sign in sign up
<<
Home , Atelidae, Atelinae, Capuchin monkey, Cebidae, Gene redundancy, Haplorhini

Proc. Natl. Acad. Sci. USA Vol. 92, pp. 2607-2611, March 1995

Fate of a redundant y-globin in the atelid clade of New World monkeys: Implications concerning fetal globin gene expression CARLA M. M. MEIRELES*t, MARIA P. C. SCHNEIDER*t, MARIA I. C. SAMPAIO*t, HoRAcIo SCHNEIDER*t, JERRY L. SLIGHTOM4, CHI-HUA CHIUt§, KATHY NEISWANGERT, DEBORAH L. GuMucIoll, JOHN CZELUSNLAKt, AND MORRIS GOODMANt** *Departamento de Genetica, Universidade Federal do Para, Belem, Para, ; Departments of tAnatomy and Cell Biology and §Molecular Biology and Genetics, Wayne State University School of Medicine, Detroit, MI 48201; tMolecular Biology Unit 7242, The Upjohn Company, Kalamazoo, MI 49007; 1Westem Psychiatric Institute and Clinic, University of Pittsburgh Medical Center, Pittsburgh, PA 15213-2593; and IlDepartment of Anatomy and Cell Biology, University of Michigan Medical School, Ann Arbor, MI 48109-0616 Communicated by Roy J. Britten, California Institute of , Corona Del Mar, CA, December 19, 1994 (received for review August 19, 1994)

