2014, August 13-17

Journal of Inborn Errors of Metabolism &Screening 1–103 Abstracts of Free Communications ª The Author(s) 2014 Reprints and permission: sagepub.com/journalsPermissions.nav Accepted for Presentation at the DOI: 10.1177/2326409814538909 13th International Symposium on iem.sagepub.com Mucopolysaccharidoses and Related Diseases, Sauipe, Bahia, Brazil, August 13-17, 2014

1. Animal Models parameters such as the sperm production and the integrity of testicular interstitial compartment, possibly as a conse- quence of the glycosaminoglycan storage progression. 1017 - Reproductive Characteristics of Male On the other hand, sperm once produced do not appear Mucopolysaccharidosis Type I Murine Model abnormal. Financial Support: AFIP, CoordenaçaõdeAper- Assed in 2 Different Ages feiçoamento de Pessoal de Nı´vel Superior (CAPES), Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico(CNPq), Cinthia Nascimento1, Odair Aguiar1, and Vaˆnia and Fundaçaõ de Amparo a Pesquisa do Estado de SaõPaulo (FAPESP). D’Almeida1 1Universidade Federal de Saõ Paulo, Saõ Paulo, Brazil 1045 - Evidence of Caspase-Independent Cell Introduction: Mucopolysaccharidosis type I (MPS) is charac- Death in Murine Mucopolysaccharidosis Type terized by the deficiency of a-L-iduronidase (IDUA) and continuous deposition of heparan sulfate and dermatan sulfate in many I Macrophages tissues and organs. Due to the susceptibility of reproductive sys- 1 1 tem to environmental and genetic factors, we considered rele- Karina Cunha e Rocha , Gustavo Monteiro Viana , Edgar 1 1 vant the biological characterization of this system in the Julian Paredes-Gamero , Ana Maria Martins , and Vaˆnia murine model of MPS-I. Objective: To characterize some of the D’Almeida1 male reproductive parameters of MPS-I mice in 2 phases of life. 1Universidade Federal de Saõ Paulo, Saõ Paulo, Brazil Methods: C57BL/6J male mice were distributed in 4 groups according to age (3- or 6-month-old) or genotype (IDUAþ/þ Introduction: Mucopolysaccharidosis type I (MPS-I) is an or IDUA/). Biometry, sperm production, sperm morphology, autosomal recessive disease caused by the deficiency of plasma testosterone, testicular histology, and histomorphometry a,-L-iduronidase (IDUA), responsible for degradation of were performed. Results: Relative weights of seminal vesicle glycosaminoglycans (GAGs). Besides intralysosomal GAG were lower in 3- and 6-month-old IDUA/ mice than that in accumulation, secondary cellular pathways might be involved the same age controls (P ¼ .016 and P ¼ .001, respectively), in the disease pathophysiology, like lysosomal membrane per- regardless of normal plasma testosterone concentration. Sperm meabilization, autophagy, and cell death. Objectives and morphology was not altered among normal and knockout mice; Methods: To evaluate parameters of cellular homeostasis however, sperm production was lower in 6-month-old IDUA/ such as lysosomal pH (by acridine orange assay), release of mice as previously demonstrated by our group (P ¼ .007), lysosomal cathepsin D (using confocal microscopy), caspase which indicates that the absence of IDUA alters sperm produc- activity (by fluorescent substrate cleavage assay), and relative tion in a quantitative but not necessarily in a qualitative way. expression of apoptotic proteins (Western blotting analysis) in Signs of testicular degeneration were present but not predomi- 3-month-old murine MPS-I macrophages. Results: We found nant in knockout mice; however, interstitial compartment was a significant decrease in lysosomal pH and an increase in more intense stained with toluidine blue, in 6-month-old cathepsin D release to cytoplasm (lysosomal membrane per- IDUA/ mice (P < .0001), suggesting storage of extracellu- meabilization), but no alteration in apoptotic markers in the lar matrix components. Besides that, the percentage of inter- IDUA / group compared to the control group. However, stitial was higher in IDUA/ mice than in the controls of when stimulated with Staurosporine (an apoptotic inducer), both age-groups (P ¼ .0002 and P ¼ .048, respectively). cells from the IDUA / group showed a higher apoptotic Conclusion: Our results demonstrate that the disruption of rate. Conclusion: Together, these results indicate a possible IDUA in male mice interferes in some of their reproductive mechanism of caspase-independent cell death present in 2 Journal of Inborn Errors of Metabolism & Screening macrophages from MPS-I mice and provide new insights for 1072 - Iduronate-2-Sulfatase Deficiency Leads understanding cellular pathology in this disease. to Early Dysregulation of Bone Development in a Zebrafish Model of Mucopolysaccharido- sis Type II 1070 - Mouse Model of Mucopolysaccharidosis Type IIIC: Distribution and Characterization Stefania Bellesso1, Marika Salvalaio1, Roberto of the Storage Process in Brain and Costa2,IlariaZancan2, Rosella Tomanin1, and Enrico Peripheral Tissues. A Histopathological Moro2 and Electron Microscopical Study 1Department of Women’s and Children’s Health, University of 1 2 2 Padova, Padova, Italy Helena Hu˚lkova´ , Carla Martins , Larbi Dridi , Martin 2 1 2 Department of Molecular Medicine, University of Padova, Padova, Hrˇebıćˇek , and Alexey Pshezhetsky Italy 1Institute of Inherited Metabolic Disorders, 1st Faculty of Medicine, Lysosomes are usually considered as end organelles with Charles University in Prague, Prague, Czech Republic the main role of degrading damaged molecules and waste 2CHU Ste-Justine, University of Montreal, Montreal, Canada substrates. However, it has become clear that they also Objectives: To characterize lysosomal storage pattern in brain functionally interact with other organelles, thus taking part and peripheral organs of mice deficient for heparan sulfate in complex cellular regulatory systems. Mutations causing acetyl-CoA:a-glucosaminide N-acetyltransferase (Hgsnat). dysfunction of lysosomal enzymes involved in catabolism This analysis is a part of the complex characterization of the of glycosaminoglycans (GAGs) are responsible for differ- mouse model for mucopolysaccharidosis type IIIC (Pshez- ent types of mucopolysaccharidosis (MPS). These meta- hetsky et al). Methods: Brain, liver, spleen, heart, lungs, kid- bolic disorders are generally considered caused by ney, and skin of mice homozygous for Hgsnat-Geo allele lysosomal accumulation of partially or totally undegraded (Hgsnat-Geo mice) and of their control counterparts were GAGs, leading to organelle impairment and cytotoxicity. examined by histology, histochemistry, immunohistochemis- However, the idea that other early cellular and develop- try, and electron microscopy. Results: The main organs mental defects may contribute to patients’clinical pheno- affected at the optical and the ultrastructural levels were brain types is clearly emerging. Among the different MPS, and liver. Lysosomal storage of material with characteristics of mucopolysaccharidosis type II (MPS-II or Hunter syn- glycosaminoglycans (GAGs) was early detectable in hepato- drome; Online Mendelian Inheritance in Man þ309900), cytes and in splenic sinus endothelium, and later and to a lesser caused by the deficit activity of the lysosomal enzyme extent in liver Kupffer cells, in bronchial respiratory epithe- iduronate 2-sulfatase (IDS), is a complex rare disorder, lium, renal glomeruli, renal tubular epithelium, fibroblasts, in which skeletal abnormalities represent one of the major vascular endothelial cells, and pericytes. Microglia containing disabling aspects. Enzyme replacement therapy is the cur- storage material of GAG type was early detectable in brains of rently available therapeutic option with, however, a limited Hgsnat-Geo mice, preceding structural changes in neurons. efficacy. To better elucidate early alterations in bone Morphological findings in neurons were dominated by progres- development occurring in MPS-II, we took advantage of sing lysosomal storage of autofluorescent ceroid-like material the zebrafish animal model, given its easy genetic manip- and by ultrastructural mitochondrial abnormalities. At the most ulation and evolutionary conservation of mechanisms and advanced stages of the disease, storage compartment con- signaling pathways regulating bone formation. In particu- tained closely packed fibrillary structures often resembling lar, we generated a zebrafish model for MPS-II, using a storage material of a rectilinear and/or fingerprint type in morpholino-based knockdown technology. The morphant neuronal ceroid lipofuscinoses. Pathological changes in neu- fish displays some typical clinical manifestations of rons were accompanied by increase in glial fibrilar acidic patients with Hunter syndrome, such as hepatomegaly, protein staining, pointing to neuronal loss. Conclusion: liver GAGs accumulation, and defects in chondrogenesis Hgsnat-Geo mice developed a widespread lysosomal storage and osteogenesis. Using different approaches, including consistent with accumulation of undegraded GAG in the in situ hybridization and transgenesis, we demonstrate that epithelial and mesenchymal cells, similar to other mouse IDS knock down affects the expression of key fibroblast models of Sanfilippo, but with later onset and lesser intensity. growth factor (FGF) signaling markers at early stages, The GAG storage in brain microglia preceded neuronal changes before a clear lysosomal impairment is detectable. More- that were characterized by lysosomal and mitochondrial altera- over, our results show an altered expression of bone- tion followed by neuronal death. Grant support: The grant related markers and bone ossification. Therefore, we NT13122-3/2012 from the Ministry of Health of the Czech hypothesize that IDS deficiency may affect FGF signaling, Republic and the operating grant (111068) from Canadian thus leading to impaired expression of genes involved in Institutes of Health Research and from JJB Foundation. bone development. Abstracts 3

1078 - Morphological Analysis of Cartilage 2Charles University, Prague, Czech Republic 3University of Manchester, Manchester, United Kingdom and Bone Tissue in Mucopolysaccharidosis 4 Type I Animal Model University of California, Los Angeles, CA, USA 5Universite´ de Picardie-Jules Verne, Amiens, France 1 1 NicoleYolanda Ferreira , Vanessa Gonçalves Pereira , Introduction: Severe progressive neurological pediatric dis- Fla´via de Oliveira1, and Vaˆnia D’Almeida1 ease mucopolysaccharidosis IIIC (MPS-IIIC) is caused by the deficiency of acetyl-CoA:glucosaminide N-acetyltransferase 1Universidade Federal de Saõ Paulo, Saõ Paulo, Brazil (HGSNAT), involved in lysosomal catabolism of heparan sul- Objectives: To evaluate the morphological characteristics of fate (HS). To understand the pathophysiology of MPS-IIIC, we cartilage and bone tissue in a mucopolysaccharidosis type I generated and studied a mouse model of the disease. Methods: murine model. Methods: Animals were maintained on a 12- A functional knockout of the Hgsnat locus in C57Bl/6 mice hour light–dark cycle, with food and water available ad libitum. was generated using gene trap technology. A selectable marker This study was approved by the Ethical Research Committee b-geo, a functional fusion between the b-galactosidase and from Universidade Federal de Saõ Paulo, Brazil. The morpho- neomycin resistance genes, was inserted into the intron 7 of the logical characteristics of cartilage and bone tissue were HGSNAT gene leading to splicing of exon 7 into the b-geo cas- accessed by histological analysis, performed on the proximal sette to generate a nonfunctional HGSNAT fusion transcript. epiphysis of femurs collected from 3-month-old male and To detect signs of neurodegeneration, we performed neurologi- female wild (a-L-iduronidase [IDUA] þ/þ;n¼ 3) and knock- cal assessment and studied behavior of mice by the open field out animals (IDUA /;n¼ 4) after euthanasia. The samples test and Morris water maze test. Pathological examination of were analyzed using hematoxylin and eosin and picrosirius the organs and tissues was performed at the ages of 2, 4, 6, staining, in order to evaluate general aspects of cartilage and 10, and 11 to 12 months by histochemistry, immunohistochem- bone tissue architecture as well as the collagen type I and III istry, and electron microscopy and stored metabolites measured deposition. Images were obtained with an Axiocam camera by mass spectroscopy. Expression of inflammation markers in attached to microscope (Axio Observer.D1 Zeiss, Germany). the brain tissues was accessed by reverse transcriptase qualita- Results: a-L-Iduronidase / animals presented an irregular tive polymerase chain reaction. Results: At 6 to 8 months, mice transition zone between articular cartilage and subchondral showed hyperactivity and reduced anxiety. Cognitive memory bone and lower quantity of trabecular bone tissue when decline was detected at 10 months, and at 12 to 13 months, compared to IDUA þ/þ animals. Also, IDUA / animals mice showed signs of unbalanced hesitant walk and urinary presented an important disorganization of cartilage layers, retention. Lysosomal accumulation of HS was observed in increased cellularity, and predominance of collagen type I hepatocytes, splenic sinus endothelium, cerebral microglia, deposition on subchondral bone and articular cartilage. liver Kupffer cells, fibroblasts, and pericytes. Starting from 5 Conclusion: Articular cartilage from IDUA / animals pre- months, brain neurons showed enlarged, structurally disorga- sented alteration in cellular layers and cellularity, besides nized, and dysfunctional mitochondria, impaired mitochondrial irregularity in transition to subchondral bone and abnormal tra- energy metabolism, and storage of densely packed autofluores- becular bone reabsorption. In addition, articular cartilage from cent material, gangliosides, lysozyme, phosphorylated t, and IDUA / animals is mostly constituted by collagen type I, amyloid b. Conclusion: Altogether, our data for the first time which presents low flexibility and high resistance. Such altera- demonstrate that HGSNAT deficiency results in lysosomal tions indicate that properties of compressibility and elasticity accumulation of HS in microglial cells followed by their acti- necessary to dissipate and cushion impact forces might be vation and cytokine release, mitochondrial dysfunction in the affected on IDUA / animal model. Support: CAPES, neurons, and their death explaining why MPS-IIIC manifests CNPq, FAPESP, and AFIP. primarily as a neurodegenerative disease.

1119 - Neuroinflammation, Mitochondrial 1121 - Nociceptive Evaluation of Defects, and Neurodegeneration in Mucopolysaccharidosis Type I Animal Model Mucopolysaccharidosis IIIC Mouse 1 1 1 1 Matheus Trovaõ de Queiroz , Nicole Yolanda Ferreira , Alexey V. Pshezhetsky , Carla Martins , Helena and Vaˆnia D’Almeida1 Hu˚lkova´2, Larbi Dridi1, Lubov Grigoryeya1, Alexander 1Universidade Federal de Saõ Paulo, Brazil Langford-Smith3, Fiona L. Wilkinson3, Kazuhiro Ohmi4, Jeroˆme Ausseil5, Eva Svobodova´2, Zuzana Ha´jkova´2, Objectives: To evaluate the nociceptive response of mucopo- Marketa´ Tesarˇova´2, Hana Hansı´kova´2, Brian W. Bigger3, lysaccharidosis type I murine model. Methods: Animals were 1 2 maintained on a 12-hour light–dark cycle, with food and water Yoo Choi , and Martin Hrebıćek available ad libitum. This study was approved by the Ethical 1CHU Ste-Justine, University of Montreal, Montreal,´ Canada Research Committee from Universidade Federal de Saõ Paulo, 4 Journal of Inborn Errors of Metabolism & Screening

Brazil. The hot plate test evaluated the nociceptive response to was assessed by 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyl tet- temperature of 6-month-old male and female wild (a-L-iduroni- razolium assay. Furthermore, CD68 immunohistochemistry dase [IDUA] þ/þ;n¼ 3) and knockout animals (IDUA /; and macrophage inflammatory protein-1a quantitative poly- n ¼ 5). Animals were placed individually on the hot plate appa- merase chain reaction were performed in liver and lung of ratus (Ugo Basile, Biological Research Apparatus Company, MPS-I and WT mice to analyze the presence of macrophage. Italy), which was heated up to 53C. Once all paws of the ani- Results: Western blot results showed no difference between mal were in contact with the apparatus surface, a timer was the antigens recognized in liver protein extracts of MPS-I or started and latency of the first response to the heat, such as WT animals. However, there is a difference in the banding pat- shaking or licking any paws, was measured in seconds. The tern recognized by IgG from MPS-I when compared to WT animals were quickly removed from the apparatus after pre- mice, indicating a variation in the IgG repertoire in these ani- senting any of the signals described. A 60-second cutoff mals. T-cell proliferation after stimulation was normal in both latency was settled for nonresponsive animals. Comparisons the groups. On the other hand, CD-68 immunostaining was among groups were performed with Mann-Whitney U test. higher in liver and lungs of MPS-I mice than that of WT mice Values of P < .05 were considered statistically significant. as well as MIP-1a expression, indicating an increase in macro- Results: a-L-Iduronidase / animals presented a mean of phages in affected animals. Conclusion: These results suggest 15.3 seconds (standard deviation [SD] ¼ 4.1) to show any that the MPS-I mice have a different IgG repertoire and response to temperature, whereas IDUA þ/þ animals pre- increased presence of macrophages in liver and lung when sented a mean of 15.9 seconds (SD ¼ 4.0) before responding. compared with WT mice. The impact of these findings in disease No significant difference in nociceptive response was found manifestation deserves further analyses. Financial support: when both the groups were compared (P ¼ .786). FIPE/HCPA, CAPES, CNPq. Conclusion: Our results suggest that 6-month-old IDUA / animals do not present a difference in nociceptive response 1214 - Possible Mechanisms Involved in the when compared to IDUA þ/þ animals. Since this is a preliminary work, it is necessary to perform the test with a higher Neuropathology of Mucopolysaccharidosis number of animals in order to reach a conclusion. There are Type I no other studies concerning nociception of mucopolysacchar- 1 1 idosis type I murine model, which makes further analysis even Guilherme Baldo , Barbara Z. Martinelli , Fabiana 1 2 2 more important for a better understanding of clinical manifes- Q. Mayer , Marcia R. Wink , Marilda Fernandes , tations of the disease. Roberto Giugliani3, and Ursula Matte3 1Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil 1213 - Analysis of Immunoglobulin G 2Universidade Federal de Cienciasˆ da Sau´de de Porto Alegre, Porto Repertoire and Macrophage Presence in Alegre, Brazil 3 Mucopolysaccharidosis Type I Mice Hospital de Clinicas de Porto Alegre, Porto Alegre, Brazil

1 1 Objectives: Trying to gain insight into the neuropathophy- Talita G. de Carvalho , Valeska L. Lagranha , Fabiana Q. siology of mucopolysaccharidosis type I (MPS-I), the aim 1 2 1 Mayer , Karina M. Monteiro , Guilherme Baldo , of this study was to evaluate the expression of genes coding Roberto Giugliani1, and Ursula Matte1 proteins that could be impaired by heparan sulfate (HS) accumulation due to a-L-iduronidase (IDUA) deficiency and 1Hospital de Clinicas de Porto Alegre, Porto Alegre, Brazil the astrocyte response under this condition. Methods: Six- 2Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil month-old IDUA knockout mice (MPS-I group, n ¼ 4) and Introduction: The clinical signs of mucopolysaccharidosis normal mice (normal group, n ¼ 5) were killed, and the type I (MPS-I) are heterogeneous, and the mechanism of patho- brain cortex and hippocampus were collected for further genesis is largely unknown, but there is increasing evidence of analyses. Gene expression of neural cell adhesion molecule the participation of immune system abnormalities on this pro- (NCAM), growth-associated protein 43 (GAP-43), fibroblast cess. Objective: To investigate immune-related aspects, such growth factor 2 (FGF-2), and fibroblast growth factor recep- as self-immunoglobulin G (IgG) repertoire, T-cell activation, tor 1 (FGFR-1) was performed by quantitative polymerase and inflammation, in mice with MPS-I. Methods: Protein chain reactions. Glial fibrilar acidic protein (GFAP) was extracts from liver of MPS-I or wild-type (WT) mice were sub- detected by immunohistochemistry and tissues were evalu- jected to polyacrylamide gel electrophoresis under reducing ated by counting positive cells (GFAPþ) in 5 random fields. conditions. After being blotted onto polyvinyl difluoride mem- Statistical analyses were performed using Student t test, and brane, the antigens were incubated with purified IgG extracted differences among groups were considered when P <.05. from MPS-I or WT mice serum. Antibody specificity pattern Results: Messenger RNA levels of NCAM were reduced was compared with regard to MPS-I and WT protein extracts in both cortex (0.6475-fold normal, P ¼ .0271) and hippo- and IgG repertoire. T-cell activation was investigated by stimu- campus (0.6-fold normal, P ¼ .0053) of MPS-I group. There lation with concanavalin A for 48 hours, and cell proliferation wasanincreaseinGAP-43mRNAlevelsinhippocampus Abstracts 5

(1.37-fold normal, P ¼ .002),andnodifferencewas followed by skeletal deformities(70%). Other features are illu- observed in the cortex (P ¼ .068). Fibroblast growth factor strated in the table. Mean age for diagnosis is 2.2 years. receptor 1 was increased in both cortex (1.19-fold normal, Antenatal diagnosis was made for 1 family. None of our P ¼ .042) and hippocampus (1.37-fold normal, P ¼ .0002), patients received enzymatic therapy. Conclusion: The high and no difference in FGF-2 expression was detected. The consanguinity rates in our country lead to higher incidence of number of GFAPþ cells was higher in the cortex (7.7-fold IEM. We need to be backed up by a large multicenter study for normal, P ¼ .003) and hippocampus (1.4-fold normal, P ¼ actual incidence of the metabolic disorders in the Gaza strip. .01) of MPS-I mice, with darker staining and more profuse Follow-up of patients with MPS needs a multidisciplinary team ramifications. Conclusion: Considering the altered NCAM, so a suggested protocol was written. FGFR-1, GAP-43, and GFAP pattern of expression observed and the large number of signaling cascades and processes that are known to be activated downstream (eg, neurite outgrowth, 1013 - Mucopolysaccharidosis I Registry synaptic plasticity, learning and memory), our study suggests Status Update possible pathways that are impaired and contribute to the 1 1 neuropathology of MPS-I, although more precise molecular Shari Fallet , Cinde Clatterbuck , and Iva Ivanovska mechanisms need to be verified. Holder1 1Genzyme, a Sanofi company, Cambridge, MA, USA 2. Epidemiology/Registries Objective: To provide an update on the status of the mucopolysaccharidosis type I (MPS-I) Registry. Method: The MPS-I Registry (clinicaltrials.gov NCT00144794) is an international, 1012 - Epidemiology of observational, voluntary database intended to track the natural Mucopolysaccharidosis in Gaza Strip, history, treatment patterns, and clinical status of the patients Palestine with MPS-I. Data on the demographics and treatment status of 1066 patients enrolled in the Registry were analyzed for this 1 1 Shireen Noman Abed , Aisha Ayyad , report. Result: As of January 3, 2014, 1066 patients from 33 and Nabil Baraqoni1 countries enrolled in the MPS-I Registry; the median age at enrollment is 5.2 years for patients with Hurler syndrome, 1Oran, Algeria 9.6 years for patients with Hurler-Scheie syndrome, and 19.3 Introduction: Mucopolysaccharidosis(MPS) is a hereditary years for patients with Scheie syndrome. The phenotype dis- progressive disease caused by mutations of genes coding for tribution of the Registry population is 59% Hurler, 22% lysosomal enzymes needed to degrade glycosaminoglycans Hurler-Scheie, and 12% Scheie (7% undetermined). There is (acid mucopolysaccharides). Mucopolysaccharidosis is an considerable delay in diagnosis, especially among patients with androgen receptor disorder except Hunter syndrome which is attenuated MPS-I (Hurler-Scheie and Scheie syndromes). Med- an X-linked disorder. In the United States, their overall fre- ian age at symptom onset for Registry patients with Hurler, quency is between 3.5/100 000 and 4.5/100 000. In Gaza strip, Hurler-Scheie, and Scheie syndromes is 0.5, 1.8, and 5.3 no studies have been made to determine the overall incidence years, respectively; median age at diagnosis is 1.0, 4.1, and of MPS. Methods: A retrospective and prospective study 9.4 years, respectively. The Registry also captures treat- shows the epidemiology of MPS. Eighteen cases were diag- ment status; 52% of patients receive enzyme replacement nosed as having MPS (6.25% of cases with inborn errors of therapy (ERT) with laronidase (Aldurazyme, Genzyme, a metabolism [IEM]) . Ten cases with MPS (age range 15 Sanofi company, Cambridge, Massachusetts and BioMarin months-10 years) were interviewed with their parents, reevalu- Pharmaceutical Inc, San Rafael, California), 19% receive ated, and complications were recorded. Results: This retro- hematopoietic stem cells transplantation (HSCT), 17% spective and prospective study showed that among the cases are treated with both ERT and HSCT, and 11% of patients with MPS, 17 of the 18 cases were products of consanguineous receive neither ERT nor HSCT. The median age at first marriage (94.4%) with male predominance (male–female ¼ treatment (ERT or HSCT) is 1.5 years for patients 1.6:1).Most cases were from the Northern Gaza (61.1%), com- with Hurler syndrome, 8.0 years for patients with Hurler pared to Gaza (33.3%) and Southern Gaza (5.6%). Family his- Scheie syndrome, and 16.9 years for patients with Scheie tory was positive in 50% of the cases. Diagnosis was made on syndrome, reflecting a global delay between diagnosis and clinical and radiological basis in 13 (72.2%) cases with 3 treatment initiation. Conclusion: The MPS-I Registry (16.7%) cases diagnosed by thin-layer chromatography and 3 enables tracking of disease course and long-term clinical (16.7%) cases by enzymatic study. Outcome of these cases was outcomes of patients with MPS-I worldwide, regardless of unknown for 3 (16.7%) cases. Three cases died (mortality the treatment status. Data from the Registry provide an 16.7%), and we still follow-up 13 (66.6%) cases. We studied opportunity to better understand the disease and response the prevalence of clinical features and complications in 10 to therapy. Conflicts: All 3 authors are employees of Gen- cases. Mental retardation is a universal finding(100%) zyme, a Sanofi company. 6 Journal of Inborn Errors of Metabolism & Screening

1026 - The Need of Asia Pacific 1Shire, Eysins, Switzerland Mucopolysaccharidosis Network and Patient Introduction: The Hunter Outcome Survey (HOS) is a global, Registration System multicenter, longitudinal, observational registry sponsored by Shire that collects real-world clinical information on the nat- 1 2 3 Sung Yoon Cho , Young Bae Sohn , Dong-Kyu Jin , and ural history of Hunter syndrome and the long-term effective- Ah-Ra Ko4 ness and safety of idursulfase (Elaprase, Shire, Eysins, Switzerland). Methods: Individuals with a confirmed diagno- 1Samsung Medical Center, Seoul, Korea sis of Hunter syndrome are eligible for enrollment in HOS. 2Department of Medical Genetics, Ajou University Hospital, Suwon, Clinical data are collected during routine evaluations and may Korea also be extracted from hospital records. Results: Since HOS 3Department of Pediatrics, Samsung Medical Center, Seoul, Korea was initiated in 2005, almost 1000 individuals with Hunter 4Clinical Research Center, Samsung Biomedical Research Institute, syndrome have been enrolled prospectively at 118 clinics in Seoul, Korea 26 countries across 4 continents. The HOS collects a broad Mucopolysaccharidoses (MPS) are relatively frequent as a range of disease- and treatment-related information and is group, with an overall incidence of 1:22 000 to 52 000 live proving to be a valuable tool in increasing understanding of births although individually rare. Asia is the world’s most Hunter syndrome and its treatment in a large population of populous continent. The medical needs for caring patients with patients with this rare disease over a long period of time. The MPS are multidisciplinary and very challenging. The system proportion of patients enrolled before 6 years of age is to fulfill the tasks is based on the integration of professional, greater now than when HOS was initiated, probably reflect- social, and governmental sectors. Scarce knowledge should ing improvements in disease awareness and diagnosis. As of be shared and resources should be combined as efficiently January 2014, the median age of patients alive at HOS entry as possible, in order to tackle the care for individuals with was8.6years(N¼ 871) at enrollment, and their median MPS more effectively across Asia and extending to the age at diagnosis was 3.3 years (N ¼ 765). The data gener- Pacific Rim. There was no standard guideline for patients ated from HOS have resulted in 14 peer-reviewed publica- with MPS in the Asia Pacific region. We need to evaluate the tions and more than 80 congress presentations. Most appropriateness of how we treat patients and guarantee their patients followed prospectively in HOS (80.2%, 655 of safety, and need to share information and set up collaborative 817) have received at least 1 infusion with idursulfase (med- research and global clinical trial. The first meeting of Asia ian age at treatment start, 7.6 years). Obtaining high-quality Pacific MPS Network (APMN) in Seoul in January, 2013 was and complete data is challenging in all disease registries, a good start for organizing the network to meet the need. The and efforts are ongoing to achieve further improvement in first task was establishment of Asia Pacific MPS Registry as the quality and completeness of HOS data. Conclusion: The an electronic data remote system, and online site has opened HOS is a unique source of real-world data on the progres- recently. As mission, APMN will serve as a core infrastruc- sion and management of Hunter syndrome. As it grows, ture for treatment of patients, mutual exchange of opinion and HOS may make further contributions to our understanding information, international cooperative research on the dis- of this rare, life-limiting disease and to improvements in ease, and global clinical trials. As vision, APMN will improve patient care. Conflicts of interest: Maria Paabøl Larsen, the quality of life for patients with MPS through active coop- Isabelle Morin, Marcella Lynch, and Tom Pulles are full- eration. In addition, APMN concerns the patients who cannot time employees of Shire. receive enzyme replacement therapy yet. There are 4 objectives of APMN: (1) organization of Asia Pacific research network of MPS (Registry, Standard Treatment Guideline); (2) to 1124 - Screening of Mucopolysaccharidosis understand current situation and exchange of information; (3) in the Associac¸a˜o de Pais e Amigos dos support for the preclinical studiesrelatedtoMPSandAsia Excepcionais of Ceara State, Brazil Pacific patients/parents with MPS; and (4) invitation and international exchange of young doctors who are responsible Maria Denise F. Carvalho1, Ellaine D.F. Carvalho1, for patients with MPS. This well-planned networking will 1 1 grow more and more. Pedro O. Barbosa , and Krishnamurti de M. Carvalho 1Unichristus/UECE/APAE-Fortaleza, Brazil

