5085, 5416, 5803”, the obtained 6382’, 6533, 6666, 6673, 6956, 7120, 7448, 7449, 7867, 8224, the nurnbers in parentheses are values 8392”, $785, 8954”, $979 9106” 9312, 9346, 9495, 9576, from the restricted dataset. As can be seen, in the MP 9625”, 9647H tree produced from either dataset, ali ciades are strongly Lagothrix/Brachytetes (16): 377, 392”, 406, 594, 1058, 1286, 4335, supported. Witli the fuil dataset, with one exception, ali 6265H 9209, 9578 4$56, 5394, 5651, 6615, 6920, 7845” clades are supported in 1.00% of the bootstrap replica Ateles/Lagothrix/Brachytetes (31): 43,224,438, 718, 800, 958, 1182, 1301, 4082, 5203, 5271, 5345, 5638, 6035—6043, 6293, tions and the exception (theAZouatta betzebut/A. senicu 6797, 6847, 6924, 7233”, 7317H, 7423”, 7453, 7493, 7507, 7733, lus clade) in 95% ofthe replications. With the restricted 7794—7795, 8320, 8440”, 8613, 8921, 9559 Atouatta betzebutlAtouatta seniculus (12): 33, 36—37”, 82, 246, 888, 1171, 1296, 4764, 5302, 8206, 8469, 9026 Ateles paniscus 44(17) A. beizebut/A. senicutuslA. caraya (126): 50, 61, 62, 83, 85, 94, 100(100)1 Ateles geoffroyi 131, 142, 203, 218, 264, 289, 320”, 358, 385, 387, 394, 444’, 486, 28(6) 532, 543, 577”. 620, 636, 638, 675, 702—703, 726, 784, 986, 1089, 100(97) Lagothrix fagotricha 1215, 1272, 1412, 1535, 1552, 1593, 3850—3997, 4034, 4150, 16(8) i 4308, 4427, 4436, 4449, 4470, 4475, 4480, 4674, 106(35) 100(100)1 4277, 4278, Brachyteles arachno,des 4769, 4784, 4859, 4880, 4904, 4919, 4931, 4949k, 5116, 5128”, 84(37) 100(100) 534711, 100(100) 5206, 5213, 5238”, 5269, 5270, 5275, 5317. 5425”, 5479, Alouatta beizebul 7(6) 5514, 5521”, 5680, 5685—5688, 5739, 5742, 5791—5794, 5861, • 123(48) 1 6140, 6310, 6342, 6366, 6395, 6401, 6536, 6572”, 6721, 1 Alouafta seniculus 6027. 100)100) 6722, 6795H, 6832, 6841, 6857, 7105—7106, 7108, 7112, 7155, 722lH, 7335, 7354, 7355, 7468, 7665, 7707, 7815, 7829, 7832, Alouatta caraya 7835, 7873’’, 829911, 8306”, 8425, 8453—8456, 8497, 8507, Cebus albifrons 8515” $619, 8788”, 8982, 9002”, 9020, 9089, 9229, 9304”, 9546, 9606 Macaca mulatia Atetes /Lagothríx /Brachyteies IAiouatt (111): 65—70, 253, 402, 32(12) 100)99) 422, 423, 436, 445, 448, 469”, 471, 555, 695, 701, 715, 786, 916, 1 Homo saplens 957, 980, 1147, 1157, 1199, 1365, 1457, 1480, 1531”, 1537, 1778, 1912—3792, 3817, 4100, 4102, 4104, 4110, 4115—4127, 4179, Tarsius syrichta 4260,4335, 4377, 4400, 4401, 4413, 4492, 4493, 4535, 4540, 4645, 4670, 4676—4677, 4775, 4783, 4820, 4827, 4$93, 5053, FIG. 3. Maximum parsimony tree found for the 11 aligned 5314, 5316, 5320—5324, 5341, 5353, 5490, 5493, 5505, 5602”, y--g1obin nucleotíde sequences. NS score for the fii)1 dataset = 3122, 5684, 5695, 5743, 5774H, 5790, 5797, 5823, 6072, 60$0H, 6103, and consistency index for this dataset 0.93. NS score for the 6222, 6309, 6463, 6472, 6473, 6491, 6500, 6506, 6514, 6573, restricted dataset (noncodíng sequences not involved in gene conver 6578, 6601, 6611, 6613, 6631, 6648”, 6681, 6714, 7476, 7480, sions) = 943, and consistency índex for this restricted dataset = 0.93. 7690, 7756”, 8248, 8264, 8314, 8348, 8590, 8607, 8693, $819, Numbers above lines are SOG values, and numbers below lines are 8$78, 8887, 8953, 8974, 912611, 9331, 9649, 9667 bootstrap values obtained in 2000 replicates. The numbers not in parentheses are for Lhe fuli dataset; the numbers ín parentheses are Note. H, positions that show homoplasy. for the restricted dataset. 26 MEIRELES ET AL.