ABSTRACT Conclusive evidence was provided that y', purifying selection. One outcome was that a mutation that the upstream of the two linked y-globin loci (5'-y'- made the qr locus a was fixed -65 MYA in the 'y2-3'), is a pseudogene in a major group of New World eutherian lineage that evolved into the first true (4, monkeys. Sequence analysis of PCR-amplified genomic frag- 8). A later outcome, most likely favored by positive selection, ments of predicted sizes revealed that all extant genera of the was that embryonically expressed -y-globin became platyrrhine family [Lagothrix (woolly monkeys), fetally expressed in the lineage out of which platyr- Brachyteles (woolly spider monkeys), Ateles (spider monkeys), rhines and catarrhines descended (1-3,9, 10). During this same and Alouafta (howler monkeys)] share a large deletion that evolutionary period, a tandem duplication produced the linked removed most of exon 2, all of intron 2 and exon 3, and much yl and y2 genes (1-3). of the 3' flanking sequence of y. The fact that two functional The tandem duplication of the ancestral anthropoid y-glo- 'y-globin genes were not present in early ancestors of the bin gene resulted from an unequal crossover between two Atelidae (and that y1 was the dispensible gene) suggests that homologous Li repetitive elements, one (Lla) upstream of the for much or even all of their evolution, platyrrhines have had single -y gene and the other (Llb) downstream of this gene (1). ly2as the primary fetally expressed 'y-globin gene, in contrast The crossover produced the tandem duplicate 5'-Lla-,y'- to catarrhines (e.g., and ) that have 'y' as Llba-,y2-Llb-3'. The linked -y1 and ry2 loci and the Li ele- the primary fetally expressed y-globin gene. Results from ments that border them are present in all simian primate promoter sequences further suggest that all three platyrrhine f3-globin gene clusters that have been sequenced across the full families (Atelidae, , and ) have y2 rather extent of the two -y loci, including six catarrhines [ (11, than y' as their primary fetally expressed y-globin gene. The 12), (12), (12), (12), (1), implications of this suggestion were explored in terms of how and rhesus (1)] and two platyrrhines [ gene redundancy, regulatory mutations, and distance of each (1, 2) and (3)]. In contrast, non-simian- 'y-globin gene from the locus control region were possibly primate B3-globin gene clusters that have been sequenced involved in the acquisition and maintenance of fetal, rather across the full extent of the orthologous y region have only a than embryonic, expression. single -y locus, which is not bordered by the 5'-Lla and 3'-Llb elements (3, 13). These non-simian sequence data have been The simian primates of the two branches of Anthropoidea, obtained from (13) and (3), the former repre- Platyrrhini (New World monkeys) and (Old World senting the primate suborder Strepsirhini and the latter rep- monkeys, , and humans), have two linked nonallelic resenting, as do the , the other primate suborder ,y-globin genes (1-3) that are found in a genomic domain called (14). Thus, two events, the insertion of Lla and Llb the 3-globin gene cluster. The genes in this cluster are arranged elements and the subsequent duplication of the -y locus, both in the linkage 5'-s-y'-y_2_-'Iri-S--1-3' (4). These 13-globin occurred in the ancestral simian lineage after it separated from cluster genes, shared by all mammalian orders, descended the tarsier lineage but before it diverged into platyrrhines and from a single ancestral 3-globin gene that tandemly duplicated catarrhines (55-35 MYA). 150-200 million ago (MYA), producing a 5'-proto-s The first platyrrhine from which an intact y-globin gene was locus and a 3'-proto-P3 locus (4). By the time of the last cloned and sequenced was a spider monkey belonging to the common ancestor of Metatheria (marsupials) and Ateles geoffroyi (Age) (15). This intact gene with (placental ) at "125 MYA, the two loci had already conserved coding and promoter sequences was subsequently differentiated into an embryonically expressed s-type locus shown to be the downstream or -y2 locus. In contrast, the upstream yl locus contained a 1.8-kb deletion that removed and a postembryonically expressed {3-type locus (5, 6). This kb of the two gene cluster has persisted in marsupials, as demonstrated most of exon 2, all of intron 2 and exon 3, and >0.6 an and an Australian 3' flanking sequence of the -y' gene (1). Although this finding by American opossum (5) dasyurid locus is a marsupial (6). However, in the early eutherians at 100-80 suggested that in spider monkeys the 'yl-globin locus pseudogene, additional individuals fromAge or closely related MYA, tandem duplications of the embryonic --type not rule out and a tandem species had not been examined. Thus, the data did resulted in E, y, and q loci, similarly, duplication was the result of a of the 13-type locus resulted in 8 and j3 loci (4, 7, 8). This the possibilities that the deletion cloning redundancy of embryonic and postembryonic genes provided opportunities for individual genes to escape the constraints of Abbreviations: MYA, million (s) ago; Age, Ateles geoffroyi; Apa, Atelespaniscus; Lla, Lagothrix lagotricha; Bar, Brachyteles arachnoides; Abe, Alouatta belzebul; Aca, Alouatta caraya; Ase, Alouatta seniculus; The publication costs of this article were defrayed in part by page charge Cal, Cebus alibifrons; Mmu, Macaca mulatta; Hsa, sapiens; LCR, payment. This article must therefore be hereby marked "advertisement" in locus control region. accordance with 18 U.S.C. §1734 solely to indicate this fact. **To whom reprint requests should be addressed. 2607 Downloaded by guest on September 24, 2021 2608 Evolution: Meireles et al. Proc. Nati Acad. Sc. USA 92 (1995) artifact or a mutation in that individual monkey; if either of were included when they greatly increased sequence identity these possibilities were proven to be true, then this deletion among the aligned sequences. would have no evolutionary significance. However, if this yl pseudogene locus resulted from an ancient deletion in the 'y1 RESULTS gene in early ancestors of a major group of New World monkeys, then at least some catarrhine and platyrrhine species The 16 extant genera of the infraorder Platyrrhini (superfam- differ in their predominant fetal y gene expression patterns- ily Ceboidea) belong to seven clades that diverged from i.e., y' is the preferred fetally expressed ry gene in two common ancestors 23-17 MYA (22-26). Moreover, the DNA catarrhines, humans (16) and chimpanzees (17), while y2 sequence evidence from our laboratory (ref. 23 and unpub- predominates in those platyrrhine species that contain the y1 lished results) groups these seven clades into three families pseudogene. Here, we present conclusive evidence that the (Atelidae, Pitheciidae, and Cebidae) and, in agreement with deletion first noted in the yl locus of a single spider monkey paleontological evidence, places the divergence node for the (1) is indeed an ancient deletion and that the y1 locus is a common ancestor of the extant genera of the atelid clade at pseudogene in all genera of the platyrrhine family Atelidae 13 MYA (Fig. 1). [Lagothrix (), Brachyteles (woolly spider mon- key), Ateles (spider monkey), and Alouatta ()].