1062 - The Hunter Outcome Survey: Introduction: The Associaçaõ de Pais e Amigos dos Excep- cionais (APAEs) has proved to be increasingly more impor- Collecting Real-World Data on a tant for screening and diagnosis of patients with lysosomal Rare Disease diseases, among them, the mucopolysaccharidosis (MPS). Objectives: To perform clinical and laboratory screening in 1 1 Tom A. W. Pulles , Maria Paabøl Larsen , all patients suspected of MPS in many APAES in Ceara´ State. Isabelle Morin1, and Marcella Lynch1 Methodology: (1) Perform educational presentations for health Abstracts 7 care professionals (audiologists, educators, psychologists, occu- studied region. The detection of carriers allows the identifica- pational therapists, nurses, and physicians) involved in the care tion of families at risk, which could be further screened. The and monitoring of children with motor and intellectual deficits; program is in progress, as an increased sample size will allow (2) clinical evaluation of suspected MPS referred by various pro- us to estimate more precisely the frequency of the mutation and fessionals; (3) perform screening of urine and blood in filter the expected number of heterozygotes and homozygotes in the paper in patients suspected of MPS; (4) perform specific enzyme region, which will be important for a population medical genet- dosage for the MPS subtype suspicion; and (5) genetic counsel- ics approach to the community, including not only early treating with specific and multidisciplinary treatment. Results: After ment but also genetic counseling and prenatal diagnosis. This the establishment of this project, our screening in 3 months— work was supported by MPS Brazil Network and INAGEMP January to March 2014—identified patients positive for MPS- and by an unrestricted grant from BioMarin. III and MPS-IV which are in a confirmation process by enzymatic measurement of leukocytes. In patients in which the MPS 1186 - The Mucopolysaccharidosis Brazil screening was negative, we seek for other diagnoses through an appropriate clinical follow-up. Conclusion: Despite the recent Network: A Decade Helping to Identify onset of this project, there is a great diagnostic perspective in the Patients With Mucopolysaccharidosis APAEs with active medical genetics services. Conflict of inter- Around the World ests: Educational presentations for health care professionals with 1 2 Shire, Genzyme, and BioMarin. Andressa Federhen , Maira Graeff Burin , Sandra Leistner Segal2, Ursula da Silveira Matte2, Karlla Cristina Tavares Jesuino2,Celio´ Luiz Rafaelli2, Maria Betaˆnia 1183 - Screening for Mucopolysaccharidosis Toralles3, Angelina Xavier Acosta3, Erlane Marques VI in a High-Incidence Area in Northeast Ribeiro4, Eugeniaˆ Valadares5, Luiz Carlos Santana da Brazil: Report of the First 1800 Newborns Silva6, Chong Ae Kim7, Charles Marques Lourenço8, Tested Dafne Horovitz9, Raquel Boy10, Carlos Steiner11, 12 3 1,2 3 Ma´rcia Gonçalves Ribeiro , and Roberto Giugliani Fernanda Bender , Angelina Acosta , Aline 1 Bochernitsan2, Tatiana Amorim3, Maira Burin2, Post Graduation Program in Medicine: Child and Adolescent Health 4 3 (UFRGS), Porto Alegre, Brazil Antonio Purificaçaõ , Kiyoko Abe-Sandes´ , 2 2 2 Medical Genetics Service, Hospital de Clıńicas de Porto Alegre Sandra Leistner-Segal , and Roberto Giugliani (HCPA), Porto Alegre, Brazil 1Hospital de Clıńicas de Porto Alegre, Porto Alegre, Brazil 3Medical Genetics Service, HUPE, Salvador, Brazil 2Medical Genetics Service, HCPA, Porto Alegre, Brazil 4Hospital Infantil Albert Sabin, Fortaleza, Brazil 3Escola Bahiana de Medicina e Sau´de Pu´blica, Salvador, Brazil 5Universidade Federal de Minas Gerais, Belo Horizonte, Brazil 4APAE, Salvador, Brazil 6Laboratory of Inborn Errors of Metabolism, HCPA, Porto Alegre, Brazil Introduction: Mucopolysaccharidosis VI (MPS-VI) is caused 7Institute of Child, Saõ Paulo, Brazil by the deficiency of N-acetylgalactosamine 4-sulfatase result- 8Hospital das Clıńicas de Ribeiraõ Preto (HCRP), Ribeiraõ Preto, ing in storage of dermatan sulfate in lysosomes and leading Brazil to progressive and severe bone dysplasia and to problems in 9Instituto Fernandes Figueira, FIOCRUZ, Rio de Janeiro, Brazil many organs and systems. Mucopolysaccharidosis VI is a very 10Hospital Universita´rio Pedro Ernesto, Rio de Janeiro, Brazil rare condition (1 of 340 000 worldwide) but has a relatively 11Department of Medical Genetics, UNICAMP, Campinas, Brazil high incidence in the county of Monte Santo (53 000 inhabi- 12Instituto de Pediatria e Puericultura Martagaõ Gesteira, UFRJ, Rio tants), in Northeast Brazil, where 13 (1 of 4000) cases with de Janeiro, Brazil MPS-VI have been identified so far. Objective and Methods: A common mutation (H178L) was identified in all these cases, Introduction: The Mucopolysaccharidosis (MPS) Brazil suggesting a founder effect. As MPS-VI could be treated with Network (MBN) was created 10 years ago to improve diag- enzyme replacement therapy and there are indications that a nosis and management of MPS diseases in Brazil. Since better outcome may be expected in early treated cases, screen- 2004, physicians from all Brazilian regions and from other ing for this disease (with customized biochemical and molecu- countries have requested support of MBN for the investiga- lar tests in dried blood spots) was added in this specific area to tion of mucopolysaccharidosis. Methods: The access to the newborn screening program already in place. Results: The information and diagnosis in MPS has been provided project started in January 2011, and a total of 1800 samples through different tools. The contact with MBN has been were analyzed until March 2014, allowing the detection of 29 performed through Web site (www.mps.ufrgs.br), e-mail carriers (1 of 62 newborns). Conclusion: We conclude that the ([email protected]), or a toll-free helpline (0800-510-2030, methodology developed for MPS-VI screening in the newborn Brazil only). Informative materials and instructions for sam- was effective for the early detection of the disease in the ple collection and shipment can be downloaded in the Web 8 Journal of Inborn Errors of Metabolism & Screening site (English, Spanish, and Portuguese). Services from all mesoregion—the third mesoregion from the coast to hinterland Brazilian regions sent the biological samples to the MBN with 44 municipalities, 298.263 inhabitants. The prevalence of headquarters, located at the Medical Genetics Service of MPS-IVA in this mesoregion is 1 per 18.641 inhabitants. For Hospital de Clınicas de Porto Alegre, where the laboratory 10 of the 22 patients, there is consanguinity among parents. investigation for MPS is performed free of charge. Further- The existence of unusually high rates of inbreeding in Paraı´ba, more, an increased number of samples from international with the frequency of consanguineous unions ranging from 6% patients has also been referred to MBN. Results: From to 41%, was detected in a previous study. In 10 of 15 patients April 2004 to December 2013, 2641 samples of Brazilian genotyped for N-acetylgalatosamine-6-sulfate-sulfatase, we patients suspicious for MPS were referred to MBN for observed an allele frequency of 70% for a specific mutation investigation. A total of 1065 patients with MPS were iden- (p.S341R). According to the history of Paraiba settlement, the tified, 606 being new diagnoses (average 5.2/month). The Portuguese families with strong tradition of consanguineous most frequent type of MPS diagnosed was MPS-II, con- unions were the most important settlers. The analysis of the sur- firmed in 320 (30%) of 1065 patients with MPS, followed names of patients shows that 6 of 22 unrelated patients have the by MPS-VI (23.3%), MPS-I (19.4%), and MPS-IVA same surname and that 5 of 6 of these patients come from the (11.5%). Most patients with MPS-I came from South or Borborema mesoregion. The first inhabitants with this surname Southeast regions (49.6%), while most patients with MPS- come from Viana do Castelo—north of Portugal arriving in VI came from Northeast region (49.5%). The MPS-IIIB and Paraiba in 1630. Paradoxically, Portugal has one of the lowest -IVA are also frequent in South with 42% and 31.5% of MPS-IVA frequencies in Europe. Conclusion: The high preva- patients, respectively, coming from these regions. In all, lence of MPS-IVA in Borborema mesoregion, the high fre- 231 patients from outside Brazil were diagnosed with MPS, quency of the same mutation, and that of the parental and MPS-II is also the most frequent type of MPS diag- consanguinity are strong evidences for the hypothesis of a nosed among these patients. Conclusion: The multiple ways founder effect. There is an ongoing genetic study to verify this to enable easy access to information and diagnostic tests hypothesis. helped to identify many patients with MPS in Brazil and in other countries, transforming MBN into a template to develop similar initiatives for other rare diseases. 3. Natural History 1003 - Anthropometrical and Dietary 1203 - Morquio A Prevalence in the State Assessment of Patients With of Paraı´ba, Northeast of Brazil: Mucopolysaccharidosis VI in Colombia A Founder Effect? Liliana Ladino1, Erika Ochoa2, and Natalia Sepu´lveda3 1 2 Paula F. V. de Medeiros , Sandra Leistner-Segal , 1Instituto de Investigacioń en Nutricioń, Genetica´ y Metabolismo, Francyne Kubaski2,Ca´tia Eufrazino1, Simone L. Santos3, Universidad El Bosque, Bogota´, Colombia 2 Gabriella C. Napy1, Ana C. Brusius-Facchin2, Aline N. Instituto Tecnolo´gico y de Estudios Superiores de Monterrey, Ciudad 2 1 1 de Mexico,´ Mexico City, Mexico´ Bochernitsan , Mariana M. Gurjaõ , Helmer A. Melo , 3 2 Departamento de Nutricioń y Bioquı´mica. Facultad de Ciencias, and Roberto Giugliani Pontificia Universidad Javeriana, Bogo, Denmark 1Universidade Federal de Campina Grande - Hospital Universita´rio To describe anthropometrical and dietary assessment of Alcides Carneiro, Paraı´ba, Brazil patients with mucopolysaccharidosis VI (MPS-VI) in Colom- 2Genetics Service, Hospital de Clıńicas de Porto Alegre, Porto Alegre, bia, a thorough nutritional assessment was conducted, includ- Brazil ing anthropometrical and dietary assessment. Growth indices 3Universidade Estadual da Paraı´ba, Departamento de Biologia, were compared with the Growth Standards and Reference Paraı´ba, Brazil Charts of World Health Organization (WHO) as well as refer- Objectives: To determine the prevalence of mucopolysacchar- ence data of Frisancho for older children and adults, regarding idosis (MPS) IVA in the state of Paraı´ba, Northeast of Brazil, body composition. Dietary assessment was used to evaluate and the distribution of patients in its mesoregions. Methods: energy and protein adequacy in comparison to Food and Agri- The latest population data were collected from Brazilian Insti- culture Organization (FAO)/WHO requirements. A total of 23 tute of Geography and Statistics (IBGE) in 2010 and patient’s patients with MPS-VI were recruited; 13(56.5%) of 23 patients records from the Hospital Universita´rio Alcides Carneiro, a ref- were men. The average age was 12.2 + 4.7 years, ranging from erence center for MPS in Paraiba. Results: The state of Paraiba 2.9 to 20.4 years. Average height was 101.5 + 7.9 cm, (range has 3.766.528 inhabitants and it is divided into 4 mesoregions. 83-121 cm). Every patient had growth retardation (height for Currently, there are 22 patients with MPS-IVA (12 males and age z-score 6.5 + 2.1), thus the anthropometrical assessment 10 females) in Paraı´ba, with a prevalence of 1 per 171.205 was done using the age according to their height instead of inhabitants. Ofthe 22 patients, 16 come from the Borborema chronological age. Only 2 (8.7%) of the 23 patients had Abstracts 9 adequate weight; 91.3% (21 of 23) had overweight or obesity. thickening and opacity, choked disk of the optic nerve, 2,.0 Body composition analysis demonstrated that overweight is to 2.5 mm enlargement of the eyebulb, and increase in intrao- due to higher fat-free mass; 65.2% (15 of 23) had arm muscle cular pressure were detected. In the MPS-II megalocornea, cor- area z-score above þ1 standard deviation (SD), while only nea opacity localizing in the cornea deep layers and stroma 4.5% (2 of 23) had tricipital skinfold z-score above þ1 SD. thickening were observed. In the fundus, dilated blood vessels Dietary analysis showed a significantly lower energy intake with the thickened wall and optic nerve choked discs were than that of healthy controls (P ¼ .0137); when compared to observed. Mucopolysaccharidosis III is characterized by hyper- FAO/WHO energy requirements for chronological age and sex, telorism and proptosis. In the MPS-IV, fundus changes in the patients with MPS-VI had a significantly lower intake (P ¼ form of optic disk edema and retina edema were seen. .0008) and when compared with requirements to age adjusted to height, their intake was significantly higher (P ¼ .0101). 1005 - Respiratory Disorders During Sleep However, energy was not associated with a specific nutritional in Children With Hunter Syndrome status (P ¼ .446). Intake of protein and lipid was lower than that of healthy controls, explaining the differences in energy Nato Vashakmadze1, Leyla Namazova-Baranova1, intake. Patients with MPS-VI would benefit from nutritional 1 1 interventions that enhance their life quality. Thus, our study Anahit Gevorkyan , Ekaterina Chernavina , 1 suggests that longitudinal and multicenter studies should be and Marina Babaykina promoted in order to evaluate the development of specific 1Scientific Center of Children’s Health, RAMS, Moscow, Russia growth reference charts as well as the determination of energy requirements, adequate for their disease, its severity, and con- Introduction: Upper airway obstruction is a major cause of the sidering their peculiar body composition. mortality observed in mucopolysaccharidosis (MPS) type II. Objectives: To identify the existence and severity of obstructive sleep apnea (OSA) in children with MPS-II. Method: 1004 - The Results of Vision Organ Follow-Up Nineteen children were with MPS-II, 2 to 16 years old (median in Children With Mucopolysaccharidosis age 6.5 years). According to the standard clinical criteria, there of Different Forms were 5 children with a mild form of MPS and 14 with severe form. All children had received enzyme replacement therapy Natella Sukhanova1, Leila Namazova-Baranova1, on the extent from 10 to 27 months by the time of research. The Anna Gevorkyan1, and Nato Vashakmadze1 polysomnographic system Embla N7000 (Iceland) was used. Nocturnal cardiorespiratory monitoring (CRM) with an estima- 1 Research Center for Children’s Health, Moscow 119991, Russia tion of OSA by a standard technique was carried out for all Materials and Methods: We analyzed the results of 34 chil- patients. The parameters of apnea–hypopnea index (AHI) and dren (68 eyes) examined, at the age of 1.5 to 17 years (median oxygen saturation nadir were analyzed. Results: A total of age 8.0 + 4.8 years). In all, 6 children had mucopolysacchar- 14 (66,7%) children had different degrees of OSA: 6 had mild idosis (MPS) I, 18 had MPS-II, 4 had MPS-III, and 2 had MPS- (by AHI ¼ 1.5-5), 5 had moderate (AHI ¼ 5-10), and 3 had VI. The ophthalmic investigation included viscometry, pachy- severe (AHI > 10). Patients with OSA had the mean nadir arter- metry, tonometry, and Schirmer test (electroretinogram [ERG] ial oxygen saturation (SaO2) of 93.2% + 4.8%. The OSA was method). The follow-up period was 24 months. noted by episodes associated with irregular breathing. The Results and Discussion: The anomaly was bilateral in 34 CRM was repeated during 6 to 12 months after the first children. On biomicroscopy in 18 children with megalocornea, research in 3 children with severe form. According to the the cornea diameter reached 13 mm and dilation of conjunctiva results, the degree of sleep apnea was increased in 2 children vessels and thickening of deep layers of cornea were detected. and without dynamics in 2 children. Conclusion: The preva- In 6 patients, marked corneal opacity bullous regeneration was lence of moderate to severe OSA was 42% (8 of 19) in children seen. In 34 patients on pachymetry , cornea sensitivity with MPS-II. The degree of expressiveness of OSA depended decreased in 14 children with mild stage, in 10 children with on severity of illness, that is, duration of the disease and the moderate stage, and in 10 children the sensitivity was lacking. initiation of enzyme replacement therapy. In 12 patients on exophthalmometry the eyebulb size increased to 2.5 mm. Minor changes in pigmentary epithelium and chor- 1008 - Natural History of Language and oids were detected 8 patients with scleral defect walls and Motor Function in Mucopolysaccharidosis edges. In 22 children, the retina vessels had dilation, wall thick- IIIA ening, and normal pathway. In 16 cases on sciascopy, up to 1.5 diopter astigmatism was detected, and in 3 children, high- Elsa Shapiro1, Kathleen Delaney2, Patrick Haslett1, degree hypermetropia and high-degree amblyopia were 1 1 observed. The ERG method indicates dysfunction of the retina Igor Nestrasil , and Chester Whitley with normal to severe changes. Conclusion: In MPS I macro- 1University of Minnesota, Minneapolis, MN, USA cornea, conjunctiva vessels dilation, cornea deep layer 2Shire HGT, Cambridge, MA, USA 10 Journal of Inborn Errors of Metabolism & Screening

Our previous work from a prospective natural history study of hepatosplenomegaly (18 of 19), craniofacial dysmorphy (16 mucopolysaccharidosis type IIIA (MPS-IIIA) established that of 19), corneal clouding (15 of 17), and skeletal changes—dys- neurologic progression can be sensitively measured using tests ostosis multiplex (17 of 19) and were observed in the most of of neurocognitive function. Here, we report on motor and lan- the patients. Psychomotor delay (13 of 19) was present in all guage development to determine their sensitivity to disease patients with Hurler type. Cardiomyopathy with valves’ progression. Methods: Twenty-five patients were recruited to impairment (13 of 17), hearing impairment (8 of 16), joint stiff- a single site for a longitudinal study of MPS-IIIA (Clinical- ness (16 of 18), carpal tunnel syndrome (5 of 19), and short sta- Trials.gov Identifier: NCT01047306) and assessed at baseline, ture (8 of 16) were present as later symptoms. All children had 6, 12, and 24 months. Fine/gross motor skills and receptive/ increased glycoaminoglycans excretion in the urine and expressive language were evaluated from parent report and decreased activity of a-L-iduronidase in isolated leukocytes. from direct assessment. The Four Point Scoring System Two mutations in IDUA gene were most prevalent (p.W402X (FPSS), a MPS-III disability assessment, was completed. [n ¼ 12] and p.Q70X [n ¼ 8]). Hematopoietic stem cells trans- Observational data were used to delineate qualitative aspects plantation (HSCT) with/without enzyme replacement therapy of motor behavior. Results: In all, 20 patients (baseline age (ERT) was performed in 8 children, in 6 of them with good range 1.1-8.8 years) had classic, rapidly progressive disease, clinical results. In all, 4 patients with milder type were treated and 5 patients (baseline age 6.7-18.3 years) showed slower pro- with a long-lasting ERT—3 of them with good therapeutic gression. Among classic cases, a developmental ceiling at 41 effect, but 1 patient died due to complications after neuro- months age equivalent was observed for fine motor skills. Sub- surgery intervention for cervical spinal cord compression. sequently, some patients showed regression. Individual trajec- Conclusion: Diagnosis of MPS-I in early phases of the disease tories were too variable to estimate an age after which decline improves the prognosis because adequate therapy (HSCT and/ occurred. Gross motor skills were impaired but relatively sta- or ERT) can be chosen. Prognosis for children with later diag- ble, not declining significantly until late in the disease. Parents nosis is very unfavorable. The diagnosis is very important also reported better gross motor skills than were directly measured; for prenatal diagnostic in affected families. This study was sup- this may be explained by the patient’s inability to imitate. Lan- ported by Ministry of Health, Czech Republic, RVO- guage decline more closely approximated the cognitive find- VFN64165. ings, with trends suggesting overall declines from approximately 40 months of age. Although the FPSS could identify children with early and late disease, it showed little 1029 - Brain Magnetic Resonance Imaging sensitivity to gradations of severity in the intermediate stages. Patterns of Disease Progression in Sanfilippo Conclusion: Variability in language and stability of motor scores over time preclude their use as accurate measures of dis- Syndrome Type A (Mucopolysaccharidosis ease progression or treatment response. However, these mea- Type IIIA) sures have clinical utility; the FPSS can determine disease 1 1 1 stage, and language and motor assessment may assist parents Igor Nestrasil , Victor Kovac , Alia Ahmed , Kathleen 1 1 1 2 and teachers to establish appropriate programming and inter- Delaney , Brianna Yund , Kyle Rudser , Patrick Haslett , ventions to maintain function in patients with MPS-IIIA. Chester Whitley1, and Elsa Shapiro1 1University of Minnesota, Minneapolis, MN, USA 2 1027 - Mucopolysaccharidosis Type I: Shire, Dublin, Ireland Clinical Manifestation in 19 Patients From Introduction: Mucopolysaccharidosis type IIIA (MPS-IIIA) is the Czech Republic a progressive neurological disease. Quantitative magnetic resonance imaging (MRI) and neurocognitive function testing may Pavel Jesina1 provide understanding of disease progression of MPS-IIIA. From the natural history of MPS-IIIA (NCT01047306), we pre- 1Institute of Inherited Metabolic Disorders, General University viously reported that baseline cognition is significantly associ- Hospital, Charles University, Praha, Czech Republic ated with age and gray matter volumes. Here, we present Introduction: Mucopolysaccharidosis type I (MPS-I) is a longitudinal data regarding regional changes in MRI- severe metabolic storage disease caused by impaired function measured brain volumes in patients with MPS-IIIA and esti- of a-L-iduronidase. The aim of this study is to describe clinical mates of the rate of decline in both cognition and brain volumes symptoms, natural course, and to evaluate the results of treat- over 24 months. Methods: Longitudinal cognitive and quanti- ment in Czech patients with MPS-I. The study group consists tative MRI data were collected from 24 children with docu- of 19 patients from 18 families. In all children, diagnosis of mented MPS-IIIA. Brain volumetric analysis and MPS-I was confirmed with enzymatic analysis and in 18 chil- developmental quotient (DQ) were obtained by automated MRI dren with molecular analysis. Results: The phenotypic distri- segmentation and cognitive assessment, respectively. Results: bution of our patients was Hurler/Hurler-Scheie/Scheie For a subset of 19 patients with classic disease diagnosed prior syndromes—13/4/2. The first symptoms of disease were to age 6, volume decreases were noted in cortex (7.5%/ Abstracts 11 year)*, amygdalae (15%/year)*, hippocampi (4.9%/year)*, the mean total score was 103, suggesting modified functional and very slightly in white matter (2.2%/year). Cortical thick- dependency (requiring assistance of up to 25% of the tasks). ness narrowed with a rate of 5.9% per year* (*, statistically sig- Respiratory pressures were below the expected range for age, nificant). Subcortical gray matter and cortical cerebellar with an average maximum inspiratory pressure of 49.3 and volumes remained stable. Ventricular volume increased maximum expiratory pressure of 65.2. The average distance (þ23.5%/year)*, presumably reflecting the brain loss. A strong measured by the 6MWT was 301 m without changes in oxy- correlation was found between DQ and cortical volume and gen saturation and respiratory and heart rates but with a high similarly between DQ and cortical thickness. Other specific data level of perceived exertion (Borg average 6.3). Conclusion: will be reported (eg, rate of decline for individual lobes of the Most of the patients evaluated were sedentary, with a deficit brain). For patients diagnosed after age 6, patterns were variable. in respiratory muscle strength, dyspneic while covering short Conclusion: In this natural history study, loss of cortical and distances and presented compromised functionality aspects. amygdala volumes with substantial ventricular enlargement was Research carrying a larger sample in this area is needed to the primary MRI patterns linked to decline in cognitive function appropriately choose treatments for this population. in patients with the classical form of MPS-IIIA. We have demonstrated that both DQ and cortical volume are markers of 1034 - Odontological Observations in disease progression in MPS-IIIA and that they are closely associated. White matter, cerebellum, and subcortical gray matter Mucopolysaccharidosis Type I, Hurler-Scheie remained stable or declined slightly. Mucopolysaccharidosis Norberto B. Guelbert1, Adriana B. Becerra1, Adriana I. type IIIA appears to be mainly a disease of cerebral cortical gray 2 3 4 matter. Conflicts of interest: The study was supported by Shire, Cismondi , Ines Noher Halac , Liliana Gomez , Patricia 4 5 5 Lexington, USA. Campij , Hugo H. Robledo , Sabastian Bulacios , and Perla Krupnik Hidalgo4 1Servicio Enfermedades Metabo´licas Hospital de Ninõs de Cordoba, 1030 - Clinical Profile, Respiratory Muscle Co´rdoba, Spain Strength, Ability, and Level of Functional 2Ca´tedra de Biologıá Celular, Universidad Nacional de Co´rdoba, Independence in Patients With Argentina Mucopolysaccharidoses in a Center of Inborn 3CONICET Consejo Nacional de Investigaciones Cientı´ficas y Errors in the State of Pernambuco, Brazil Tecnicas,´ Argentina 4Servicio de Atencioń Odontolo´gica Integral a la Persona con Ba´rbara Bernardo R. Silva1, Maria do Carmo M. B. Discapacidad. Facultad de Odontologıá, Universidad Central de 1 1 1 Venezuela, Carcas, Venezuela Duarte ,Lı´via B. Andrade , Marcelo S. Kerstenetzky , 5 1 Servicio de Radiologıá Hospital de Ninõs de Co´rdoba, Co´rdoba, and Patrıćia G. M. Bezerra Argentina 1Instituto de Medicina Integral Prof Fernando Figueira, Recife, Brazil Introduction: Mucopolysaccharidosis type I (MPS-I) is a Objectives: To evaluate the clinical profile, respiratory mus- multisystemic lysosomal storage disease. The deficiency of the cle strength, functional ability, and level of functional inde- a-L-iduronidase enzyme results in accumulation of glycosamino- pendence among patients with mucopolysaccharidosis glycans (GAGs) in various tissues and organs. The mouths of (MPS). Methods: Cross-sectional study targeting 19 patients these patients show characteristic signs and symptoms of impor- with MPS, ranging from 6 to 38 years. Children younger than tance in health and welfare and contribute to the diagnosis and 6 years who were unable to perform the tests were excluded. possibly to the therapeutic monitoring. Objectives: To show The instruments used were the Pediatric Evaluation of Dis- odontologic involvement in MPS-I; to promote oral health in ability Inventory (PEDI) and the Functional Independence lysosomal storage diseases; and to evaluate the influence of Measure (FIM) questionnaires, which were chosen based on enzyme replacement therapy (ERT) on dental manifestations. the age of the patient. Respiratory muscle strength and func- Materials and Methods: Five patients with MPS-I, Hurler- tional capacity were assessed by the manometer and 6-minute Scheie phenotype, a girl and 4 boys between 4 and 13 years of age walk (6MWT) tests, respectively. Results: Of the patients, and under ERT for more than 2 years, were studied with clinical 73% were MPS type VI, 16.5% type IV, and 10.5% type dental examination, panoramic tomography, and lineal computed II. Their average age was 15.7 years, and 63% of them were tomography (CT) with multiplanar 3-dimensional (3D) recon- males. Their mean body mass index was 20.3 and 68% were struction of the temporomandibular joint. In 1 patient, optical and sedentary. Three children who were assessed by the PEDI electron microscopy of gingival biopsy was performed. Results: regarding self-care and social function scored an average In the oral cavity, it was evidenced the limited mouth opening, jaw of 39 and 53, respectively, showing normal development. hypoplasia, anterior open bite, dental crowding, delayed eruption Regarding mobility, the average score of 16.7 suggested a of permanent elements, gingival hyperplasia, and macroglossia. normative developmental delay or inferior performance than The orthopantomography showed narrow lower jaw, bilateral normal. Sixteen patients were assessed by the FIM, in which condylar hypoplasia, confirmed by CT-3D. The gingival biopsy 12 Journal of Inborn Errors of Metabolism & Screening showed the intralysosomal accumulation of GAGs with disrup- 1Pediatric Hospitla Borras-Marfan, La Habana, Cuba tion in the basal membrane when compared to other studies of 2National Institute of Endocrinology, La Habana, Cuba patients without ERT. Conclusion: The oral manifestations were 3Laboratory of Metabolism Inborn at National Center of Medical constant in our patients; 100% showed bilateral condylar hypo- Genetics, La Habana, Cuba plasia and severe limitation in opening their mouth. Less involve- Introduction: Mucopolysaccharidoses (MPSs) are inherited ment was noted in children who were started on ERT early. metabolic disorders caused by deficiencies of the enzymes responsible for the intralysosomal catabolism of glycosaminogly- 1035 - Bone and Joint Disease in the cans. The MPSs are inherited as autosomial recessives, except Mucopolysaccharidoses Involves Hunter disease that has an X-chromosomal-linked inheritance. The MPS type III, also called Sanfilippo disease, is the most fre- Inflammation and Improves Upon Treatment quent, and the impairment of central nervous system is consider- With Pentosan Polysulfate able in this condition. Objectives: To describe clinical, 1 1 1 metabolic, immunological, and hormonal characteristics in an Calogera M. Simonaro , Michael Frohbergh ,YiGe ,Fanli 8-year-old boy with Sanfilippo disease associated with preco- 1 1 1 Meng , Xingxuan He , Victor A. DeAngelis ,Nesrin cious puberty. Methods: The medical history of a patient was Karabul2,AlexanderSo´lyom3, and Edward H. Schuchman1 studied. Topics regarding main clinical dates, pre- and perinatal events, familial history as well as laboratory test results were ana- 1Icahn School of Medicine at Mount Sinai, New York, NY, USA lyzed. Review of the literature was done. Results: Perinatal 2Villa Metabolica, Children’s Hospital, University of Mainz, Mainz, adverse events, coarse facies, macrocephaly, slight hepatome- Germany galy, psychomotor developmental retardation, and progressive 3Pediatrics, University of Pecs,´ Pecs,´ Hungary neurological deterioration were the main reasons for suspicion Introduction: We have previously described the inflammatory of MPS in our case; nevertheless, the presence of enlarged testis mechanisms leading to joint and bone disease in the mucopoly- and increased hair in facial and pubic area were not so clear for us. saccharidoses (MPSs) and identified an Food and Drug Adminis- A positive result in cetyltrimethylammonium bromide and blue tration/European Medicines Agency-approved drug, pentosan toloudina test with increased heparan sulfate in urine chromato- polysulfate (SP-54, PPS), which resulted in reduction of inflam- graphy make our suspicion true. Serum values for follicle- matory cytokines and marked improvements in motility, groom- stimulating hormone, luteinizing hormone, thyroid-stimulating ing behavior, and bone and cartilage disease in a rat model of MPS hormone, T4, and testosterone reveal a central precocious puberty type VI. Objectives: To assess dose-related effects of PPS to fur- that had recently been described in a fewer number of cases with ther establish the basis for clinical trials. Methods: In our previ- MPS-III, most of them during genistein therapy, a situation differ- ous work, we reported the effects of daily, oral PPS treatment in ent from our case. Conclusion: Precocious puberty associated MPS-VI rats, and here we compare these effects with weekly sub- with MPS-III is a relatively new finding in some patients with cutaneous (subQ) injections. The MPS-VI rats were treated with MPS-III, but there is not enough evidence whether it is related weekly subQ PPS at human equivalent doses of 1, 2, and 4 mg/kg. to isoflavone preparation or not. Our case may help to clarify that Biochemical, pathological, and clinical assessments were made. because the patient was out of treatment. Results: The most efficacious subQ PPS dose was 2 mg/kg. Improvements in subQ versus oral administration were observed. Treatment of all MPS-VI rats with weekly subQ PPS for up to 6 1039 - A Mongolian Child Case of a Family months was safely tolerated at all doses. Conclusion: We With Mucopolysaccharidosis Type II, Hunter propose that weekly subQ injections of PPS will be efficacious Syndrome and safe in patients with MPS, and a phase 1/2 clinical trial is planned. Further assessments of inflammation in MPS, along Zolzaya Doljoo1, Pureydori Ichinkhorloo1, Munkhtsetseg with exploration of the mechanism of PPS action in these dis- Bazarragchaa1, Kherlen Polkhoo1, Munktuya orders, are topics of ongoing research and will be discussed. 1 1 Conflicts of interest: Drs Simonaro and Schuchman have a Tumurkhuu , and Sarantuya Jay patent on the use of PPS in the MPSs. 1Department of Molecular Biology and Genetics, Health Sciences University of Mongolia, Ulaanbaatar, Mongolia 1036 - Mucopolysaccharidosis III Associated Introduction: Mucopolysaccharidosis type II (MPS-II, Hunter With Precocious Puberty: Case Report and syndrome) is an X-linked recessive lysosomal storage disorder resulting from the defective activity of the enzyme iduronate 2- Literature Review sulfatase. Hunter disease can vary from mild to severe, depend- 1 ing on the level of enzyme deficiency. Objective: To identify Arianne Llamos Paneque , Carmen Margarita Perez´ de enzyme deficiency of glycosaminoglycans in a case with a 1 2 1 la Hoz , Cecilia Perez´ Gensen , Elsa Bertila Acosta , and familial history. Method: We diagnosed a patient with clinical Liens Garlobo3 symptoms of MPS. The patient was a 13-year-old boy. He Abstracts 13

typically had a coarse face, short stature, hepato–splenome- at rest including >95% oxygen saturation, end-tidal CO2 galy, dysostosis multiplex, and severe mental and growth retar- (38-44 mm Hg), and heart rate. Initially, percentage of Total dation. He had persistent pneumonia. Although he was Forced Expiratory Volume (%FEVTOT) was normal until apparently MPS because of his phenotype, the subtype was not approximately 10 years of age; however, as the age increased clear. His nephew and uncle had same symptoms, and both of the %FEVTOT fell showing a significant negative correlation them died at the age of 13. The grandmother and her 2 daugh- between %FEVTOT and age (P ¼ .025-.01). Furthermore, ters are suspected as a carrier of X-linked recessive MPS II dis- %FEVTOT was negatively correlated with patients’ weight, order, Hunter syndrome by genealogical study and we analyzed suggesting that the higher body mass indices exhibited in enzyme activities in serum. Results: Serum N-acetylgluco- patients with Morquio A syndrome may have a detrimental saminidase, a-L-iduronidase, iduronate-2 sulfatase, and b- impact on overall respiratory function (P ¼ .025-.01). Finally, galactosidase levels were checked and iduronate-2 sulfatase over all ages and gender, patients with Morquio A have nor- deficiency was found in this patient. N-acetyl-galactosamine- mal FEV 1/FEVTOT compared to age- and gender-matched 4-sulfatase (arylsulfatase B [ASB]), acid b-galactosidase controls of average stature. Conclusion: These data indicate (BGAL), BGAL–ASB activities were 16.41 mmol/L/h (normal that patients with Morquio A have small but functionally nor- control–patient control ¼ 57.76:2.67), 20.05 mmol/L/h (normal mal lungs, most likely as a result of the effects of the skeletal control–patient control ¼ 41.21:58.35), and 1.22 mmol/L/h dysplasia on the developing lung. (normal control–patient control ¼ 1.01:15.46), respectively. Levels of a-L-iduronidase sulfatase and a-iduronidase were 1053 - Severity and Clinical Manifestations of 0.07 mmol/L/h (normal control–patient control ¼ 136.57: 0.30) and 17.26 mmol/L/h (normal control–patient control ¼ Mucopolysaccharidosis Type IVA (Morquio A 12.56:0.38), respectively. Conclusion: Prenatal biochemical Disease) in Korea screening test should be implying since we have diagnosed 1 2 2 2 familial cases. Ah-Ra Ko , Youghee Kwun , Rim Huh , Jieun Lee , SungYoon Lee2, YoungBae Sohn3, Ok-Hwa Kim4, and 2 1050 - Noninvasive Pulmonary Function Test Dong-Kyu Jin in Patients With Morquio A 1Clinical Research Center, Samsung Biomedical Research Institute, Sungkyunkwan University School of Medicine, Seoul, South Korea Francyne Kubaski1, Shunji Tomatsu1, Pravin Patel1, 2Department of Pediatrics, Samsung Medical Center, 1 1 1 Sungkyunkwan University School of Medicine, Seoul, South Korea Tsotumu Shimada , Eriko Yasuda , Robert W. Mason , 3 William G. Mackenzie1, Helen M. Oldham1, Tadao Orii1, Department of Medical Genetics, Ajou University Hospital, Suwon, 1 South Korea and Thomas H. Shaffer 4Department of Medical Genetics, Ajou University Hospital, Suwon, 1Nemours/Alfred I. duPont Hospital for Children/UDEL/HCPA, South Korea Newark, NJ, USA Introduction: Mucopolysaccharidosis IVA (MPS-IVA, Mor- Introduction: Patients with Morquio A syndrome exhibit a quio A syndrome) is a rare, autosomal recessive disorder caused characteristic systemic skeletal dysplasia from excessive stor- by the deficiency of the lysosomal enzyme N-acetylgalatosa- age of keratan sulfate and chrondroitin-6-sulfate in the lyso- mine-6-sulfate-sulfatase (GALNS). Reduced GALNS activity somes, mainly in chondrocytes. In clinical practice, chest results in impaired catabolism of glycosaminoglycans, keratin wall and formal respiratory function tests are difficult to per- sulfate, and chondroitin-6-sulfate. It leads to multisystemic com- form owing to the small size of the body and patient cooper- plications involving the musculoskeletal, respiratory, cardiovas- ation. Moreover, most patients are wheelchair bound and/or cular, and digestive systems; however, there is no central are postoperative, have severe muscle weakness (atrophy), nervous system impairment. There is no definite therapy for and cannot perform physical endurance tests, forced pulmon- MPS-IVA, and the current management options are palliative. ary function tests, and 6-minute walk or 3-minute stair climb Objectives: To evaluate the clinical and the molecular genetic tests. Objectives: To establish novel and feasible clinical end characteristics of 13 Korean patients with MPS-IVA. Method: points in patients with Morquio A, using noninvasive pulmon- Thirteen patients were diagnosed as MPS-IVA via enzyme activ- ary function tests and comparing with spirometry tests. ity assay from January 1997 to December 2013 at Samsung med- Methods: Twenty-two patients with Morquio (7 males and ical center in Korea. The GALNS genes of all patients were 15 females), ranged from 3 to 40 years of age, underwent non- analyzed. Patients’ charts were retrospectively reviewed for clin- invasive pulmonary function tests with vital signs. The pul- ical manifestations. Result: In all, 10 patients had severe clinical monary function tests analyzed were pneumotachography, phenotype and 2 had intermediate phenotype, on the basis of impulse oscillometry system, and respiratory inductance clinical phenotype criteria. One patient had a mild phenotype, plethysmography. The statistical analyses were performed and his final adult height was 168.5 cm. Radiologic findings using Spearman Rank correlation coefficients and Student indicated skeletal abnormalities in all patients, especially in the t test (P <.05).Results: All patients had normal vital signs hips and extremities. Eight patients had an odontoid hypoplasia, 14 Journal of Inborn Errors of Metabolism & Screening

3 showed atlantoaxial instability, and 4 patients had no abnorm- Mol Genet Metab, 2013). Here, 1- and 2-year endurance and pul- alities except platyspondyly in cervical spine. In all, 6 patients monary function data are presented. Methods: Endurance was had kyphoscoliosis in spine and 10 patients had genu valgum. assessed using the 6-minute walk test (6MWT) and the 3- Two pairs of siblings were included, so 11 different GALNS minute stair climb test (3MSCT). Pulmonary function was eval- mutations were detected. c.451C>A accounted for 23.8% (5 of uated by measuring forced vital capacity (FVC) and maximum 21) and detected in both pairs of siblings. Eight patients were voluntary ventilation (MVV). Data were analyzed using tested for pulmonary function and all were normal. Conclusion: repeated measures analysis of covariance models. Annualized Mucopolysaccharidosis IVA is a severe progressive systemic estimates of change for 6MWT, 3MSCT, FVC, and MVV were skeletal disorder that has the potential to cause disease in most determined using model estimates and interpolation. Results: In bone-related system. An understanding of the manifestations all, 353, 184, and 78 patients were assessed at year 0 (baseline), of MPS-IVA may allow early diagnosis, and therapy in the early year 1, and year 2, respectively. The overall annualized estimate stage may improve the quality of life of patients. of change in 6MWT distance was 4.86 + 3.25 m; a larger decline of 6.84 + 5.38 m was observed in the subset of 1055 - Longitudinal Analysis of Endurance and patients meeting the inclusion/exclusion criteria of the phase 3 clinical trial of elosulfase a (5yearsoldwithbaseline6MWT Pulmonary Function From a Natural History distance 30 and 325 m). In contrast, little change (0.14 + Study of Morquio A Syndrome 0.60 stairs/min) was observed in 3MSCT. Annualized changes in FVC and MVV were 2.44% + 0.68% and 1.01% + 2.38%, 1 2 3 Paul R. Harmatz , Karl Eugen Mengel , Roberto Giugliani , respectively. The FVC and MVV increased in patients aged 4 5 6 Vassili Valayannopoulos , Shuan-Pei Lin , Rossela Parini , 14 years but decreased in older patients. Conclusion: The nat- Nathalie Guffon7, Barbara K. Burton8, Christian Hen- ural history of Morquio A syndrome is characterized by progres- driksz9, John Mitchell10, Ana Martins11, Simon A. Jones12, sive impairment of endurance as measured by the 6MWT. Norberto Guelbert13, Ashok Vellodi14, Frits Wijburg15,Ke Growth likely influenced pulmonary function changes, as pul- 16 16 16 monary parameters increased in younger but not in older Yang ,PeterSlasor , and Celeste Decker patients. This study further supports the use of the 6MWT as a 1Children’s Hospital and Research Center Oakland, Oakland, CA, meaningful clinical outcome measure in ambulatory patients USA with Morquio A. 2Villa Metabolica, MC University of Mainz, Mainz, Germany 3Hospital de Clıńicas de Porto Alegre and Universidade Federal do Rio Grande do Sul, Brazil 1056 - Clinical Polymorphism and 4Hoˆpital Necker-Enfants Malades, Paris, France 5 Phenomenon of Syntropy in Mackay Memorial Hospital and Mackay Medical College, Taipei, Mucopolysaccharidosis Taiwan 6Az. Ospedaliera S. Gerardo, Monza, Italy 1 1 7 Elena Ya. Grechanina , Yulia B. Grechanina , Elena V. Hoˆpital Femme Me`re Enfant, Lyon, France 1 1 8Lurie Children’s Hospital and Northwestern University Feinberg Bugaeva , and Kamilla F. Nagieva School of Medicine, Chicago, IL, USA 1SSIEM, Kharkiv, Ukraine 9Birmingham Children’s Hospital NHS Foundation Trust, Objective: To study the clinical polymorphism of mucopoly- Birmingham, United Kingdom saccharidosis (MPS) in Eastern Europe, clarifying the possibil- 10McGill University Health Centre, Montreal, Canada ity of phenotypic and genotypic syntropy phenomena for 11Universidade Federal de Saõ Paulo, Saõ Paulo, Brazil individual rehabilitation. Methods: Clinical genetics, high- 12Central Manchester University Hospital, University of Manchester, performance liquid chromatography of amino acids, gas chro- Manchester, United Kingdom matography, mass spectrometry, tandem mass spectrometry, 13Hospital de Ninõs de Cordoba, Cordoba, Argentina molecular genetics, and cytogenetics. Results: Among 52 14Great Ormond Street Hospital, London, United Kingdom 077 primarily examined patients (2000-2013), we found 263 15Academic Medical Center, Amsterdam, the Netherlands (0.5%) with clinical and biochemical signs of involvement in 16BioMarin Pharmaceutical Inc, Novato, CA, USA the pathological process of MPS. Only 6 (2.28%) of 263 had Introduction: The Morquio A Clinical Assessment Program syndromic forms, including phenotypic syntropy phenomenon. (MorCAP) is a multicenter, multinational, longitudinal natural Three patients had MPS-II (Hunter syndrome), with absence of history study designed to describe the spectrum and progression iduronate sulfatase activity against the background of methyl- of symptoms in Morquio A syndrome (mucopolysaccharidosis enetetrahydrofolate reductase (MTHFR) 677CT polymorphism IVA [MPS-IVA]) without disease-modifying treatment. Base- (‘‘risk allele’’). One patient had MPS-IVB (Morquio syndrome line data revealed substantial impairment in multiple domains B) with an abrupt reduction in b-galactosidase enzyme activity including endurance and respiratory function (Harmatz et al, (5 nmol/mg/h [reference values 8-240 nmol/mg/h]; Dr BJHM Abstracts 15