dataset, ali but three clades are supported by 100% of 0.35 O 65 Ateles geoffroyi the bootstrap replications, and of the three not so lT1 °‘ supported, two ofthem 0.42 Ateles paniscus (the Atouatta betzebul IA. senicu 100 091 lus clade and the Macaca/Homo clade) are supported Lagothrix lagotricha by 99% and the remaining one (the Atetes ILagothrix / 1.90 3.81 100 Brachyteíes arachnoides Brachyteles clade) by 97% ofbootstrap replications. 100 0.28 0.10 Alouatta beizebul 90 With each dataset, the clades with less than 100% 1.71 0.27 bootstrap support have smaller $00 values (Fig. 3) and 100 Alouatta seniculus 0.28 fewer synapomorphíes (Table 2) than the other ateime Alouatta caraya clades. Nevertheless, 3.72 the numbers of synapomorphies Cebus alb,frons 26.27 and $OG values supporting the clades with less than 4.13 100% bootstrap values are still substantial. With the mulatta restricted dataset, 7 and 10 synapomorphies and SOG

values of 6 and 6 support the Atouatta betzebut/ ,__ Tarsius syrichta A. senicutus and Ateles/Lagothrix/Brachytetes clades, —/ respectively. The numbers of synapomorphies for the FIG. 5. Neighbor-Joining tree found for the 11 aligned -y-globin most parsimonious ateime clades in some cases (such nucleotíde sequences. Numbers above lines are bootstrap values as the twojust cited) are larger than the $00 numbers obtained in 2000 replicates, and numbers below lines are the for these clades. The $00 number is lower than the percentages ofnucleotide change. number of synapomorphies supporting each such clade because among the substitutions counted as autapomor the trees that break up the clades in the ML tree with phies of one or another lineage within the clade are the least decreases in likelihood are considerably Iess homopiastic substitutions that act as putative synapo likely than the ML tree. morphies for the alternative grouping that breaks up The NJ tree (Fig. 5) depicts the sarne cladistic the clade with the least addition of mutations over the relationships as the MP trees. score ofthe MP tree. and ML The nurnbers below the lines represent bootstrap values as percent Figure 4 shows the ML tree constructed for the ages, based on 2000 replicates. These y NJ results aligned -y-globin sequences. This tree of highest likeli strongly support ali clades, since they showed 100% hood at lnL score of —26916 fully supports the cladistic bootstrap values, except the Lagothrix IBrachytetes and groupings obtained by the MP tree shown in Fig. 3. In Atouatta beizebuilA. senicutus clades, which showed the ML tree ali clades except the Atouatta beizebul / 99 and 90% values, respectively. The values presented A. senicutus clade are supported by 100% bootstrap above the lines on the tree in Fig. 5 are percentages of values. The A. betzebut IA. seniculus clade is supported nucleotide change (i.e., branch lengths). by 85% of bootstrap replications. The $00 values for the interior nodes range from —14 for the A. beizebui / Estimated Branch Times in Ateime Phytogeny A. senicutus clade to —406 for theAtouatta clade. Thus, Guided by the fossil evidence on ateimes and the model of local molecular ciocks, we used the percent ages ofnucleotide change between ancestral and descen Atetes -186 1 paniscus dant branch points in the ateime region of the NJ tree 100 -51 Ateles geoffroyi (Fig. 5) to estimate divergence times among ateime 100 lineages. In contrast to the model of a global Lagothrix lagotricha molecular clock in which -161 100 ali lineages are assumed to accumulate Brachyteles arachno,des -131 100 nucleotide change at the sarne rate, the model of local 100 molecular clocks makes no such assurnption but uses -14 Alouatta belzebul -406 85 paleontological evidence on an early branch time within 100 Alouafta seniculus a localized region of the phyiogenetic tree to initially Alouatía caraya calibrate the local molecular clock for that region and then allows the clock to run faster or slower according to whether a descendant lineage accumuiates change