MATERIALS AND METHODS Other Mammals Primates Samples and DNA Extraction. The sources of the DNA sequences determined in this study were eight captive monkeys representing the four genera of the family Atelidae: threeAteles-twoAge [the original one (Agel) from the zoo in Madison, WI (15) and the second (Age2) from the zoo in Santa Strepsirhini Haplorhini Ana, CA] and one Ateles paniscus (Apa) from the Centro galago y duplication Nacional de Primatas (CNP), Para, Brazil; one Lagothrix 3555MYA ¶ N\ lagotricha (Lla) from CNP; one Brachyteles arachnoides (Bar) Anthropoidea Tarsier from the Centro de Primatologia, Rio de Janeiro, Brazil; and three Alouatta-one Alouatta belzebul (Abe) from CNP, one Alouatta caraya (Aca), and one Alouatta seniculus (Ase) (the latter two from the zoo in Los Angeles, CA). The Platyrrhini Catarrhini DNA sources for the sequences determined in this study were Old World M A clone AgeCh35-19-2 (15) for Agel and genomic DNAs ex- 1 16genera/7clades Apes tracted from peripheral blood cells as described by Bell et al. Ceboidea in 3 families Human (18) forAge2,Aca, andAse and by Sambrooketal. (19) forApa, Radiation 17-23MYA Lla, Bar, and Abe. Primers and the PCR Protocols. The primers, referred to as Rl and R2 (5'-GTTT- (5'-AATGTGGAAGATGCTGGG-3') diverged I GTTGCTCAGACATGAC-3'), were designed to amplify both share 1.8Kb yl del 'y'- and y 2-globin locus sequences over a region that in y' of Agel begins 209 bp upstream of the 5' start of the 1.8-kb Atelidae Pitheciidae Cebidae deletion originally found by Fitch et al. (1) and ends 222 bp Howler M Tit M Night M downstream of the 3' end of this deletion. The following PCR Spider M Saki M Capuchin M conditions were employed: 94°C for 3.5 min for the initial Woolly M Uakan Squirrel M denaturation, followed by 29 cycles (94°C, 30 sec; 55°C, 45 sec; Woolly Spider M 72°C, 45 sec) and a final cycle with a final extension at 72°C for 10 min. After agarose gel electrophoresis, the amplified frag- ments were isolated from the gel by using the Qiaex gel M-Monkey extraction kit (Qiagen, Chatsworth, CA). FIG. 1. Phylogenetic relationships of the three ceboid families to Cloning and Nucleotide Sequence Reactions. Purified DNA the major clades of nonceboid primates. Common names for some fragments from the y1 locus were cloned into pGEM-t (Pro- representative extant New World monkeys are listed for these ceboid mega) and transformed into Escherichia coli host JM109 families. The family Atelidae represents one of the seven anciently (Promega), as described by the vendor. Selected clones were separated ceboid clades; the extant atelids can all be grouped as infected with helper phage M13K07 (Promega) and the re- subfamily , which divides into tribes Alouattini (for howler sulting single-stranded DNAs were purified by PEG/NaCl monkeys) and Atelini (for spider, woolly, and woolly spider monkeys). by phenol/chloroform extraction and The family Pitheciidae contains two of the seven anciently separated precipitation followed clades, one for the monkeys and the other for saki, , ethanol precipitation. By using the dideoxynucleotide chain- and monkeys, all in the two clades grouped together in termination method (20) and T7 polymerase (Sequenase subfamily . The family Cebidae contains four ofthese seven version 1.0 kit; United States Biochemical), nucleotide se- anciently separated clades. The clade that contains marmoset also quences were determined for at least three clones derived from contains pygmy marmoset, , , and Goeldi's mon- each individual examined, with each clone representing a key. The DNA evidence for dividing the seven ceboid clades into three separate PCR amplification. families was obtained from e-globin gene sequences (23) and from Sequence Analysis. By using the ESEE200B sequence editor 1.8-kb intron 1 sequences of the interstitial retinol-binding protein (21), the sequences from the clones for each individual were (IRBP) gene (unpublished data). The most parsimonious trees found sequences from for these two sets of orthologous sequences were congruent in most assembled and aligned and these consensus respects. However, s sequences grouped the pitheciines with the the eight atelid monkeys were then aligned against one another atelines (23), whereas IRBP sequences grouped them with the cebids and also against the known (12) orthologous sequences from (unpublished data). Thus here we treat the pitheciines as equally capuchin monkey (Cebus albifrons, Cal), rhesus monkey (Ma- separated from atelines and cebids (or, at the family level, pitheciids caca mulatta, Mmu), and human (Homo sapiens, Hsa). Gaps from atelids and cebids). Downloaded by guest on September 24, 2021 Evolution: Meireles et al. Proc. Natl. Acad. Sci. USA 92 (1995) 2609