Poorthuis) against the background of methionine synthase therapy (ERT) patients showed statistically lower %FM than reductase (MTRR) 66GG polymorphism (‘‘risk allele’’ of that of the group without ERT, suggesting a possible treatment cobalamin deficiency), hypertaurinemia, and hypohomocystei- effect on body fat accumulation. Conclusion: We believe it is nemia. We found that 1 patient had the combination of MPS- very relevant to nutritional monitoring management of patients like phenotype with Ehlers-Danlos syndrome: coarse facial with MPS, aiming to adapt the nutritional parameters. Addi- features, a disproportionate body, keeled chest deformity, tional studies with larger samples should be conducted in an kyphoscoliotic spinal deformity, wing-like scapulas, a high attempt to confirm this hypothesis. skin extensibility, its softness, velvet, hypotonia, hypermobility of joints, varicose veins, and swelling of the lower extremities. Echographical examination revealed hepatosplenomegaly, 1061 - Gastrointestinal Manifestations in metabolic, dysplastic renal changes, mitral valve prolapse, and Patients With Mucopolysaccharidoses an additional chord of the left ventricle. Oxyproline 155.4 mg/d 1 2 increased urinary glycosaminoglycans up to 148 CPC U/g Luciana Giugliani , Carolina FM Souza , Sandra MV 3 4 4 creatinine, hyperprolinemia, hyperglycinemia, hyperpolinuria, Vieira , Guilherme Baldo , Ursula Matte , Rafael L. hyperhomocysteinemia—26.6 mmol/L. Probands mother Maurer4, Lucia M. Kliemann5, and Roberto Giugliani6 M—disproportionate body, coarse facial features, kyphoscolio- 1PhD in Program in Child and Adolescent Health, UFRGS, Porto tic spinal deformity, a soft, doughy, hyperelastic skin, hyper- Alegre, Brazil mobility of joints, varicose veins, and lymphatic edema of 2Serviço de Genetica´ Medica,´ HCPA, Porto Alegre, Brazil the lower extremities. In 1 patient, the combination of MPS- 3Laborato´rio Experimental de Gastroenterologia e Hepatologia, like phenotype with 45,X/46,XX genotype, mtDNA poly- HCPA, Porto Alegre, Brazil morphism (8697GA, 8860G, tRNA-lysine), with MTHFR 4Centro de Terapia Genica,ˆ HCPA, Porto Alegre, Brazil 677T T ‘‘risk alleles’’, increase in chondroitin-4-sulfate, 5Departamento de Patologia, FAMED, UFRGS, Porto Alegre, Brazil chondroitin-6-sulfate levels. Conclusion: Revealing clinical 6Departamento de Genetica,´ IB, UFRGS, Porto Alegre, Brazil polymorphism of MPS allowed individualizing treatment and rehabilitation of patients. Objective: To assess gastrointestinal manifestations in patients with mucopolysaccharidosis (MPS) and bowel mucosa histology in a MPS-I mouse model. Methods: Cross-sectional study 1058 - Body Fat Assessment by Bioelectrical with a convenience sampling strategy, including patients with Impedance in Patients With a diagnosis of MPS of any type and regardless of enzyme Mucopolysaccharidoses replacement therapy (ERT) status. Patients were assessed by means of a dietary record and an interview focused on gastro- 1 2 Luciana Giugliani , Carolina FM Souza , and Roberto intestinal symptoms and also by a set of laboratory tests. DNA Giugliani3 samples of patients were also tested for primary lactase hypo- lactasia, and bowel mucosa specimens from MPS-I mice 1PhD in Program in Child and Adolescent Health, UFRGS, Porto underwent histological examination. Results: A total of 27 Alegre, Brazil patients were included, with a median age of 12 (1-28) years. 2Medical Genetics Service, HCPA, Porto Alegre, Brazil The most prevalent gastrointestinal symptoms were flatu- 3Department of Genetics, UFRGS, Porto Alegre, Brazil lence, abdominal distension, abdominal pain, and loose Objective: To evaluate the nutritional status of patients with stools. A significant difference in the prevalence of flatulence mucopolysaccharidosis (MPS) seen in a specialized outpatient was observed among different MPS types (P ¼ .004). The pre- clinic, by means of body composition assessment by bioelectri- valence of flatulence and abdominal distension was signifi- cal impedance (BIA). Methods: A cross-sectional study with a cantly higher in the non-ERT group than in the ERT group convenience sampling. Inclusion criteria were confirmed diag- (P ¼ .04 and .03, respectively). Most biochemical tests per- nosis of MPS, patient with 10 years of age, and the presence formed to workup and/or rule out specific conditions were of conditions appropriate for the performance of the examina- within normal limits. Histological analysis of small-bowel tis- tions. Patients were evaluated by means of anthropometrics, sue from MPS-I mice found increased cell volume indicative and body composition parameters were provided by BIA. of some form of intracellular accumulation. On molecular Results: A total of 13 patients enrolled, 7 (53.8%) females and testing for lactase deficiency, 58.8% of the patients had the 6 (46.2%) males, with a median age of 22 (12-28) and 15 (10- CC genotype, which is consistent with lactose intolerance. 19) years, respectively. Regarding nutritional status, 5 (38.4%) Conclusion: Ourresultssuggestthatgastrointestinal manifes- were eutrophic, 4 (30.8%) were overweight, and 4 (30.8%) tations are frequent across most MPS types, and ERT plays a were obese. There was no statistical difference in the percent- role in treating them. The findings of bowel histology analysis age of fat-free-mass and fat mass (FM) when compared to dif- intheMPSmousemodelareconsistentwithcellularabnorm- ferent types of MPS. However, it was noted that patients with alities contributing to these manifestations. Further studies MPS-IVA presented with a greater tendency in %FM in rela- focusing on the gastrointestinal manifestations of MPS are tion to the other MPS types studied. Enzymatic replacement warranted to corroborate our findings and provide a better 16 Journal of Inborn Errors of Metabolism & Screening understanding of the pathophysiological mechanisms associ- degrade glycosaminoglycans (GAGs). Recurrent respiratory ated with these symptoms in affected patients. infections, sleep disturbances, and upper and lower airway obstruction are frequently reported in patients with MPS. How- ever, cellular accumulation of GAG fragments leading to pro- 1073 - Prevalence of Obstructive Sleep Apnea gressive multisystem manifestations can clutter homeostasis, in Children With Mucopolysaccharidosis in also modify the function of other cellular components, their Sao Paulo, Brazil signals, and produce substances. Objectives: To immunologi- cally evaluate patients with MPS to clarify why they are prone Ana Maria Martins1, Gustavo A. Moreira2, Sandra O. to infections. Methods: Eighteen patients with MPS (mean age Kyosen1, Camilla L. Patti1, Carmen S. C. Mendes1, Maret ¼ 13-year-old, from 5 to 32 years) in enzyme replacement ther- H. Rand1, Patrıćia Feliciano1, Carolina S. Aranda1,Vaˆnia apy (ERT), 88% male, were evaluated (type I ¼ 5, type II ¼ 9, 1 2 and type VI ¼ 4) by measurement of complete blood count and D’Almeida , and Sergio Tufik quantitative/qualitative serum immunoglobulins (Ig; IgG, IgM, 1Centro de Erros Inatos do Metabolismo, Universidade Federal de and IgA) and review of their immunization schedules (Bacillus Saõ Paulo, Brazil Calmette-Guérin [BCG], hepatitis B, and rubella). Results: All 2Instituto do Sono, Sao Paulo, Brazil patients had previous history of wheezing and pneumonia, with significant improvement in symptoms after initiation of ERT. Introduction: Prevalence of respiratory problems is still Only 1 patient had iron deficiency anemia. Two patients had unclear in patients with mucopolysaccharidosis (MPS), and neutrophils lower than expected, and all patients had adequate studies have reported the importance of screening patients with number of lymphocytes. All patients were vaccinated for BCG; MPS for obstructive sleep apnea (OSA). We aimed to verify the however, 1 patient had lymph node tuberculosis. Only 1 patient OSA prevalence in patients with MPS, based on the first poly- had IgG serum levels lower than third percentile. Three patients somnography. Methods: A retrospective study of data from the had IgM levels lower than third percentile. Regarding the qua- medical files of patients with MPS at the Centro de Referência litative evaluation of Igs, 1 (5.5%) patient showed no response em Erros Inatos do Metabolismo was conducted. Results: Data to rubella vaccine and 10 (55%) patients showed no response to from 46 patients (17 MPS-I, 16 MPS-II, and 13 MPS-VI), 12 hepatitis B vaccine, despite complete vaccination schedule. females and 34 males, with mean age of 4.6 years (range: Conclusion: The immunological evaluation of patients with 2.7-8.3), median age (months) of disease onset of 12 for MPS is mandatory, especially for the high frequency of respira- MPS-I and 18 for MPS-II and –VI, were used. Diagnosis was tory infections presented by them. More studies on humoral established 58.4, 44, and 57 months after the initial manifesta- and innate immunities are needed to understand the disease and tion of MPS-I, -II, and -VI, respectively. The patients had improve the treatment of these complications. Conflicts of underwent surgeries (mainly adenoidectomy and/or tonsillect- interest: Vania D’Almeida: Grants from BioMarin, Genzyme omy) before the diagnosis, 23% of MPS-I and 50% and and Shire as a speaker, advisory board and scientific consultant 53.8% of MPS-II and -VI, respectively. Parents reported snor- Ana Maria Martins: Grants from BioMarin, Genzyme and ing in 35.3%, 31.3%, and 30.8% of patients with MPS-I, -II, Shire as a speaker, advisory board and scientific consultant. and -VI, respectively; however, the OSA was prevalent in 76.5%, 56.3%, and 53.8% of patients with MPS-I, -II, and -VI, respectively. Conclusion: These results highlight 1075 - Mucopolysaccharidosis I Diagnostic the importance of screening children with MPS for OSA using Dilemma: Results From Global Patients’ polysomnography, irrespective of MPS type and previous complaints of snoring. Financial support: IGEIM, Shire, and and Physicians’ Surveys BioMarin. Christine Lavery1, Rebecca Gould2, and Erin Wilkie3 1Society for Mucopolysaccharide Diseases, Amersham, United 1074 - Immunological Evaluation of Patients Kingdom With Mucopolysaccharidosis 2Fulcrum Research Group, Waltham, MA, USA 3Genzyme, a Sanofi company, Cambridge, MA, USA Carolina S. Aranda1, Dirceu Sole´1, Patrıćia Feliciano1, Objectives: To improve and optimize patient identification for Carmen S.C. Mendes1, Maret H. Rand1, Sandra O. 1 1 1 mucopolysaccharidosis I (MPS-I) through better understanding Kyosen , Marco A. Curiati , Sueli Canossa , Viviani of the diagnostic journey. To explore and map the diagnostic 1 1 1 Tiozzo , Marcia C. Mallozi , Beatriz T. Costa-Carvalho , journey and leverage this understanding to inform targeted Vaˆnia D’Almeida1, and Ana Maria Martins1 physician education. Methods: Physician surveys: completed in 2012 to 2014; 210 rheumatologists and 372 pediatricians 1Universidade Federal de Sao Paulo, Saõ Paulo, Brazil in the United States, Canada, Brazil, Mexico, Italy, Germany, Introduction: Mucopolysaccharidosis is a group of metabolic France, the United Kingdom, the Netherlands, and Belgium. diseases caused by the deficiency of lysosomal enzymes that Physicians were asked to provide their suspected diagnoses and Abstracts 17 anticipated next steps for 2 unidentified cases of MPS-I (pedia- had hyperintense signal. The 5 patients with MPS-II had stenosis tric and adult). Patient surveys: completed in 2009 to 2013; 168 of the craniovertebral junction with normal cord signal on MRI. caregivers/patients with MPS-I in the United States, the United All the 7 patients with MPS-IV presented craniocervical stenosis Kingdom, France, Germany, Spain, Mexico, Argentina, Brazil, with spinal cord hyperintense signal. Among the 8 patients with Colombia, and Venezuela. Assessed diagnostic journeys of MPS-VIA evaluated, 6 had stenosis with hyperintense signal, 1 patients with MPS-I. Results: Results varied by region, speci- showed craniocervical stenosis, and 1 had normal MRI. In alty, and MPS phenotype. At a global level, patients most com- patients with multiple MRIs, we observed that without interven- monly received their diagnosis from a geneticist or a metabolic tion in the craniocervical stenosis, most cases evolved to hyper- disease specialist; more than 50% of patients saw at least 2 intense signal, denoting spinal cord suffering. Besides spinal other types of physicians prior to being referred to the diagnos- cord MRI, we performed neurophysiological assessments in ing physician. Patient surveys indicated delays of 0.5 to 8 years order to analyze the integrity of nerve transmission. All patients between symptom presentation and diagnosis. Only 9% of phy- showed motor and sensory conduction involvement in varying sicians included MPS in their differential; most commonly sus- degrees, suggesting that medullar impairment begins before the pected diagnosis was rheumatoid arthritis (29% of surveyed image change. Since both quality of life and life expectancy have physicians). Approximately 75% of pediatricians referred the improved after ERT, SCC in MPS will be a challenge in the patients to a rheumatologist or a pediatric rheumatologist. Only long-term management of these diseases. Thus, it becomes 23% of physicians referred to a geneticist or a metabolic dis- imperative to redefine the diagnostic criteria and optimal timing ease specialist. Only 19% of surveyed physicians chose a test for intervention. Support: BioMarin, Genzyme, and Shire. likely to lead to MPS diagnosis. After reviewing educational Conflicts of interest: Continuing medical education provided information about MPS, the percentage of physicians willing by BioMarin, Genzyme, and Shire. to test a current patient for MPS increased >30% points. Conclusion: Mucopolysaccharidosis I is underrecognized; affected individuals visit numerous specialists before being 1093 - Morquio A Syndrome: Diagnosis and correctly diagnosed. There is a strong interest from the physi- Current and Future Therapies cian community to learn more about MPS-I. Earlier detection may be improved through targeted differential diagnosis edu- Shunji Tomatsu1, Tsutomu Shimada1, Eriko Yasuda1, cation to encourage prompt diagnosis. This study was sup- Pravin Patel1, Tsutomu Shimada1, William G. ported by Genzyme, a Sanofi company. Conflicts of Mackenzie1, Robert W. Mason1, Mihir M. Thacker1, interest: Erin Wilkie is an employee of Genzyme, a Sanofi 1 2 company. Mary Theroux , Adriana M. Montanõ , Carlos J. Almeciga-Dı´ áz2, Luis A. Barrera2, Yasuyuki Suzuki3, and Tadao Orii3 1077 - Evaluation of Spinal Cord 1 Compression in Mucopolysaccharidosis Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, USA 1 1 2Saint Louis University, St Louis, MO, USA Anneliese Lopes Barth , Ana Carolina Esposito , Daniel 3 de Souza e Silva1, Alessandra Augusta Penna e Costa1, Gifu University, Gifu, Japan and Anna Patricia Riello2 Introduction: Morquio A syndrome is an autosomal recessive disorder, 1 of 50 lysosomal storage diseases, and is caused by 1IFF/FIOCRUZ, Rio de Janeiro, Brazil the deficiency of N-acetylgalactosamine-6-sulfate sulfatase. 2Rede Labs Dor, Rio de Janeiro, Brazil Deficiency of this enzyme causes specific glycosaminoglycan Spinal cord compression (SCC) is a known complication of accumulation: keratan sulfate and chondroitin-6-sulfate. The mucopolysaccharidosis (MPS) and is expected to occur in the majority of KS is produced in the cartilage; therefore, the unde- natural history of the disease, regardless of enzyme replacement graded substrates accumulate mainly in cartilage and in its therapy (ERT), as intravenous enzyme does not cross the blood– extracellular matrix (ECM), causing direct leads to direct brain barrier. Because magnetic resonance image (MRI) demon- impact on cartilage and bone development and leading to the strates the spinal cord and canal directly, it is the mostly used resultant systemic skeletal spondyloepiphyseal dysplasia. technique in diagnosing spinal stenosis and compression. Cra- Method: In this presentation, screening, diagnosis, pathogen- niovertebral junction stenosis indicates cord compression, esis, and current and future therapies of Morquio A are dis- although some authors consider the medullar hyperintense signal cussed from the past articles. Results: Chondrogenesis, the as the true statement of this diagnosis. The onset of SCC is cur- earliest phase of skeletal formation that leads to cartilage and rently unknown, since most patients do not undergo routine ima- bone formation, is controlled by cellular interactions with the ging until symptoms or signs of neurological compromise ECM, growth and differentiation factors, and other molecules develop. In order to diagnose SCC, we evaluated 23 patients that affect signaling pathways and transcription factors in a with different types of MPS at distinct times of their disease. All temporal–spatial manner. In patients with Morquio A, in early 3 patients with MPS-I showed craniocervical stenosis, while 2 childhood or even at birth, the cartilage is disrupted presumably 18 Journal of Inborn Errors of Metabolism & Screening as a result of abnormal chondrogenesis and/or endochondral 1Department of Pediatrics, Center for Lysosomal and Metabolic ossification. The unique clinical features are characterized by Diseases, ErasmusMC-Sophia Children’s Hospital, ErasmusMC- a marked short stature, odontoid hypoplasia, protrusion of the Sophia Children’s Hospital, Rotterdam, the Netherlands chest, kyphoscoliosis, platyspondyly, coxa valga, abnormal 2Department of Pediatrics Orthopedics, ErasmusMC-Sophia Chil- gait, and laxity of joints. In spite of many descriptions of the dren’s Hospital, Rotterdam, the Netherlands unique clinical manifestations, diagnosis delay still occurs. 3Department of Pediatrics, Division of Radiology, ErasmusMC- Conclusion: The pathogenesis of systemic skeletal dysplasia Sophia Children’s Hospital, Rotterdam, the Netherlands in Morquio A syndrome remains an enigmatic challenge. 4Department Clinical Genetics, Center for Lysosomal and Metabolic Diseases, ErasmusMC University, Rotterdam, the Netherlands 5Department of Child Neurology, Center for Lysosomal and 1095 - Growth Charts for Patients With Metabolic Diseases, ErasmusMC-Sophia Children’s Hospital, Hunter Syndrome Rotterdam, Netherlands Introduction: Mucopolysaccharidosis type VI (MPS-VI) is Shunji Tomatsu1, Pravin Patel1, Yasuyuki Suzuki2, Eriko 1 1 2 caused by the deficiency of N-acetyl galactosamine 4-sulfatase Yasuda , Tsutomu Shimada , Kenji E Orii , and Tadao leading to intralysosomal accumulation of the glycosami- 2 Orii noglycans dermatan and chondroitin 4-sulfate in connective 1Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, tissue, cartilage, and bone. Dysostosis multiplex, joint con- USA tractures, and debilitating hip problems are characteristic 2 Gifu University, Gifu, Japan features. Enzyme replacement therapy (ERT) is effective, but hip problems appear relatively resistant to therapy. We pro- Introduction: Children with mucopolysaccharidosis II (MPS- spectively studied hip pathology in MPS-VI to create a better II), also known as Hunter syndrome, an X-linked disorder, have understanding of mechanisms involved. Methods: We stud- a multisystem dysfunction caused by the accumulation of gly- ied pathological features of the pelvis and femoral head by cosaminoglycans. However, there has been no systemic report x-ray and magnetic resonance imaging (MRI) over time in on the growth of patients with MPS. Method: The purpose of 11 patients (ranged 2.2 until 18.2 years) receiving ERT. this study is to describe the growth patterns of patients with Results: The shape of the pelvis appeared abnormal in the MPS-II and to compare with the patterns of age-matched con- youngest patients with flaring of the iliac bone, hypoplasia trols. Data (height, weight, age, etc) were collected in a long- of basilar portion of the ilium, and dysplasia of the acetabu- itudinal study of Japanese male patients with MPS-II (n ¼ lum as the most prominent features. Over time sufficient cov- 111). Results: The mean birth length was 50.31 + 1.42 cm, erage of the femoral head was maintained by disposition of while the mean birth weight was 3.35 + 0.39 kg. The mean cartilage at the lateral site of the acetabulum (shown on MRI). final height and weight at 18 years and older were 125.63 + Eventually, a neoacetabulum was formed. In none of the 9.09 cm and 37.18 + 8.72 kg, respectively, corresponding to patients subluxation of the hips was observed. The femoral a lower difference of 46.40 cm and 25.89 kg, when com- head appeared normal (x-ray and MRI) at young age, but gra- pared with healthy Japanese male controls. The mean birth dually the shape of the epiphysis started to change with 2 body mass index (BMI) was 10.84 + 3.29 kg/m , while the increasing age. Avascular necrosis developed at the medial 2 mean BMI at 18 years was 29.41 + 6.15 kg/m . The growth site. Eventually, a coxa magnum was formed. Arthrosis of the pattern in patients with MPS-II was characterized by over- femoral head was observed with cysts, abnormal formation of growth for the first several years, although growth velocity fell cartilage and bone as specific hallmarks. The cartilage cover- below that of the normal healthy controls after 1 year of age. ing the femoral head (MRI) remained normally present. In the There was no statistical difference in growth between patients eldest and in 1 severely affected patient with MPS-VI, the with the attenuated and severe phenotypes from birth until 8 angle of inclination of the femur had changed to varus posi- years of age. Conclusion: This report describes the natural his- tion. Conclusion: Our study shows that patients with MPS- tory of growth in patients with MPS-II, which can help in mon- VIdevelophippathologyatveryyoungagestartingwiththe itoring the progression of the disease as well as assessing pelvis affected first and later also the femoral head. Hip therapeutic efficacy. pathology could not be prevented by early start of ERT.

1103 - The Emerging Deformation of the 1106 - Exploratory Analysis of Growth Plate Pelvis and Femoral Head in Patients With Mechanical Environment During Bone Mucopolysaccharidosis VI Development: A Computational Model

Esmee Oussoren1, Gert J. H. J. M. Bessems2, Iris Plug1, Johana M. Guevara1, Miguel A. Moncayo2, Juan J. Vaca2, Annick S. Devos3, George J. G. Ruijter4, Hannerieke J. M. Maria L. Gutierrez2, Luis A. Barrera1, and Diego A. P. van den Hout5, and Ans T. van der Ploeg1 Garzo´n2 Abstracts 19

1Institute for the Study of Inborn Errors of Metabolism, Pontificia Objectives: To assess mucopolysaccharidosis IVA (MPS- Universidad Javeriana, Bogota´, Colombia IVA) burden among adult and child patients in Brazil and 2Numerical Methods and Modeling Research Group (GNUM), Colombia. Methods: A patient-reported outcome survey was Universidad Nacional de Colombia, Bogota´, Colombia undertaken in Brazil and Columbia as part of a globally conducted survey (United Kingdom, Turkey, Spain, and Germany) Introduction: Mechanical stimuli play a significant role in the assessing MPS-IVA burden among adults (18 years,) and normal process of long bone development as evidenced by clin- children (5-17 years). The survey assessed disease impact on ical observations and in vivo studies. Such stimuli may also mobility, pain, fatigue, and quality of life (QoL). It was admi- play an important role in the progression of several genetic nistered in person (Colombia) or by mail (Brazil) with assis- chondrodysplasias as those developed in mucopolysaccharido- tance by patient associations. The QoL assessments was done sis. Up to now, approaches to understand stimuli characteristics using EQ-5D-5 L and converted to index scores using UK have been limited to the first stages of epiphyseal development. crosswalk (ranging from 0.654 to 1.000). Pain was assessed Furthermore, knowledge about mechanical behavior in the using Brief Pain Inventory Short Form (BPI-SF) in adults and growth plate, mainly responsible for longitudinal bone growth, Adolescent Pediatric Pain Tool (APPT) in children. Fatigue is scarce. Objectives: To study stress distribution on epiphysis was assessed by determining the number of evenings patients and growth plate during different stages of normal bone devel- felt very tired. Results: Results were from 25 patients (8 adults opment, from gestation to adolescence, as a first approach to and 17 children); 76.5% (13 of 17) of children and 62.5% (5 of understand mechanical influences in normal and pathological 8) of adults had joint pain. Mobility was impaired; 41.2% (7 of states. Methods: A finite element analysis of mechanical stress 17) of children and 62.5% (5 of 8) of adults used wheelchairs or distribution within growth plate was performed using an axi- walking aids. The BPI-SF and APPT results showed patients symmetric (3-dimensional) model of a generic epiphyseal geo- always using wheelchairs had less pain but greater pain inter- metry. A possible correspondence between stress patterns ference than those using only when needed. In all, 70.6% (12 found and morphological characteristics of the growth plate of 17) of children and 50.0% (4 of 8) of adults reported fatigue. was explored. Different growth plate locations, morphologies, Increased mobility among wheelchair users was associated and widths as well as different epiphyseal developmental with more fatigue. Actively mobile patients had significantly stages were simulated. Results: Results showed that stress dis- better QoL, with index scores of 0.884 for adults not using tribution during bone development established patterns that wheelchairs, 0.386 for those using only when needed, and may influence growth of local epiphyseal structures and coin- 0.328 for patients always using wheelchairs; scores were cide with histological arrangement of growth plate. Further- 0.495, 0.674, and 0.180, respectively, in children. Decreased more, our results suggest that mechanical stimuli may play mobility, self-care, and daily activities had greatest impact on different regulation roles in growth plate behavior through nor- QoL. Conclusion: Patients with MPS-IVA less reliant on mal long bone development. Conclusion: The model used wheelchairs or not using wheelchairs experience more pain and revealed important information related to epiphyseal and fatigue but have better QoL than less mobile patients. Improve- growth plate stress distribution and the ossification process. ment in mobility, pain, and fatigue reduction and functional Results from our study may be useful for understanding general capacity can improve QoL in patients with MPS-IVA. Results mechanisms underlying mechanical influence on bone devel- from Brazilian and Colombian patients are similar to the global opment, in particular to formulate hypotheses regarding bone population results, indicating similar disease manifestations. pathologies resulting from genetic or acquired conditions. Fur- Conflicts of interest: Roberto Giugliani received consulting ther work is needed to consider factors such as epiphyseal fees and several speaker honoraria fees from BioMarin; inves- shape, loading conditions, and growth plate morphology in spe- tigator in several research projects and clinical trials sponsored cific bones. by BioMarin. Martha Solano, Regina Garcia Prospero, and Luz Victoria Salzaar have no conflict of interest. Mohit Jain is a 1113 - The Impact of Morquio A Syndrome paid employee and holder of stocks of BioMarin Europe Ltd. (Mucopolysaccharidosis IVA) Among Patients in Colombia and Brazil 1129 - Ultrasound Examination Reveals Roberto Giugliani1, Martha Solano2, Regina Garcia Typical Alterations in Joints of Patients With Prospero3, Luz Victoria Salazar4, and Mohit Jain5 Morquio (Mucopolysaccharidosis IV) and Other Mucopolysaccharidosis 1Medical Genetics Service, HCPA, Department of Genetics, UFRGS, and INAGEMP, Porto Alegre, Brazil 1 1 2 2 Nesrin Karabul , Michael Beck , Alexander So´lyom , Fundacio´n Cardioinfantil, Colombia 1 1 3Allianca Brasil de Mucopolissacaridoses (APMPS), Brazil Eugen Mengel , and Christina Lampe 4Asociacio´n Colombiana de Pacientes con Enfermedades de 1Villa Metabolica, Children’s Hospital, University of Mainz, Germany Depo´sito Lisosomal, Colombia 2Pediatric Rheumatology, Pediatric Hospital, University of Pecs,´ 5BioMarin Europe Limited, San Rafael, CA, USA Hungary 20 Journal of Inborn Errors of Metabolism & Screening

Introduction: One of the main features of several mucopoly- interventions, prevalence and timing of ENT surgery for saccharidoses (MPSs) is bone damage and remodeling, along MPS-I, -II, and -VI (treatable MPS disorders). Results: The with synovial thickening, clinically manifested as coarse median ages at diagnosis of MPS-I, -II, and -VI are 2.6, 3.3, and facies, thickened and widened bones on x-rays, and joint con- 5 years, respectively. In MPS-II, the incidence of ventilation tractures of varying severities. These signs and symptoms can tubes is 40% to 100% and upper airway obstruction 48% to be the presenting features of the disease and lead to clinical 100%, with corresponding incidences for MPS-I, 23% to diagnosis when properly interpreted. The aversion to unneces- 86% and 18% to 100%, and for MPS-VI, 66% to 100% and sary exposure of patients to radiation and the question of which 45% to 85% (ranges represent lowest and highest values cur- bones to examine by x-ray are considerable issues. Patients rently described in the literature), respectively. Adenotonsillar with MPS are additionally at a much higher risk of severe surgery and ventilation tubes are common interventions in sequelae from anesthesia, making magnetic resonance imaging early childhood that may precede diagnosis of MPS. Conclu- examination more difficult. Therefore, the question of the best sion: The ENT surgeons could assist in early diagnosis of MPS. method by which to measure bone and joint involvement and The HATT project—MPS-I, -II, and -VI Screening in a High progression in patients with established disease is a difficult Risk Population With Previous Surgical Repair or Presence one. Methods: We used ultrasound to examine patients with of Inguinal and/or Umbilical [H]ernia in Combination With MPS having joint disease, comparing the results to those typi- Pediatric Ear, Nose and Throat Surgery ([A]denoidectomy cally found in inflammatory arthritis. The changes we have and/or [T]onsillectomy and/or [T]ympanostomy)—will evalu- found in patients with MPS-IV are illustrated by a representa- ate a history of ENT surgery, combined with common early dis- tive case report. We present documentation of ultrasound ease manifestations, as a strategy to promote early MPS changes in patients with MPS, which might be useful to speed diagnosis and management. This project will be discussed, with the diagnosis of disease and serve as a readily available and an invitation to join the international multicenter study. Con- harmless tool for monitoring of changes in the bones and joints flicts of interest: Dr Bruce has received a travel grant and hon- of patients. We also propose a basic scoring system for quanti- orarium payable to the ‘Paediatric ENT Research Fund’ at the fication of such changes. Results: From our observations, it Royal Manchester Children’s Hospital to give an invited lec- appears that there are certain specific changes in the bones and ture by Shire. Dr Jones has received honoraria, travel grants, joints of patients with MPS apparent on ultrasound examina- or research grants from Shire. Dr Molter is an investigator in tion. Conclusion: Ultrasound is a useful and convenient the HATT project and is a consultant for publication review method for documenting and following bone and joint disease and planning for Shire. He is also an educational lecturer for in patients with MPS. We have proposed a preliminary scoring BioMarin. Drs Wille and Man are employees of Shire. system to follow bone and joint involvement in MPS and will explore the clinical correlations further. 1136 - Mucopolysaccharidoses IIIA and IIIB: 1133 – Ear, Nose, and Throat Disease and the A Preliminary Comparison of Disease Early Diagnosis of Mucopolysaccharidoses: Trajectory Using Baseline Data From 2 The HATT Project Independent Natural History Studies 1 1 2 Simon A. Jones1, Iain A. Bruce2, Micheline Wille3, Kristina Kathleen Delaney , Chester Whitley , Maureen Cleary , 3 3 Hayley Bullock2, Laila Arash3, and Eugen Mengel3, Man , and David Molter 3 4 1 Miriam Hartmann , Paul Harmatz , Nicolle Napier- The Willink Biochemical Genetics Unit, St Mary’s Hospital, 4 5 5 1 Manchester, United Kingdom Ionascu , Nitin Nair , Patrick Haslett , and Elsa Shapiro 2Paediatric ENT Department, Royal Manchester Children’s Hospital, 1University of Minnesota, Minneapolis, MN, USA Manchester, United Kingdom 2 Great Ormond Street Hospital for Sick Children, London, United 3Shire, Eysins, Switzerland Kingdom 4Department of Otolaryngology, Washington University School of 3Villa Metabolica, Center for Pediatric and Adolescent Medicine, MC Medicine, St Louis, MO, USA University of Mainz, Germany 4Children’s Hospital Oakland, Oakland, CA, USA Introduction: Mucopolysaccharidoses (MPSs) are rare meta- 5 Shire, Lexington, MA, USA bolic diseases resulting from deficiencies of specific lysosomal enzymes. Progressive upper airway obstruction and hearing Introduction: Mucopolysaccharidosis III (MPS-III) A and B loss are associated with several types, including MPS-I, -II, and are progressive neurodegenerative diseases. Utilizing baseline -VI. The aim of this project is to evaluate ear, nose, and throat data from natural history studies of MPS-IIIA (NCT01047306) (ENT) interventions combined with other early disease mani- and MPS-IIIB (NCT01509768), the cognitive, adaptive festations as a strategy to promote early diagnosis of MPS. behavioral, and motor functions of patients were compared. Methods: A systematic literature review was undertaken to Methods: Assessments used Vineland Adaptive Behavior determine median age at diagnosis, incidence of ENT Scales (VABS-II) for adaptive behavioral function and Bayley Abstracts 21

Scales of Infant and Toddler Development (BSID-III) or Kauf- 1Centro de Referencia em Erros Inatos do Metabolismo- man Assessment Battery for Children (KABC-II) for cognitive Universidade Federal de Sao Paulo, Sao-Paulo, Brazil function. Data were expressed as age equivalents (AEq) and Introduction: Mucopolysaccharidoses (MPSs) are a heteroge- developmental quotients (DQ ¼ AEq/chronological age neous group of disorders caused by reduced degradation of one 100). Results: Twenty-five patients with MPS-IIIA and 18 or more glycosaminoglycans. The MPS disorders are charac- patients with MPS-IIIB were enrolled. Mean (standard devia- terized by auditory, visual, musculoskeletal, cardiovascular tion) age was 75 (+11) months and 148 (+26) months for and stomatognathic system, abnormal chewing, and swallow- MPS-IIIA and MPS-IIIB, respectively. Both cohorts included ing. Objective: To identify characteristics of the organs’ pho- approximately 60% of male, and approximately 80% of the noarticulatory muscles and functions such as swallowing, patients were diagnosed before 6 years of age, a surrogate for speech, voice, language, and hearing. Methods: We evaluated the ‘‘classic,’’ most severe phenotype. Plots of AEq and DQ 46 patients with MPS-I, -II, and -VI at Centro de Referˆencia em versus age for adaptive behavior and cognitive status revealed Erros Inatos do Metabolismo -Universidade Federal de Sao overlap in the distributions for MPS-IIIA and IIIB. There was a Paulo, MPS-I: 20 patients (12 males and 8 females), MPS-II: strong, significant, correlation between cognitive AEq (BSID- 16 patients (15 males and 1 female), and MPS-VI 10 patients III or KABC-II) and adaptive behavioral function (VABS-II) (7 males and 3 females), all patients receiving enzyme replace- for both disease groups (r ¼ .95 [MPS-IIIA]; r ¼ .83 [MPS- ment therapy. They were assessed using the protocol for the IIIB]), indicating concurrent validity of these measures in both phoniatrics evaluation that seeks to recognize the structure and diseases. Correlation coefficient between the groups was simi- function of the stomatognathic system. Food were used for eva- lar in both magnitude and direction. Age differences between luation of swallowing and considering evaluation of voice, the populations with MPS-IIIA and MPS-IIIB and the small speech, and language the spontaneous talk was used. This number of patients limit the scope of this analysis. Also, the instrument was chosen due to the difficulty in expression of lack of patients with MPS-IIIB <5 years means this critical these children. Results: All patients had at least 1 change in early period of disease progression cannot be compared. each of the items cited: difficulty in swallowing (39.6%), Conclusion: This cross-sectional analysis suggests that rates change in points articulation of speech sounds (67.4%), voice of cognitive decline are comparable in older patients with and tense hypernasality (60.9%), and difficulties in comprehen- MPS-IIIA and MPS-IIIB. However, the lack of younger sion and expression (54.35%) and hearing impairment (67.4%). patients with MPS-IIIB precludes any definitive conclusions Conclusion: We conclude that patients with MPSs I, II, and VI about the comparability of trends in that age group. Conflicts of show the changes in posture, tone, mobility, and sensitivity of interest: These studies (NCT01047306 and NCT01509768) the organs’ phonoarticulatory muscles, beyond the functions of were funded by Shire. Ms Delaney has received consulting fees swallowing, speech, and language. We proposed early inter- from Shire. Dr Whitley has received consulting fees from vention therapy, for these events showed improvement or Actelion, Biomarin, Genzyme, Pfizer, Protalix, and Shire. He remained without negative effects. has received grants from Actelion, Amicus, Biomarin, Gen- zyme, Pfizer, Protalix, and Shire. Dr Arash has received consulting fees from Shire. Dr Mengel has received consulting fees from Actelion, Biomarin, Genzyme, and Shire. He has 1154 - Alterations in Stomatognathic System performed contracted research for Actelion, Biomarin, Gen- of Patients With Mucopolysaccharidosis zyme, and Shire. Dr Harmatz has received travel, honoraria, 1 1 and consulting fees from BioMarin, Shire, and Alexion and has Maria Beatriz Cabral , Regina Wanderley Cruz , Laira undertaken contracted research for Alexion-Enobia, Bio- Renata Lemos1, and Nelson Eduardo Freitas1 Marin, FerroKin-Shire, Sanofi-Genzyme, and Shire. He has 1Universidade Federal da Bahia, Salvador, Brazil also been the recipient of educational grants from BioMarin, Sanofi-Genzyme, and Shire. Drs Nair and Haslett are Shire Introduction: According to the literature, patients with muco- employees. Dr Shapiro has received consulting fees from polysaccharidosis (MPS) present a range of facial, joint, and Armagen, Genzyme, and Shire, and grants from Genzyme, bone changes that also affect the stomatognathic system. National MPS Society, Ryan Foundation, Shire, and Team Objective: To present the changes found in the stomatognathic Sanfilippo. Ms Hartmann and Drs Cleary, Bullock, and system of 29 patients with MPS at the outpatient clinic of Med- Napier-Ionascu have nothing to declare. ical Genetics, the Federal University of Bahia (UFBA) Hospital in Salvador—BA (2011-2012). Methods: Cross-sectional study including all patients who are already monitored in the 1137 - Phonological Assessment in Patients hospital and who agreed to participate in the study. Data collection was performed in 2 stages: oral examination and standar- With Mucopolysaccharidoses I, II, and VI dized interview conducted with the mother or the child’s main 1 1 1 caretaker or with the patient himself or herself, focusing on the Cintia M. Gonc¸alves , Sueli Canossa , Marco A. Curiati , patient’s socioeconomic and behavioral variables related to 1 1 Carolina S. Aranda , and Ana Maria Martins oral health care. The study was approved by the Committee for 22 Journal of Inborn Errors of Metabolism & Screening