-39 Macaca mulatta at a siower or faster rate than the other descendant Iuu lineages (Goodman, 1986; Bailey et ai., 1991, 1992; Homo sapiens Schneider et ai., 1993). Tarsius syrichta The earliest ateline fossil, Stirtonia, judged to be a basal member of tribe Alouattini on the basis of FIG. 4. Maximum likelihood tree found for the 11 aligned -y-glo dental bin nucleotide sequences. Its likelihood score or natural logarithm characters, dates to the rniddle Miocene at 15—16 number (ln) = —26916. Numbers above lines are SOG values, and Milhion years ago (Stirton, 1951; McFadden, 1990; numbers below lines are bootstrap values obtained in 100 replicates. McKenna and Beil, 1998). The age of $tirtonia iends MOLECULAR PHYLOGENY OF NEW WORLD MONKEYS 27 credence to the estimated age of 16 Ma for the last with 2.57 Ma as the reference date for the A. caraya—A. common ancestor (LCA) oftribesAlouattini and Atetini seniculus IA. belzebul brancli point, this reference date obtained (Goodman et ai., 1998) by local clock calcula was equated to 0.37 (average branch length of the tions with c-globm and IRBP intron 1 gene sequences A. seniculus/A. belzebul clade as a total group) and the on using 25 Ma as the reference date for the LCA of ali brancli time ofAlouatta seniculus from A. betzebui was extant ceboids. With 16 Ma as the reference date for the equated to 0.27 (average branch length of tlie crown alouattin—atelin brancli point, the local clock calcula group) to estirnate 1.89 Ma as the age of this croun tion for branch points within the ateline region of the ‘y group. NJ tree were carried out as follows. Each clade defined The sarne procedure was followed for estimatíng the by a brancli point was treated first as a crown group branch tirnes wíthin Atelini. In this case, tlie starting (consisting of the two descendant branches from the reference date of 16 Ma was equated to 1.48 (the branch point) and then as a total group (consisting of average branch length ofAtelini as a total group) for the two descendants plus their stem). The average the initial calibration of the local clock. Equating the percentage nucleotide change was determined for the age of the Atelina—Brachytelina brancli point to 1.06 clade first as a crown group and then as a total group. (the average branch length of the crown group) then These average branch length values and the branch yielded a brancli time of 11.48 Ma, the reference date times (LCA ages) estimated from them are iisted ín for calibrating Lhe next round of local clock calcula Table 3. To estimate the branch time ofAlouatta caraya tions. It should be noted that the ateime branch from the Aiouatta seniculus group (A. seniculus, accurnulated nucleotide sequence change at a slower A. belzebul), tlie reference date of 16 Ma for the rate than did the alouattín branch. Thus, our model lias Atelini—Alouattini branch time was equated to 2.04 the clock (time keeper) run at faster rates in the (the average branch length of Alouattini as a total descent of atelin lineages and at slower rates in the group) and tlie branch time being estimated was equated descent ofalouattin lineages. to 0.33 (the average branch length ofthe crown group), i.e., 16 Ma was multiplied by the fraction 0.33/2.04 to from Combined yield a date of 2.57 Ma. On recalibrating the local clock Phylogenetic Inferences Tandemly y- and e-Gtobin and IRBP Sequences The -y-globin nucleotide sequences from this study TABLE 3 were cornbined in tandem with previously published e-globin and IRBP intron 1 sequences. The species Local Clock Estimates of Branch Times represented in this dataset did not include Ateles Within Atelinae paniscus and Alouatta caraya because they were repre Average branch length for sented only by y sequences. The dataset represented Branch timee with all three sequences five ateimes (Lagothrix lagotri Crown Total (Crown group e/ia, Rrachyteles arachinoides, Atetes geoffroyi, Ai Branch-Point group groupb age) Ma ouatta belzebul, and A. seniculus) and two of the four and Homo sapiens). The Age—Apa 0.40 1.05 (Ateima) 4.36 outgroups (Cebus albifrons Lia—Bar 0.90 1.07 (Brachytehna) 9.62 two other outgroups (Macaca rnulatta and Tarsius Atelina—Brachytelina 1.06 1.4$ (Atelini) 11.48 syrichta) were represented by y and e sequences but not 0.37 (A. senicutus by IRBP sequences. This dataset of tandemly combined Abe—Ase 0.27 group) 1.89 sequences, spanning 15,820 aligned nucleotide posi Abe/Ase—Aca 0.33 2.04 (Alouattini) 2.57 tions, is available at our Web site address. Average of the lengths of the two branches that descend to the Figure 6 sliows the MP tree with bootstrap and SOG present from the brancli point defining the crown group. These values for tlie tandemly cornbined y, e, and IRBP branch iengths are deríved trem the percentage nucleotide change on sequences. In agreement with tlie separate y, e, and NJ tree ia Fig. 5. the relevant lineages ofthe IRBP MP trees, the MP tree for the tliree tandemly b The iength of the stem of the crown group added to the average branch length ofthe croun group yields the average branch length of combined sequences depicts Brachyteies and Lagothrix the total group, the taxonomic name ofwhich is given in parenthesis. as sister-groups, next Brachytelina and Atelina, and The reference date of 16 Ma for the age of the branch point tlien Atelini and Alouattini. Ali groupings in this MP designating the LCA of Alouattini and Atelini is used te initiaHy tree (Fig. 6) are supported by bootstrap values of 100%. The of the c]osest descendant branch calibrate the loca] clock. age SOG are stronger than in the point ia the alouattín clade is estimated from the proportions of Moreover, the values crown group iength te total group length ofthat clade. The estimated separate y MP tree: 22 rather than 16 for the groupíng age of thís descendant branch point is then used to recahbrate the ofLagothrix and Brachyteies, 35 ratlier than 28 for the clock and estimate the age of the next descendant branch point. The grouping ofAteles with the bracliytelan clade, and 135 sarne procedure is followed ia estirnating ages of branch points ia the rather than 106 for the grouping ofAtouatta with the ate]in dada, always using the proportion of crown group iength to total group iength of the clade defined by the descendant branch atelin clade. Our phylogenetic results are congruent pOint. not only wíth our previous results using the 1.8-kb e