The identification of a 1.8-kb deletion in the cloned 'yl- the correct sequence. Because the eight atelid monkeys share globin locus of an individual spider monkey as observed by the identical 1.8-kb deletion within the ryl locus, this deletion Fitch et al. (1) left two important questions unanswered: (i) and the resultant y1 pseudogene must have already been fixed Was the deletion a cloning artifact or limited to one individual, at some time prior to their radiation from a common ancestor and (ii) if not, how long ago did the deletion occur? To answer 13 MYA. the first question, we examined three individual spider mon- On surveying genomic DNAs from members of the two keys (two from Age and one from Apa), and to answer the other major platyrrhine clades (cebids and pitheciids) with the second question, we examined other individuals from the three same PCR primers, we have obtained large-sized fragments in other atelid genera and from the two other platyrrhine fam- the range of 2.1-2.2 kb indicative of intact y-globin genes and, ilies. occasionally, smaller fragments approaching the range ofthose With Rl and R2 as 5' and 3' primers, respectively, we were for the yl pseudogene locus ofAlouatta and the atelins (Ateles, able to PCR-amplify two DNA fragments from either the Lagothrix, and Brachyteles). Sequence data gathered on these original A clone AgeCh35-19-2 (15) of the spider monkey smaller fragments from nonateline monkeys have shown that studied by Fitch et al. (1) or from genomic DNA of each of the they are PCR-generated products unrelated to y-globin genes. two other spider monkeys: there was a small fragment pre- That cebids lack this particular deletion is evident from the fact sumed to be from the upstream yl-globin gene region and a that a member of the family Cebidae (a capuchin monkey large fragment presumed to be from the downstream y 2-globin belonging to the species Cal) was found to have full-length yl- gene region (Fig. 2). Sequencing of the cloned fragments and y2-globin genes when clones spanning the full extent of its confirmed these presumptions. For the spider monkey, the size two 'y-globin loci were sequenced (3). Also, we have now of the upstream region (,yl) bordered by these primers is 431 confirmed with sequence data on the yl locus that another bp, consisting of 209 bp 5' and 222 bp 3' of the deletion, and cebid () and two pitheciids (titi and saki mon- the size of the expected downstream region (y2) is 2139 bp. keys) lack this 1.8-kb deletion (C.-h.C., M.I.C.S., M.P.C.S., Therefore, the deletion observed by Fitch et al. (1) is not due H.S., and M.G., unpublished results). These findings establish to a cloning artifact or a mutation in a single individual. that the 1.8-kb deletion could not have occurred or been fixed Approximately the same sized fragments were amplified in a common ancestor of all extant platyrrhines but occurred from genomic DNAs of a woolly monkey (Lla) and a woolly in the stem lineage of the atelids. spider monkey (Bar). Small and large fragments were also amplified from genomic DNAs of three howler monkeys (Abe, Aca, and Ase). However, as determined by sequence analyses DISCUSSION the sizes of the small fragment were 584, 585, and 586 bp for In nonanthropoid eutherian mammals, the y gene is expressed Abe, Aca, and Ase, respectively, and this was found to be due exclusively in embryonic life (10, 28, 29). However, in the to insertion of a monomeric Alu element [diagnosed as a anthropoid primates, -y appears to be silent in embryonic life member of the main class II of Alus (27)] between nt 52 and but becomes the major (3-like globin gene expressed during 53 downstream from the 3' end of the deletion. fetal life (16). The finding that the y gene of the galago (a Fig. 3 shows the nucleotide sequences bordered by primers strepsirhine primate that diverged from the anthro- Rl and R2 for the y1 pseudogene locus for these eight poid or simian primates 55-60 MYA) is embryonic (10) individual monkeys representing the four extant genera of the definitively establishes that the fetal recruitment of y occurred atelid clade. The Agel sequences for Rl and for the comple- after the divergence of strepsirhines from the lineage to simian ment of R2 are from the previously published spider monkey primates. sequence (ref. 1; GenBank accession no. X53420). The re- In earlier studies, we established (1, 2) the time and mech- mainder of theAgel sequence shown here was that determined anism for the y event. The molecular evi- from the 0.43-kb PCR product amplified in the present study dence makes it clear that this duplication occurred after the by using primers Rl and R2 and differs in nucleotides at five separation of haplorhine and strepsirhine primates and prior positions (G = 323, T = 329, G = 335, G = 338, and T = 350) to the separation of catarrhines and platyrrhines (55-35 from the nucleotides in the corresponding positions of the MYA). Because both platyrrhine and catarrhine primates sequence in GenBank (C = 359, C = 365, A = 371, C = 374, apparently express their 'y genes in fetal life (see below), we and A = 386). Since the nucleotides in the GenBank sequence inferred that fetal recruitment and duplication of the -/ gene at these five positions differed from those in the two other both occurred within the same evolutionary window. Also, we spider monkeys, Age2 and Apa, the 0.43-kb PCR-amplified suggested the possibility that the duplication event set the stage product obtained from A clone AgeCh35-19-2 was also se- for fetal recruitment since the duplicated y gene would be quenced. We consider our present PCR-derived sequence as redundant and, therefore, free to evolve a new function (expression in the fetal stage). Indeed, in the simian branch of 1kb the haplorhines, a marked upsurge of nonsynonymous and Capuchin Monkey promoter nucleotide substitutions occurred in the ancestral yl simian lineage after it diverged from the lineage to tarsier but and catarrhines. of exl ex2 ex3 L1ba exl ex2 ex3 before it diverged into platyrrhines Many I [17.. ['7- the resultant simian-specific nucleotides were then conserved in the extant simian y-globin gene sequences (refs. 1 and 2 and Rl Rl unpublished data). Some of these simian-specific nucleotides may have altered the regulatory properties of the y promoter. In fact, recent studies from our laboratory demonstrate that 1 the simian-specific nucleotides near the proximal CCAAT box in the promoter may have facilitated the fetal expression Spider Monkey pattern of simian 'y genes by reducing the binding of repressors that act in the fetal stage (30). Thus, the combined results from FIG. 2. Location of Ri and R2 primers in the linked -yl- and both phylogenetic and functional studies make it reasonable to ly 2-globin loci of capuchin and spider monkeys. The gap in the spider monkey ryl locus represents the 1.8-kb deletion. Llba is the hybrid Li suggest that the transition from embryonically to fetally ex- element in which the "b" portion is the 3' border of the -y1 locus and pressed 'y genes closely followed the duplication of the y genes. the "a" portion is the 5' border of the -y2 locus (1). The most 5' and Any changes that were beneficial, with regard to either the 3' portions of the y' and the y2 loci, respectively, are not shown. function of the coded amino acid sequence or the develop- Downloaded by guest on September 24, 2021 2610 Evolution: Meireles et al. Proc. NatL Acad2 Sci USA 92 (1995)