Ethics in Research, Faculty of Dentistry, UFBA. Results and scoliosis, and 84.61% had hip dislocation. Discussion: As pre- Discussion: Twenty-nine Brazilian patients with MPS were viously described in the literature, a higher percentage for evaluated. A general situation of late diagnosis was found, with occurrence of severe phenotype is found; additionally, the an average time for the diagnosis around 8.8 years (n ¼ 19). Of authors believe that the presence of neuro, orthopedic, and car- the respondents’ parents, 43% are farmers and all families diovascular comorbidities must be taken into account to clas- receive between 1 and 2 minimum wages per month. The most sify patients according its clinical severity. frequent findings in the stomatognathic system were macroglossia (88.5%), hypotonic lips (52%), reduced mouth opening (92.3%), ogival palate (100%), and frontal open bite (53.8%). 1167 - Patient, Therapeutic, and Metabolic Regarding caries experience, the dmft and decay missing or Predictors of Sleep Disordered Breathing filled teeth scores were low, despite the poor oral hygiene that characterized the participants. The data suggest that the clinical in Mucopolysaccharidosis I approach to these patients should be multidisciplinary, and Abhijit Ricky Pal1, Eveline J. Langereis2, Muhammad A. dentists should be aware of systemic clinical manifestations 1 3 3 3 and those affecting the stomatognathic system so that the best Saif , Jean Mercer , Karen L. Tylee , Heather J. Church , 4 2 4 treatment plan can be performed. Robert F. Wynn , Frits A. Wijberg , Iain A. Bruce , Jones Jones4, and Brian W. Bigger5 1156 - Determination of Clinical 1Department of Paediatric Otolaryngology, Royal Manchester Children’s Hospital, Manchester; United Kingdom Characteristics of Colombian Patients With 2 Morquio A Syndrome Department of Paediatric Metabolic Diseases, Emma Children’s Hospital, AMC, the Netherlands 3 Johanna C. Acosta Guio1, Sandra M. Tapiero2, Martha Willink Biochemical Genetics Unit, Genetic Medicine, St Mary’s 3 2 Hospital, Manchester, United Kingdom Solano , and Harvy M. Velasco 4Department of Haematology/BMT, Royal Manchester Children’s 1Instituto de ortopedia infantil roosevelt - instituto de nutricioń Hospital, Manchester, United Kingdom genetica´ y metabolismo, Ubosque, Bogota´, Colombia 5Stem Cell & Neurotherapies, Faculty of Medical and Human 2Maestrıá de Genetica´ Humana, Universidad Nacional de Colombia, Sciences, University of Manchester, Manchester, United Kingdom Cundinamarca, Colombia Introduction: Mucopolysaccharidosis I (MPS-I) commonly 3Fundacioń Cardio infantil, Cundinamarca, Colombia manifests with airway obstruction and sleep disordered breath- Introduction: Mucopolysaccharidosis (MPS) type IVA or ing (SDB). The success of current treatment strategies, includ- Morquio A syndrome (Online Mendelian Inheritance in Man ing hematopoietic stem cell transplantation (HSCT) for the # 253000) is an autosomal recessive disease, caused by muta- severe Hurler phenotype and enzyme replacement therapy tions in the N-acetylgalatosamine-6-sulfate-sulfatase gene, (ERT) for the attenuated Hurler-Scheie form, may be influ- generating deficiencies in the enzyme N-acetylgalactosamine- enced by a number of factors, including age at commencement 6-sulfate-sulfatase, responsible for the degradation of glycosa- of treatment and monitored using biomarkers of metabolic cor- minoglycans keratan sulfate and chondroitin 6 sulfate, leading rection. We aim to determine whether therapeutic factors and to the accumulation of these mainly in bone, cartilage, heart, biomarkers predict the severity of SDB. Methods: Therapeu- and lungs. Since MPS-IVA has a high incidence in Colombia tic, clinical, and biomarker data, including 158 sleep oximetry (0.68:100 000), the phenotypic description of a population studies, urine dermatan sulfate–chondroitin sulfate (DS–CS) sample was performed. Materials and Methods: We analyzed ratio, and leukocyte a-L-iduronidase (IDUA) enzyme level 14 patients with clinical diagnosis of MPS-IVA confirmed with post-HSCT were collected in 62 patients with MPS-I (44 Hur- enzymatic activity in leukocyte; demographic variables, ler and 18 Hurler-Scheie) between 6 months pretreatment and anthropometric variables, and clinical endophenotypes were 16 years posttreatment (mean follow-up 2.5 years). The pres- analyzed using clinical methodology proposed by Montanõ ence and functional nature of an immune response to ERT was et al. Results: Fourteen patients were analyzed from 12 unre- determined using enzyme-linked immunosorbent assay and a lated families (50% male and 50% female), with a mean age novel cellular uptake inhibition assay. Multivariate analysis of 13.2 years (confidence interval [CI] +8.5). With respect was performed to determine significant predictors of SDB. to the beginning of symptoms, 57.14% occurred between 2 and Results: Forty-one patients received HSCT, while 21 received 3 years, 28.57% between 3 and 6 months, and 14.29% between ERT alone. The incidence of SDB in our cohort is 68% with a 5 and 7 years. Among the most common symptoms, thoracic median oxygen desaturation index 4% (ODI4%) of 6.6/h. A deformity, genu valgus, disproportionate short stature, and gait higher proportion of ERT-treated patients demonstrate progres- disturbances are described. The mean age at diagnosis was 6.7 sion of SDB compared to HSCT-treated patients (73% vs 26%). years (CI +7.16). The 92.85% present severe phenotype, while The DS–CS ratio is a significant predictor for the presence, 7.15% have attenuated phenotype. Among the comorbidities of progression, and severity of SDB in patients with MPS-I severe cases, 23.07% had cord compression, 76.92% had (P ¼ .025, .0026, .016). The leukocyte IDUA level 1 year Abstracts 23 post-HSCT and age at transplant predict for the presence and 1College of Medicine Estaćio de Juazeiro-do-Norte, Estaćio-FMJ, progression of SDB in patients with Hurler syndrome (P ¼ Juazeiro do Norte, Brazil .011, .05). Cellular uptake inhibition in ERT-treated patients 2Esp., Hospital Geral of Fortleza, HGF, Fortaleza, Brazil was a significant predictor of median nocturnal oxygen satura- Introduction: The skeleton is generally one of the most tion and ODI4% (P ¼ .0007, 0.0015). Conclusion: Sleep dis- severely affected organs in patients with mucopolysaccharidosis ordered breathing continues to create a significant burden of VI (MPS-VI; Maroteaux-Lamy syndrome), causing severe mor- disease in MPS-I, despite the current therapeutic strategies. The bidity. Patients with MPS-VI typically show dysostosis multi- severity and progression of SDB may be reduced by early treat- plex. The aim of this study was to describe 3 Brazilian ment and factors that optimize metabolic correction. siblings with MPS-VI, in order to illustrate the wide spectrum of possible manifestations. Methods: Case reports of 3 siblings with MPS-VI who are receiving enzyme replacement therapy 1168 - Spinal Cord Compression in Patients (ERT) with recombinant human acetylgalactosamine 4- With Mucopolysaccharidosis VI sulfatase (ARSB; Naglazyme BioMarin Pharmaceutical Inc, 1 1 Novato, California). The initiation of treatment for each patient William O. S. Cerqueira , Ingrid L. S. Gomes , Angelina was, respectively, at 6 years and 3 months for the first patient, 2 1 1 Acosta , and Emilia K. E. A. Leaõ years and 9 months for the second patient, and 5 days of life for 1Universidade do Estado da Bahia, Salvador, Brazil the third patient. Results: At 5 years of age, the first patient presented more severe radiographic lesions than the second patient, Objective: To identify clinical signs of spinal cord compres- and ERT had not been initiated for both the patients yet. At 5 sion (SCC) in patients with mucopolysaccharidosis (MPS) VI years of age, the first patient presented radiographic lesions sug- in enzyme replacement therapy (ERT). Methodology: Obser- gestive of dysostosis multiplex, but these lesions were less vational and descriptive study of series of cases. Sample con- severe than in the second patient. The ERT was not started for sists of individuals with biochemical diagnosis of MPS-VI the 3 patients for 3 months after the start. The third patient does who attended the outpatient medical genetics service of Hospi- not present clinical manifestations for radiographic lesions, tal Universita´rio Professor Edgard Santos/Federal University of while the first and second patients who started ERT later present Bahia. Neurological clinic evaluation was realized for patients an altered walking. Cervical spine magnetic resonance imaging on ERT. Results: The study included 15 patients (53.3% from showed lesions more severe in first patient than in the second Monte Santo—Bahia). In this sample, there were 67% male, patient and did not show lesions in third patient. Conclusion: and the average age of the patients was 11 years. The average Although the third patient has started therapy early, it is not age of diagnosis was 5 years, the average age of onset of ERT known whether bone lesions resulted from no treatment for 3 was 7 years, and the average time of ERT was 4 years. Only 4 months or whether the Naglazyme dose should be adjusted to (27%) patients realized magnetic resonance imaging (MRI) ERT in the neonatal period. Despite bone lesions at 5 years in during the start of the treatment and the examinations showed the third patient, probably the discontinuation of therapy inter- stenosis of the craniovertebral junction and cervical spinal fered with the efficacy of the therapy and determined the radio- canal. Among these patients, 2 male siblings from Monte Santo graphic lesions that did not affect the quality of life. on ERT for 6 years showed the following findings: progressive limbs weakness and worsening of gait, global hyperreflexia and bilateral clonus, and Babinski sign, associated with the impor- 1175 - Obstructive Sleep Apnea Syndrome in tant thoracic lumbar spinal deformity. Both the patients and other patients from Monte Santo have the p.H178L mutation. Patients With Mucopolysaccharidosis Conclusion: Spinal cord compression is a neurological compli- Danielle de Araujo Torres1, Ana Carolina Esposito1, cation of MPS-VI, and the clinical signs are very suggestive. 1 1 The MRI contributes to the diagnosis, but only neuroimage did Anneliese Lopes Barth , and Dafne Horovitz not confirm the SCC and the detailed clinical examination is 1Instituto Nacional da Sau´de da Mulher, da Criança e do very important. The SCC can occur in people with MPS-VI Adolescente-Fernandes Figueira/ FioCruz, Rio de Janeiro, Brazil even if they are on ERT, but 1 question remains: do the ERT increase this risk of SCC? Introduction and Objectives: In patients with mucopolysaccharidosis (MPS), the macroglossia, adenotonsillar hypertrophy, and deposition of glycosaminoglycans (GAGs) on tracheobron- 1173 - Skeletal Disease of 3 Brazilian Siblings chial mucosa may lead to the development of obstructive sleep apnea syndrome (OSAS). This study aims to evaluate the pre- With Mucopolysaccharidosis VI Who valence of OSAS in a group of patients with MPS and evolu- Received Enzyme Replacement Therapy tionarily compare the severity of OSAS in those on enzyme replacement therapy (ERT). Materials and Methods: Review 1 2 Ada Maria Farias Sousa Borges , Kelnner Portela Luz , of records of 23 patients with MPS (3 type I; 6 type II; 6 type and Erlane Marques Ribeiro2 IV and 8 type VI), with age range 3 to 36 years, followed in 24 Journal of Inborn Errors of Metabolism & Screening

Instituto Fernandes Figueira/FioCruz, Rio de Janeiro, Brazil, who the mitral, aortic and tricuspid leaflets, mild regurgitation underwent polysomnography (total of 48 examinations). The mitral, aortic and tricuspid and, in control, thickening of the American Academy of Sleep Medicine (AASM) criteria for mitral leaflets and aortic, mitral regurgitation and mild aortic OSAS by age group were used. Results: Of the 23 patients, 21 ful- was observed. Increased GAG and increased slightly after. filled the diagnostic criteria for OSAS, revealing a prevalence of The ERT initiated 2 years earlier by FMP seem to have 91.3% in the group. Among the 48 examinations, 9 (18%)were allowed greater height growth than her sister, despite having normal, 12 (25%) were classified as mild OSAS, 15 (31%)as greater joint involvement. Regarding the cardiac involve- moderate, and 12 (25%) as intense. Fourteen patients, all on ERT, ment, there is also evidence of better progress than LMP. Gen- underwent more than one evaluation, which allowed an evolu- erally, ERT combined with regular clinical follow-up has tionary comparison of the OSAS severity. There was an evolu- been providing both satisfactory gains of several manifesta- tionary improvement in 5 (35%) patients, maintenance of tions of this complex disease. severity in 3 (21%) patients, and worsening in 6 (42%) patients. Discussion and Conclusion: The OSAS is often found in patients with MPS. Different treatments may be offered such as adenoton- 1181 - Prevalence of Respiratory Allergies in sillectomy or appliances using positive airway pressure (continu- Patients With Morquio A Syndrome and ous positive airway pressure /bilevel positive airway pressure), the true impact of ERT in OSAS still unknown. Due to the high Investigation of its Potential Association prevalence of OSAS in MPS, patients should systematically With Urinary Glycosaminoglycans Levels undergo sleep studies, focusing on the detection and treatment 1 1 of respiratory abnormalities. Further studies are needed to verify Clarissa T. Habekost , Luciana Giugliani , Cla´udia 1,2 1 the efficacy of ERT in OSAS associated with MPS. Vanzella ,Debora´ M. B. Pereira , and Roberto Giugliani1,2,3 1179 - Mucopolysaccharidosis Type VI: 1Hospital de Clı´nicas de Porto Alegre, Porto Alegre, Brazil Clinical Aspects of 10 Years Follow-Up of 2 2Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil 3 Sisters Accompanied in University Hospital INAGEMP, Porto Alegre, Brazil Bettina Ferro De Souza, Belem, Para, Brazil Introduction: Morquio A syndrome or mucopolysaccharidosis IVA (MPS-IVA) is a lysosomal storage disease caused by the 1 1 Isabel C. N. Souza , Raimunda H. F. Feio , and Luiz C. S. deficiency of the enzyme N-acetylgalatosamine-6-sulfate- Silva1 sulfatase, which catalyzes a step in the catabolism of glycosaminoglycans (GAGs), keratan sulfate, and chondroitin-6-sulfate. 1Universidade Federal Do Para´, Belem,´ Brazil Respiratory problems were always reported as a frequent Report of the evolution of 2 sisters with mucopolysaccharido- issue in all mucopolysaccharidoses. In addition, up to now, sis VI (MPS-VI) in enzyme replacement therapy (ERT) for 10 the chest anatomical alterations were considered the main years, at the University Hospital Bettina Ferro de Souza. LMP etiology of the respiratory findings and, to our knowledge, is of short stature aged 9 had 100 cm corneal clouding þ/4þ, there are not any reports regarding a higher frequency of hepatomegaly, and reduced joint mobility þþ/4þ.After10 respiratory allergies in patients with MPS-IVA. Objectives: years of ERT, LMP showed a growth of 22.5 cm, had main- To investigate the frequency of respiratory allergies in Brazi- tained corneal clouding, without hepatomegaly, and showed lian patients with MPS-IVA in comparison to literature data improvement in joint mobility. In the evaluation of comple- andinrelationtotheurinaryGAGs.Methods: History of mentary examinations and glycosaminoglycan (GAG) pre- allergic chronic rhinitis and chronic sinusitis and asthma was sented in the initial polysomnography, mild restrictive considered as evidence of respiratory allergies. The MPS respiratory disorder was observedandincontrolmildsnoring Brazil network has records of 135 patients with MPS-IVA, was observed. The initial echocardiogram showed thickening and we were able to evaluate 47 of those patients in regard of the mitral and aortic leaflets, mild mitral regurgitation and to their medical history and urinary GAGs. Results: Forty- in control thickening of the mitral, aortic, and tricuspid leaf- seven percent had history of respiratory allergies. Approxi- lets, left atrium enlarged with mild mitral, aortic, and tricus- mately 17% had presented with asthma and 30% with rhino pid insufficiency were observed. Increased GAG and sinusitis symptoms. The levels of urinary GAGs were not normal after. The FMP at age 7 had the same height as her sis- related to the history of respiratory allergies neither through ter, 100 cm; corneal clouding þ /4 þ, hepatomegaly, and regression analyses (P ¼ .18) nor through comparison reduced joint mobility þþ/4þ. After grown 26.5 cm, corneal between medias (P ¼ .18). Conclusion: Our results show that clouding maintained, without hepatomegaly, improves the respiratory allergies are quite frequent in the population with mobility of small joints, maintaining commitment shoulder. MPS-IVA and should be considered as an important factor of Initial polysomnography showed mild restrictive disordered respiratory symptoms in this population. However, further breathing and in control, severe obstructive disorder was studies are necessary for better understanding of the patho- observed. The initial echocardiogram showed thickening of physiological mechanisms of allergy in these patients. Abstracts 25

1182 - Neurophysiological Evaluation in 3Chefe do Serviço de Genetica´ do HUPES, Salvador, Brazil Cervical Myelopathy in Patients With Objective: To characterize the speech disorders and the stoma- Mucopolysaccharidosis: The Somatosensory tognathic system in individuals with mucopolysaccharidosis and Motor-Evoked Potentials (MPS) who attended a reference medical genetics service in the state of Bahia. Methodology: Observational and descriptive Daniel S. Silva1, Anneliese L. Barth1, Ana C. Esposito1, study of series of cases. Sample consists of individuals with Alessandra P. Costa1, Juan C. Llerena1, and Dafne DG. biochemical diagnosis of MPS who attended outpatient medi- Horovitz1 cal genetics service Hospitalar Universita´rio Professor Edgard Santos/Universidade do Estado da Bahia. Protocols were 1 Instituto Fernandes Figueira, Rio de Janeiro, Brazil applied containing evaluation of posture, morphology, mobi- Introduction: Cervical myelopathy occurs in patients with lity, and tone of the articulators and speech through the naming mucopolysaccharidosis (MPS) having different degrees of and repetition of words in the ABFW test. Result: The study functional impairment. Magnetic resonance imaging (MRI) has included 9 patients with MPS types II (1), III (2). and VI (6), been the method of choice to detect spinal cord compression. the average age was 11 years, and 8 patients are on enzyme Somatosensory-evoked potentials (SEPs) and motor-evoked replacement therapy. In the evaluation of the stomatognathic potentials (MEPs) may offer a look at physiologic anatomy and system, 68% (6 of 9) had everted lower lip, 55% (5 of 9) provide a sensitive tool for assessment of central sensory and enlarged tongue, 89% (8 of 9) high and narrow palate, and motor pathways. Methods: We present 28 patients with MPS 78% (7 of 9) anterior open bite. Hypofunction of buccinator having spinal cord compression in whom we recorded ulnar and tongue was found in 100% (9 of 9) of patients and impaired and posterior tibial nerve SEPs (ulnar SEPs: brachial plexus mobility of the mandible was observed in 78% (7 of 9) of the potentials [N9], cervical spinal cord potentials [N13], cortical participants. The speech evaluation revealed that 89% (8 of waveforms [N20]; posterior tibial SEPs: lumbar potentials 9) have frontal lisp, 78% (7 of 9) phoneme substitution, and [N21] and thalamocortical potentials [P37]) and calculated 45% (4 of 9) distortion. Conclusion: Structural alterations central conduction time; we also performed MEPs using mag- were common in the study that agrees with the literature find- netic stimulation of roots and brain and calculated central ings. This condition mainly arises because of accumulation of motor conduction time. Results: Somatosensory-evoked glycosaminoglycans in the upper airways. Speech disorders potentials: SEPs were performed 32 times in 25 patients and the were prevalent and justified by the disharmony of oral myo- results were abnormal after stimulation of upper and lower functional; once-for-a-good joint phonemic is necessary for the limbs in almost all cases (with only 2 exceptions). Motor- integrity of the articulators. The frontal lisp was the most pre- evoked potentials: waveforms were obtained in awaken valent condition for abnormal speech, consistent with the find- patients; MEPs were performed 25 times in 17 patients and ings of high rates of anterior open bite and hypofunction the results were abnormal in all patients (no exceptions). tongue. The results suggest that orofacial myofunctional disor- Conclusion: Evoked potentials and magnetic resonance ima- ders in patients with MPS significantly undermine the speech. ging are complementary tests. The former provides a view of Speech therapy is essential to ensure the effectiveness of verbal functional anatomy, whereas the latter registers structure. In the communication of these individuals. literature, it is established that patients with MPS often develop spinal cord compression during the course of the disease; in our opinion, the term ‘‘dysfunction’’ is more adequated in this con- 1187 - Morquio A Syndrome text because, despite the different anatomic and physiologic (Mucopolysaccharidosis IVA): Brothers backgroud in each type of the disease, in all of them neurophy- Presentations siological evaluation has shown severe impairment of conduc- 1 2 tion in sensory and motor central pathways. We believe that Olga Y. Echeverri , Eugenia Espinosa , Johana M. SEP and MEP analyses are useful to detect functional impair- Guevara1, Yudy A. Ardila3, Ninna F. Pulido3, and Lisseth ment of the sensory and motor central pathways in these Carbarcas3 patients. Evoked potentials allow mapping the anatomic speci- 1 ficity, the functional sensitivity, and have the ability to monitor Instituto de Errores Innatos del Metabolismo. U. Javeriana, Bogota´, changes over time. Colombia 2Instituto de Ortopedia Infantil Roosevelt, Bogota´, Colombia 3Hospital Universitario San Ignacio, Bogota´, Colombia 1185 - The Speech in Mucopolysaccharidosis Introduction: Mucopolysaccharidosis IVA (MPS-IVA) is Danielle S. Silva1, Joice S. Santana2, Angelina X. Acosta3, characterized by an important skeletal involvement without 1 compromise of the mental sphere. Objectives: To present 2 Emilia K. E. A. Leaõ couples of brothers diagnosed as MPS-IVA. For both cou- 1Universidade do Estado da Bahia, Salvador, Brazil ples, the second case was detected during familial study 2Hospitalar Universita´rio Professor Edgard Santos, Salvador, Brazil after diagnosis of the index case. In the first couple, the 26 Journal of Inborn Errors of Metabolism & Screening initial clinical presentation of the index case is outstanding; pregnancy, without perinatal complications. Although her the second one is a couple of half-brothers. Methods: All parents are from the same geographical area, no consangui- patients were evaluated by different medical specialties. nity was established. First, signs and symptoms were evi- Diagnosis was made based on skeletal alterations and dys- dent at 8 months when hip dysplasia was detected. At 18 morphic features. Studies requested included urine analysis months, the patient presented gait disturbance as a conse- and bone radiology. Diagnosis was confirmed by enzyme quence of genu valgu that has been slowly progressive. activity measured in blood cells. Results: Couple 1: Since she was 6 years old, thoracic deformity was noted Females, currently 7.7 and 2.7 years old. Older sister, the (pectum carinatum). Initial diagnosis was spondylo- index case, consulted by generalized edema and was diag- metaphyseal chondrodysplasia. Methods: Column radiogra- nosed as nephrotic syndrome. The MPS-like phenotype was phy, cardiac evaluation, and biochemical analysis for MPS observed in this patient without compromise of central ner- were performed. Results: Patient’s physical examination vous system. Biochemical and enzymatic studies confirmed revealed disproportionate short stature (114 cm < P3), med- the MPS-IVA diagnosis. Diagnostic tests were also per- iofacial hypoplasia, anteverted nares, systolic murmur grade formed on the younger sister who presented flat nasal bridge II, increased thoracic anteroposterior diameter, and short and hip dysplasia as the only abnormal findings. The bio- thorax. Initial x-rays reported hyperlordosis and lumbar gib- chemical studies confirmed the MPS-IVA diagnosis. Couple bus, genu valgu, epiphyseal widening, and hip dysplasia. 2: Males, currently 10 and 4 years old. Older brother, the Columnar x-ray showed thoracolumbar scoliosis, ovoid ver- index case, presented signs and symptoms suggestive of tebral bodies (thoracic and lumbar), and diminished bone an MPS, for this reason biochemical studies were requested. density. Biochemical studies showed N-acetylgalatosamine- Results confirmed MPS-IVA diagnosis. In a second mater- 6-sulfate-sulfatase enzyme activity as normal (4.33 nmol/ nal brother initially without suggestive phenotype, the h/mg; control 6.87 nmol/h/mg) and b-galactosidase as N-acetylgalatosamine-6-sulfate-sulfatase deficiency was also diminished (0.55 nmol/h/mg; control: 21.42 nmol/h/mg), confirmed. Family refused molecular studies. Conclusion: establishing diagnosis of MPS-IVB. Molecular studies are The enzyme replacement therapy for MPS-IVA was recently in process in order to establish possible genotype–phenotype approved. Thus, for a successful treatment, it is of great correlation. Conclusion: Clinical characteristics observed in importance to make an early diagnosis. Unfortunately, in the patient lead to consider MPS as a possible diagnosis, most cases diagnosis is based on clinical manifestations that and MPS-IVB was confirmed by biochemical studies. This occuratanadvancedageinwhichtheoutcomeoftreatment disease is one of the less frequent among MPS and is clinically may not be as successful as in early treated patients, there- indistinguishable from MPS-IVA. Spondylo-metaphyseal chon- fore family studies are crucial for early diagnosis in drodysplasia is usually the first diagnosis considered in these siblings. patients, since these diseases are more frequent; however, Mor- quio disease must always be included in the presumptive diagnosis. 1189 - Morquio B Syndrome (Mucopolysaccharidosis IVB): Clinical Case 1190 - Skeletal Features in Patients With Presentation Nonclassical Mucopolysaccharidosis IV Seen in Northern Ireland Olga Y. Echeverri1, Johana C. Acosta2, Yudy A. Ardila3, 1 3 3 Johana M. Guevara , Liseth Cabarcas , Ninna F. Pulido , Fiona J. Stewart1, and Simon Jones2 1 and Luis A. Barrera 1Northern Ireland Regional Genetics Service, Belfast, Northern 1Instituto de Errores Innatos del Metabolismo. U. Javeriana, Bogota´, Ireland Colombia 2Willink Unit Manchester, Manchester, England 2Instituto de Ortopedia Infantil Roosevelt, Instituto de investigacioń Northern Ireland has a population of 1.7 million people. In this en nutricioń genetica´ y metabolism, Bogota´, Colombia population, there are 15 patients with mucopolysaccharidosis 3Hospital Universitario San Ignacio, Bogota´, Colombia IV (MPS-IV) Morquio disease. Of these, 5 have the classical Introduction: Mucopolysaccharidoses are a group of inborn form of the disease and 10 have a nonclassical form. In the non- errors of metabolism that present a wide clinical and bio- classical cases, heights of female range from 140 to 171 cm, and chemical spectrum. Although diagnosis may be facilitated heights of male range from 151 to 170 cm. The patients pre- by the striking physical features’ characteristics, only the sented in mid-childhood with abnormal gait and pain in their biochemical studies allow classifying among subtypes, hips. Childhood x-rays showed flattening and irregularity of the which is important as enzyme replacement therapy has been femoral heads. There was later development of irregularity of the developed for some of them. Objectives: To report a clini- vertebrae. All were felt to have either spondyloepiphyseal or cal case of 7-year-old female patient, born from the second spondylometaphyseal dysplasia. In late teens and early 20s, the Abstracts 27 changes in hips deteriorated. They were described as being like symptoms in these patients do not lead the patients to seek pro- severe osteoarthritis, and 8 of 10 patients have had at least 1 hip fessional help and therefore cause a significant diagnostic replaced. With increasing age, the patients developed degenera- delay. tion changes in their elbows with irregularity of the articular surface and loose bodies. They all started to get severe pain in their 1197 - Dentofacial Characteristics of Children ankles. Imaging described the talus as having an appearance akin to avascular necrosis. There was also vertical fracturing of the and Adolescents With talus described and severe osteoarthritis of the ankle joint. Radi- Mucopolysaccharidosis: A Pilot Study ological images showing all these features will be shown. One 1 1 patient developed severe changes in his spine when young. He Tahyna´ Duda Deps , Esdras Campos França , Eugenia 1 1 had a scoliosis and had very extensive surgery. Now in his Ribeiro Valadares , Isabela Almeida Pordeus , and Ana mid-30s, he has severe pain in his back. Much of the early metal- Cristina Borges Oliveira1 work has fractured, and he is currently being assessed for spinal 1Hospital de Clıńicas da UFMG, Belo Horizonte, Brazil surgery. This report aims to illustrate the aggressive joint destruction that can occur in nonclassical MPS-IV with resultant Objective: To describe the dentofacial characteristics of chil- pain, limited mobility, and consequently an inability to work. dren and adolescents with mucopolysaccharidosis. Methods: This has had a major impact on their quality of life. Conflicts Data collection from this pilot study was performed in the den- of interest: Both authors have received travel assistance and tal clinics for children/adolescents at the Faculty of Dentistry of honoraria from BioMarin. the Federal University of Minas Gerais (UFMG) in Belo Hor- izonte, Brazil. This study included 9 children/adolescents diagnosed with MPS aged 5 to 21 years, assisted by the Association 1194 - Unrecognized Phenotype of of Mucopolysaccharidosis of Minas Gerais or by the Clinic of Mucopolysaccharidosis Type VI Inborn Errors of Metabolism of the Clinics Hospital of the UFMG. The Research Ethics Committee of the UFMG 1 2 Anna Tylki-Szymanska , Agnieszka Jurecka , and approved this study. Dentofacial characteristics were investi- Agnieszka Rozdzynska-Swiatkowska3 gated by clinical examination of malocclusion (vertical and transversal), dental caries, and oral hygiene. Results: The aver- 1Department of Pediatrics, Nutrition and Metabolic Diseases, The age age of the participants was 12.5 years (þ3.4), with most of Children’s Memorial Health Institute, Warszawa, Poland them being males (66.7%). Regarding the type of MPS, 33.3% 2Department of Genetics, University of Gdan´sk, Gdan´sk, Poland were type I, 33.3% type II, and 33.3% type VI. Most (66.7%) 3Anthropology Laboratory, The Children’s Memorial Health Institute, children/adolescents were identified with some malocclusion. Warszawa, Poland Dental caries was present in 44.4% of the participants and oral Background: Mucopolysaccharidosis type VI (MPS-VI; hygiene was satisfactory in 66.7% of them. Conclusion: The Maroteaux-Lamy syndrome, Online Mendelian Inheritance in prevalence of dentofacial alterations present in this portion of Man 253200) is caused by mutations in the gene coding for the population was high. The oral hygiene was satisfactory in N-acetylgalactosamine-4-sulfatase (4-sulfatase, arylsulfatase most children/adolescents with MPS. Conflicts of interest: B, EC 3.1.6.12), a lysosomal enzyme involved in the degrada- The study ‘‘Oral Features of Children/Adolescents Wwith tion of dermatan sulfate. The clinical presentation of MPS-VI Mucopolysaccharidosis: A Pilot Study’’ is approved by the varies greatly with respect to age of onset and rate of disease Ethics Committee of the Federal University of Minas Gerais progression, and 2 types of attenuated MPS-VI phenotypes can and presents no conflict of interest. be distinguished: osteoarticular and cardiac, both with a clear genotype–phenotype correlation. Methods: We describe a 1202 - Cerebrospinal Fluid Flow Study Using cohort of newly recognized patients with MPS-VI (n ¼ 4) homozygous for the p.R152W mutation. Results: The first Magnetic Resonance Imaging in clinical signs in these patients developed around their teenage Mucopolysaccharidosis years and included the triad of heart involvement, joint limita- 1 1 tion, and skeletal abnormalities. Symptoms of cardiac valve Carmen S. C. Mendes , Maret H. Rand , Marco A. 1 1 1 disease were the most prevalent chief complaints before the Curiati , Patrıćia Feliciano , Carolina S. Aranda , Maria diagnosis of MPS-VI. Prior to diagnosis, both joint and skeletal Lucia Borri2, and Ana Maria Martins1 abnormalities, though radiologically significant, did not lead to 1Centro de Referenciaˆ em Erros Inatos do Metabolismo- clinically significant symptoms and could have been easily Universidade Federal de Sao Paulo, Sao Paulo, Brazil missed in routine health care. Similarly, other features charac- 2DDI-Universidade Federal de Sao Paulo, Sau Paulo, Brazil teristic for MPS-VI such as facial dysmorphia were either mild or absent. Conclusion: Individuals with p.R152W in the homo- Introduction: Cerebrospinal fluid (CSF) flow study is a nonin- zygous state seem to significantly differ from other attenuated vasive imaging technique that is useful for the evaluation of patients with MPS-VI. Relatively mild osteoarticular patients with hydrocephalus. Objective: To evaluate the CSF 28 Journal of Inborn Errors of Metabolism & Screening flow using magnetic resonance imaging (MRI) in 5 patients lower than in other MPS and does not seem to be related to with mucopolysaccharidosis having neurological manifesta- the patients age. These data will be instrumental to allow the tions. Methods: We analyzed CSF flow study by phase- interpretation of the results of PSG after treatment with ERT. contrast MRI (PC-MRI) in 5 patients: MPS type I in 2 patients, Conflicts of interest: Some authors are investigators/study MPS type I in 2 patients, and MPS type VI in 1 patient. The age coordinators in sponsored trials. range was 5 to 32 years, 3 females and 2 males, with neurologic signs and symptoms. Results: All patients showed neurological 1215 - Knee Evaluation in Patients With examination abnormalities; the most frequent findings were pyramidal signs in 5 patients and macrocephaly in 3. Severe Mucopolysaccharidosis IVA cognitive impairment was observed in 1 patient. The MRI Paula F. V. Medeiros1, Fabio G. Nepomuceno2, Thiago O. abnormalities were observed in all patients. The most frequent 1 2 1 MRI findings were dilated perivascular spaces in all 5 patients, Silva , Adriana L. Ortega ,Ca´tia Eufrazino , Aline F. 1 1 indicating hydrocephalus in 3 patients and white matter Alves , and Arthur A. Moreira changes in 3. Three patients showed abnormalities in CSF flow 1Universidade Federal de Campina Grande, Hospital, Campina study, 2 of them with hydrocephalus, and all had stenosis in Grande, Paraı´ba, Brazil craniovertebral junction. Patient 1: MPS-VI, 5 years, CSF flow 2Universidade Cruzeiro do Sul, Saõ Paulo, Brazil reduced in foramen magnum, craniovertebral stenosis at C1 and C2. Patient 2: MPS-II, 3 years, no CSF flow in foramen Objectives: To evaluate knee angle and strength of the quadri- magnum, narrowing of the spinal canal at C1 and C2. Patient ceps femoris muscle in patients with mucopolysaccharidosis 3: MPS-I, 7 years, hyperdynamic CSF flow in third and fourth IVA (MPS-IVA). Methods: Nineteen patients with MPS- ventricles, mesencephalic aqueducts, and reduced flow in IVA were included, 6 females and 13 males, aged 7 to 44 years. foramen magnum, craniovertebral, and cervical stenosis. The patients were evaluated for the measure of the angulation Conclusion: Neuroradiological changes in MPS have been of their lower limbs separately through a single-film radiologic described before, although we have few articles regarding this examination with a goniometer (normal value 7-9). A digital subject. The role of brain CSF flow study is an adjunct for the dynamometer was used to estimate the strength of the quadri- diagnosis and therapy planning of abnormalities like hydroce- ceps femoris muscle with the knee in 45 of flexion. Results: phalus and high intracranial pressure. The 12 patients without knee surgery presented average valgus lower limbs angulation of 30.55 (10-55) in the right knee and 26.81(16-40) in the left one, and with average strength of 1205 - Prevalence of Sleep Apnea in Patients 16.07 N in the right knee and 19.9 N in the left one. The 7 With Mucopolysaccharidosis IVA patients who underwent orthopedic surgery to correct knee valgus presented an average valgus of 10.57 (7 to 30) in the 1 2 1 Andressa Federhen , Angela B. John ,Camila M. Bittar , right knee and 7.14 (5 to 21) in the left one, with average Simone C. Fagondes2, Taiane A. Vieira3, and Roberto strength of 22 N in both right and left knees. The study shows Giugliani1 that 72% of the patients operated can walk, whereas only 50% 1 of those nonoperated can. Three siblings have significant phe- Medical Genetics Service, Hospital de Clinicas de Porto Alegre, notypic variation: 2 males are unable to walk, with severe val- Brazil 2 gus (average of 47.5 in the right knee and 29.5 in the left Pulmonology Service, Hospital de Clinicas de Porto Alegre, Brazil 3 one), whereas the female one can walk (10 and 18 ) in left and Medical Genetics Service/Post-graduate Research Group, Hospital right knees, respectively, and had about 6 times more knee de Clinicas de Porto Alegre, Brazil strength than her brothers. Of the females with MPS-IVA, Objective: To determine the prevalence of obstructive sleep 66.7% can walk although none of them had been operated, apnea (OSA) in a cohort of patients with mucopolysaccharido- whereas only 53.84% of male patients can walk and 53.84% sis (MPS) IVA before start of enzyme replacement therapy underwent a knee corrective surgery. Conclusion: The study (ERT) with recombinant human N-acetylgalactosamine-6- detected severe valgus and knee strength deficit among the sulfatase (BMN110, approved by Food and Drug Administra- patients with MPS-IVA unable to walk. These parameters seem tion as Vimizim). Methods: Patients enrolled in a phase III worse in the nonoperated and in male patients. study (arms: placebo, drug weekly, drug every other week, and for 24 weeks) followed by an open-label extension study (arms: 1223 - Clinical Manifestations and Natural drug weekly, and drug every other week) underwent standard Course of Mucopolysaccharidosis IVA polysomnography (PSG) at baseline. Results: Fifteen patients (8 males) with median age of 26.3 years (5-34) underwent PSG Tatiana Munoz1, Julian Raiman2, Hanna Faghfoury2, and before the start of ERT. Results showed a median apnea- 3 hypopnea index of 3.1 (0.6-15.2) in 15 patients, and 9 of 15 Jennifer Semotok patients had OSA (7 mild and 2 severe). Conclusion: The pre- 1Hospital for Sick Children, Division of Clinical and Metabolic valence of OSA in patients with MPS-IVA (60%) seems to be Genetics, Toronto, Canada Abstracts 29