(At

Ateima sister-subtribes into divides which of ter the diploid that suggests 1989) ai., et Pieczarka 1980;

lat the Atelini, and (Aiouatta) Alouattini sister-tribes (Chiareili, 32 34 to from varies ofAteles number diploid

into divides Atelinae subfamily Again, resuits. the previous that fact 1995). further The ai., et Stanyon 1991;

these with agreement good in are sequences gene Seuanez, and Lima 1987; ai., et (Armada 53 to 44 from

y-globin with results present The respectively. Ma, varies that number diploid has Aiouatta hand, other

and 11 16, 13, are also Lagothrix and Brachyteles and the On inversions. and three transiocation reciprocal

Brachytelina, and Ateima Atelini, and ofAJouattini one ages to attnbute (1985) ai. et Viegas-Pequinot which

group totai the Accordingly, respectively. Ma, 11 and ofLagothrix, the karyotype in chrornatin intercalary of

at 13, 16, and Brachytelína sister-subtribesAtelina and presence the to due are patterns of banding differences

Atelini, and Alouattini sister-tribes Atelinae, subfamily Some minor similar. are 5, very pair except some pairs,

ages of group crown the placed sequences nucleotide ali cliromo et (1985), ai. Viegas-Pequinot and 1982)

gene 1

intron and IRBP e-giobin based on (1980, by

estimates Chiareili observed (2n as and 62), sarne =

clock local molecular classification, this Ma. 7 For to the is Lagothrix and Brachyteies in number mosome

11 from ranged groups as total or genera groups chro croun diploid The relationship. sister-group this support

as subtribes and Ma, 10 to 14 from ranged groups totai also data Cytogenetic Lagothrix. and Brachyteies of

as subtribes or groups as croun tribes Ma, 20 14 to from the sister-grouping 6 supports of value SOG a 92% and

groups ranged totai as tribes or groups croun as of 1996) lies value a bootstrap ai., et (Schneider dataset

age age. subfami of The equivalent roughly of taxa to this tree for MP the In sequences. 1 gene intron IRBP

was assigned sarne rank the i.e., taxa; ofthe ranks and the e-globin nuclear combined tandemly the on based

clades determined ages ofthe estimated the and ai. et clades (1996) (1995) and Schneider ai. et by Harada

(1998) represented all taxa named ai. et Goodman findings previous the corroborate results present Our

by proposed classification the primate provisional In gene of conversions. free a history with sequences ing

noncod 3’ flanking 5’ by the and

are 8

provided

clade, ofAteiines Ciassification Phyiogenetic

this supporting 16 the synapomorphies of that noting

is it worth Furtherrnore, Lago thrix. and ofAtelini. genera the Brachyteles are extant

of sister-grouping for the of and Brachyteies 16 value Lagothrix, Ateies, SOG a whereas and Alouattini,

support bootstrap 100% -y of extant genus yields sole sequences the of is Aiouatta dataset clearly Atelinae,

fuil the of analysis tribes two of parsimony sister Ofthe noted, 1990). As Brachyteies (Kay, already with

cases in and other ai., et 1985) (Dunlap Lagothrix with

Ciade Lagothrix) (Brachyteies,

Brachyteian

The

cases in some uatta Aio for grouping were responsible

features morphological

that convergent indicate indeed DISCUSSION

Our DNA results and Brachytetes. diet ofAiouatta rous

folivo the reftecting features to convergent grouping

ouatta[Ateies(Brachyteies,Lagothrix)].