>R1 ------>> ImOv 1 114 (120) Agel AATQTGGAAC.ATCCTCCCOCC&CA.AACCCTCCCAAZCTAZCCTCTCGTaLCCAGGCCA.CCCCCACCA CTATQCTTC -----CAAAAG.TTCACCCTQCCTCTCJAQG&TTT Age2 . ...... A ...... -- C...... Lla...... A...... TC .------C...... - Bar...... A.c...... L...... C...... -- C......

Atbe...... A.. ...A...... C...... C...... - - ...... Aca...... A.. ...A...... C...... C...... -C...... Ass .A...... L...... C----CA0GCT...... C...... Cal...... A...... C...... ------...0....C...... mm ...... A.A...... A...A...... C..... C...... -C . ..-C T...T..... Baa...... A...... A...... C..a..C ...... -- C .... TC..T ...... >1205 2 >DRL 209 (240) Agel CTCCUCACCTTCTCA^CTTTCAAACTCCATTrCTTCAkATCTCACACCCTCCTACTT?-C?CACCCALTCCACCCAJ.CTTCTrZCACACOCTTTCGCAAL------Age2 ...... C.. .-...... ------

Apa ...... 0a------LI ...... c...C .. C ...... Q.. .T...... Ca------.. . .BarC ...... -...... c...... C. C------

Abe ...... T Ca------Aca .C...... -9.....T ...... Cr------Ass ...... e...... C....-.. . a------. Cal ...AT ....TC ...... a...... C.....-.C...... 0CCTCTCCTCTCCTTC?OCCA!CT /1 Mau ....0...... r.....C ...... -.. C...... CCTCTCCTCTCCCTC?CCCATCA?T1 Baa...... C.....T.C. .. .-...... G. .-.. .C...... CC?0?CCTCTGCCCTCT&CCCATCAT I 261 (2160) >ALU Agel------TTACTTTCATTAACTATACTCAACCCALTCCTTACTTTACTLWAAGJCTTfTC------