2Clinical and Metabolic Genetics, Hospital for Sick Children, Toronto, intrathecal (IT) administration and measured cerebral fluid bio- Canada markers to assess efficacy. Methods: Eighteen patients with 3Health Network and Mount Sinai Hospital, Toronto, Canada MPS-1H received IT enzyme replacement therapy (ERT) at 4 time points: 8 to 12 weeks prior to bone marrow transplant Introduction: Mucopolysaccharidosis (MPS) type IVA (MPS- (BMT), 14 days prior to BMT, 100 days after BMT, and 180 IVA)is an autosomal recessive lysosomal storage disease days after BMT. We measured cerebrospinal fluid (CSF) white caused by the deficiency of N-acetylgalactosamine-6-sulfate cells, protein, opening pressure (OP), heparin II cofactor–throm- sulfatase (GALNS), needed to degrade the glycosaminogly- bin complex (HCIIT), and biomarkers of inflammation. Results: cans (GAGs) keratan and chondroitin-6-sulfate. Objectives: We found a significant reduction in the OP between the first and To describe the natural history of patients with MPS-IVA, second doses of IT ERT (22.5 mm H Ovs18mmHO; P ¼ from childhood through to adulthood. Methods: Retrospec- 2 2 .03). We found significantly higher levels of CSF monocyte tive review of patients diagnosed with MPS-IVA over the last chemoattractant protein-1 (MCP-1), stromal cell-derived 25 years at 2 centers in Toronto, Canada. Data were collected factor 1 (SDF-1), interleukin (IL) 1 receptor antagonist, retrospectively from medical records. Results: A total of 14 IL-8, macrophage inflammatory protein 1b, and vascular patients were enrolled in this study, 7 males and 7 females. endothelial growth factor in patients with MPS-IH when The mean age of the patients was 21.7 years. Initial symptoms compared to non-MPS-IH patients, and transplant led to a were noticed between 6 months and 5 years of age. The declineinMCP-1andSDF-1levels over the 4 doses of average age of diagnosis for these patients was 3.1 years IT ERT (976 + 126to169+ 53pg/mL for MCP-1, 396 (9 months-6 years). All patients received multidisciplinary + 31 to 302 + 48 pg/mL for SDF-1). Our analysis of CSF care with a mean of 7.23 specialties per patient (5 to 9). A pro- HCIIT levels showed a marked reduction in the amount of gressive skeletal dysplasia was commonly observed. On HCIIT between the first and second IT ERT doses. Conclu- average, patients needed some type of wheelchair support sion: This is the first in-human experience with IT ERT in by the age of 12.1 years. Surgeries were performed in order patients with MPS-IH. Patients with MPS-IH tolerated IT to improve posture, mobility, and quality of life. The mean ERT well; there were no adverse events observed, and the number of surgeries per patient was 2.9 (0-9). The most delivery was safe without increased morbidity or mortality. common surgical sites include leg (33%), neck (22%), ear We show significant declines in several biomarkers of MPS- (11%), hip (11%), strabismus, and hernia repair (2% each). IH including CSF OP, HCIIT, and several CSF cytokines. The GALNS activity varied from 0 to 0.15 nmol/mg prot/17 The most significant results were found after the first dose h. Molecular testing for GALNS gene was confirmatory of IT ERT prior to BMT. The IT ERT may provide patients in 10 patients, 4 patients have pending results. Length of with MPS-1H a ‘‘bridge’’ of CNS protection against the follow-up varied from 10 to 33 years, and no deaths were inflammatory component of MPS-1H, prior to undergoing observed. Conclusion: The MPS-IVA is a degenerative BMT. Conflicts: This trial had support from Genzyme. lysosomal disorder that requires a multidisciplinary approach. Skeletal abnormalities are the main complications, which are mostly treated with surgery. A thorough understanding of nat- 1020 - Quantitative Ultra-Performance ural course of MPS-IVA is mandatory at both local and inter- Liquid Chromatography Tandem Mass- national levels, in order to assess the response to therapeutic Spectrometry Multiplex Urinary Analysis interventions including enzyme replacement therapy. of Glycosaminoglycans for Patients With Mucopolysaccharidoses 4. Biochemical/Biomarkers/Screening Christiane Auray-Blais1, and Pamela Lavoie1 1015 - Improvement in Biomarkers After 1Universite´ de Sherbrooke, Quebec, Canada´ Intrathecal Iduronidase for Children With Introduction: Mucopolysaccharidosis (MPS) disorders are a Mucopolysaccharidosis I-Hurler result of primary defects in lysosomal enzymes. Depending on the specific gene defect, the catabolism of one or more of the 1 1 1 Troy Lund , Linda Polgreen , Weston Miller , and Paul MPS is blocked leading to the accumulation of the correspond- Orchard1 ing glycosaminoglycan (GAG) substrates. Objectives: To improve the diagnosis and monitoring of patients affected with 1University of Minnesota, Minneapolis, MN, USA different types of MPSs, such as Hurler/Scheie (MPS-IH, -IS, Introduction: Mucopolysaccharidosis type I-Hurler (MPS-IH) -IHS), Hunter (MPS-II), Sanfilippo (MPS-III), Morquio (MPS- is caused by the deficiency of a-L-iduronidase and defective IV), and Maroteaux-Lamy (MPS-VI) syndromes. In order to metabolism of glycosaminoglycans leading to fatal neurodegen- do so, we developed a urinary analysis quantitative methodology eration corrected only by bone marrow transplant. To bypass the using a tandem mass spectrometry (MS/MS) multiplex blood–brain barrier, we tested the hypothesis that Aldurazyme approach. Dermatan sulfate (DS), heparan sulfate (HS), keratan can be given directly to the central nervous system (CNS) via sulfate (KS), and chondroitin sulfate (CS) were specifically 30 Journal of Inborn Errors of Metabolism & Screening targeted. Method: A methanolysis was performed by adding 1Division Of Genetics, Cibo-Imss, Guadalajara, Mexico methanol-HCl3 N to a previously nitrogen-evaporated urine Introduction: Mucopolysaccharidosis IVA can be diagnosed sample and heating at 65C for 75 minutes. After evaporation based on clinical grounds and, as other lysosomal diseases, can under nitrogen, the residue was redissolved in 200 mLofasolu- also be confirmed by biochemical analyses (dried blood spots tion containing the deuterated internal standards synthesized in [DBSs] or leukocytes) and/or molecular analysis on N-acetyl- house. Sample of 5 mL was injected onto an Acquity-I-Class galatosamine-6-sulfate-sulfatase (GALNS). Objective: To ultra-performance liquid chromatography (UPLC) coupled to a determine leukocyte residual activity of galactosamine-6- Xevo TQ-S MS/MS (Waters Corp, Milford, Massachusetts). sulfato sulfatase in 65 suspected Mexican patients with Mor- Results: Our results show an efficient differentiation between quio syndrome by clinical features and/or DBS positivity. patients with MPS and controls. This 6.5-minute multiplex Methods: Leukocytes were extracted using standard method method allows high sensitivity and good resolution for the detec- with 0.25 mol/L saccharose and triton X-100 and homogenized tion of small quantities of urinary GAGs. Linearity was good by sonication. Proteins were measured by Lowry method in a from 0 to 400 mg/mL for KS, DS, HS, and CS. Each MPS type Beckman Coulter DU 730 spectrophotometer (Beckman Coul- can be distinguished from one another due to the specific GAG ter, Pasadena, California). Residual activity of galactosamine- profile, except MPS-I and -II, which present a similar elevation 6-sulfate sulfatase was measured using a modification of the in DS and HS. Conclusion: This UPLC-MS/MS method aiming method published by van Diggelen et al (1990): the reaction at quantifying urinary GAGs for MPS disorders is simple, effi- was performed with 10 mg of diluted proteins with 0.2% bovine cient, and rapid. Keratan sulfate analysis might be applicable serum albumin and 1 mmol/L MU-BGAL-6S.NH4 and incu- to patients with Morquio syndrome for detection, diagnosis, and bated at 37C for 18 hours. Later addition of phosphate buffer monitoring. This multiplex method is applicable for high-risk was realized and a final incubation with b-galactoside galacto- screening of patients with MPS in a single urine analysis. Con- hydrolase was performed at 37C for 2 hours. Enzymatic activ- flicts: We have received an Investigator-Initiated Research grant ity was measured with a Turner 450 fluorometer at 360 nm from Shire. Nevertheless, Shire had no involvement whatsoever filter and 450 nm emission. A 4-mm curve was performed as in the protocol, design, analysis, and interpretation of the results. quality control in each medication. Results: A total of 65 patients (44 females/21 males) were included. The distribution 1024 - The Role of Biomarkers in Treatment by geographic zones clustered in the central (26), western (19 Outcomes patient), southern (15), and northern (5) regions. Based on our reference values on Mexican population of 44.4900 to Simon Heales1 231.7533 nmol/mg prot/18 h, average 138.1257 nmol/mg prot/18 h, 43 patients (66% of the sample) were confirmed due 1 Great Ormond Street Hospital & UCL Institute of Child Health, to absent or minimal residual enzymatic activity (0.00%-3.5%) London, United Kingdom and 21 were regarded as MPS-IVA (and also as MPS-IVB by b- Biomarkers, from a laboratory point of view, are chemicals that galactosidase enzymatic activity). Molecular analysis on can be measured and quantified in patient samples. The ultimate GALNS will be performed in the near future on these positive objective is to offer clinicians and patients meaningful results that patients. Conclusion: In this sample of Mexican patients with can support a diagnosis and reflect the efficacy of treatment stra- suspected diagnosis of MPS-IV, the confirmation of diagnosis tegies. Concerning lysosomal storage disorders, there are a num- by leukocyte residual activity of galactosamine-6-sulfato sulfa- ber of biomarkers available to laboratories, many of which reflect tase was positive in 66%. the nature of the stored material that accumulates as a result of the enzyme deficiency, for example, glycosaminoglycans for mucopolysaccharide disorders, glucose tetrasaccharide for Pompe dis- 1060 - Optimization of Keratan Sulfate ease, and globotriaosylceramide for Fabry disease. The above- Separation by Using Peltier System Following mentioned biomarkers are useful with regard to monitoring treat- an Improved Rapid Isolation of Urinary ment compliance and can, but not always, correlate with clinical Glycosaminoglycans in Small Volume of outcome. Research is now in progress to identify new biomarkers Urine Samples that will support the existing laboratory repertoire and provide better information with regard to clinical outcome. Mihriban Tijien Tanyalcin1 1Izmir, Turkey 1047 - Biochemical Diagnosis of Introduction: Measurement of urine glycosaminoglycans Mucopolysaccharidosis IVA (Galactosamine- (GAGs) in patients with mucopolysaccharidosis (MPS) is consid- 6-Sulfate Sulfatase) in Mexican Patients ered to be the first step in the diagnosis of this heterogenous group of lysosomal storage disorder presenting clinical phenotype. 1 1 Jose E. Garcia-Ortiz , Thiago D. da Silva-Jose , Jesus A. Method and Results: Urine sample containing 300 mgofGAGs Juarez-Osuna1, and Sandra C. Mendoza-Ruavalcaba1 is the most appropriate concentration that gives best precipitation Abstracts 31 with 1000 mL cetylpyridinium (CPC)/citrate buffer. Instead of of a lysosomal storage disease and compared these with considering the creatinine concentration in urine, we suggest the patients having MPS-II with and without cognitive impairment. use of urine GAG concentration because it presents better preci- Results: The average GAG level in healthy adults (n ¼ 31) was pitation with CPC; therefore, we should target GAGs instead of 46.4 +19.1 ng/mL (mean + standard deviation). In surrogate- urine creatininefor optimizedprecipitation of GAGs since it gives normal children, the mean GAG levels for neonates were 68.4 a clear pattern of high-resolution GAG electrophoresis (GAGE) + 22.8 ng/mL (n ¼ 24), for 1- to 23-month-olds, they were followinghigh-speedcentrifugationat12200rpm.Thehigh- 61.8 + 27.8 ng/mL (n ¼ 58), for 2- to 11-year-olds 54.7 resolution electrophoresis (HRE) micromethod described here +27.2 ng/mL (n ¼ 77), and for 12- to 18-year-olds 51.4 enables a clear separation of keratan sulfate from chondroitin sul- +25.6 ng/mL (n ¼ 43). Glycosaminoglycan levels in non- fate based on the effect of cold buffer using low voltage. The MPS-II patients were all less than approximately 200 ng/mL. GAGs HRE banding patterns are more clear, easily identified, and In contrast, 16 patients with MPS-II having cognitive impair- provide a guide for the enzyme analysis deficient in the MPS dis- ment, who enrolled in a phase I-II study of intrathecal orders. In order to maintain a cool medium, Peltier is used. Peltier idursulfase-IT (HGT-HIT-045/NCT00920647), had GAG lev- according to its structure is a kind of a substance that, when the els between 423.7 and 3426.6 ng/mL at baseline, with a mean voltage is applied, gets cooler on one side while the other side gets of 1570.4 + 885.7 ng/mL. Data from 3 additional pediatric warmer. Cooling sides of the Peltiers are in contact with alumi- patients with cognitive impairment showed levels between num plate 20 30 cm where the electrophoresis tank is placed. 842.9 and 2360.9 ng/mL. We also obtained samples from 2 The system is installed with 6 Peltiers/30 watt supported by the pediatric and 4 adult patients with MPS-II without cognitive 380-watt power supply. The temperature of buffer in the electro- impairment and found that 5 of 6 had cerebrospinal fluid (CSF) phoresis tank can be cooled down to 8Cto10C with this Peltier GAG levels between 356.8 and 459.3 ng/mL and 1 had a CSF system. Conclusion: This procedure allows GAG isolation and level of 1181 ng/mL. Conclusion: These data indicate that high-resolution GAGE to be easily performed in routine clinical patients with MPS-II and cognitive impairment have markedly diagnostic laboratories by giving us a distinct pattern of GAGs in elevated levels of CSF GAG, whereas attenuated patients with patients with MPS-I, MPS-II, MPS-III, MPS-IV, and MPS-VI . MPS-II typically have levels that fall between those of the cognitively affected patients and healthy controls. Conflicts of interest: These studies were funded by Shire (NCT00920647 1069 - Levels of Glycosaminoglycans in the [HGT-HIT-045], NCT01449240 [HGT-HIT-072]). Dr Hen- Cerebrospinal Fluid of Healthy Young Adults, driksz has received consulting fees from Actelion, BioMarin, Surrogate-Normal Children, and Patients Glaxo-SmithKline, and Sanofi-Genzyme and has undertaken Having Hunter Syndrome With and Without contracted research for Actelion, Amicus, BioMarin, GlaxoS- mithKline, Sanofi-Genzyme, Shire, and Synageva. Dr Muenzer Cognitive Impairment has been a consultant to BioMarin Pharmaceutical, Shire HGT, Green Cross, and PTC Therapeutics and serves on advisory Christian J. Hendriksz1, Joseph Muenzer2, Adeline 3 4 5 boards and speaker’s bureaus for Genzyme, BioMarin, and Vanderver , Jonathan M. Davis , Barbara K. Burton , Shire. He is currently the principal investigator for phase I/II 6 7 7 Nancy J. Mendelsohn , Nan Wang , Luying Pan , Arian IT enzyme replacement clinical trials for MPS-II sponsored by Pano7, and Ann J. Barbier7 Shire. Dr Vanderver has received consulting fees from Shire and has performed (unpaid) consulting for Stemcells, Inc. Dr Davis 1Salford Royal NHS Foundation Trust, Salford, United Kingdom has no conflicts to declare. Dr Burton has received consulting 2University of North Carolina, Chapel Hill, NC, USA fees from, and serves on advisory boards for, BioMarin and 3Children’s National Medical Center, Washington, DC, USA Shire and has undertaken contracted research for BioMarin, Cyt- 4Floating Hospital for Children at Tufts Medical Center, Boston, MA, onet, Genzyme, Shire, Synageva, and Ultragenyx. Dr Mendel- USA sohn has received travel funding from Genzyme, BioMarin, 5Northwestern University Feinberg School of Medicine/Children’s and Shire and has received grant funding from Genzyme, Bio- Hospital, Chicago, IL, USA Marin, and Shire. She sits on the North American advisory and 6Children’s Hospitals and Clinics of Minnesota, MN, USA the publications committee boards for Shire. Ms Wang and Drs 7Shire, Lexington, MA, USA Pan, Pano, and Barbier are all employees of Shire. Introduction: Accumulation of glycosaminoglycans (GAGs) in urine and tissues is the hallmark of the mucopolysaccharidoses (MPSs). In Hunter syndrome (MPS-II), approximately 1083 - Biochemical Diagnosis of Egyptian two-thirds of patients are affected by cognitive impairment. We investigated the levels of GAGs in cerebrospinal fluid Children With Oligosaccharidoses (CSF) in different populations. Methods: We established nor- 1 2 mal ranges in a population of 31 healthy adults as well as in 202 Ekram Maher Fateen , Manal Fouad , Mona Sabry 1 1 2 surrogate-normal children, defined as children who underwent Aglan , Mona Mahmoud Ibrahim , Noha El Bougdady , a lumbar puncture for a clinical indication other than suspicion and Amira Radwan1 32 Journal of Inborn Errors of Metabolism & Screening

1National Research Centre, Giza, Egypt biochemical analyses that are not easily available to patients liv- 2Cairo University, Giza, Egypt ing in areas geographically distant from the principal cities, where the studies are done. This is why the use of samples col- Introduction: Oligosaccharidoses are disorders caused by a lected in solid phase is an advantage when the purpose is the defect in the breakdown of complex carbohydrate side chains study of high-risk populations, where it is necessary to avoid of glycosylated proteins. They resemble mucopolysaccharido- cooling processes associated with liquid samples. The present sis (MPS) but are less common. Skeletal deformities and coarse work aims to present the experience of 9 years (2005-2014) of facies may range from mild to severe. There is usually intellec- selective screening in Colombia through the enzymatic evalua- tual disability, often with behavioral difficulties, progressive tion of a-L-iduronidase (IDUA), iduronate sulfatase, and aryl- neurological symptoms, and seizures. Early onset is more fre- sulfatase B in dried blood spots of possible patients with MPS- quent than in MPS and are often fatal within few years. Diag- I, -II, and -VI, respectively. Methodology: A group of 1962 nosis is based primarily on detection of increased urinary patients was evaluated (age: 1 month-35 years) with end point excretion of abnormal oligosaccharides and glycosaminogly- enzymatic fluorometric quantifications using 4- cans (GAGs) in urine are normal; confirmation is made by methylumbelliferyl as a marker and 1.2 mm punches. The b- enzyme analysis and molecular studies. Our goal is to establish galactosidase activity was estimated as a control enzyme. a protocol for the diagnosis of Egyptian patients with oligosac- Results: The presented analyses enabled us to establish refer- charidosis in order to provide proper genetic counseling for ence values for Colombian population and facilitated the diag- families of affected patients. Methods: The study included nostic definition of 21 patients with MPS-I (enzymatic activity 46 patients and 50 normal controls. Patients were subjected range for IDUA: 0.0-0.65, reference value [RV]: 1.5-20.1), 20 to history taking, pedigree analysis, clinical examination, mea- with MPS-II (activity range for IDS: 0.0-1.86, RV: 10.7-45.2) suring the level of total GAGs, and 2-dimensional electrophor- and 34 with MPS-VI (activity range for ASB: 0.0-2.0, RV: esis of total GAGs in urine to exclude MPS, thin layer 2.9-43.3; activity range in nmol/h/mL). Conclusion: These chromatographic (TLC) separation of oligosaccharides, and results allowed an early incorporation of patients in the available assessment of enzyme activity according to the pattern of the enzymatic replacement therapies and to offer a preliminary per- TLC to confirm the diagnosis of oligosaccharidoses type. spective of the incidences of these diseases in our country. Results: In all, 16 (34.8%) patients had abnormal pattern of TLC but only 4 (8.7%) of them were diagnosed by deficient enzyme activity. Conclusion: Mucopolysaccharidoses and oligosaccharidoses share many clinical features, but they are less 1090 - Development of a Novel Biomarker for common. The biochemical diagnosis of both disorders is Mucopolysaccharidoses: Level of Disulfated important for counseling of the affected families to avoid more Keratan Sulfate affected siblings. Shunji Tomatsu1, Tsutomu Shimada1, Robert W. Mason1, Eriko Yasuda1, William G. Mackenzie1, Adriana 1084 - Analysis of ␣-L-Iduronidase, Iduronate M. Montan˜o2, Francyne Kubaski1, Roberto Giugliani3,4, Sulfatase, and Arylsulfatase B in Dried Blood 5 6 6 Spots: Experience From 9 Years of Selective Seiji Yamaguchi , Yasuyuki Suzuki , and Kenji E Orii Screening in Colombian Patients With 1Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, Hurler-Like Features USA 2Saint Louis University, St Louis, MO, USA 3 Alfredo Uribe1, Adis Ayala2, Monica Espan˜a1, and Medical Genetics Service, Hospital de Clınicas de Porto Alegre, 1 Porto Alegre, Brazil Natalia Pacheco 4Department of Genetics, Universidade Federal do Rio Grande do 1Universidad de los Andes, Centro de Investigaciones en Bioquimica, Sul, Porto Alegre, Brazil Bogota´, Colombia 5Shimane University, Matsue, Japan 2Universidad Distrital Francisco Jose de Caldas, Cundinamarca, 6Gifu University, Gifu, Japan Colombia Introduction: Keratan sulfate (KS) is known as a storage Introduction: The glycosaminoglycan metabolic disorders or material in mucopolysaccharidosis IV (MPS-IV). However, mucopolysaccharidoses (MPSs) are deficiencies of a specific no detailed analysis has been reported on subclasses of KS: lysosomal enzyme that sequentially degrades these compounds. monosulfated KS and disulfated KS. Methods: We have estab- This causes a progressive accumulation of macromolecules at lished a novel assay method for mono- and disulfated KS using the cellular level generating a multisystemic commitment. This liquid chromatography tandem mass spectrometry and have is reflected in the clinical symptomatology that includes, among measured both KS levels in various specimens. Results: Disul- others, coarse facial features, short stature, multiple skeletal fated KS is dominant in shark cartilage and rat serum, while dysplasias, corneal opacity, and visceromegalies. The diagnos- monosulfated KS is dominant in bovine cornea and human tic approach is challenging because it requires specialized blood. Levels of both mono- and disulfated KS vary with age Abstracts 33 in blood and urine of control participants and patients with with MPS-IVA and -VII, compared with age-matched controls. MPS-II, -IVA, and -IVB. The mean levels of both forms of Levels of KS in patients with MPS-IVA were also higher than KS in blood from patients with MPS-II, -VA, and -IVB were those in age-matched controls, although differences were less elevated compared with that in age-matched controls. The frac- pronounced than that with C6S. Combining KS and C6S data dis- tion of disulfated KS in total KS in control participants criminated patients with MPS-IVA from age-matched controls increased with age, reaching 40%. The fraction of disulfated better than either C6S or KS levels alone. Conclusion: This is the KS in patients with MPS-IVA was around 40% for all ages. The first report showing that blood levels of C6S are quantitatively proportion of disulfated KS of total KS in patients with MPS-II evaluated in patients with MPS-IVA and -VII and indicate that was similar to control participants except between 5 and 10 C6S could be a useful biomarker for these metabolic disorders. years of age. Levels of mono- and disulfated KS in urine of all patients with MPS-IVA and -IVB were more than 3 standard deviations above the mean of the age-matched controls. 1092 - RapidFire Tandem Mass Conclusion: The level of disulfated KS and its proportion of Spectrometry: Application to Diagnosis and total KS distinguish control participants from patients with Monitoring of Mucopolysaccharidoses MPS-II, -IVA, and -IVB, indicating that disulfated KS is a novel biomarker for these disorders. Shunji Tomatsu1, Tsutomu Shimada1, Eriko Yasuda1, Pravin Patel1, Robert W. Mason1, William G. 1 1 2 1091 - Chondroitin 6-Sulfate as a Novel Bio- Mackenzie , Francyne Kubaski , Joan Kelly , William A. LaMarr2, Seiji Yamaguchi3, Yasuyuki Suzuki4, and Tadao marker for Mucopolysaccharidoses IVA and 4 VII Orii 1Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, Shunji Tomatsu1, Tsutomu Shimada1, Eriko Yasuda1, USA 1 1 2Agilent Technologies, Inc, Santa Clara, CA, USA Robert W Mason , William G. Mackenzie , Francyne 3 Kubaski1, Roberto Giugliani2,3, Seiji Yamaguchi4, Shimane University, Matsue, Japan 4Gifu University, Gifu, Japan Yasuyuki Suzuki5, Kenji E Orii5, and Tadao Orii5 Introduction: Mucopolysaccharidoses (MPSs) are caused by 1Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, the deficiency of the lysosomal enzyme, resulting in excessive USA accumulation of glycosaminoglycans (GAGs). We developed 2Medical Genetics Service, Hospital de Clınicas de Porto Alegre, GAG assay method by liquid chromatography tandem mass Porto Alegre, Brazil spectrometry (LC-MS/MS; Oguma et al 2007a); however, it 3Department of Genetics, Universidade Federal do Rio Grande do takes 4 to 5 minutes per sample to be analyzed. Therefore, Sul, Porto Alegre, Brazil we need to have another rapid analytical method for a large 4Shimane University, Matsue, Japan number of samples. Methods: RapidFire with tandem mass 5Gifu University, Gifu, Japan spectrometry (RF-MS/MS) system, an integrated solid-phase Introduction: Chondroitin 6-sulfate (C6S), a glycosaminogly- extraction robot, allows the analytical measurement of samples can (GAG), is distributed mainly in the growth plates, aorta, derived directly from quenched assay plates without additional and cornea; however, the physiological function of C6S is not need of sample desalting/preprocessing, and therefore, each fully understood. One of the limitations is that no rapid, accu- sample is processed within 10 seconds (1 million samples per rate quantitative method to measure C6S has been established. year). We aimed to develop a higher throughput system of Mucopolysaccharidoses (MPS) IVA and VII are caused by the heparan sulfate (HS) assay by using RF-MS/MS. The HS levels deficiency of N-acetylgalactosamine-6-sulfate sulfatase and were measured in blood from controls and patients with MPS- b-D-glucuronidase, respectively, resulting in accumulation of II, -III, and -IV. Results: Results obtained from RF-MS/MS C6S and other GAGs. Although levels of keratan sulfate showed (1) that there were strong correlations in dDiHS-0 S (KS), heparan sulfate, and dermatan sulfate in samples from and dDiHS-NS between conventional LC-MS/MS and RF- patients with MPS are well described, this is the first report MS/MS, (2) that levels of HS in blood were significantly ele- of quantitative analysis of C6S levels in samples from patients vated in patients with MPS-II and -III, (3) that the level of with MPS-IVA and -VII. Methods: We developed a method to HS in a patients with severe type of MPS-II was higher than digest polymeric C6S and measure resultant disaccharides that in an attenuated type, and (4) that reduction in blood HS using liquid chromatography tandem mass spectrometry (LC/ level was observed in patients with MPS-II treated with MS/MS). The C6S levels were measured in blood from control enzyme replacement therapy or hematopoietic stem cell trans- participants and patients with MPS-IVA and -VII aged from 0 plantation. Conclusion: The RF-MS/MS provides much higher to 58 years. We also assayed KS levels in the same samples for throughput than LC-MS/MS-based methods with similar sensi- comparison with C6S. Results: Levels of C6S in blood tivity and specificity in HS assay, indicating that it is feasible decreased with age and were significantly elevated in patients for diagnosis, monitoring, and screening of MPS. 34 Journal of Inborn Errors of Metabolism & Screening

1096 - Assay for Glycosaminoglycans by Oguma3, Yuniko Shibata4, Hideyuki Futatsumori4, Seiji Tandem Mass Spectrometry and its Yamaguchi5, Yasuyuki Suzuki6, and Tadao Orii6 Applications 1Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, 1 1 USA Shunji Tomatsu , Tsutomu Shimada , Robert W. 2Sapporo IDL 1 1 2 2 Mason , Eriko Yasuda , Joan Kelly , William a LaMarr , 3Daiichi Sankyo, Chu¯o,¯ Japan Adriana M. Montanõ3, Seiji Yamaguchi4, Yasuyuki 4Seikagaku Co, Tokyo, Japan 5 Suzuki5, and Tadao Orii5 Shimane University, Matsue, Japan 6Gifu University, Gifu, Japan 1Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, USA Introduction: Mucopolysaccharidoses (MPSs) are caused by 2Agilent Technologies, Santa Clara, CA, USA the deficiency of lysosomal enzyme activities needed to 3Saint Louis University, St Louis, MO, USA degrade glycosaminoglycans (GAGs), which are long 4Shimane University, Matsue, Japan unbranched polysaccharides consisting of repeating disacchar- 5Gifu University, Gifu, Japan ides. Glycosaminoglycans include chondroitin sulfate (CS), dermatan sulfate (DS), heparan sulfate (HS), keratan sulfate Introduction: Glycosaminoglycans (GAGs) are distributed in (KS), and hyaluronan. Their catabolism may be blocked singly the whole body and play a variety of important physiological or in combination depending on the specific enzyme defi- roles associated with inflammation, growth, coagulation, fibri- ciency. There are 11 known enzyme deficiencies, resulting in nolysis, lipolysis, and cell-matrix biology. Accumulation of 7 distinct forms of MPSs with a collective incidence of higher undegraded GAGs in lysosomes gives rise to a distinct clinical than 1 in 25 000 live births. Accumulation of undegraded meta- syndrome, mucopolysaccharidoses. Measurement of each spe- bolites in lysosomes gives rise to distinct clinical syndromes. cific GAG in a variety of specimens is urgently required to Generally, the clinical conditions progress if untreated, leading understand GAG interaction with other molecules, physiologi- to developmental delay, systemic skeletal deformities, and cal status of patients, and prognosis and pathogenesis of the dis- early death. The MPS disorders are potentially treatable with ease. Method and Results: We established a highly sensitive enzyme replacement therapy or hematopoietic stem cell trans- and accurate tandem mass spectrometry (liquid chromatogra- plantation. For maximum benefit of available therapies, early phy tandem mass spectrometry [LC-MS/MS]) method for mea- detection and intervention are critical. Method: We recently surements of disaccharides derived from 4 specific GAGs developed a novel high-throughput multiplex method to assay (dermatan sulfate, heparan sulfate [HS], keratan sulfate, and DS, HS, and KS simultaneously in blood samples using high- chondroitin sulfate). Disaccharides were produced by specific performance liquid chromatography/tandem mass spectrome- enzyme digestion of each GAG and quantified by negative ion try for MPS. Results: The overall performance metrics of HS mode of multiple reaction monitoring. Subclasses of HS and and DS values in patients with MPS-I, -II, and -VII versus GAGs with identical molecular weights can be separated using healthy controls at newborns were as follows using a given set a Hypercarb column (2.0 50 mm, 500 mm) with an acetoni- of cutoff values: sensitivity, 100%; specificity, 98.5%-99.4%; trile gradient in ammonium acetate (pH 11.0). We also devel- positive predictive value, 54.5% to 75%; false positive rate, oped a GAG assay by RapidFire with tandem mass 0.62% to 1.54%, and false negative rate, 0%. Conclusion: spectrometry (RF-MS/MS). The RF system consists of an inte- These findings show that the combined measurements of these grated solid-phase extraction robot that binds and desalts sam- 3 GAGs are sensitive and specific for detecting all types of ples from assay plates and directly injects them into a MS/MS MPSs with acceptable false-negative/-positive rates. In addi- detector, reducing sample processing time to 10 seconds. The tion, this method will also be used for monitoring therapeutic RF-MS/MS consequently yields much faster throughput than efficacy. We review the history of GAG assay and application conventional LC-MS/MS-based methods. However, the RF to diagnosis for MPS. system does not have a chromatographic step, and, therefore, cannot distinguish GAGs that have identical molecular weights. Both methods can be applied to analysis of dried blood 1105 - A New Approach in the Diagnosis of spots, blood, and urine specimens. Conclusion: We compare Mucopolysaccharidoses the assay methods for GAGs and describe their potential applications. Kimiyo M. Raymond1, Jean M. Lacey1, Roberto Giugliani2, Charles Marques Lourenço3, Mark J. Magera1, Dimitar 1 1 1 1098 - Newborn Screening and Diagnosis of K. Gavrilov , Silvia Tortorelli , Devin Oglesbee , Piero 1 1 Mucopolysaccharidoses Rinaldo , and Dietrich Matern 1Mayo Clinic, Rochester, MN, USA 1 1 Shunji Tomatsu , Tsutomu Shimada , Robert W. 2Federal University of Rio Grande do Sul, Porto Alegre, Brazil Mason1, Tadashi Fuji2, Masaru Fukushi2, Toshihiro 3University of Saõ Paulo, Saõ Paulo, Brazil Abstracts 35