1993) this attributed Kay, and but later ies, (Arithony

Ai arrangement sarne phylogenetic

the yield

results

withBrachyte groupedAtouatta

characters, 117

dental

II) i.e., ali sequences, oxidase (cytochrome

COIl

long

analyzíng on Kay (1990), whereas

morphology,

forelimb

0. 7-kb- and sequences

6-phosphate-dehydrogenase)

on basis of the Lagothrix with Aiouatta grouped

(1985)

(glucose G6PD (1997) nuclear using 1-kb-long

Dornum

et ai. proposed. also Dunlap been have groupings

native

ofVon wíth but results also sequences IRBP and 1.8-kb

alter However, dental characters. and cranial based on

(1986) 1984), and Ford (1981, (1973), Rosenberger eser

Zing of víews previous with agrees clade Brachyteies)

2000 replicates. in obtained

the (Ateies/Lagothrix/ atelin of sister-group the as values are bootstrap lines below numbers and values, SOG are

lines above species. Numbers primate (Aio uatta) non-ateline Alouattini Having clades. four atelin and ateime and ateime

five from sequences nucleotide 1 íntron

IRBP y- and c-globin and for both values bootstrap by 100% corroborated are

combined tandemly for tree found parsÍmony 6. Maximum FIG.

results These (Fig. parsimony 4). respectively clades,

and ateime up atelin the break to mutations extra

sytichta Tatsius

and 28 106 4). takes It (Table together Brachytetes) and

saplens

Homo

(Ateies, Lagothrix, three group atelins the that 31 and 100

together ateimes group the that synapomorphies 111 mulatta Macaca

contam sequences -y-globin aligned The Brachyteies.