- - Age2 ------

Ape ------

- - - L a ------Bar ------C------Abe ---- TTCI? LA ----TTTCTT LAm ---- I¶IC?T Cal OCCCTC?T?CCCC?ACTTCAOCTCTTAOAC0COCAAACRAT...... CT. C..G0...TC...... A...... TCTTTT---- Am= CCOCTCTATC4CCJCACTTCACCTCTTACaCiATC-,-AOA.-OCACCAAAC-sk--aCAITTT CTTTCCA----- .0... CC.A...T ...... A.....TTTT---- Baa CCQCTCTACQCCCCACCTTCAQQTCTTACLATCOCACAA OCTTTTCTTCCA----Ca.0....C.A..B...... ATTTT---- (2260) Agel ------Aqe2 ------Ape ------L a ------Bar ------Abe WCCACTGCQCGTT C2mCTACCLCrCCCTGCTCAOOTGhTLAOOCUA rCC Aea ACCCCCT=TCAGGTGLACG T"ACACCC Ame TTTAATACCTTLCLrT=CkoCWCTACCTACC=QTCCCCTGCTCGCTAOACCC Cal ------fl u -- - Bmaa------356 (2400) Agel-A------C------AAflA cC-ATocccTCAkAGTOOCAOLCTOTCAOLGAT05TTCfOAA0SOALQ ATTCATT0TAAGCTT

Age2 ......

Apae...... Ll-a--...... C...... C...... Bar------C...... r ...... C. ...c...... Abe aC00CcTACTAACCAACTTTTC...... CA...... TC ...... C...... C...... Aea gQCCCCT?ACTAACCARACTTTTC...... C...... -..TT...... C...... C...... Ass CCCCCCTACTAACCAACTTTTC ...... TCO...... C...... Cal. ------C---.C...... C ...... C ...... T...... C.0...... CaC...... ma ------T...... 0.C..AA..0.C...... C...... T------...... C.C..c...... Bea------T.T...C.... C-C. LA.a.0...... C.A.A.. T.... C.A...... C.C...... Q-C.0......

cR2-OCIGLBJWiTSI?. < 431 (2501) Agel CTCCACAAAATCCCAACTT------CACCCTCACAACTCACoCATCACTCTCTCATCTCTCkCoCAACAAAC Aqea2 . Ape

LIa.TC......

Bar .

Abe...... T ... .. Lea... ..B.. ..

Ass ..e.. .. .T .. Cal .... .000 ... ALCCTcRACCAAAT ...... r flu .....C...... CCTC.C..A.. . TA .... C . C.... Baa .L.-.C.CC...... ACCTCAAOCAA.AT...... A...... C.C...... Q.0.G.A FIG. 3. Aligned y'-globin locus sequences demonstrating that all atelid genera'share thel1.8-kb deletion. The 5' and 3' borders of these aligned sequences are defined by Rl and the complement of R2. The identical Ri sequence is found in all eight atelid individuals; this was confirmed by using a different pair of primers (one located upstream and the other downstream from R1) and sequencing the PCR-amplified fragment. Dots in rows below a nucleotide position indicate that nucleotides for a particular y1 gene are identical with the nucleotide present on the top (Agel) line. Dashes designate.gaps that are required because of indels (insertions/deletio'ns) in one or more members of the sequence alignment. Number above the last nucleotide position of each row represents the number of nucleotides in the Agel sequence up to and including that position. The number in parentheses at the end of each row represents the number of aligned positions (with their gaps) up to and including the last position of the row. The sequences for alignment positions 241-2040 are not shown here because only previously published se'quences (12) (in this case those of Cal, Mmu, and Hsa) are present in this part of the alignment. mental timing of expression, could then be positively selected How do the findings of the present study affect our assess- and also easily spread via gene conversion to the other y gene. ment of this evolutionary scenario? Here, we have shown that, In this regard, the molecular evidence suggests that the more in a major clade of New World monkeys, the y1-globin locus ancient gene conversions in the 5' regulatory region of the 'y has suffered a 1.8-kb deletion. The deletion is shared by all genes have been polar, in the direction of y2to y (refs. 2 and extant members of the family Atelidae and, therefore, oc- 3 and unpublished data). curred prior to the radiation of these genera (13 MYA). Thus, Downloaded by guest on September 24, 2021 Evolution: Meireles et aL Proc. Nati Acad Sci USA 92 (1995) 2611