Introduction: We developed 3 highly sensitive and specific (when available), to improve and facilitate the interpretation of methods and a simple postanalytical algorithm for use in the biochemical results by physicians when diagnosing MPS-VI. biochemical screening for Fabry disease, metachromatic leuko- Methods: The ASB activity in leukocytes and dried blood spots dystrophy (MLD), saposin B deficiency, multiple sulfatase was compared, and data on ASA þ ASB activity in leukocytes deficiency, mucolipidosis II, and mucopolysaccharidoses were also analyzed in samples sent to our laboratory for MPS- (MPSs). Methods: Glycosaminoglycans (GAGs): urine speci- VI diagnosis. Results: Determination of ASB activity in leuko- mens are evaporated and the dry residue is subjected to metha- cytes was shown to be more specific than in dried blood spots, nolysis yielding the mucopolysaccharides for analysis as their probably due to the use of ASA inhibitor in the leukocytes assay. unique repeating disaccharide units. Liquid chromatography In addition, the calculation of a ratio between ASB and (ASA þ tandem mass spectrometry (LC-MS/MS) is performed using a ASB) enabled a better agreementbetween results from both meth- short LC column to separate the mucopolysaccharides from the ods and was shown to be a more reliable parameter to conclude or bulk of the specimen matrix. Keratan sulfate (KS): urine spe- exclude MPS-VI diagnosis, when compared to the evaluation of cimens, after digestion with keratanase II, are centrifuged ASB activity alone. Conclusion: The use of ASB–(ASA þ ASB) through a 10 000-molecular weight cutoff filter to remove large ratio may be a useful tool to facilitate the interpretation of enzyme molecules (such as proteins). The prepared extract is then activity data for MPS-VI diagnosis. analyzed by LC-MS/MS. Ceramide trihexosides (CT) and sulfatides (S): urine specimens are extracted with 2:1 chloro- 1110 - Experience in the Diagnosis and form–MeOH for determination of CT and S. The dry residue is reconstituted and analyzed by LC-MS/MS. Results: Method Management of Patients With verification demonstrates acceptable accuracy and precision. Mucopolysaccharidoses in Slovakia Analysis of the results (GAGs, KS, CT, and S) using an in- 1 2 1 house developed algorithm enables correct differential diagno- Katarıńa Hlavata´ ,Jań Chandoga , Anna Hlavata´ , 2 4 sis of the listed disorders. Clinical sensitivity and specificity are Darina Behu´lova´ , Helena Poupeˇtova´ , and Lenka as follows: GAGS: sensitivity 100% for MPS disorders (N ¼ Dvorˇa´kova´4 31), specificity 98% to 100% (N ¼ 308 normals); KS: sensitiv- 12nd Department of Pediatrics Comenius Univ Med School and ity 100% (N ¼ 18, MPS-IV or GM I gangliosidosis), specificity Children’s Univ Hosp, Bratislava, Slovakia 99.1% (N ¼ 224 normals); CT and S: sensitivity 100% for 2Inst of Med Bio, Genet and Clinic Genetics, Faculty of Med, Fabry or MLD (N ¼ 33 total), specificity 90% to 96% (N ¼ Comenius Univ, Bratislava, Slovakia 255 normals). Conclusion: We describe 3 laboratory tests and 3Centre of Inher Metabol Disease, Depart of Lab Medicine, Univ a simple algorithm for the detection of multiple disorders using Children’s Hosp, Bratislava, Slovakia <1 mL urine. This improves upon the existing methods with 41st Facul of Med, Charles Univ Prague, Gen Univ Hosp, Prague, respect to sample volume, sample preparation, and greatly Czech republic improves clinical sensitivity and specificity. Introduction: Mucopolysaccharidoses (MPSs) are a group of 1107 - Mucopolysaccharidosis VI Diagnosis: inherited lysosomal storage disorders, which were previously considered untreatable or just limited therapeutical options Another Way to Look at Enzyme Activity were available. These disorders are caused by absent or Data reduced activity of a specific enzyme; this leads to the accumu- 1 1 lation of glycosaminoglycans in different tissues which results Vanessa G. Pereira , Matheus T. Queiroz , Marion C. in progressive mental and physical deterioration in childhood 1 1 1 Braga , Joyce U. S. Yamamoto , Ana M. Martins , and or early adulthood. In recent decades, we have seen a signifi- Vaˆnia D’Almeida1 cant progress in clarifying the pathogenesis as well as in diagnostics and in particular in the possibility of causal therapy. 1Universidade Federal de Saõ Paulo, Saõ Paulo, Brazil The first successful treatment of certain types of MPS was bone Introduction: Mucopolysaccharidosis type VI (MPS-VI) is marrow transplantation. Over the last decade, new therapeutic caused by the deficiency of arylsulfatase B (ASB) due to muta- approaches have become available including enzyme replace- tions in the arylsulfatase B gene (ARSB). Laboratory diagnosis ment therapy and substrate reduction therapy. Methods: In includes quantitative and/or qualitative analysis of urinary glyco- Slovakia, the patients with lysosomal storage disorders are saminoglycans, determination of ASB enzyme activity in differ- treated in the Center of Inherited Metabolic Disorders in ent biological samples, and detection of mutations in the ARSB Faculty Hospital in Bratislava (CDMP). Laboratory diagnosis gene. We have been performing fluorimetric assays to determine is carried out in cooperation with the domestic and foreign ASB enzyme activity in leukocytes and dried blood spots for the laboratories. For the successful treatment of MPS, early diag- diagnosis of MPS-VI, using Pb2þ and Agþ ions to remove endo- nosis is essential. Results: By 2001, in Slovakia 23 patients genous inhibitors and to inhibit arylsulfatase A (ASA), respec- were diagnosed with MPS by syndromology and enzymology. tively. Objectives: To compare data on enzyme activity from After the introduction of screening and quantitative determina- leukocytes and dried blood spots, as well as molecular analysis tion of glycosaminoglycans in urine and their identification by 36 Journal of Inborn Errors of Metabolism & Screening electrophoresis followed by a targeted enzymological examina- 1Department of Biochemistry, University Medical Center Hamburg- tion, the number of diagnosed patients increased. Nowadays, Eppendorf, Children’s Hospital, Hamburg, Germany there are 37 patients with MPS in Slovakia. Conclusion: The 2Institute of Biochemistry and Molecular Biology, University of Bonn, availability of prenatal diagnosis in treatable types (I, II, VI) Bonn, Germany enables early initiation of the therapy. We have treated 13 3Department of Cellular and Molecular Medicine, University of patients and our experience with treatment of MPS shows that California, San Diego, CA, USA all patients had some benefits from this therapy, but their qual- More than 50 lysosomal enzymes and proteins require mannose ity of life strongly depends on the time of initiating the therapy. 6-phosphate (M6P) residues for efficient transport to lyso- The task for the next decade is to verify the long-term therapeu- somes and maintenance of lysosomal function. Mutations in the tic effect of treatment of patients with MPS. N-acetyl-D-glucosamine 1 (GlcNAc-1) phosphotransferase complex catalyzing the formation of M6P targeting signals 1116 - Pilot Newborn Screening Program for result in missorting of lysosomal enzymes and cause the lyso- Treatable Lysosomal Diseases in Brazil: somal storage disorder mucolipidosis type II (ML-II). How- Study Design ever, the total deficiency of all lysosomal enzymes is partially compensated by enzyme- and cell-specific alternative Fernanda Bender1, Gabriel Civallero1, Sandra Leistner- lysosomal targeting. In this study, we examined whether the Segal1, Maira Burin1, Ana Carolina Brusius-Facchin1, degradation of glycosaminoglycans (GAGs), impaired in 1 1 1 mucopolysaccharidosis (MPS), is affected in a knock-in mouse Graziela Ribas , Carmen Vargas , and Roberto Giugliani model for ML-II. The ML-II mice show decreased viability, 1Hospital de Clıńicas de Porto Alegre, Porto Alegre, Brazil reduced mean body weight and body length, and severe skeletal abnormalities. Mass spectrometric and histochemical analyses Introduction: Lysosomal storage disorders (LSDs) are inher- demonstrated accumulation of high-mannose structures, fuco- ited disorders caused by the deficiency of specific enzymes. sylated branched glycans, gangliosides, and cholesterol in This deficiency causes the storage of substrate, leading to a ML-II mouse brain and mouse embryonic fibroblasts (MEFs). progressive and severe bone dysplasia and to problems in many Additionally, accumulation of heparan sulfate and chondroitin organs and systems. All LSDs are inherited in an autosomal sulfate was observed after 35S-sulfate labeling of GAGs in recessive manner, except Hunter syndrome (mucopolysacchar- ML-II MEFs. SILAC-based comparative stable isotope label- idosis [MPS] II) and Fabry disease, which are X-linked reces- ing by/with amino acids in cell culture quantitative analysis sive disorders. Objective: At present, there are no known cures of lysosomal fractions isolated from fibroblasts revealed loss for LSDs. Today, bone marrow transplantation and enzyme of few lysosomal enzymes such as iduronate-2-sulfatase, replacement therapy (ERT) are available treatment options for required for the degradation of chondroitin and heparan sulfate, patients with certain types of LSDs. As LSDs can be treated and a-fucosidase or Niemann-Pick type 2. Other lysosomal with ERT and as there is evidence that a better result can be enzymes, such as cathepsin D and B, were not affected by the expected in cases treated early, a program of neonatal screening deficiency of the GlcNAc-1-phosphotransferase demonstrating for LSDs was created on this specific area. Methods: To the enzyme-specific differences among lysosomal proteins in their program already in place for phenylketonuria, congenital susceptibility to the loss of M6P residues. The identification of hypothyroidism, hemoglobin disorders and cystic fibrosis, now the lysosomal enzymes limiting the degradation of GAGs in also including biotinidase deficiency and congenital adrenal ML-II is ongoing and might allow single or combinatory hyperplasia, tests for Gaucher, Fabry, Pompe, MPS-I, MPS- replacement with recombinant lysosomal enzymes available II, and MPS-VI, were added to the screening panel. The project for treatment of MPS. aims, in its first stage, to adapt the enzyme assays to fluorimetric micromethods, reducing the cost of reagents and mainly of the expensive substrates. Results and Conclusion: The study will evaluate the operational issues, cost, false-positive 1141 - Nonreducing End Glycosaminoglycan rate, and other aspects related to the inclusion of the lysosomal Analysis: A Powerful Tool for Drug Discovery panel in the newborn screening program and provide valuable and Development, Patient Diagnosis, and information to the newborn screening operators in Brazil. Monitoring Response to Therapy in Mucopolysaccharidoses 1125 - Loss of Distinct Lysosomal Enzymes Shripad Bhagwat1, Roger Lawrence1, Evan Adintori1, Limiting the Degradation of 1 1 1 Glycosaminoglycans in Mucolipidosis II Mice Katherine Webster , Rob Herman , Joe Darin , Jillian Brown1, Mika Aoyagi-Scharber1, Jon Vincelette1, Sherry Sandra Markmann1, Katrin Kollmann1, Melanie Thelen2, Bullens1, Stuart Bunting1, Shih-hsin Khan2, Steven Le2, Volkmar Gieselmann2, Jeffrey Esko3, and Braulke Patricia Dickson2, Elizabeth Schwarz3, Marzia Pasquali4, Thomas3 and Brett Crawford1 Abstracts 37

1BioMarin Pharmaceutical, Inc, Novato, CA, USA 1ECRCHUS-University of Sherbrooke, Sherbrooke, Canada 2Department of Pediatrics, Los Angeles Biomedical Research Introduction: Mucopolysaccharidosis (MPS) type IVA, also Institute at Harbor-UCLA Medical Center, Torrance, CA, USA known as Morquio A syndrome, is an autosomal recessive lyso- 3ARUP Institute for Clinical and Experimental Pathology, Salt Lake somal storage disorder. This disease is caused by the deficiency City, UT, USA of the lysosomal enzyme N-acetylgalactosamine-6-sulfatase, 4Departments of Pathology and Pediatrics, University of Utah Health which is involved in the degradation of the glycosaminoglycan Sciences Center, Salt Lake City, UT, USA keratan sulfate (KS). Diagnosis can be difficult in affected Introduction: The measurement of substrate storage in lysoso- patients, particularly when the disease progression is slow. mal storage diseases has previously been hampered by the Objectives: To implement and validate an existing liquid chro- complexity and heterogeneity of the storage material. The matography tandem mass spectrometry methodology to quan- Sensi-Pro mucopolysaccharidoses (MPS) assay is an liquid chro- tify KS disaccharides in urine of patients with Morquio A matography tandem mass spectrometry-based platform tool syndrome. Normal reference values were also established fol- designed to selectively measure lysosomal substrate accumula- lowing the analysis of urine from healthy controls. Methods: tion in all MPS types using a distinct analyte for each disease Keratanase II (KII) solution of 10mL was transferred to a poly- class. Here, we demonstrate the utility of the Sensi-Pro assay propylene tube containing 100 mL of urine sample. Ammonium in a number of preclinical and clinical applications. Methods: acetate buffer of 100 mL was also added with the same amount The assay is based on depolymerization of glycosaminoglycans of the internal standard solution. Digestion of the KS macromo- in the sample using bacterial lyases. The lyases fragment the gly- lecule was performed at 40C + 2C for 2 to 4 hours to obtain cosaminoglycan polymers into disaccharides with an unsatu- related disaccharides. After centrifugation, 20 mLofthe rated bond at the nonreducing end (NRE) of each digested sample was injected onto an Alliance 2795XE HPLC disaccharide; however, the preexisting NRE is liberated as a coupled to a Quattro Micro MS/MS (Waters, Milford, Massa- fully saturated disaccharide. Due to this mechanism of cleavage, chusetts) system. Results: Disaccharide responses were linear the preexisting NRE can be selectively identified and quantified. from 0.313 to 20 mg/mL. Intraday and interday accuracy and Since each MPS type is caused by the deficiency of a different precision assays were good with relative standard deviation and lysosomal enzyme that acts on the NRE, this method generates BIAS percentages at 20%. No carryover was observed, and a unique NRE from each MPS class. The identity of the NRE the heavy-labeled internal standards were corrected for matrix is diagnostic for the MPS class, and the abundance is a direct effects. Our results show an efficient differentiation between measure of the molar abundance of storage material. Results: patients with MPS-IVA and age-matched controls. Conclusion: Data reveal that the Sensi-Pro assay provides a sensitive, selec- The implementation of a tandem mass spectrometry assay for tive, and robust means to detect disease and to measure response quantitation of KS disaccharides in urine of patients with to therapy for several MPS disorders. The assay facilitates quan- Morquio A syndrome might be a useful tool for high-risk titative analysis for a number of applications including the dis- screening studies and for the diagnosis and monitoring of covery and development of novel enzyme replacement patients with MPS-IVA under enzyme replacement therapy. therapies and a central nervous system-penetrant small molecule Conflicts of Interest: I receive honoraria from BioMarin therapy for MPS-III. Conclusion: The Sensi-Pro assay is a pow- Pharmaceutical Inc. erful tool for preclinical drug discovery, clinical drug development, patient diagnosis, and managing ongoing therapy of patients and can be applied in any therapeutic mode (enzyme 1150 - Prenatal Diagnosis of replacement therapy, substrate reduction therapy, chaperone, Mucopolysaccharidoses in Egypt: Counseling or unknown mechanisms). Conflicts of interest: Authors Lawr- ence, Adintori, Webster, Herman, Darin, Brown Aoyagi- Aspects and Diagnostic Tools Scharber, Vincelette, Bullens, Bunting, Bhagwat, and Crawford 1 2 are employees and stockholders of BioMarin Pharmaceutical Inc Ahmed A. L. Aboulnasr , and Ekram M. Fateen (BioMarin). Authors Le, Dickson, and Khan are contracted clin- 1Gynecology & Obstetric department faculty of medicine, Cairo ical researchers for BioMarin. Author Pasquali has provided university, Giza, Egypt consulting services and received travel support from BioMarin. 2Biochemical Genetics department, National Research Centre, Giza, Author Schwarz has no conflicts of interest. Egypt Objective: Prenatal counseling for mucopolysaccharidoses 1143 - Validation of a Tandem Mass (MPSs) diagnosis. Methods: A total of 106 pregnant women were counseled in the last 14 years. All have one or more Spectrometry Assay for Quantitation of affected sibling with MPS except 2 cases with MPS-IVA having Keratan Sulfate Disaccharides in Urine of positive family history in a close relative. The MPS types were Patients With Morquio A Syndrome 39 (36.8%)typeI,15(14.15%) type II, 14 (13.2%)typeIII,17 (16%) type IVA, and 21 (19.8%) type VI. In all, 63 couples Pamela Lavoie1, and Christiane Auray-Blais1 counseled in 1 pregnancy and 20 couples counseled 43 times 38 Journal of Inborn Errors of Metabolism & Screening in successive pregnancies, 18 couples in 2, 1 couple in 3, and 1 dismutase (SOD) and catalase (CAT) since the damage to lipids couple in 4 pregnancies. Consanguineous marriage was present (lipid peroxidation) was measured by the presence of thiobarbi- in 91 (85.8%) pregnancies. In 39 (36.8%) pregnancies, couples turic acid reactive substances (TBARS). Analysis of variance have no normal children. However, in 73 (68.9%), couples have followed by the Tukey post hoc, with Pearson correlation was no normal boys. Prenatal diagnosis (PD) was performed in 83 used to compare results of analysis of plasma with those of both (78.3%) pregnancies. Amniocentesis was done at 14 to 15 weeks HC and patients with MPS. Analysis was performed using sta- gestational age in 39 (47%) to withdraw 10 mL for analysis of tistical software package SPSS 17 (SPSS Inc., Chicago, Illinois), glycosaminoglycans (GAGs) by 2-dimensional electrophoresis and level of significance was set at P <.05.Results: We found a (2-DEP). Chronic villus sampling (CVS) was done at 11 to 12 significant increase (P ¼ .02) in lipid peroxidation (TBARS) in weeks gestational age in 44 (53%) pregnancies to measure spe- MPS-I, but in MPS-VI, no change in any of the parameters stud- cific enzyme activity fluorometrically. In 7 cases of them, ied in the plasma of groups was observed. Analyzing SOD and amniocentesis was needed to verify diagnosis of borderline CAT, there were no significant differences (P > .05) among the enzyme result (5 cases) or because CVS did not yield enough groups. Conclusion: As the MPS-I and MPS-VI diseases are villi (2 cases). Of the 106 counseled, 23 (21.7%) pregnant characterized as rare diseases, the sample size of this study was women were not subjected to PD. In all, 14 (60.9%)didnotshow low. However, with the analysis of the results, there was an up at scheduled time for PD, 4 (17,4%) had spontaneous abortion increase in damage to lipids in MPS-I, suggesting that this dis- before PD, 3 (13%)camelateforPD,1(4.3%) had vesicular ease is more vulnerable to oxidative damage than MPS-VI. mole, and 1 refused. Results: Of those subjected to PD, 59 (71.1%)havenormalfetusand24(28.9%) have affected fetus. 1199 - Insights into the Interplay Between Conclusion: All types of MPSs could be diagnosed prenatally. ␣ Analysis of GAGs by 2-DEP of amniotic fluid is sensitive and -L-Iduronidase and Cholesterol by a Protein– accurate method for PD of MPS. Prenatal diagnosis by measur- Protein Interaction Network Analysis ing enzyme activity in chorionic villi is recommended as CVS is 1 2 2 done 3 to 4 weeks earlier than amniocentesis which is more Ursula Matte , Barbara Z. Matinelli , Joice F. Poloni , and favorable medically, ethically, and psychologically. High con- Diego Bonatto2 sanguinity rate in Egypt leads to more genetic diseases. To have 1Hospital de Clı´nicas de Porto Alegre, Porto Alegre, Brazil a normal boy is a motive for repeated pregnancies. 2Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil Objectives: To design and analyze protein–protein interac- 1166 - Preliminary Analyses of Biomarkers of tion (PPI) networks by applying system biology tools in order Oxidative Stress in Mucopolysaccharidoses I to elucidate the interplay between proteins involved in a-L- and VI iduronidase (IDUA) activity and cholesterol metabolism. Methods: We used STRING data set to design a PPI network Alexandre Silva de Mello1, Ana Carolina Breier2, with IDUA interactions and a PPI network with proteins Marina Frusciante1, Carolina Antunes1, Gabrielli involved in cholesterol metabolism. The results were analyzed using Cytoscape software. The Advanced Network Borbolato1,Jessica´ Marinho1, Mariane Wohlenberg1, 1 1 Merge tool performed the union of these networks, and the Fernanda S. Machado ,NiaraS.Medeiros,Clau´dia union PPI network obtained was clustered by Molecular Com- 1 1 da Silva Funchal , Caroline Dani , and Janice Carneiro plex Detection (MCODE) tool. The most relevant proteins Coelho2 were identified by centrality analysis using CentiScaPe plugin for the nodes and WERW-kpath for the edges. The gene ontol- 1Centro Universita´rio Metodista IPA, Porto Alegre, Brazil ogy analysis was applied in each cluster to obtain information 2Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil about the major biological processes associated. Results: The Introduction: High levels of reactive oxygen species have analyses of interactome network showed 1975 proteins clus- been associated with oxidative stress and inflammation being teredin22modulesandinvolvedinavarietyofbiological related to cellular changes characteristic, caused by changes processes. The most prominent processes in the union PPI net- in metabolic pathways of individuals with inborn errors of work are related to system development (eg, development of metabolism. Patients with mucopolysaccharidoses (MPSs) blood vessels, heart, lymphoid organs and nervous system, characterized by biomolecular and tissue damage that results regulation of growth, angiogenesis, and organ morphogen- in the accumulation of glycosaminoglycans not degraded in the esis), regulation of signaling pathways, cell adhesion, migra- cells of various organs and systems. Methods: Three biomar- tion, endocytosis, and regulation of cell death. Considering kers of oxidative stress were evaluated in patients having specifically the proteins from intersection, we observed their MPS-I (n ¼ 7) and MPS-VI (n ¼ 7), deficiency in a-L-iduroni- involvement in the regulation of signaling pathways, system dase and arylsulfatase B enzymes, respectively, apart from development, and immune system response, which means that healthy controls (HC; n ¼ 14). The antioxidant capacity of these processes are highly influenced by the interaction of blood plasma was measured by the enzyme superoxide proteins linking IDUA and cholesterol networks. In addition, Abstracts 39 the centrality analysis revealed that IDUA is one of the bottle- 2Molec and Cell Biol Lab, Ped Neurol Unit and Lab, Meyer Children’s necks controlling the flow of information through the net- Hospital, Florence, Italy work. Conclusion: Our results showed a network linking 3The Buck Institute for Research on Aging, Novato, CA, USA IDUA and cholesterol metabolism proteins. The implications 4Department of Computer Science, University of San Francisco, San of these findings for the clinical manifestations of mucopoly- Francisco, CA, USA saccharidosis I should be further investigated. 5Children’s Hospital & Research Center Oakland, Oakland, CA, USA 6Health Interactions Inc, San Francisco, CA, USA 5. Molecular Genetics Introduction: Morquio A syndrome (mucopolysaccharidosis IVA [MPS-IVA]) is caused by deficient activity of the enzyme 1011 - Characterization of Algerian Patients N-acetylgalactosamine-6-sulfatase (GALNS) resulting from With Morquio Type A: Novel Mutation in the mutations in the GALNS gene. Morquio A-associated GALNS GALNS Gene mutations are numerous and heterogeneous. New mutations are continuously published. To aid the detection and interpretation Abdelmadjid Benmansour1, Arndt Rolfs2, Anne Katrin of GALNS mutations, we summarize all Morquio A-associated Giese2, and Catherine Caillaud3 published mutations in GALNS and report a new public-access, locus-specific database for the GALNS gene. Methods: We 1 Oran, Algeria summarize published mutations in GALNS from 541 patients 2 Akos Institute, University of Rostock, Rostock, Germany with Morquio A, together with an additional 81 published, 3 Necker enfants malades hospital, Paris, France Morquio A-associated GALNS mutations that were not Objectives: To describe new patients with N-acetylgalac described in the context of genotypes from individual patients. tosamine-6-sulfatase (GALNS) gene mutation and investigate Results: A total of 277 unique GALNS mutations associated intrinsic variability of mucopolysaccharidosis type IVA (MPS- with Morquio A were identified from 1091 published GALNS IVA; Online Mendelian Inheritance in Man #253000) or Mor- alleles. In agreement with the previous findings, most GALNS quio A syndrome (MPS-IVA) in patients sharing the same gen- alleles reported from patients are missense (79%), and even the otype. Methods: Direct Sanger sequencing of GALNS gene in 3 most frequent mutations are relatively uncommon. The 3 most patients from 2 unrelated families with MPS-IVA clinical common missense alleles (R386C, I113F, and G301C) together description of the patients. Results: We identified in both pedi- only represent 14% of all alleles. There is significant geogra- grees a homozygous mutation in exon 5 of the GALNS gene phical and/or ethnic origin-based allele frequency variability. (c.454dupC-p.Leu152Profs6*), which creates a frameshift at Of these alleles, 11% are insertions/deletions, 6% intronic, and codon152andresultsinastopcodon5positiondownstream. 4% nonsense. Most Morquio A-associated mutations have only The expression of MPS-IVA is different: while the 2 siblings been reported 1 to 2 times. We find that 48% of patients are have a moderate form of MPS-IVA, the third patient is severely homozygous for a GALNS mutation, 39% heterozygous, and affected. Conclusion: Mucopolysaccharidosis type IVA is an 13% have only 1 mutation detected. The locus-specific data- inherited autosomal recessive disease caused by a deficient base for the GALNS gene catalogs all reported mutations in activity of the lysosomal enzyme GALNS. More than 180 differ- GALNS to date. Conclusion: Challenges in both mutation ent mutations have been described in the GALNS gene. Based detection and genotype–phenotype interpretation are caused on the severity of the skeletal dysplasia, a mild ‘‘attenuated’’ and in part by the heterogeneity of GALNS mutations and lack of a severe ‘‘classic’’ form are distinguished. Our patients, who multiple independent families with the same mutations. Paren- carry a novel mutation in the GALNS gene, provide evidence tal molecular testing is encouraged. Reporting of new alleles that there must be factors influencing disease severity beyond facilitates distinguishing pathogenic from benign mutations. basic genotype–phenotype correlations. The gold standard for diagnosis of Morquio A is still deficient GALNS enzyme activity in leukocytes or fibroblasts, together with wild-type activity of control enzymes. Conflicts of 1028 - Morquio A Syndrome Interest: Dr Fietz has received travel support and honoraria (Mucopolysaccharidosis IVA): A Review of from BioMarin Pharmaceutical. Drs Church, Morrone, and 277 Gene Mutations Curated in a New Tylee have received consultant fees and limited travel support GALNS Locus-Specific Database from BioMarin Pharmaceutical and provide a diagnostic service for MPS for samples from Turkey that is funded by BioMarin. Nicole Miller1, Amelia Morrone2, Anna Caciotti2,Robert Dr Pollard is a paid employee of the Greenwood Genetic Center, Atwood3, Kathryn Davidson1,ChaoyiDu3, Patricia Francis- which has contracts with BioMarin. Dr Wang holds a financial Lyon4, Paul Harmatz5, Matthew Mealiffe1,Sean interest in BioMarin. Dr Mooney serves as a consultant for Bio- Marin Pharmaceutical. Mrs Davidson and Dr Miller are employ- Mooney3, Tal Ronnen Oron3,AprilRyles4, and Karl A 6 ees of BioMarin. Drs Al-Sayed, Brusius-Facchin, Caciotti, Coll, Zawadzki Gort, Kubaski, Lacerda, Laranjeira, Leistner-Segal, Pajares, and 1BioMarin Pharmaceutical Inc, Notvato, CA, USA Ribeiro declare no potential conflicts of interest. 40 Journal of Inborn Errors of Metabolism & Screening

1228 - Morquio Syndrome: New mutation. Results: Sibling 1: second pregnancy after first ecto- Heterozygous Mutation of the GALNS Gene pic pregnancy. Normal pregnancy and normal milestones in 2 Siblings From South-West Colombia development. After skull fracture at 17 months, coarse facial features and brain mild atrophy were detected, and he was Harry Pachajoa1,2, Marıá Fernanda Hernandez-Amariz1, referred to Genetics. Subsequently, he presented umbilical and 1 3 inguinal hernia, recurrent ear infections, dysostosis multiplex, Felipe Ruı´z-Botero , and Sabrina Eichler hepatomegaly, global development delay, and corneal opacity. 1Centro de Investigaciones en Anomalıás Congenitas´ y He began enzymatic therapy with Aldurazyme at 54 months Enfermedades Raras, Facultad de Ciencias de la Salud, Universidad and was transplanted at 65 months with umbilical cord blood Icesi, Cali, Colombia progenitor cells. He died of an infection 2 months later. Sibling 2FundaciońClıńica Valle del Lili, Cali, Colombia 2: third pregnancy. At the last trimester of pregnancy, the 3 Director Diagnostic Analytics Centogene, Rostock, Germany mother presented high blood pressure. At birth diagnosed with clubfoot. Further laboratory studies were performed due to his- Introduction: Mucopolysaccharidosis type IV A, or Morquio tory of affected brother and confirmed the diagnosis in the syndrome, is an autosomal recessive lysosomal storage disor- patients. Nowadays, he has mild corneal opacities, and he is der that is caused by mutations in the N-acetylgalactosamine- receiving enzyme replacement therapy with Aldurazyme since 6-sulfatase (GALNS) gene, leading to the deficiency of 5 months. The family did not authorized bone marrow trans- GALNS enzyme which is encoded by this gene, resulting in the plant. Laboratory studies of sibling 2: enzymatic activity for accumulation of keratan sulfate and chondrotin sulfate in cer- a-L-iduronidase (IDUA) activity in a dried blood sample was tain tissues. It is expressed as generalized skeletal dysplasia 0.1 mmol/L/h. Sequencing of IDUA gene found 2 heterozygous with corneal clouding, resulting in short stature, pectus carina- mutations. The first is located in exon 2/intron 2: tum, platyspondylia, odontoid hypoplasia, kyphoscoliosis, and c.299_299þ1delinsAT (p.R100Nfs*32). This is a result of genu valgum. Cardiovascular and respiratory systems can also combination of 2 heterozygous changes: c.299G>A (p.R100 be affected. This phenotype has a broad variability associated K) and c.299þ1G>T; both are not previously reported. with more than 180 mutations that have been reported. Until PolyPhen-2 and Mutation Taster indicated that both are damaging recently, there was no effective therapy for treating the disease and Alamut 2.2 predicts an aberrant effect in splicing. The second aside from a multidisciplinary approach, and this year a recom- mutation is located in exon 11 c.1598C>G (p.P533R). The father binant enzyme was approved. Objective: To report the cases of is carrier of c.299_299þ1delinsAT and the mother of 2 siblings with new mutation in GALNS gene. Methods: Nine c.1598C>G. Conclusion: There are more than 200 mutations and six-year-old brothers with clinical characteristic of severe described in IDUA, including 3 complex mutations. Only 1 is a Morquio syndrome presenting deficiency of GALNS enzyme. deletion–insertion; the present new splicing mutation expands the The GALNS gene was analyzed by polymerase chain reaction type of changes that affect the function described for IDUA gene. and exome sequencing. Results: A previously reported mutation in exon 3 (c.280C>T p.R94C) and a new heterozygous variant in exon 9 (c.998G>A p.G333D) were found. They were analyzed with polyphen-2, SIFT, and Align-GVGD softwares with a pre- 1044 - System Biology Approach to diction of damaging mutations. Conclusion: These brothers Mucopolysaccharidosis Through the Use of a have received an approach in a multidisciplinary team including Computational Human Metabolic pediatrician, orthopedist, geneticist, endocrinologist, neurosur- Reconstruction geon, physiatrist, and neuropsychologist, and the enzymatic replacement therapy is being considered. This multidisciplinary Carlos J. Almeciga1, Diego A Salazar2, Edwin A. approach is recommended for the best control of the disease. Rodriguez1, George E. Barreto2, Janeth Gonzales1, and Carlos J. Almeciga-Diaz1 1038 - A Complex New Splicing Mutation in 1Institute for the Study of Inborn Errors of Metabolism, Pontificia IDUA Gene Present in Compound Universidad Javeriana, Bogota´, Colombia 2 Heterozygosity in a Mexican Family With 2 Pontificia Universidad Javeriana, Bogota´, Colombia Siblings Affected by Mucopolysaccharidosis I Objective: To identify the cellular mechanism impaired on mucopolysaccharidosis and new biological markers through a 1 1 Yuritzi Santillań-Hernańdez , Aurea Vera-Loaiza , and system biology approach using a computational metabolic Raul Eduardo Pinã-Aguilar1 human network reconstruction. Methods: The human metabolic reconstruction Recon2 was used to model the metabolic changes 1Medical Genetics Department, Centro Medico´ Nacional ‘‘20 de observed after silencing each one of the mucopolysaccharidosis Noviembre’’, ISSSTE, Mexico city, Mexico (MPS)-related genes. Synthesis of adenosine triphosphate was Objective: To describe a Mexican family with siblings having selected as objective function. Models were analyzed using mucopolysaccharidosis type I presenting a new complex COBRA toolbox through flux balance and variability analysis. Abstracts 41