tons albif Cebus

and Lagothrix, for Ateles, the Atelini and ouatta

seniculus Alouatta

for Ai sister into Alouattini tribes, two division its 100

157 and ofAtelinae rnonophyly the support Our findings

beizebul Aiouatta

100

Ciades and Ateiin Aiouattin

103 Ateiesgeoffroyi

135

100

arachnoides rachyteIes and Brachyteies. ofLagothrix

100 35

for a the sister-grouping is synapomorphy 62 of number 22

lagotricha Lagothrix

AL. ET MEIRELES

28 ______MOLECULAR PHYLOCENY OF NEW WORLD MONKEYS 29

(1996). eles) and Brachytelina (Brachyteies and Lagothrix). C. M., Slightom, 4. L., Gumucio, D. L., and Goodman, M. Reduction oftwo functional y-globin genes te one: An evolutionary The local molecular clock estimates, based on these y trend in New World monkeys (Infraorder Platyrrhini). Proc. Nuti. reference age for sequences and using 16 Ma as the Acad. Sci. USA 93: 6510—65 15. group, place the ages of subfamily Atelinae as a crown Chiu, C-H., Schneider, H., Slightom, 4. L., Gumucie, D. L., and tribe Atelini and subtribe Brachytelina at 11.5 and 9.6 Goodman, M. (1997). Dynamics of regulatory evolution in primate Ma, respectively; i.e., the total group ages of the two p-globin gene clusters: Cis-mediated aquisition of simian -y expres sister-subtribes (AteIma and Brachytelina) and the two sion patterns. Gene 205:47—57. sister-genera (Brachyteies and Lagothrix) are also 11.5 Dunlap, 5. 5., Thorington, R. W., Jr., and Aziz, M. A. (1985). Forelimb and 9.6 Ma, respectively (Table 3). The ages for these anatomy ofNew World monkeys: Myology and the interpretation of models. Am. J. Phys. Anthropoi. 68:499—517. ranked taxa are well within the ranges of the previous primitive anthropoid J. PHYLIP—Phylogeny inference package (ver estimates (Goodman et ai., 1998). Felsenstein, (1989). sion 3.2). Ciadistice 5: 164—166. Fitch, D. H. A., Bailey, W. J., Tagle, D. A., Goodman, M., Sieu, L., and ACKNOWLEDGMENTS Slightom, J. L. (1991). Duplication ofthe y-globin gene mediated by Li long interspersed repetitive elements in an early ancestor ef We thank Dr. Adelmar Coimbra-Filho and Dr. Alcides Pissinatti simian primates. Proc. Nati. Acad. Sci. USA 88: 7396—7400. (Centro de Primatologia do Rio de Janeiro, RJ, Brazil) and Dr. Kathy Fleagle, J. G. (1988). “Primate Adaptation and Evolution,” Academic Neiswanger (University of Pittsburgh Medical Center, Pittsburgh, Press, San Diego. in this work. We also thank Dr. Michael PA) for the samples used Ford, S. M. (1986). Systematics of the New World monkeys. Ia Molecular Medicine and Genetics, Wayne State Hagen (Center for “Comparative Primate Biology, Volume 1: Systematics, Evolution School of Medicine, Detroit, Ml) for the syntbesis of University, and Anatomy” (D. R. Swindler and J. Erwin, Eds.), pp. 73—135. primers. This research was supported by grants from Conselho A. R. Liss, NewYork. Nacional de Desenvolvimento Cientifico e Tecnologico (CNPq), Brazil Olson, C. B., Beeber, J. E., and Czelusniak, J. (1982). (201530/93-7), National Science Foundation (NSF) (INT 960291W, Goodman, M., biological analysis of mamma and National Institutes ofHealth (NIH) (HL 33940). New perspectives in the molecular lian phylogeny. Acta Zeoi. Fennicn 169: 19—35. Goodman, M., Czelusniak, J., and Beeber, J. E. (1985). Phylogeny of REFERENCES primates and other eutherian orders: A cladistic analysis using amino acid and nucleotide sequence data. Ciadistics 1: 171—185. Tooth form and diet in Arithony, M. R. L., and Kay, R. E (1993). Goodman, M. (1986). Molecular evidence on the ape subfamily on the comparative ateline and alouattine primates: Reflections Homininae. Ia “Evolutionary Perspectives and the New Genetics” method.Arn. J. Sci. 293: 356—382. (H. Gershowitz, D. R. Rugknagel, and R. E. Tashian, Eds.), pp. Armada, J. L. A., Barroso, C. M. L., Lima, M. M. C., Muniz, J. A. E C., 121—132. A. R. Liss, NewYork. H. N. (1987). Chromosome studies in Aiouatta and Seuanez, Coedman, M. (1996). Epilegue:Apersenal acceunt ef the origins ef a Am. J. Primatoi. 