two functional -y-globin genes were not needed in the common 2. Hayasaka, K., Fitch, D. H. A., Slightom, J. L. & Goodman, M. ancestors of this clade. In this regard, it is of further interest (1992) J. Mol. Biol. 224, 875-881. that in the two other families of platyrrhines, the Pitheciidae 3. Hayasaka, K., Skinner, C. G., Goodman, M. & Slightom, J. L. and the Cebidae, the possibility exists that the -y' gene, (1993) Genomics 18, 20-28. although not deleted, has suffered potentially disabling mu- 4. Goodman, M., Koop, B. F., Czelusniak, J., Weiss, M. L. & tations in its regulatory sequences. In the capuchin monkey Slightom, J. L. (1984) J. Mo. Bio. 180, 803-823. 5. Koop, B. F. & Goodman, M. (1988) Proc. Natl. Acad. Sci. USA (family Cebidae), the proximal CCAAT element, a motif 85, 3893-3897. shown to be important for y expression (31), has the sequence 6. Cooper, S. J. B. & Hope, R. M. (1993) Proc. Natl. Acad. Sci. USA CCAAC (3). In addition, our preliminary data from the titi 90, 11777-11781. monkey's yl gene show the presence of point mutations in both 7. Hardison, R. C. (1984) Mo. Bio. Evol. 1, 390-410. proximal and distal CCAAT boxes. If the findings in both 8. Harris, S., Barrie, P. A., Weiss, M. L. & Jeffreys, A. J. (1984) J. capuchin and titi monkeys are confirmed in other members of Mol. Biol. 180, 785-801. their respective families, then these data, coupled with the 9. Goodman, M., Czelusniak, J., Koop, B. F., Tagle, D. A. & finding of the deleted yl gene in all members of the atelid Slightom, J. L. (1987) Cold Spring Harbor Symp. Quant. Biol. 52, family, indicate that y2 is probably the only expressed y locus 875-890. in all of the platyrrhines. 10. Tagle, D. A., Koop, B. F., Goodman, M., Slightom, J. L., Hess, If 2 iS indeed the major (or only) functional D. L. & Jones, R. T. (1988) J. Moi. Biol. 203, 439-455. y locus in 11. Shen, S., Slightom, J. L. & Smithies, 0. (1981) Cell 26, 191-203. platyrrhines, this would indicate that the y2 locus attained a 12. Bailey, W. J., Hayasaka, K., Skinner, C. G., Kehoe, S., Sieu, L. C., fetal expression pattern prior to the radiation of the super- Slightom, J. L. & Goodman, M. (1992) Mol. Phylogenet. Evol. 1, family Ceboidea (i.e., before 23 MYA). It would also explain 97-135. why the polarity of the ancient gene conversions in the 5' 13. Tagle, D. A., Stanhope, M. J., Siemieniak, D. R., Benson, P., regulatory region of the ancestral platyrrhine y genes had the Goodman, M. & Slightom, J. L. (1992) Genomics 13, 741-760. polarity of y2 to yl (refs. 2 and 3 and unpublished data). 14. Koop, B. F., Tagle, D. A., Goodman, M. & Slightom, J. L. (1989) These data also pose other evolutionary questions. What Mol. Biol. Evol. 6, 580-612. facilitated the preservation of the y2 gene rather than the y' 15. Giebel, L. B., Van Santen, V. L., Slightom, J. L. & Spritz, R. A. gene in the platyrrhines? Why, in platyrrhines, is the yl gene (1985) Proc. Natl. Acad. Sci. USA 82, 6985-6989. dispensible, while in catarrhines [at least in humans (16) and 16. Bunn, H. F. & Forget, B. G. (1986) in Hemoglobin: Molecular, Genetic and Clinical Aspects (Saunders, Philadelphia), p. 68. chimpanzees (17)], this -y gene is retained and expressed at 17. Huisman, T. H. J., Schroeder, W. A., Keeling, M. E., Gengozian, much higher levels than the -y2 gene in fetal life? At least three N., Miller, A., Brodie, A. R., Shelton, J. R. & Apell, G. (1973) considerations may be important in this regard. (i) It is possible Biochem. Genet. 10, 309-318. that an optimal distance from the locus control region (LCR) 18. Bell, G. I., Karam, J. H. & Rutter, W. J. (1981) Proc. Natl. Acad. is necessary to attain (or maintain) a fetal rather than an Sci. USA 78, 5759-5763. embryonic expression pattern. The distance between the -y 19. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular genes and the LCR has been altered several times during the Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press, evolution of the primate 3-globin gene cluster (by duplications Plainview, NY), 2nd Ed. and/or insertions of repetitive elements) and the final dispo- 20. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. sition of the ry genes with respect to the LCR is clearly different Sci. USA 74, 5463-5468. in the platyrrhines and 21. Cabot, E. L. & Beckenbach, A. T. (1989) Comput. Appl. Biosci. catarrhines (refs. 3, 8, 32-34, and 5, 233-234. unpublished data). Distance from the LCR has been shown to 22. Fleagle, J. G. (1988) PrimateAdaptation and Evolution (Academ- affect both the timing and the level of expression of the ic, New York). downstream genes (35, 36). (ii) Since competition between the 23. Schneider, H., Schneider, M. P. C., Sampaio, I., Harada, M. L., -y promoter and the , promoter for interaction with the LCR Stanhope, M., Czelusniak, J. & Goodman, M. (1993) Mo. has been proposed to be an important factor in hemoglobin Phylogenet. Evol. 2, 225-242. switching (for review, see ref. 36), it is possible that yl and y2 24. Rosenberger, A. L., Setoguchi, T. & Shigehara, N. (1990)J. Hum. genes do not function equivalently in this regard or that the Evol. 19, 209-236. nature of the competition is different in platyrrhines and 25. Ford, S. M. (1986) in Comparative Primate Biology, eds. Swindler, catarrhines. (iii) These two y genes may differ in their ability D. R. & Erwin, J. (Liss, New York), Vol. 1, pp. 73-135. to respond to hematopoietic stress in the adult bone marrow. 26. Kay, R. F. (1990) J. Hum. Evol. 19, 175-208. While it is not 27. Jurka, J. & Milosavljevic, A. (1991) J. Mol. Evol. 32, 105-121. possible to assess the importance of these 28. Hardison, R. C. (1981) J. Biol. Chem. 256, 11780-11786. considerations on the basis of the available data, a further 29. Hill, A., Hardies, S. C., Phillips, S. J., Davis, M. G., Hutchinson, analysis of the molecular evolution of primate y-globin genes C. A., III, & Edgell, M. H. (1984) J. Bio. Chem. 259, 3739-3747. is likely to yield additional clues as to the means by which these 30. Gumucio, D. L., Shelton, D. A., Blanchard-McQuate, K., Gray, genes have evolved another function. T., Tarle, S., Heilstedt-Williamson, H., Slightom, J. L., Collins, F. & Goodman, M. (1994) J. Biol. Chem. 269, 15371-15380. We thank Drs. Roy Britten and Jerzy Jurka for classifying the 31. Myers, R. M., Tilly, K. & Maniatis, T. (1986) Science 232, monomeric Alu sequence inserted in the howler monkey sequences. 613-618. This research was supported by grants from Conselho Nacional de 32. Barrie, P. A., Jeffreys, A. J. & Scott, A. F. (1981)J. Mol. Biol. 149, Desenvolvimento Cientifico e Technologico (Brazil) (201530/93-7), 319-336. Financiadory de Estudos e Projetos (Brazil) (66.94.0034.00), National 33. Collins, F. S. & Weissman, S. (1984) Prog. NucleicAcid Res. Mol. Institutes of Health (HL33940), and National Science Foundation Biol. 31, 315-462. (DEB9116098). 34. Rogan, P. K., , J. & Weissman, S. M. (1987) Mol. Biol. Evol. 4, 327-342. 1. Fitch, D. H. A., Bailey, W. J., Tagle, D. A., Goodman, M., Sieu, 35. Hanscombe, O., Whyatt, D., Fraser, P., Yannoutsos, N., Greaves, L. & Slightom, J. L. (1991) Proc. Natl. Acad. Sci. USA 88, D., Dillon, N. & Grosveld, F. (1991) Genes Dev. 5, 1387-1394. 7396-7400. 36. Engel, J. D. (1993) Trends Genet. 9, 304-309. Downloaded by guest on September 24, 2021