Genes associated with reactions that changed after gene silen- (3.5%) of 57 were deletions, 2 (3.5%)of57wereindels,4 cing were subjected to enrichment analysis. Results: Models for (7.0%) of 57 were duplications, and 49 (85%)of57werepoint MPS-I, -II, -III (A to D), -IV (A and B), -VI, and -VII were gen- mutations. Among point mutations, 7 (10.6%)of49weresplice erated. For all the evaluated MPS models, several genes associ- site, 10 (21.2%) of 49 were nonsense, and 32 (68%)of49were ated with cellular respiration and oxidative phosphorylation missense mutations. Conclusion: This is the largest sample of were altered as previously reported for other lysosomal storage Latin American patients with MPS-II reported to date. We believe disorders. New or unexplored metabolic pathways were also that the methodology employed in this study is appropriate for the observed, such as the metabolism of some amino acids, peroxi- diagnosis and the identification of mutations in patients with MPS- some proliferator-activated receptor-g signaling, and purine and II and possible carriers. Therefore, in the present state of knowl- pyrimidine metabolism. Flux variability analysis allowed to edge, the identification of the mutation present in individuals with identify different grades of overlapping of the reaction fluxes MPS-II has, as main objective, the genetic counseling of families. ranges of the MPS models in comparison to those observed with the wild-type model. Reaction fluxes ranges in the MPS models, 1052 - Clinical and Molecular Genetic which were outside those observed in the wild-type model, were classified as possible biomarkers. Metabolism of sphingolipids Analysis of Korean Patients With and aminosugar, as well as transport and exchange/demand reac- Mucopolysaccharidosis Type III (Sanfilippo tions, showed the highest number of reaction fluxes ranges out- Syndrome) side the wild-type ranges. Conclusion: The use of the human 1 2 2 2 metabolic reconstruction Recon2 is a valuable tool that allows Ah-Ra Ko , Youghee Kwun , Rim Huh , Jieun lee , Sun- to model the metabolic consequences of glycosaminoglycan cat- gYoon Cho2, YounBae Sohn3, and Dong-Kyu2 abolism impairment and to predict new biomarkers. In addition, 1Clinical Research Center, Samsung Biomedical Research Institute, these models might be used to identify new therapeutic targets. Sungkyunkwan University School of Medicine, Seoul, South Korea 2Department of Pediatrics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, South Korea 1046 - Idorunate-2-Sulfatase Gene: Molecular 3Department of Medical Genetics, Ajou University Hospital, Suwon, Characterization of 103 Latin American South Korea Patients Introduction: Mucopolysaccharidosis type III (MPS-III, Sanfi- AnaCarolinaFacchin1, Ida Vd. Schwartz1, Francyne lippo syndrome) is an autosomal recessive disorder caused by 1 1 1 deficiencies in 4 enzymes involved in the lysosomal degradation Kubashi , Roberto Giugkiani , and Sandra Leistner-Segal of the glycosaminoglycan heparan sulfate. It is characterized by 1Medical Genetics Service, Hospital de Clinicas de Porto progressive neurocognitive declines, behavioral abnormalities, sleep disturbances, and relatively mild somatic manifestations. Alegre, Porto Alegre, Brazil Objectives: To evaluate the clinical and molecular genetic char- Objective: To identify the disease-causing mutations in 103 unre- acteristics of 21 Korean patients with MPS-III. Methods: We lated patients with mucopolysaccharidosis II (MPS-II) from Latin retrospectively reviewed 21 patients from 20 unrelated families America. Methods: Samples were first analyzed through poly- who were diagnosed as MPS-III by enzyme assay from January merase chain reaction (PCR)/restriction fragment length poly- 1997 to December 2013 in Samsung medical center. Clinical morphism for the presence of the common inversion/disruption manifestations and results of molecular genetic analysis were of the idorunate-2-sulfatase (IDS) gene. Samples with no evidence investigated. Results: In all, 10 (48%) patients were diagnosed of the IDS–IDS2 recombination were analyzed throughout the 9 as MPS-IIIa and MPS-IIIb, respectively, and 1 patient (4%)as exons and intron–exon boundaries of the gene by PCR and sequen- MPS-IIIc. The median age of onset of first signs or symptoms cing. Results: We have found great allelic heterogeneity among was 3.3 years (range 1.5-5.0), and median age at diagnosis was our patients; 57 different mutations in 103 patients and 30 novel 5.9 years (range 1.9-10.2). The average delay between the first mutations. All the novel point mutations were considered to be presenting signs/symptoms and the diagnosis was 2.6 years causative for the disease after analysis in 100 alleles of unaffected, (range 0.2-6.3). The first presenting signs/symptoms of 20 and unrelated controls and bioinformatics analyses, performed by patients were developmental delay (95%), and only 1 (5%)patient Polyphen v.2, predicted that these mutations are probably dama- showed hepatomegaly. At the time of diagnosis, facial dysmorph- ging. Alterations such as inversion/disruption was found in 13 ism was observed in 17 (80%) patients. The other clinical mani- (12%) of 103 patients, partial deletions was found in 4 (4%)of festations of patients who could be followed up were behavioral 103 patients, and total deletion of the IDS gene was found in 3 disturbances (67%), sleep disturbances (62%), seizure (57%), and (3%) of 103 patients. Small insertions/deletions/indels (<22 bp) orthopedic problems (42%). The median age at loss ability to and point mutations were identified in 83 (88%)of103patients. speech was 8 years (range 5.7-11) and to walk was 9.9 years Intronic mutations were found in 3 (3%) of 103 patients, all of (range 7.9-13.0) in patients who were available. Molecular which involves the consensus splice donor or acceptor site. genetic analysis was performed in 7 patients with MPS-III, and Regarding the type of the 57 different small alterations found, 2 9 different sequence variants were identified. Four novel 42 Journal of Inborn Errors of Metabolism & Screening mutations (c.703GA(IVS5-42G>A), c.200T>C, with Morquio A identified 99 separate changes, of which 39 were c.1976C>T) were detected. Conclusion: It is suggested that when previously unpublished, novel GALNS mutations associated with a patient shows developmental delay and/or characteristic Morquio A: p.Val16Glu, p.Leu36Arg, p.Asp40Asn, p.Val48Gly, somatic feature of MPS, screening for MPS-III should be p.Glu51Lys, p.Pro81Leu, p.Ala84Glu, p.Leu91Pro, p.Gly116- considered. Val, p.His145Tyr, p.Phe156Leu, p.His166Arg, p.Gly201Glu, p.Leu214Pro, p.Phe216Ser, p.Thr235Lys, p.Ser264Thr, p.Asn 289Asp, p.Arg380Gly, p.Gly415Val, p.Ile416Thr, p.Pro420Arg, 1081 - Molecular Testing of 163 Patients With p.Ala492Thr, p.Gly500Ser, p.Cys507Phe, p.Glu126Ter, p.Trp Morquio A Syndrome (Mucopolysaccharidosis 141Ter, p.Tyr209Ter, p.Arg251Ter, p.Pro357ArgfsTer21, p.Leu IVA):39NovelGALNSGeneMutations 372SerfsTer6, p.Tyr385Ter, p.Gln414Ter, p.Val427SerfsTer13, p.Glu477_Gln485del, Complex del-dup (duplication from intron 1 2 3 Nicole Miller , Amelia Morrone , Karen L. Tylee , Moen 5tointron9,deletioninintron10),c.120þ1g>c, c.405_422þ1del, Al-Sayed4, Ana Carolina Brusius Facchin5, Anna Caciotti2, c.758þ4a>t. We also identified 26 SNPs. Conclusion: Reporting Heather J. Church3,MaJose´ Coll6, Kathryn Davidson1, Morquio A-associated GALNS mutations improves genetic Michael J. Fietz7, Laura Gort6, Madhuri Hedge8, counseling and diagnosis capability. There are limitations in what can be concluded from molecular testing of the patient alone, in Francyne Kubaski5,Lućia Lacerda9, Francisco 9 5 10 addition to limitations in mutation detection. Therefore, it is recom- Laranjeira , Sandra Leistner-Segal , Sean Mooney , mended when possible to also molecularly test both parents. 6 11 9 Sonia Pajares , Laura Pollard , Isaura Ribeiro , and As previously reported, the second disease-associated allele Raymond Wang12 maynotbeidentifiedupto15% of the time. Although molecular testing provides useful diagnostic and genetic counseling informa- 1BioMarin Pharmaceutical Inc, Novato, CA, USA tion, enzyme activity testing of GALNS, along with other enzymes, 2Meyer Children’s Hospital and University of Florence, Florence, Italy remains the standard for diagnosis of Morquio A. 3Willink Biochem Gen, Cen Manchester U. Hosp NHS Found Tr, United Kingdom 4Dept of Med Gen, King Faisal Specialist Hosp and Research Center, Riyadh, Saudi Arabia 1139 - The G116V Mutation is Common in 5Lab de Gen Molec, Hosp de Clıńicas de Porto Alegre, Brazil Patients of Pakistani Origin With 6Servicio de Bioquı´mica y Genetica´ Molecular, Hospital Clıńic de Mucopolysaccharidosis Type IVA and is Barcelona, Spain 7 Associated With a More Severe Phenotype at SA Pathology, Women’s and Children’s Hospital, North Adelaide, Presentation Australia 8 Emory Genetics Lab, Emory University School of Medicine, Atlanta, Saikat Santra1, Suresh Vijay1, Shagufta Khan1, Jinendra GA, USA 1 1 9Centro de Genetica´ Medica´ Jacinto Magalha˜es (CGMJM) do Centro Ekanayake , and Guirish Solanki Hospitalar do Porto (CHP), Portugal 1Birmingham Children’s Hospital, Birmingham, United Kingdom 10The Buck Institute for Research on Aging, Novato, CA, USA Introduction: Mucopolysaccharidosis type IVA (MPS-IVA) is a 11Biochemical Genetics Lab, Greenwood Genetic Center, lysosomal storage disorder showing variation in the severity of its Greenwood, SC, USA. widespread skeletal dysplasia between patients. In our center, 12Children’s Hospital of Orange County, Orange, CA, USA many patients are of Pakistani origin, in whom mutation analysis Introduction: Morquio A syndrome is an autosomal recessive reveals a common mutation. Patient records were analyzed to lysosomal storage disorder caused by partial or total deficiency assess whether this mutation is associated with a severe skeletal of the enzyme N-acetylgalactosamine-6-sulfatase (GALNS) phenotype. Methods: Twenty-eight patients with MPS-IVA have encoded by the GALNS gene. Mutations occur throughout the been treated at our hospital between 2000 and 2013. Patient gene and many are identified only in 1 patient or 1 family, causing records including available computed tomography and magnetic difficulties both in mutation detection and in interpretation. Here, resonance imaging were reviewed to assess the spinal manifesta- we publish GALNS mutations in patients diagnosed with Mor- tions at presentation in these patients. Results: In all, 24 (85%) quio A, identify GALNS mutations that previously had only been patients were of Pakistani origin, of whom 17 (70%) were homo- reported in 1 patient or family, and describe novel Morquio A- zygous for the G116V mutation in GALNS and had family mem- associated GALNS mutations. Methods: Mutations in GALNS bers from the Saleh Khana region of Pakistan. Median age at from patients with Morquio A were reported from 7 different diagnosis in the G116V group was earlier: 16 months (index cases laboratories; 2 clinicians were involved in reporting molecular 23.5 months) compared to 24 months (index cases 30 months) in testing results. Individuals received a diagnosis of Morquio A the non-G116V group. Median age of first symptom recognition prior to and independent of molecular testing results. All GALNS was 8.5 months in the G116V group and 12 months in the non- mutations were checked against reported single-nucleotide poly- G116V group. There were lumbar spine abnormalities at presen- morphism (SNPs). Results: Molecular testing of 163 patients tation in 100% of the G116V group and 77% of the non-G116V Abstracts 43 group, and lumbar spinal surgery has been done or is awaited in 1147 - Determination of Molecular Profile of 29% of the G116V group versus 9% of the non-G116V group. Colombian Patients With Diagnosis of The incidence of cervical cord compression was similar across Mucopolysaccharidosis Type VI: Maroteaux both the groups but was first noted earlier (median 30 months vs 113 months) and led to earlier intervention (median 5 years Lamy Syndrome vs 10.5 years) in the G116V group. There have been 4 deaths in Johanna C. Acosta Guio1, Gustavo Giraldo2, Paola Ayala2, the G116V group (median 8.6 years) compared to 1 in the non- 2 1 G116V group (at 23 years). Conclusion: The G116V mutation Juan Carlos Prieto , and Reggie Garcia is a common mutation among patients with MPS-IVA who origi- 1Instituto de Investigacioń en Nutricioń, Genetica´ y Metabolismo de nate from the Saleh Khana region of Pakistan and is associated la Universidad el Bosque, Inst, Bogota´, Colombia with a more severe spinal phenotype than other mutations. 2Instituto de Genetica´ de la Pontificia Universidad javeriana, Bogota´, Colombia 1145 - Analysis of Pathogenic Introduction: Maroteaux Lamy syndrome (Mucopolysacchari- dosis VI [MPS-VI]; Online Mendelian Inheritance in Man # Mutations, Disease Progression, and 253200) is a lysosomal storage disease characterized by systema- Antibody Response to Idursulfase in 17 tic clinical manifestations and significant functional damage. The Dutch Patients With reported worldwide incidence is 1:248.000 to 1:300.000 live Mucopolysaccharidosis II births, and in Colombia 27 cases are known and 10 belong to indi- genous groups. To date, 133 mutations have been reported: 100 Audrey Vollebregt1, Marianne Hoogeveen-Westerveld2, missense/nonsense, 9 in splicing site 9, 17 small deletions, and Marian A. Kroos2, George J. Ruijter1, Iris Plug1, Ans T. van 3smallinsertions.Materials and Method: Observational der Ploeg1, and Pim WWM Pijnappel1 description of a cohort of patients. Population and sample: Con- firmed patients with decreased enzyme activity in leukocytes 1 Center for Lysosomal and Metabolic Diseases & Department of arylsulfatase B (ARSB). Methodology: With previous signature Pediatrics, Erasmus MC-Sophia, Rotterdam, the Netherlands of the informed consent, sample of peripheral blood was taken. 2 Department of Clinical Genetics, Molecular Stem Cell Biology, DNA extraction and amplification: DNA extraction by salting- Erasmus MC, Rotterdam, the Netherlands out method, conventional polymerase chain reaction for all exons Introduction: Mucopolysaccharidosis type II (MPS-II; in the gene ARSB, reagents from Promega (Fitchburg, Wiscon- Hunter) is a rare X-linked lysosomal storage disorder caused sin)and Thermocycler BIO-RAD (Hercules, California). Sequen- by the deficiency of iduronate-2-sulfatase (I2S), leading to cing: sequencing of interest regions in the gene ARSB by a accumulation of glycosaminoglycans (GAGs). Clinical capillary sequencer; analysis of sequences using bioinformatic symptoms include short stature, coarse facial features, ivory methods. Results:In all, 13 patients were studied; to date, sequen- skin lesions, mental impairment, hepatosplenomegaly, and cing of 4 exons in 7 patients have been performed, finding in cardiac valve abnormalities. Objective: To link the geno- patient 3 a variant of exon 2, not previously reported, types of 17 Dutch patients with MPS-II to biochemical and c.1618A>C p.H111P. The Polyphen2, Mutation taster, Mustab, clinical parameters, including the antibody response to Panther, and Provean programs were run, evaluating the effect enzyme replacement therapy (ERT). Methods: The effects on protein, finding a highly deleterious variation. Variants in exon of I2S mutations on enzyme activity and processing were 5 were identified: Patient 1 rs101598; patient 2, rs101598 and determined in a transient expression system. Urinary GAG rs1065757; patient 4, rs1065757; patient 5, rs1065757; and levels were measured. Antibody levels were determined at patient 6, rs1065757. The sequences of the remaining 4 exons for several time points during ERT using enzyme-linked immu- the initial 7 patients and the 8 exons of the remaining 6 patients are nosorbent assay. Results: A total of 15 different pathogenic currently running. Conclusion: In the samples analyzed to date, a mutations were identified. These included 2 total gene dele- potentially pathogenic variant in exon 2, c.1618A>C p.H111P, tions, 3 small deletions, 1 nonsense, and 9 missense muta- not previously reported in the literature, was identified; the tions. Six mutations were novel. The effects of these sequencing of the remaining exons is in process. mutations on processing and activity of I2S in vitro were studied. All patients developed a modest antibody response to idursulfase within 12 weeks of treatment. Within the 1152 - Mutation Spectrum and Report of 4 group of 17 patients, the severity and onset of clinical Novel Mutations in Iduronate-2-Sulfatase Gene symptoms varied from mild symptoms with no mental in Indian Patients With Hunter Syndrome impairment to a severe progressive disease phenotype with mental retardation. Conclusion: This study provides Gaurav Verma1, Madhulika Kabra1, Neerja Gupta1, insight into the phenotype–genotype relationship in MPS- 1 1 1 II in the Dutch population. The antibody response to ERT Shivaram S. Shastri , Pallavi Mishra , Punt Kaur , Savita 1 1 1 was mild. Sapra , Madhumita Roychowdhury , and Sheffali Gulati 44 Journal of Inborn Errors of Metabolism & Screening

1Department of Pediatrics, All India Institute of Medical Sciences, processes have led, in recent years, to establish prediction New Delhi, India models for change in gene frequencies from bioinformatics analysis in order to sponsor screening programs and clinical Introduction: Mucopolysaccharidosis type-II (MPS-II; Hunter intervention at the population level. Objectives: To deter- syndrome) is an uncommon X-linked recessive multisystem dis- mine gene model variability in the iduronate-2-sulfatase order with significant variability in both age of onset and rate of (IDS) gene in patients with mucopolysaccharidosis type II progression. It is caused by the deficiency in the activity of the (MPS-II) and their families. Methods: From DNA sequencing lysosomal enzyme, iduronate-2-sulfatase (IDS), synthesized by results for the IDS gene in patients with MPS and their fam- the 24 kb long IDS gene, located at Xq28. Objective: To identify ilies, bioinformatics analysis with PolyPhen-2 and MEGA the mutation spectrum of IDS gene in Indian patients with MPS- V6.0 software packages were conducted to establish the effect II. Method: Twenty-two patients were recruited from 19 unre- of gene variants in the pathogenesis and to build a model of lated families after institutional ethics committee approval and evolution in the gene of interest on the population group informed consent based on the deficient leukocyte IDS levels. screened. Results: A group of mutations and polymorphisms, Genomic DNA was amplified by polymerase chain reaction using some of them previously reported in the literature and other 9 sets of primers that covered the entire coding region of the IDS de novo, were characterized. Their significance and effect on gene, flanking intronic splice regions and 50 and 30 untranslated the protein product of the IDS gene were determined. Finally, regions. Bidirectional Sanger-sequencing was performed using the presence of a recent founder effect for frequently allelic ABI 3130 Genetic Analyzer (Life technologies, Carlsbad, Cali- variants was established, showing that action of genetic drift fornia). Sequences were analyzed using National Center for Bio- in medium term on these variants will increase the frequency technology Information Basic Local Alignment Search Tool. and likely drive to a change in the incidence of MPS-II in the Results and Discussion: Based upon the phenotypic analysis Colombian southwestern region. Conclusion: In the medium of 22 patients, 18 patients were classified as severe MPS-II. Muta- term, the incidence of MPS in colombian southwestern popu- tions were identified in 10 families of19. Missense (3 of 19, 16%), lation is expected to increase, which warrants the immediate nonsense (2 of 19, 10%), splice site (2 of 19, 10%), small inser- decision making of public health, to implement a plan of sur- tion, small duplication, and indel (1 of 19, 5%) each were identi- veillance through neonatal screening. fied. Four mutations, c.1248C>T, c.205_206insAAAACTG GCAT, c.1435_1456dupAAGCCGAGTTTAAAAGATATA A, and c.1442delGinsTC, were novel and predicted to be 1155 - Mutation p.T500A in Exon 15 of the pathogenic. Nonsense mutations were associated with severe GLB1 Gene is not Prognostic for Morquio B phenotype in 2 patients. Prenatal diagnosis was done in 1 fam- Disease ily and the fetus was found to be a carrier. Majority of the mutations (4 of 19, 21%), though nonrecurrent, were in exon 9 and Eduard Paschke1, Roberto Giugliani2, Charles Marques- its flanking splice-site region. The IDS/IDS2 recombination 3 4 4 has not yet been tested, and this could be the main reason for Lourenco , Karl Paul , and Werner Windischhofer not finding mutations in the remaining 9 families. Conclusion: 1Department of Pediatrics, Medical University of Graz, Graz, Austria Mutation analysis of IDS gene is helpful in making a specific 2Medical Genetics Service, HCPA and Department of Genetics, diagnosis, carrier testing, and prenatal diagnosis. No specific UFRGS, Porto Alegre, Brazil genotype–phenotype correlation was observed. Exon 9 3Neurology Service, Hospital das Clinicas, FMRP-USP, Ribeirao Preto, appears to be the mutational hot spot in our Indian patients. Brazil 4Department of Pediatrics, Medical University of Graz, Graz, Austria 1153 - A Personalized Clinical Genomics Introduction: Alterations in the GLB1 gene are found in a Approach to Estimate Gene Stability on neurodegenerative disorder, GM1 gangliosidosis (GM1), and in Morquio B disease (MBD) with skeletal dysplasia and nor- Iduronate-2-Sulfatase in a Colombian South- mal central nervous system (CNS) function. At least 2 GLB1 western Population Affected With Mucopo- alleles, p.W273L and p.T500A, were so far reported as being lysaccharidosis Type II prognostic for the MBD phenotype. p.W273L was found in homozygous and heterozygous MBD, never detected in 1 2 1 Jose M. Satizabal , Lina J. Moreno , Adalberto Sa´nchez , GM1, and biochemically related to normal amounts of lysoso- Julio C. Montoya1, and Felipe Garcı´a1 mally located gene products with specific catalytic impairment of keratan sulfate degradation. In contrast, only 2 previous 1Universidad del Valle Escuela de Ciencias Ba´sicas, Valle Del Cauca, reports on 3 European cases suggested a phenotype- Colombia determining role for p.T500A. Although 2 of them were 2Universidad del Valle Departamento de Pediatria, Genomics, Valle unequivocally classified as having the specific dysostosis and Del Cauca, Colombia normal CNS function, a third one had minor, possibly nonge- Introduction: The evaluation and characterization of the netic mental retardation. We now can add further information variability in gene sequences associated with disease on 3 heterozygote p.T500A carriers from Brazil. Methods: Abstracts 45

Phenotyping of patients using a standardized protocol as well nondegraded material in lysosomes which lead to skeletal as biochemical and genetic diagnosis was done as previously abnormalities, psychomotor retardation, and cardiorespiratory published.1 Results: Three Brazilian males (A, B, and C), 7, complications. A considerable variation in the onset and severity 31, and 39 years of age, were found to be heterozygote for of the clinical phenotypes are observed. Objectives: To describe p.T500A [c.1498A>G] and a small insertion, c.1577dupG, the a Brazilian patient with ML-III a/b presenting 2 novel mutations most common GLB1 allele in Brazil. Causing a frameshift and in GNPTAB and analysis of the mutant messenger RNA truncated gene product (p.Gly526GlyfsX5) and affecting a func- (mRNA) and protein. Methods: GNPTAB geonomic DNA from tionally essential domain in exon 16, this allele causes severe the affected family was analyzed. Pathogenic mutations were infantile GM1 in homozygous patients. Patients with the pheno- inserted into a wild-type complementary DNA expression con- type p.T500A/c.1577dupG may therefore be regarded as func- struct. Expression studies, proteolytic activation, and subcellular tional homozygotes for p.Thr500Ala. Although expected to localization analysis of mutant a and b-subunits by real-time express the MBD phenotype, only 2 of them (A and C) were neu- polymerase chain reaction, Western blotting, and immunofluor- rologically unaffected. Patient B developed speech difficulties at escence microscopy were performed. Results: A 2-year-old age 3 and thereafter mild psychomotor delay, neurological boy born from nonconsanguineous parents was presented for regression, and low normal intelligence. Conclusion: p.T500A clinical genetic evaluation of suspected mucopolysaccharidoses. is not prognostic for MBD. With respect to upcoming therapies, The biochemical and clinical diagnosis was suggestive of patient databases are required to elucidate the full genetic spec- ML-III. Genomic GNPTAB sequencing revealed that the trum of neurologically unaffected GLB1 phenotypes. patient was compound heterozygous for the novel mutations c.1931_1932CA>TG (p.T644 M) and c.3668_3670delCTA (p.T1223del). The amino acid substitution T644M affected a 1158 - Genotype–Phenotype Correlation in potential N-glycosylation site, whereas the mutation p.T1223del Mucolipidosis III ␣-β: A comprehensive Study leads to amino acid deletion in the second membrane domain of of a Brazilian Patient Exhibiting Novel the a/b-subunit precursor. Analysis of mutant mRNA expression showed no significant differences in comparison with controls. GNPTAB Mutations The protein expression, proteolytic cleavage, and subcellular localization of both mutants were comparable to the wild-type Ida Vanessa Doederlein Schwartz1, Renata V. Velho2, 3 4 protein, but the enzyme activity was different than that of con- Fernanda Sperb-Ludwig , Raffaella De Pace , Taciane trols. Conclusion: Our data extend the knowledge about the 2 5 6 Alegra , Nataniel F Ludwig , Charles M. Lourenço , structural requirements for stability, intracellular transport, and Thomas Braulke7, and Sandra Pohl7 proteolytic activation of the GlcNAc-1-phosphotransferase that contribute to understanding of genotype–phenotype correlations 1Department of Genetics and Molecular Biology, Universidade in patients with ML-II/-III a/b. Federal do Rio Grande do Sul, Porto Alegre, Brazil 2PGP in Genetics and Molecular Biology, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil 1169 - Mutational Spectrum in a Sample of 3 PGP in Healthy Sciences, Universidade Federal do Rio Grande do Mexican Patients With Sul, Porto Alegre, Brazil Mucopolysaccharidosis Type VI 4Section Biochemistry, Children’s Hospital, University Medical Center Hamburg-Eppendorf, Hamburg, Germany 1 5 Miguel Angel Alcantara , and Ariadna Gonzalez-Del Medical Genetics Service of Hospital de Clıńicas de Porto Alegre, 1 Porto Alegre, Brazil Angel 6Hospital de Clıńicas de Ribeiraõ Preto, Universidade de Saõ Paulo, 1Department of Human Genetics, National Institute of Pediatrics, Saõ Paulo, Brazil Mexico City, Mexico 7Section Biochemistry, Children’s Hospital, University Medical Center Introduction: Mucopolysaccharidosis type VI (MPS-VI) is an Hamburg-Eppendorf, Hamburg, Germany autosomal recessive disorder caused by a deficiency of arylsul- Introduction: Mucolipidoses (ML) II and III a/b are autosomal fatase B (ARSB). More than 130 mutations have been identi- recessive disorders caused by GNPTAB mutations. GNPTAB fied in the ARSB gene and 75% are point mutations. In encodes the a and b-subunit precursor of membrane-bound Mexico, the incidence, prevalence, and mutational spectrum N-acetyl-D-glucosamine 1 (GlcNAc-1) phosphotransferase that of MPS-VI are unknown. Objective: To describe the ARSB is synthesized in the endoplasmic reticulum and transported to genotypes in a sample of Mexican patients with MPS-VI. the Golgi apparatus for proteolytic activation. The GlcNAc-1- Materials and Methods: Ten nonrelated patients with clinical phosphotransferase catalyzes the formation of mannose 6- suspicion of MPS-VI were included; only 3 of them were phosphate targeting signals on soluble lysosomal enzymes. referred with a decreased ARSB activity. Fully automated Patients with ML-II/III a/b are biochemically characterized by sequencing of the 8 exons and exon–intron boundaries of missorting of lysosomal enzymes and the accumulation of ARSB (RefSeq NG_007089.1, NM_000046.3) was performed 46 Journal of Inborn Errors of Metabolism & Screening using genomic DNA (dried blood spot or total blood). Results: in IDUA gene. The c.1205G>A is observed in 50% of mutant Seven pathogenic alleles were identified, 5 of them are not alleles in Northern Europe and Spain, and c.1598C>G is observed enlisted in HGMD and MPS6 databases: c.309C>A in 10% of IDUA mutant alleles in Spain. In accordance, in our (p.Tyr103*), c.257A>T (p.Tyr86Phe), c.655G>C (p.Ala219- study, these mutations were the most frequent and together Pro), c.980G>A (p.Arg327Gln), c.176A>G (p.Asp59Gly), and represent the 50% of mutant alleles observed. The third most c.904_905inv (p.Gly302Pro). Homozygous genotypes were frequent mutation was the novel c.539G>C, this finding could more prevalent (N ¼ 8 patients) than compound heterozygous suggest the presence of a different mutational spectrum of IDUA genotypes (N ¼ 2 patients). Point mutations account for 70% of gene in Mexican population due to its heterogeneity genetic MPS-VI alleles, and c.904_905inv comprises 6 alleles (30%,3 background. Acknowledgments: SANOFI-Genzyme México homozygous patients). Novel missense mutations affect the for their financial support to perform the molecular studies. sulfatase superfamily domain; PolyPhen and SIFT analyses predicted them as damaging. Discussion: Predominance of point and novel mutations is in agreement with the mutational 1174 - Identification of a Novel Mutation in ARSB spectrum and the common finding of ‘‘private’’ muta- the Human ARSB Gene on Chromosome tions in MPS-VI. Genotype–phenotype correlation is necessary 5q14.1 for Patients With Autosomal for the pathogenic classification of novel mutations. To our Recessive Mucopolysaccharidosis Type VI in knowledge, microinversions are not reported in MPS-VI, and predominance of c.904_905inv suggests that this could be a Southwest Colombia founder allele; haplotype analysis is currently in process. Since Maria Amparo Acosta1, Ramon Lago-Lestoń2, Francisco 2 mutations were identified, molecular study conducted in 2 3 patients with clinical suspicion and/or enzymatic diagnosis of Barros-Angueira , and Angel Marıá Carracedo Alvarez MPS-VI is considered a reliable, accurate, and rapid diagnostic 1Pediatrics Department, College of Medicine, University of Cauca, test now available in Mexico. Acknowledgments: BioMarin Popayań, Colombia México and Asociacioń ‘‘Pide un deseo’’ for their financial 2Clinical Hospital of Santiago de Compostela, Galicia, Spain support to perform the molecular studies. 3Pathology Department, College of Medicine, University of Santiago de Compostela, Galicia, Spain

1170 - ␣-L-Iduronidase Genotype in a Sample Introduction: The mucopolysaccharidosis type VI (MPS-VI) or of Mexican Patients With Maroteaux-Lamy syndrome is a recessive multisystemic pro- Mucopolysaccharidosis Type I gressive lysosomic storage disease caused by the deficiency of N-acetylgalactosamine 4-sulfatase enzyme. In Latin America, Ariadna Gonzalez-Del Angel1, and Miguel Angel Alcantara1 few studies have been related to the ethnic origin of patients with MPS-VI, but a difference has been noted in the incidence or pre- 1DNA-GEN, SC valence for the region. A total of 32 patients with MPS-VI are Introduction: Mucopolysaccharidosis type I (MPS-I) is an auto- identified in Colombia and 16 in the Department of Cauca, corresponding to 50% of the total cases with Maroteaux-Lamy syn- somal recessive disorder caused by the deficiency of a-L-iduronidase (IDUA) coded by the IDUA gene located on 4p16.3. More drome registered in the country. All 16 patients were identified than 100 different mutations have been reported and most of them clinically and by enzyme assay. Methods: DNA sequencing of 2 are private, and due to the great allelic heterogeneity described, of these individuals belonging to Guambiano Amerindian shelter national screening studies are required. Objective: To describe with strong inbreeding. Results: Molecular characterization of the IDUA genotype in a sample of Mexican patients with the mutation in 2 patients with severe form of MPS-VI and their MPS-I. Materials and Methods: Fourteen patients with clinical families by sequencing indicated homozygous or heterozygous diagnosis of MPS-I were included. Fully automated sequencing for the p.Ser403X mutation, which was never reported before. of the 14 exons and exon–intron boundaries of IDUA were In addition, we report the same haplotype in 2 patients and their performed using genomic DNA (dried blood spot or total blood). heterozygous relatives when N-acetylgalactosamine 4-sulfatase Results: The 2 mutant alleles were identified in all patients. gene was analyzed with intragenic single-nucleotide polymorph- Eleven genotypes due to the presence of 11 pathogenic alleles isms. Conclusion: These results together with the genealogy were observed. The compound heterozygous genotype was the analysis strongly suggest an inbreeding effect in this population. most common (n ¼ 12 patients). Point mutations were observed in 22 alleles, and the most common were c.1205G>A (n ¼ 8) and 1177 - Use of the Illumina TruSight Inherited c.1598C>G (n ¼ 6). Four mutations have not been described before: c.539G>C (p.Trp180Ser), c.525G>A (p.Trp175*), Diseases Panel to Assist in the Diagnosis of c.901G>C (p.Asp301His), and c.1402 þ 1G>C. Novel missense Lysosomal Storage Disorders mutation analysis with PolyPhen and SIFT predicted them as 1 1 1 pathogenic. Discussion: The presence of 11 alleles in our study Michael J. Fietz , Kristian Brion , Tomothy Pyragius , and is in agreement with the great genetic heterogeneity described Karin Kassahn1 Abstracts 47

1SA Pathology, North Adelaide, Australia pattern related to a low or no IDS activity. We reported a pattern of transitional mutation c.438C>T in the relative women of Introduction: Mutation studies play various important roles in patients with MPS-II caused by point mutations c.641C>T and the diagnosis and management of lysosomal storage disorders c.1122C>T. From several bioinformatics analyses, we found an (LSDs). For most LSDs, mutation testing is performed after association between the inherited deamination mechanisms, obtaining a biochemical diagnosis and is used to confirm the responsible to avoid skewed X inactivation, and transitional diagnosis to provide prognostic information or to assist with mutations in pathogenic spots along IDS gene. Besides, data anal- family or prenatal testing. However, for some LSDs, mutation ysis predicted a possible increase in pathogenic mutations on IDS testing is the only means of obtaining a definitive diagnosis. gene. We consider this finding very valuable to propose a broad Objective: To assess the suitability of the 550-gene Illumina screening of methylation target spots in X chromosome of fertile TruSight Inherited Disease Panel (Illumina, San Diego, Cali- females. Results from these screening tests would help to prevent fornia) for the rapid and efficient detection of causative muta- an increase in allele frequency in X-linked diseases such as MPS, tions in patients with an LSD. Methods: DNA samples from Lesch-Nyhan syndrome, and Duchenne muscular dystrophy. patients with LSD having known causative mutations or from patients with LSD having a biochemical diagnosis without known mutations or from patients with a clinical suspicion of a relevant LSD were used for validation and testing of the 1196 - Development of a Protocol for Inherited Disease Panel. Samples were processed according Identification of Mutations in Brazilian to the manufacturer’s instructions, sequenced using the Illu- Patients with Mucolipidosis II/III mina MiSeq Sequencing System, and the results analyzed using the Illumina VariantStudio Data Analysis Software. Results: Ida V. D. Schwartz1, Nataniel F. Ludwig2, Fernanda S. Samples from a number of patients with known disease- Ludwig1, Renata V. Velho1, Carolina U. Cruz2, and U´rsula causing mutations were examined, revealing that, with the 2 exception of the GBA gene (Gaucher disease), the Inherited Dis- S. Matte ease Panel reliably detected single-nucleotide changes and small 1Universida Federal do Rio Grande do Sul, Porto Alegre, Brazil insertions or deletions. Subsequent analysis has enabled the 2Hospital de Clıńicas de Porto Alegre, Porto Alegre, Brazil detection of the causative mutations in patients affected by Introduction: Mucolipidoses II and III (ML II/III a/b)is Niemann-Pick disease type C and I-cell disease. Further, an autosomal recessive disease caused by mutations in the detection of mutations in the MCOLN1 and CLN6 genes, N-acetylglucosamine-1-phosphate transferase, a and b subunits respectively, has confirmed clinical diagnoses of mucolipi- (GNPTAB) gene (MN_024312.3) located on chromosome dosis IV and late-infantile neuronal ceroid lipofuscinosis. 12q23.3. This gene encodes 2 subunits (a and b)ofN- Conclusion: Analysis of the TruSight Inherited Disease acetylglucosamine-1-phosphotransferase, which adds a key Panel has revealed its ability to rapidly and effectively marker responsible for the recognition of the residue of man- detect single-nucleotide changes and small insertions/dele- nose 6-phosphate that allows lysosomal hydrolases to enter the tions in various LSD genes. However, the results have indi- lysosome. Objective: To develop a protocol for identification cated that the system may not be effective in detecting of GNPTAB mutations to be applied in Brazilian patients larger insertions/deletions or in analyzing genes with closely with biochemical diagnosis, or suspect, of ML II/III a/b. related pseudogenes, for example, GBA. Methodology: Retrospective analysis of mutations reported in 16 Brazilian patients with ML II/III a/b who had been pre- 1193 - Methylation of c.438C>T SNP on IDS viously investigated by our group through sequencing of GNPTAB and had their genotype identified. Results: Twelve Gene Would Lead to a Deamination Cascade different mutations were reported in patients analyzed, the Along Gene Sequence Responsible for an most frequent being c.3503_3504delTC (allele frequency ¼ Increase in Transitional Mutations 37.5%, exon 19). The exons with a higher rate of pathogenic variations are exon 19, exon 13 (4 mutations corresponding 1 1 2 Jose M. Satizabal , Adalberto Sanchez , Lina J. Moreno , to 20% of alleles), and exon 10 (3 mutations corresponding Julio C. Montoya1, and Felipe Garcıá1 to 12.5% of alleles), followed by exons 3, 12, and 14 (1 mutation each). Discussion/Conclusion: We suggest exon 1Universidad del Valle Escuela de Ciencias Ba´sicas, Valle Del Cauca, 19 of GNPTAB should be the first one to be analyzed, fol- Colombia lowed by exons 13 and 10, and, finally, by exons 3, 12, and 2Universidad del Valle Departamento de Pediatrıá – Genomics, Valle 14. If we do not find any mutation in these exons, the Del Cauca, Colombia remaining exons should be analyzed. The use of a protocol Several authors have reported the role of DNA methylation on analysis for DNA diagnosis has shown great importance, iduronate 2-sulfatase (IDS) gene as a possible explanation for X since it decreases the time employed in the analysis and chromosome inactivation. Besides, patients with mucopolysac- allows reduction in costs. Support: FIPE-HCPA, CNPq, charidosis (MPS) exhibit a skewed X chromosome-inactivation and FAPERGS. 48 Journal of Inborn Errors of Metabolism & Screening

1198 - Whole-Exome Sequencing for and catalytic activity of the mutant enzyme. Support: Molecular Diagnosis of Mucolipidosis II/III ␣/β FIPE/HCPA, FAPERGS, and CNPq. Ida V. D. Schwartz1, Fernanda S. Ludwig1, Taciane Alegra1, Renata V. Velho1, Nataniel F. Ludwig2, Chong Ae 1200 - Haplotype Analysis of Brazilian Patients Kim3, Fernando Kok4, Joaõ P. Kitajima4, Eline van Meel5, With Mucopolysaccharidosis Type IIIC Reveals and Stuart Kornfeld5 Possible Founder Effects of HGSNAT Mutations 1 Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil 1 2 2 Carla Martins , Sandra Leistner-Segal , Jean-Francois Hospital de Clıńicas de Porto Alegre, Porto Alegre, Brazil 3 2 3Universidade de Saõ Paulo, Saõ Paulo, Brazil Lefe`bvre , Roberto Giugliani , and Alexey V. 3 4Mendelics Genomic Analysis, Saõ Paulo, Brazil Pshezhetsky 5 Washington University School of Medicine, St Louis, MO, USA 1Department of Biochemistry, University of Montreal, Montreal,´ Objectives: To evaluate the reliability and feasibility of Canada 2 molecular diagnosis by whole-exome sequencing (WES) of Serviço de Genetica´ Medica,´ Hospital de Clıńicas de Porto Alegre mucolipidosis II/III (ML II/III), a genetically heterogeneous (HCPA), Porto Alegre, Brazil 3 autosomal recessive condition caused by mutations in Division of Medical Genetics, Sainte-Justine University Hospital, N-acetylglucosamine-1-phosphate transferase, a and b Research Center, Montreal, Canada subunits (GNPTAB) or N-acetylglucosamine-1-phosphate Introduction: Mucopolysaccharidosis type IIIC (MPS-IIIC) is transferase, g subunit (GNPTG). Methods: The patient, an an autosomal recessive genetic disease caused by mutations in the 18-year-old male born to nonconsanguineous parents, had heparan sulfate acetyl-CoA:a-glucosaminide N-acetyltransferase clinical features typical of ML II/III. Previous biochemical (HGSNAT ) gene. Sixty-three mutations described so far alter the investigation showed a very high activity of plasma lysoso- productionand/oractivity ofthe HGSNAT enzyme, leading to the mal hydrolases and the presence of phosphorylated residues accumulation of heparan sulfate in the lysosome. Previously of mannose-6-phosphate in cation-independent mannose (Martins et al, in Proc. 12th International symposium on MPS and 6-phosphate receptor affinity column. Peripheral blood was related diseases, Noordwijkerhout, the Netherlands, 2012), we extracted using Easy DNA kit (Invitrogen). Whole-exome analyzed molecular defects in 8 Brazilian patients diagnosed sequencing was performed by capturing 200 000 exons clinically and biochemically with MPS-IIIC and found that of 20 500 genes with Nextera Exome Capture system, fol- >65% of the mutant alleles carried 4 mutations (c.234 þ 1G>A, lowed by the next-generation sequencing using illumina c.372-2A>G, c.525dupT, and p.S541L) previously identified in HiSeq2500 (Illumina, San Diego, California). Sanger Portuguese patients, while the remaining presented 2 novel muta- sequencing in the patient and parents validated the WES tions, c.1348delG and p.N258I. Considering the major contribu- results. Detected variants were analyzed using the algo- tion of Portuguese immigrants to the Brazilian genetic pool, we rithms SIFT and PolyPhen2 for prediction of functional hypothesized that the mutation spectrum of the Brazilian patients impact. Results: Whole-exome sequencing generated 64 with MPS-IIIC could be due to founder effects. Objective: To test 363 166 sequences, each target base was read on average this hypothesis by haplotype analysis. Methods: Haplotypes 92,and94% of the target bases were read at least 10. were defined by 21 intragenic single-nucleotide polymorphisms Two heterozygous variants in GNPTAB were identified— in the HGSNAT gene. PHASE software (Chiago, Illinois) was c.1208T>C (p.Ile403Thr), which were previously reported used to infer the haplotypes. Besides the 8 Brazilian patients as deleterious, and the novel variant, c.1723 G>A with MPS-IIIC, we also analyzed the haplotypes in the previ- (p.Gly575Arg), which was not present among more than ously described patients carrying the same mutations (Hrˇebı´- 8000 normal controls, including 1000 Brazilians. No var- cˇek et al, 2006). The haplotypes of patients with MPS-III iants were found in both GNPTG and NAGPA genes. Aame were compared with those reported in HapMap database results were obtained using Sanger sequencing. The father (http://www.hapmap.org). Results: The haplotypes carrying was carrier of p.Ile403Thr and the mother of p.Gly575Arg. the c.234þ1G>A, c.372-2A>G, c.525dupT, and p.S541L It was probably predicted that PolyPhen-2 damaged both mutations are observed in both Brazilian and Portuguese mutations (respectively, 0.993 and 0.974). SIFT prediction patients. Besides the c.525dupT mutation exclusively confirmed the first mutation (p.Ile403Thr) as deleterious observed in Portuguese and Brazilian patients with MPS- and pointed the variant p.Gly575Arg as tolerated/neutral. IIIC, the haplotypes carrying the other 3 mutations are also Conclusion: Whole-exome sequencing is a reliable alterna- observed in other populations. Conclusion: Thepresenceand tive for molecular confirmationofMLII/IIIandcanrapidly frequency of the mutations identified in the Brazilian patients arrive at a diagnosis. Prediction of the pathogenicity of rare with MPS-IIIC are likely due to founder effects. The missense variants is still a problem, and functional studies c.525dupT mutation was most likely introduced in Brazil by might be necessary. In this regard, we plan to analyze the Portuguese immigrants and possibly also the c.234þ1G>A, expression, proteolytic activation, subcellular localization, c.372-2A>G, and p.S541L mutations. Abstracts 49