13: 283—296. beizebui. new paradigm. Moi. Phyiegenet. Evei. 5: 269—285. J., Fitch, D. H. A., Tagle, D. A., Czelusniak, J., Slightom. Bailey, XV Goodman, M., Perter, C. A., Czelusniak, J., Page, 5. L., Schneider, II., 4. L., and Goodman, M. (1991). Molecular evolution ofthe (n-globin Shoshani, 4., Gunnell, O., and Greves, C. E (1998). Teward a gene locas: Gibbon phylogeny and the hominoid slowdown. Moi. phylogenetic classification ef primates based on DNA evidence Bioi. Eooi. 8: 155—184. cemplemented by fossil evidence. Moi. Phyiegenet. Evei. 9: 585— (7., Kehoe, 5., Sieu, L. C., Bailey, XV J., Hayasaka, K., Skinner, C. 598. Slightom, J. L., and Goodman, M. (1992). Reexamination of the Greves, C. P. (1993). Order Primates. In “Mammalian Species ofthe Mrican hominoid trichotomy with additional sequences from the World: A Taxonomic and Geographic Reference” (D. E. Wilsen and primate 3-globin gene cluster. Moi. Phyiogenet. Euoi. 1: 97—135. D. M. Reader, Eds.), 2nd ed., pp. 243—277. Smithsenian Inst. Press, Schneider, H., Schneider, M. E C., Sampaio, 1., Barroso, C. M. L., Washington, DC. Harada, M. L., Czelusniak, 4., and Goodman, M. (1997). Update on Schneider, Schneider, M. E C., Sampaie. 1., the phylogenetic systematics ofNew World monkeys: Further DNA Harada, M. L., H., evidence on the evidence for placing the pygmy rnarmoset (Cebueiia) within the Czelusniak, J., and Goodman, M. (1995). DNA Support for the genus Gaiiithrix. Int. J. Prirnatoi. 18:651—674. phylegenetic systematics of New World menkeys: sister-grouping of Cebus and Saimiri from two unlinked nuclear Bell, O. 1., Karam, J. H., and Rutter, W. J. (1981). Polymorphic DNA genes. Moi. Phyiegenet. Evei. 4: 331—349. region adjacent to the 5’ end of tbe human insulin gene. Proc. Mati. Acad. Sci. USA 78: 5759—5763. Hayasaka, K., Skinner, C. O., Goodman, M., and Slightom, J. L. (19931. The -y-globin genes and their flanking sequences in pri Bremer, K. (1988). The limits of amino acid sequence data in mates: Findings with nucleotide sequences of capuchin monkey angiosperm phylogenetic reconstruction. Evoietion 42: 795—803. and tarsier. Genemics 18: 20—28. Cabot, E. L., and Beckenbach, A. T. (1989). Simultaneous editing of D. O., Bleasby, A. J., and Fuchs, R. (1992). Clustal V: multiple nucleic acid and protein sequences with ESEE. Comput. Higgens, seftware for multiple sequence alignment. CABIOS 8: Appi. BioscL 5: 233—234. Improved 189—191. Chiarelli, A. B. (1980). The kaiyology of South American primates ef extant and fessil and their relationship to Arrican and Asian species. In “Evolution Kay, R. F. (1990). The phyletic relationships Suei. 175— ary Biology of the New World Monkeys and Continental Drift” (R. Pithechnae (Platyrrhini, Anthropoidea). 1. Hum. 19: Ciochon andA. B. Chiarelli, Eds.). pp. 387—398. Plenum, NewYork. 208. rate Chiarelli, A. B. (1982). Cariologia e origem dos macacos sulamerica lCmura, M. (1980). A simple methed for estimating evolutionary nos. Ia “Genetica Comparada de Primatas Brasileiros” (E H. ef base substitutien threugh comparative studies ef nucleetide Saldanha, Ed.), pp. 37—61. Sociedade Brasileira de Genetica, sequences. J. Moi. Evei. 16: 111—120. Ribeirao Prto, Brazil. Lima, M. XVI. C., and Senanez, H. N. (1991). Chremeseme studies in Chiu, C-H., Schneider, H., Schneider, M. E C., Sampaie, 1., Meireles, the red hewler monkey, Aio uatta senicuius stramineus (Platyr 30 MEIRELES ET AL.

rhini, Primates): Description of an X1X2Y1Y2iX1X1X2X2 sex Rosenberger, A. L., Setoguchi, T., and Shigehara, N. (1990). The fossii chromosome system and karyologicai comparisons with other record ofcalbtrichine primates. J. Hum. Euoi. 19:209—236. species. Cytogenet. Ceii Genet. 57: 151—156. Rowe, N. (1996). “The Pictorial Guide to the Living Primates,” MacFadden, B. J. (1990). Chronology of Cenzeic primate localities ia Pogoaios Press, East Hampton, NY SouthAmerica. J. Hum. Euoi. 19: 7—21. Saitou, N., and Nei, M. (1987). The neighbor-joining method: A new McKenna, M. C., and Beil, 5. K. (1998). “Classification ofMammals method for reconstructing phylogenetic trees. Moi. Bioi. Suei. 4: Above the Species Levei,” Columbia Univ. Press, New York. 406—425. Meireles, C. M., Schneider, M. E C., Sampaio, M. 1. C., Schneider, H., Sambrook, J., Fritsch, E. E’., and Maniatis, T. (1989). “Molecular Y Shghtom, J. L., Chiu, C.-H., Neiswanger, K., Gumucio, D. L., Cloning: A Laboratory Manual,” 2nd Ed., Cold Spring Harbor Czelusniak, J., and Goodman, M. (1995). Fate of a redundant Laboratory Press, Cold Spriug Harbor, NY. 1 y-globin gene ia the atehd clade of New Worid moakeys: Implica Sanger, E, Nicklen, 5., and Coulson, A. R. (1977). DNA sequencing tions coaceraing fetal globin gene expression. Proc. Nati. Acad. Sei. with chain-terminating inhibitors. Pmc. Nati. Acad. Sei. USA 74: USA 92: 2607—2611. 5463—5467. Meireies, C. M. (1997). “Evolucao Molecular dos Genes Globinas Schneider, II., Sampaio, 1., Rarada, M. L., Barroso, C. M. L., Gama 1 e Gama 2 em Atelineos (Primates, Platyrrhini),” Ph.D. Schneider, M. E C., Czelusniak, J., and Goodman, M. (1996). thesis, Universidade Federal do Para, Belem, Brazil. Molecular phylogeny of the New World monkeys (Platyrrhini, Mittermeir, R. A., Rylands, A. E., and Coimbra-Filho, A. F. (1988). Primates) based on two unlinked nuclear genes: IRBP intron 1 and Systematics: Species and subspecies—an update. In “Ecology and c-globin sequences. Am. J. Phys. Anthropoi. 100: 153—179. Behavior of Neotropical Primates” (R. A. Mittermeier, A. B. Ry Schneider, H., Schneider, M. P. C., Sampaio, 1., Harada, M. L., iands, A. E Coimbra-Filho, and G. A. B. da Fonseca, Eds.), Vol. 2, Stanhope, M., Czelusniak, J., and Goodman, M. (1993). Molecular pp. 13—75. World Wildlife Fund, Washington, DC. phylogeny ofthe New World monkeys (Platyrrhini, Primates). Moi. Pieczarka, J., Nagamachi, C. Y., and Barros, R. M. 5. (1989). The Phyiogenet. Euoi. 2: 225—242. karyotype of Ateies poniscus paniscus (Cebidae, Primates): 2n = Shen, S-H., Slightom, J. L., and Smithies, O. (1981). A history of the 32. Braziiian J. Genet. 12: 543—55 1. human fetal globin gene duplication. Ceii 26: 191—203. Porter, C. A., Sampaio, 1., Schneider, H., Schneider, M. P. C., Slightom, J. L., Blechl, A. E., and Smithies, O. (1980). Human fetal Czelusniak, J., and Goodman, M. (1995). Evidence on primate and Ayglobin genes: Complete nucleotide sequences suggest phylogeny from c-globin gene sequences and flanking regions. J. that DNA can be exchanged between these duplicated genes. Cel? Moi. Euoi. 40: 30—55. 21: 627—638. Portei C. A., Page, 5. L., Czelusniak, J., Scbneider, H., Schneider, Slightom, J. L., Koop, B. E, Xu, E, and Goodman, M. (1988). Rhesus M. E C., Sampaio, 1., and Goodman, M. (1997a). Phylogeny and fetal globin genes: Concerted gene evolution in the descent of evolution of selected primates as determined by sequences of the higher primates. J. Bioi. Citem. 263: 12427—12438. €-globin locus and 5’ flanking regons. Int. J. Prirnatoi. 18: 261— Stanyon, R., Tofanelli, 5.. Morescalchi, M. A., Agoramoorthy, G., 295. Ryder, O. A., and Weinberg, J. (1995). Cytogenetic analysis shows Porter, C. A., Czelusniak, J., Schneider, H., Schneider, M. E C., extensive genomic rearrangements between red howler (Aiouatto Sampaio, 1., and Goodman, M. (1997b). Sequences of the primate senicuius, Linnaeus) subspecies. Ata. J. Primatoi. 35:171—183. €-globin gene: Imphcations for systematics of the marmosets and Stirton, R. A. (1951). Ceboid monkeys from the Miocene of Columbia. other New World primates. Gene 205:59—71. Buii. Uniu. Caüf Pubi. Geoi. Sei. 28: 315—335. Rogan, P. K., Pan, J., and Weissman, 5. M. (1987). Li repeat elements Viegas-Pequinot, E., Koiffmann, C., and Dutrillaux, B. (1985). Chro in the human e-°y-globin gene intergenic region: Sequence analysis mosomal phylogeny of Lagothrix, Brachyteies and Cacajao. Cyto and concerted evolution within this family. Moi. Bioi. Evoi. 4: genet. Ceii Genet. 39: 99—1 04. 327—342. von Dornum, M. J. (1997). “DNASequence Data from Mitochondrial Rosenberger, A. L. (1981). Systematics: The higher taxa. Ia “Ecology COTI and Nuclear G6PD Loci and a Molecular Phylogeny of the and Behavior of Neotropical Primates” (A. F. Coimbra-Filho and R. New World Monkeys (Primates, Platyrrhini),” Ph.D. thesis, Har Mittermeier, Eds.), Vol. 1, pp. 9—27. Academia Brasileira de Cien vard Uaiversity, Cambridge, MÁ. cias, Rio de Janeiro. Zingeser, M. R. (1973). Dentition of Brachyteies arachnoides with Rosenberger, A. L. (1984). Fossil New World monkeys dispute tbe reference to alouattine and ateline affinities. Foha Primatoi. 20: molecular. J. Hum. Evoi. 13: 737—742. 35 1—390.