1207 - Deep Genotyping of the Iduronate 1UFRGS, Porto Alegre, Brazil 2-sulfatase Gene in Colombian Patients Introduction: Mucolipidoses II and III (ML II and III) are auto- With Hunter Syndrome somal recessive lysosomal disorders in which the essential mannose 6-phosphate recognition marker system is deficient. 1 2 3 Johanna Galvis , Jannet Gonzalez , Alfredo Uribe , and Objective: To evaluate the frequency of nonpathogenic variations Harvy Velasco1 in N-acetylglucosamine-1-phosphate transferase, a and b subunits (GNPTAB) gene in healthy controls. These variants have been pre- 1National University of Colombia, Bogota, Colombia viously described in Brazilian patients with ML II and III a/b. 2Pontifical Xavierian University, Bogota, Colombia Methods: DNA was extracted from peripheral blood of 100 anon- 3University of Los Andes, Bogota, Colombia ymous healthy donors using the Easy DNA kit (Invitrogen). Ten Introduction: Mucopolysaccharidosis type II (MPS-II) also intragenic polymorphisms have been analyzed (-41_-39delGGC, known as Hunter syndrome is an X-linked disorder caused by c.18G>A, c.27G>A, c.323þ20delT, 365þ96_97delGT, mutations in the iduronate 2-sulfatase (IDS) gene, an enzyme that c.365þ145C>T, c.1285-166G>A, c.1932A>G, c.3135þ5T>C, catalyzes the initial step in the catabolism of heparan and derma- and c.3336-25T>C). Results: Until now, analysis of 4 polymorph- tan sulfate. Mucopolysaccharidosis type II has significant allelic isms has been completed: c.365þ96_97delGT (allele frequency ¼ heterogeneity that limits the establishment of genotype–pheno- 43.5%, intron 4), c.365þ145C>T (allele frequency ¼ 46%,intron type correlations. This study assessed the clinical features in con- 4), c.1285-166G>A (allele frequency ¼ 64%, intron 10), and junction with deep genotyping in a group of Colombian patients c.3336-25T>C (allele frequency ¼ 44.5%, intron 17). The other with MPS-II and attemptedtoestablish a degree ofgenotype–phe- polymorphisms are still under analysis. Conclusion: This series notype correlation by employing bioinformatic tools. Methods: is the most extensive in terms of the number of polymorphisms Eighteen Colombian patients were included after obtaining analyzed for ML II and III. Based on the results, the GNPTAB gene informed consent. Clinical features including IDS activity were proved to be quite polymorphic. The most frequent alteration was registered for analysis. For genotyping, 3 different molecular c.1285-166G>A (intron 10). It is important to emphasize the study methodologies were applied (multiplex ligation-dependent probe of polymorphisms, because polymorphisms enable us to evaluate amplification, direct exonic sequencing, and restriction fragment the linkage disequilibrium of these alterations, generate haplotype length polymorphisms), which used genomic DNA from each analyses, and determine the origin of mutations. Support: CNPq, patient. Results: In this group of patients, 11% were non- FAPERGS, and FIPE-HCPA. neuronopathic and 89% were neuronopathic. A total of 13 mutations were identified, of which 6 were novel (c.548_564dup16, c.477insT, c.595_607del12, c. 549_562del13, c.182delC, and a 1216 - A Novel Disease Causing Mutation of complete deletion of exon 7). The frequency of common mutations (R468Q, Q465X, K347Q, K236N, S71N, R88H, and a Iduronate 2-sulfatase Gene in 2 Independent conversion phenomenon) was 53.85%. Molecular docking Families From Colombian Southwestern was performed on the wild-type and mutant IDS, finding Region changes in the enzyme–substrate interaction for the mutant 1 1 IDS. Conclusion: Age at diagnosis was similar to that reported Jose´ M. Satizabal , Adalberto Sanchez , and Lina J. in the literature. By employing the 3 methodologies, the geno- Moreno2 typing showed a sensibility of 100%. The frequency of novel 1Universidad del Valle, Escuela de Cencias Ba´sicas, Valle Del Cauca, mutations (46.15%) is similar to what has been reported else- Colombia where. The S71N mutation was frequent among the attenuated 2Universidad del Valle Departamento de Pediatrı´a Genomics, Valle phenotype, while private frameshift mutations and rearrange- Del Cauca, Colombia ments were seen in patients with severe phenotypes. The use of bioinformatic tools was of great utility to predict the reper- DNA sequencing of iduronate 2-sulfatase (IDS) gene was per- cussions of different mutations on the tridimensional structure formed on 2 independent families with members having Hun- of human IDS. However, given a small sample, the phenotype– ter disease. An unreported mutation that creates a shift in the genotype was not feasible; hence, larger group study samples readingframeatcodonD190inexon5ofIDS gene was are required. detected. The new frame ends in a stop codon at position 8 downstream. Bioinformatics analyses were performed using PolyPhen-2 and SIFT software packages. This mutation likely 1211 - Analysis of Nonpathogenic Alterations results in either a truncated protein or the loss of protein of the GNPTAB gene in the Brazilian synthesis. The mutation c.566dupT leads to a change in population p.D190Gfs*9 on IDS protein. Fluorometry assays of iduronate 2-sulfatase activity on a young male with Hunter disease Ida Vanessa Schwartz1, Vitor Bertolozzi Mendes1, and showed a pathological decreasing. A functional study would Fernanda Ludwig Sperb1 be performed to confirm pathogenic association. 50 Journal of Inborn Errors of Metabolism & Screening

6. Quality of Life/Pshycosocial specific in capturing the impact of the disease on self-care activities. However, questions in both the mobility and caregiving domains were deemed more specific and relevant. These patients’ 1010 - Bowen Oliver—A Life in Reflection perspectives bring more insight into understanding the tests’ results and their relevance in capturing the benefit of the treat- David Oliver1 ment. Although patients felt the generic and widely used EQ- 5D-5L was nonspecific to Morquio A, the domains assessed were 1Hornsby Heights, Sydney, Australia deemed to capture the relevant parameters. The pain tools (BPI- Bowen Oliver was a friendly, generous, and positive young SF and APPT) were considered to be appropriate, but patients man whose friendship greatly improved the lives of those struggled to objectively respond to the questions due to difficul- around him. Diagnosed with mucopolysaccharidosis type VI ties in remembering living without pain. Caregivers felt that ZBS (MPS-VI) at age 5, Bowen was fortunate to commence enzyme did not capture the impact on many areas of their daily caring replacement therapy (ERT) at age 9, thanks to the work of the activities such as the financial, family, and personal burden of car- Adelaide LDRU team, and this treatment opened up the possi- egiving and the overwhelming feeling of guilt associated with los- bility of a full and wonderful life. His health improved following personal time. Conclusion: The focus group highlighted the ing the commencement of ERT, enabling him to thrive through patient relevance of questions. Patient focus groups are recom- high school and enter university to study writing, international mended in developing any ‘‘burden of illness study.’’ Conflicts relations, and politics. Along the way, Bowen gathered a great of Interest: Christine Lavery received financial support in person group of friends around him and found joy in reading books, in or by the Society for Mucopolysaccharide Diseases from Bio- watching cinemas, and in photography. For many in the Austra- Marin in the following capacities: participant on advisory board, lian MPS community, Bowen was both a friend and an example patient access program for clinical trials, travel grants, and unrest- of what could be achieved in life despite the obstacles of MPS. ricted educational grants. Mohit Jain received financial support/ Bowen succumbed to a seizure at age 20, just as he was launch- salary as employee of BioMarin. Larisa Mihoreanu received ing into his adult life and enjoying all of the adventures that financial support/salary as employee of BioMarin. come with it. This poster is a reflection of Bowen’s life, through his own words, and the words of his family and friends who knew and loved him. It seeks to show just how special he was 1101 - A Workshop for Children With and how meaningful his contribution to this world truly was. Lysosomal Storage Disorders and Their Parents

1066 - Assessment of the Relevance of 1 1 Quality-of-Life and Activities-of-Daily-Living Shauna A. Kearney and Robert N. Jobe 1 Questions in Patients With Morquio Birmingham Children’s Hospital, Birmingham, United Kingdom A Syndrome (MPS-IVA) and Primary Carers: Objectives: (1) To explore children’s understanding of their A Focus Group Approach lysosomal storage disorder (LSD), the impact this has, and their feelings about this and (2) to explore the impact of caring for a Christine Lavery1, Larisa Mihoreanu2, and Mohit Jain2 child with an LSD, including mucopolysaccharidosis (MPS) disorders. Methods: (1) Two clinical psychologists facilitated 1Society for Mucopolysaccharides Diseases, Amersham, United parallel workshops for children, siblings, and their parents; (2) Kingdom diagnoses included MPS-I, MPS-IV, MPS-VI, and Pompe dis- 2BioMarin Europe Ltd, London, United Kingdom ease; (3) 2 males, 4 females, 2 siblings, and 5 parents; (4) age Objectives: To assess the relevance of patient-reported outcome range 7 to 12 years; (5) content included worksheets, group dis- and activities of daily living tools in capturing the impact of Mor- cussion, and role-play; (6) topics included are ‘‘me and my con- quio A syndrome on patient’s quality of life and functional ability. dition, things I can/cannot do, identifying and working with Methods: This study was undertaken to inform a ‘‘Morquio A feelings’’; (7) common themes were extracted from the analy- Burden of Illness Study.’’ Three focus groups of patients (N ¼ sis of group discussions; (8) parents shared their experiences, 6) and caregivers (N ¼ 8) were asked to assess the relevance of challenges, and what helped; and (9) participants formed a col- questions taken from the 5-level version of European QoL-5 lage of ‘‘a tree and leaves’’ to provide feedback about the Dimensions (EQ-5D-5L) questionnaire, mucopolysaccharidosis group. Results: The following themes emerged: (1) children Health Assessment Questionnaire (MPS-HAQ), Zarit Burden had a superficial (age appropriate) understanding of their disor- Scale (ZBS), the Brief Pain Inventory Short Form (BPI-SF), and der and did not want to know more; (2) feeling different and the Adolescent Pediatric Pain Tool (APPT). Results: Patients restricted in activities; (3) desire to have fun; (4) social isola- with Morquio A syndrome report constant challenges in life tion/wanting friendships; (5) parents experienced grief after related to mobility, pain, fatigue, and an environment poorly diagnosis, guilt, social isolation, pressure on time, and concerns adapted to their needs. Patients felt a quarter of the questions in about siblings; (6) maternal resilience and practical help influ- the self-care domain of the MPS-HAQ were neither relevant nor enced family functioning; (7) without exception, the children Abstracts 51 enjoyed the group, with comments (on the collage) such as attaining their career goals, and focused less on the medical ‘‘this was amazing,’’ ‘‘I liked talking to others,’’ ‘‘I want to impact of their disease. These findings suggest that after an ini- come again,’’ ‘‘it was nice letting my feelings out’’; (8) parents tial adaptation period, wheelchair users become more deter- enjoyed talking/listening to other parents, sharing their stress, mined as their disease progresses. Among children, those and having the chance to reflect on their feelings. Conclusion: NWCs enjoyed better social relationships and participated in Mental health is essential to the quality of life of children with more physical activities but had greater levels of exhaustion, LSDs and their families. In running workshops of this nature, less support at school, and more missed school days than the we provide the opportunity for emotional expression, education wheelchair users. Conclusion: Actively mobile adult patients surrounding their condition, and emotional support. This work- with Morquio A experience more independence, increased shop was very positively received by all involved and high- employment rate, and reduced emotional and psychological bur- lights the need to remain vigilant to the psychological needs den of the disease. In children, increased independence results in of these families. Conflicts of Interest: Shauna Kearney has greater social contact but less structured school assistance and received study grants and travel costs from Shire, Biomarin, more missed school days. Conflicts of Interest: (1) Christian Genzyme, and Merck Serono. Neither Shauna Kearney nor Hendriksz received consulting fees from BioMarin. Consultancy Robert Jobe have any conflicts of interest to disclose. for patient organizations, EMEA—paid travel grants to deliver lectures paid for by patient organizations; (2) Christine Lavery received an unrestricted educational grant. MPS Society 1104 - The Psychosocial Aspects of Morquio A received an unrestricted educational grant to support a patient Syndrome (MPS-IVA)—A Patient-Reported carer workshop in respect of this study. Christine Lavery did not Survey receive any payment personally; (3) Christina Lampe received travel support from BioMarin and speaker’s fee; (4) Lisa Bell 1 2 Christian J. Hendriksz , Christine Lavery , Christina is a paid employee and holds stocks of BioMarin Pharmaceutical Lampe3, Lisa Bell4, Andrew Olaye5, and Mohit Jain5 Inc; (5) Andrew Olaye is a paid employee and holds stocks of BioMarin Europe Ltd; (6) Lisa Bell is a paid employee and holds 1Manchester Academic Health Science Centre, Salford Royal stocks of BioMarin Europe Ltd. Foundation NHS Trust, Salford, United Kingdom 2The Society for Mucopolysaccharide Disease, Amersham, United Kingdom 1218 - Development of a Specific 3Villa Metabolica, Center of Pediatric and Adolescent Medicine, Questionnaire for Quality of Life of Patients Mainz, Germany With Mucopolysaccharidosis 4BioMarin Pharmaceutical Inc, San Rafael, CA, USA 5 BioMarin Europe Ltd, London, England Nicole Ruas Guarany1, Neusa Sica da Rocha2, Marcia 2 3 Objectives: To assess the psychosocial burden of Morquio A Gonçalves Ribeiro , Heber de Souza Maia Filho , and Ida syndrome among adults and children. Methods: A patient- Doederlein Schwartz2 reported outcome survey was undertaken in United Kingdom, 1Universidade Federal de Pelotas, Capaõ do Leaõ, Brazil Turkey, Spain, Germany, Brazil, and Colombia to assess the 2Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil burden of Morquio A among adults (18 years, N ¼ 27) and 3Universidade Federal Fluminense, Niteroí, Brazil children (5-17 years, N ¼ 36). The psychosocial burden of Morquio A was assessed by measuring disease impact on Introduction: Mucopolysaccharidosis (MPS) have different patient’s social life, emotional and psychological well-being, clinical manifestations that have impact on the quality of employment, and education using Likert-type response scales. life (QOL). So far, there are no specific instruments to assess Results: The psychosocial impact of Morquio A in adult the QOL of these patients. Objectives: To present the psycho- patients varied with wheelchair status. Patients not using metric properties of the field test of the MPS-QOL for the 3 wheelchairs (NWCs) reported greater optimism, independence versions: 8 to 12 years, 13 to 17 years, and >18 years. and motivation than patients using wheelchairs only when Methods: A controlled study with convenience sampling was needed (SWCs) or always (AWCs). Patients NWCs had higher performed with 144 Brazilian patients having different types employment rates; lower social, emotional, and psychological of MPS, age 8 years, with or without cognitive impairment, impacts on employment and education; and less difficulty in receiving, or not, enzyme replacement therapy (ERT), and 72 integrating with peers and maintaining friendship. Patients patients with other genetic diseases (osteogenesis imperfecta, SWCs reported the highest levels of anger, demotivation, frus- Gaucher disease, and phenylketonuria), were evaluated. For tration, and depression. Patients SWCs had the greatest diffi- both groups, the versions of MPS-QOL and generic instru- culties in beginning and maintaining relationships and ments for assessing QOL (WHOQOL-BREF-DIS and Ped- highest emotional and psychological impact on their employ- sQOL) were applied. Frequency analysis of the data was ment. Patients AWCs had greater confidence, less frustration, performed using analysis of ceiling, floor effect, and missing and anger than patients NWCs and SWCs. Patients AWCs had data for MPS-QOL items; internal reliability using Cronbach less difficulty in beginning relationships, were more driven in a; convergent validity between the MPS-QOL and the generic 52 Journal of Inborn Errors of Metabolism & Screening

QOL instruments using the Spearman correlation test; and dis- activities. Studies with larger sample sizes should be conducted criminant validity between the variables of interest and the to confirm our findings. MPS-QOL questionnaires through the Mann-Whitney U test. Results: The frequency analysis of the questions indicated the 1221 - Case Study: Assessing Psychosocial exclusion of the generic questions (ceiling effect). The Cronbach a coefficient was higher than .70 for the 3 questionnaires. The Patient With a Diagnosis of convergent validity indicated that there is a higher correlation Mucopolysaccharidosis Type I between MPS-QOL questionnaires than among generic QOL 1 1 instruments (patients with MPS). The discriminant validity Petruska O. B. Pereira , Izabel C. N. Souza , Raimunda showed that MPS-QOL was able to discriminate the differences H. F. Feio1, and Maiana A. Reis1 between the questionnaires by proxy, sex, type of MPS, group of 1 Hospital Universita´rio Bettina Ferro de Souza (HUBFS) – UFPA, patients, and treatment by ERT. Conclusion: The results indi- Para´, Brazil cate that the MPS-QOL questionnaires are appropriate, valid, and reliable when compared to generic instruments. The use of In order to perform psychosocial assessment of patients with these tools can help identify changes in QOL of patients with mucopolysaccharidosis type I, the Behavioral Inventories from MPS, being a possible marker of disease progression or clinical Aseba Patterns and the Test of Nonverbal Intelligence SON outcomes as specific treatments or supportive therapies. were used as instruments, which were applied to their guar- dians. The reports were applied annually in the period between 2009 and 2013. The results of the tests varied in their applica- 1219 - Mucopolysaccharidosis: Quality of Life tions, with indicators of clinical and borderline scores on items of Caregivers psychosocial and activities. Generally, the patient had more scores for depression, as well as alternations in intelligence Nicole Ruas Guarany1, Matheus Wilke2, Ana Paula scores, indicating different intelligence quotient coefficients Vanz3, and Ida Doederlein Swartz2 level, below the average and normal, what indicates problems 1 in school learning. The existence of treatment evasion in Universidade Federal de Pelotas, Capaõ do Leaõ, Brazil neurogenetics clinic, psychological service, and enzyme 2Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil 3 replacement therapy (ERT), in periods of depression, must be Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil considered. The discontinuation of clinical follow-up and infu- Introduction: Mucopolysaccharidosis (MPS) is a group of rare sion possibly reflected in the quality of life, worsening health genetic diseases caused by the deficiency of specific enzymes status and well-being, characterized by respiratory problems involved in glycosaminoglycans (GAGs) catabolism. The such as chronic rhinitis and motor worsening, with repercus- accumulation of GAGs in the body causes multisystemic sions on joint motion of hands and wrists. We can consider that abnormalities. The quality of life (QOL) is related to physical, the patient has reported normal scores (average, 79%), indicat- mental, and emotional well-being, and social relationships. A ing positive effects during ERT. An impact of this therapy in caregiver is anyone who supports or takes care of someone who this patient’s life is clearly the control of respiratory infections is ill or incapacitated, and in most cases, that person is a family and motor skills as well as positive coefficients that appear in member who is asked to provide most of the care. Objectives: Behavioral Tests and Intelligence Tests. Therefore, ERT asso- The aim of the study was to evaluate the QOL of caregivers of ciated with clinical follow-up allowed patients’ social living patients with MPS. Methods: Cross-sectional study, conveni- and their cognitive and social skills. ence sampling comprised mothers of patients with MPS seen at the Medical Genetics Service, Hospital de Clıńicas de Porto 7. Enzyme Replacement Therapy Alegre (HCPA), Brazil. WHOQOL-BREF was used for assessing QOL; its scores range from 0 (worst) to 100 (best). Results: This study included mothers of 13 patients with MPS 1006 - Mucopolysaccharidosis Type VI— (MPS-I ¼ 1, MPS-II ¼ 5, MPS-IIIA ¼ 1; MPS-IIIB ¼ 2, MPS- Treatment With Galsulfase: Our Experience IVA ¼ 3, and MPS-VI ¼ 1), and 2 mothers had more than 1 1 1 2 affected child (1 family with MPS-II and 1 with MPS-IVA, Jorge Sales Marques , Dalila Rocha , Vera Rocha , and respectively). The average score was 46.59. Considering the Helena Santos1 total sample, the physical domain showed the highest score 1Centro Hospitalar Vila Nova De GAIA/ESPINHO, Vila nova de Gaia, (mean ¼ 54.9) and the environmental ones showed the worst Portugal score (mean ¼ 34.11). Mothers of children with MPS-II 2Centro Hospitalar do Taˆmega e Sousa, Penafiel, Portugal showed the lowest QOL, with an average of 44.62 points. Conclusion: These data suggest that the QOL of mothers of Introduction: Mucopolysaccharidosis type VI (MPS-VI) is an patients with MPS is compromised. The lowest QOL of moth- autosomal recessive disorder. The deficient enzyme is arylsul- ers of individuals with MPS-II seems to be related to a more fatase B. Galsulfase is the replacement therapy. In our 14-year- severe symptomatology and greater need for help in daily old boy who was diagnosed with MPS-VI at 15 months of age, Abstracts 53 we checked clinical improvement during the treatment with on endurance, cardiopulmonary function, growth, survival, and galsulfase that began when he was 8 years old. Methods: The immunogenicity from clinical trials, 10-year follow-up (Resur- data analyzed were weight, height, head circumference, growth vey Study) and clinical surveillance program. Results: Endur- velocity, body mass index, coarse face, umbilical hernia, ingu- ance parameter in the 12-minute walk test (12MWT) showed inal hernia, hepatomegaly, hip dislocation, spinal cord com- significant improvement in mean walk distance of 92 m at pression, carpal tunnel syndrome, heart, lungs, vision and eye week 24 over placebo (clinical trials). After 6.8 years on fundi, hearing, endurance test, psychomotor development, and enzyme replacement therapy (ERT), patients (n ¼ 46) walked glycosaminoglycans (GAGs) in urine. Results: The height/ a mean of 65.7 m more (in 6MWT) compared to baseline weight and head circumference maintained the same percen- (Resurvey Study). Forced vital capacity (FVC) increased by tile, but the body mass reduced. The growth velocity was also 17% (n ¼ 33); and forced expiratory volume in 1 second the same. No change was observed in his coarse face appear- (FEV1) increased by 11% at 96 weeks (n ¼ 33; clinical trials). ance. Due to umbilical hernia and bilateral hip dislocation, he After 6.8 years of ERT, patients <13 years showed an increase had to undergo surgery 3 times, and after galsulfase therapy, in FVC by 68% (n ¼ 26) and in FEV1 by 55% (n ¼ 25), and no more relapse was observed. The patient was operated for those 13 years showed an increase in FVC by 12.8% (n ¼ inguinal hernia before we started the enzyme therapy. Hepato- 22) but FEV1 was maintained (n ¼ 22; Resurvey Study). Left megaly reduced from 6 to 3 cm. The patient had spinal cord ventricular function remained normal and intraventricular sep- compression and carpal tunnel syndrome. Electrocardiogram tal hypertrophy decreased after 96 weeks. Mitral valve stenosis/ was normal. Heart ultrasound improved from thick mitral and regurgitation and aortic valve stenosis remained unchanged aortic valve to normal structure. Forced expiratory volume in from baseline; aortic regurgitation increased but severity 1 second (FEV1)/FEV ratio increased from 85% to 97%.His increased from trace to mild. Growth rates improved in patients eyes still had moderate hipotransparency of the cornea. Hear- who started ERT at <6 years of age compared to the MPS-VI ing change was observed, that is, from transmission hearing growth curves; the largest improvement was seen in rapidly loss caused by hypertrophy of the adenoids to normal sounds progressing patients who started treatment at <3 years of age, after surgery. In the 12-minute walk, he showed improvement showing a mean additional growth of >10 cm at 5 years of age. and walked 575 m and he also finished the test. In the the 3- Treated patients had a 16.5% (17 of 103) mortality rate com- minute stairs climb, he climbed 6 more stairs. No improvement pared to 50% (7 of 14) in untreated patients. Seroconversion in development quotient was observed. The GAGs reduced did not correlate with incidence of adverse event (AE) or seri- during the treatment. Conclusion: Our case showed that galsul- ous adverse event (SAE) or decreased efficacy. Incidence of fase improves patient’s resistance, function of heart and lungs, AEs or SAEs has not changed since commercial availability avoiding relapse of hip dislocation and umbilical hernia and of galsulfase. Infusion-associated reactions occurred in >50% reducing liver size. It did not change the evolution of other of patients but were manageable with premeditations and/or severe complications probably because the treatment started altering ERT infusion rates. Conclusion: Available data sup- at the age of 8 years. What remains open is, if galsulfase was port galsulfase safety and demonstrate improvement in endur- started right after the diagnosis, the evolution of the clinical ance, cardiopulmonary function, growth, and long-term picture of our patient would be different? survival. Conflicts: Author Quartel is an employee and stock- holder of BioMarin. All other investigators provided consulting services, received research grants, and participated in advisory 1014 - Galsulfase for Mucopolysaccharidosis board meetings and received speaker honoraria and travel sup- Type VI: Analysis of Clinical Data Since 2000 port from BioMarin Pharmaceutical Inc. This study was supported by BioMarin Pharmaceutical Inc and, in part, with 1 2 Paul Harmatz , Christian Hendriksz , Roberto funds provided by the National Institutes of Health/National Giugliani3, Elizabeth Braunlin4, and Adrian Quartel5 Center for Research Resources (NIH/NCRR) CTSA grant UL1RR024131 (Dr Harmatz). 1Children’s Hospital & Research Center Oakland, Oakland, CA, USA 2Birmingham Children’s Hospital NHS Foundation Trust, Birmingham, United Kingdom 3 1018 - Impact of Long-Term Galsulfase Department of Genetics/UFRGS and INAGEMP, Medical Genetics Treatment on Survival of Patients With Service/HCPA, Porto Alegre, Brazil 4Pediatric Cardiology, University of Minnesota, Minneapolis, MN, Mucopolysaccharidosis Type VI USA 1 2 3 5BioMarin Pharmaceutical Inc, Novato, CA, USA Roberto Giugliani , Christina Lampe , Nathalie Guffon , David Ketteridge4, Elisa Leaõ-Teles5, James Wraith6, Objective: To summarize the efficacy and safety data of gal- Simon Jones6, Cheri Piscia-Nichols, Ping Lin7, Adrian sulfase (Naglazyme; BioMarin Pharmaceutical Inc, Novato, 7 8 California) in mucopolysaccharidosis type VI, a disorder Quartel , and Paul Harmatz caused by N-acetylgalactosamine-4-sulfatase deficiency. 1Department of Genetics/UFRGS and INAGEMP, Medical Genetics Methods: Summarized data reported on the effect of galsulfase Service/HCPA, Brazil 54 Journal of Inborn Errors of Metabolism & Screening

2Villa Metabolica, University Medical Center of the University of 1025 - The Improvement in CNS Defects in Mainz, Germany 3 MPS-II Mouse Via Systemic High-Dose Hoˆpital Femme Me`re Enfant, Bron, France Enzyme Replacement Therapy 4Women’s and Children’s Hospital, North Adelaide, Australia 5 Hospital Pedia´trico Integrado, Centro Hospitalar de S. Joa˜o, Porto, Sung Yoon Cho1, Youn Bae Sohn2, Dong-Kyu Jin3, and Portugal 4 6Manchester Centre for Genomic Medicine, St Mary’s Hospital, Ah-Ra Ko CMFT, University of Manchester, United Kingdom 1Samsung Medical Center, Seoul, Republic of Korea 7BioMarin Pharmaceutical Inc, Novato, CA, USA 2Department of Medical Genetics, Ajou University Hospital, Suwon, 8Children’s Hospital & Research Center Oakland, Oakland, CA, USA Korea 3Department of Pediatrics, Samsung Medical Center, Seoul, Korea Objective: To investigate the impact of long-term galsulfase 4Clinical Research Center, Samsung Biomedical Research Institute, (Naglazyme; BioMarin, Novato, California) enzyme replace- Seoul, Korea ment therapy (ERT) on survival of patients with mucopolysaccharidosis type VI (MPS-VI). Mucopolysaccharidosis type VI Introduction: Mucopolysaccharidosis type II (MPS-II), also is a progressive genetic disorder caused by the deficiency of known as Hunter syndrome, is a rare, X-linked lysosomal stor- N-acetylgalactosamine-4-sulfatase. Patients with rapidly pro- age disorder caused by a deficiency of iduronate-2-sulfatase gressive disease generally do not live beyond their second to (IDS), which is involved in the lysosomal degradation of glyco- third decade of life, whereas those with slowly progressive dis- saminoglycans (GAGs). Patients with MPS-II have a variety of ease may survive into their 30s and 50s. Pre-ERT urinary glyco- symptoms that affect all organs and may cause progressive cog- saminoglycan (uGAG) levels of > and 200 mg/mg creatinine nitive impairment. Although intravenous enzyme replacement (assayed using Whitley et al [Clin Chem 1989] method) were therapy (ERT) is available, amelioration of central nervous sys- used to define rapidly and slowly progressive disease (Swiedler tem (CNS) defect by ERT is limited by the blood–brain barrier. et al, Am J Med Gen A 2005). Methods: Survival data were col- Therefore, it is important to simultaneously treat the visceral lected for 117 patients (ERT: n ¼ 103; naive: n ¼ 14) of the 121 and CNS defects in the patients with MPS-II. This study was patients who previously participated in a cross-sectional study in performed to investigate responses in brain to high doses of 2001 to 2002 (Swiedler et al, 2005) and compared by Kaplan- systemic infusion of recombinant human IDS (rh-IDS) in mice. Meier (KM) analysis. Cox proportional hazard model was used Methods: High dose of systemic ERT was given in 3 different to calculate ERT impact on survival and expressed as hazard doses (1, 5, and 10 mg/kg weekly) of rh-IDS for 3 different ratio (HR) with 95% confidence interval (95%CI); the multivari- durations (1 month, 3 months) to MPS-II mice of 2 different ate analysis included adjustments for baseline age and pre-ERT age (2-month-old and 8-month-old). Analysis of brain tissue uGAGs. Results: Patients received ERT for 6.8 + 2.2 years at including GAG measurement, IDS activity assay, brain pathol- 10-year follow-up. The observed mortality rate at follow-up was ogy, and immunohistochemistry was performed. In addition, 16.5% (17of103)inthetreatedand50% (7 of 14) in the naive behavioral assessment by footprint pattern analysis and Y-maze patients. Results of KM analysis showed a significant separation test was performed. Results: High dose of systemic ERT allowed (Log rank P ¼ .0006), indicating an ERT survival benefit. The the IDS to reach the brain, with the substantial correction of the unadjusted HR was 0.24 (95%CI, 0.10-0.59) and adjusted HR CNS phenotype and neurobehavioral features. Conclusion: was 0.11 (95%CI, 0.04-0.29). For patients with rapidly progres- Central nervous system defects of MPS-II mice can be treated sive disease, treated patients had improved survival with a mor- by systemic ERT, providing the potential for development of tality rate of 17.9% (12 of 67) compared to naive patients (85.7% an effective treatment for patients with MPS-II. [6of 7]). Mean age of the patients who died in the treated and untreated groups was similar (15.4 + 12.4 vs 14.4 + 13.5 years) in spite of the difference at baseline (13.7 + 9.8 vs 19.8 + 12.8 1033 - Mucopolysaccharidosis Type I: Long- years). Of the patients who died, treated patients had an overall Term Follow-Up of Safety and Effectiveness survival of 7.5 compared to 4.8 years for untreated patients. Conclusion: Long-term galsulfase ERT is associated with of Enzyme Replacement Therapy in 10 improved survival of patients with MPS-VI. Conflicts: Authors Argentinean Patients Quartel and Lin are employees and stockholders of BioMarin; 1 1 Piscia-Nichols is a former employee of BioMarin. All other Norberto B. Guelbert , Adriana B. Becerra , Alicia N. 1 1 1 investigators provided consulting services, received research Giner , Nidia Azar , Nadia A. Gomez , Sandra L. grants, and participated in advisory board meetings and received Antonozzi1,AndreaDelgado1, and Guillermo A. Guelbert1 speaker honoraria and travel support from BioMarin Pharmaceu- 1Servicio Enfermedades Metabo´licas Hospital de Nin˜os de Cordoba, tical Inc. This study was supported by BioMarin Pharmaceutical Co´rdoba, Argentina Inc and, in part, with funds provided by the National Institutes of Health/National Center for Research Resources (NIH/NCRR) Introduction: The mucopolysaccharidosis type I (MPS-I) is a CTSA grant UL1RR024131 (Dr Harmatz). multisystemic autosomal recessive lysosomal disorder caused Abstracts 55

by deficiency of a-L-iduronidase. It has a broad spectrum of outpatient center for venous infusions was inaugurated, with 5 clinical severity divided into 3 syndromes, Hurler (H-severe), patients receiving ERT (2 MPS-I and 3 MPS-VI). Currently, 17 Hurler-Scheie (HS-moderate), and Scheie (S-mild), varying the patients on ERT were being followed in our institution, compris- speed of progression and extent of multisystem manifestations ing 4 with MPS-I, 5 with MPS-II, and 8 with MPS-VI. In all, 13 and neurodegenerative disease. Objective: To evaluate the receive infusions in our center, while 2 with MPS-II and 2 with safety and efficacy of enzyme replacement therapy (ERT) in MPS-VI are decentralized, receiving infusions in the city a group of MPS-I in Argentina during an average period of where they live. Before decentralization, local teams were 6.8 years. The series consisted of 10 patients with MPS-I, 4 trained by IFF professionals, and all continue to have a periodic H-severe and 6 HS-mild, 3 women and 7 men belonging to 8 clinical monitoring at IFF. Conclusion: With the advances in not related families. All had typical manifestations of the dis- the diagnosis of rare diseases and identification of new patients ease, and the diagnosis was confirmed by the deficiency of with MPS, discussion regarding decentralization for the intra- a-L-iduronidase in dried blood spot in filter paper and leuko- venous infusions becomes necessary, as long distance travel to cyte pellet. Other studies are brain and cervical spine magnetic the reference center becomes a burden, leading to interference resonance imaging, abdominal ultrasound, echocardiography, in the maintenance of treatment. Families and health staff agree measurement range motility, polysomnography, and quantita- that decentralization improves the quality of life of patients and tive urinary excretion of glycosaminoglycans (GAGs) by spec- families. This study was supported by Biomarin, Genzyme, trophotometric method (DMB). At the time of ERT (on average and Shire. 6.8 years), we observed reduction in hepatosplenomegaly and improvement in cardiomyopathy besides increase in weight and height, disappearance of nocturnal apneas and rhinorrhea, 1040 - A Mongolian Child Case of a Family and normalization of urinary GAGs. No change was observed With Mucopolysacchoridosis Type II, Hunter in flexion contractures of the joints, but exercise testing Syndrome (6-minute walk test and 3-minute stair climb) was normal. 1 1 1 We found no improvement in heart valves and corneal cloud- Jane Collette Roberts , Simon A Jones , Sarah Phillippo , ing. Three H patients stopped the ERT after 3 months and went Clare Hamilton-Kay1, and Jean Mercer1 through successful bone marrow transplant. Conclusion: Our 1Manchester Centre for Genomic Medicine, Manchester, England findings showed that ERT reduced lysosomal GAG storage, which was evidenced by the decrease in urinary excretion of Objectives: To discuss adverse events potentially linked to the dermatan and heparan sulfate. There was a significant repeated use of topical anesthetic creams on port sites used for improvement in the quality of life of patients and their fami- enzyme replacement therapy (ERT). Lysosomal storage disor- lies. We have not recorded adverse reactions in any case. ders (LSDs) are a group of rare inherited metabolic disorders caused by a lysosomal enzyme deficiency. Some LSDs now 1037 - Decentralization of Drug Treatment have licensed ERT, which are administered as a weekly/ biweekly infusion. As regular intravenous access is required, (Enzyme Replacement Therapy) in topical anesthetic creams are often used to reduce pain. Many Mucopolysaccharidosis of these children will need intravenous port insertion due to 1 1 poor venous access, young age, or needle phobia. In Manche- Ana Carolina Esposito , Anneliese Lopes Barth , Daniela ster, 2 types of local anesthetic creams are commonly used, 1 1 Koeller Rodrigues Vieira , Celma Dias Maciel , Esther Ametop Gel and Emla cream. For older children or for children Nunes Platenik1, and Dafne Dain Gandelman Horovitz1 who find the application of the cream upsetting, ethyl chloride spray can be used (Cryogesic). Methods: Through regular 1IFF/Fiocruz, Rio de Janeiro, Brazil inspection, we have identified a growing problem with skin Introduction: In Brazil, most patients with mucopolysacchari- integrity on the port sites upon the repeated use of anesthetic dosis are followed by reference centers, where they receive creams, with dimpling, bruising, and thinning of the skin. the weekly infusions of enzyme replacement therapy (ERT). The black septum of the port device can appear through the Objectives: To discuss the possibility of decentralization of ERT skin due to the dermis becoming thin and transparent, in patients with MPS, in order to help them receive the infusions mimicking a bruise. Over the last 4 years, 7 of the 64 ports near home. Methods: Patients with MPS types I, II, and VI, have been adversely affected. All 7 patients had been followed by the Department of Genetics, Instituto Fernandes receiving weekly ERT. Results: In one case, the septum Figueira (IFF/Fiocruz), and on ERT, were selected. We evaluated of the port had completely eroded through the skin on the the medical records and conducted interviews with the families, in chest wall as the usage of weekly Ametop Gel at home was order to understand the transportation facilities of patients who inappropriate, resulting in a full thickness dermal burn. To lived away from the treatment center and what families and health date, 5 of the 7 ports have required removal/replacement staff thought of decentralization. Results: The first ERT in IFF/ following visualization of the septum and/or dimpling, scab Fiocruz was in 2004, in a patient with MPS-I; it was administered formation. One child developed a Cryogesic burn, which weekly in the pediatric inpatient ward. In December 2007, the healed uneventfully, and another port is under weekly 56 Journal of Inborn Errors of Metabolism & Screening review. Conclusion: Further data are required from other 1043 - Follow-Up Study of Developmental comparable centers to understand the rationale behind these Quotient in the Patients With Mucopolysac- adverse events to capture common reactions and provide charidosis Type II Severe Form Under the recommendations to prevent future incidences and multiple port replacements in this vulnerable group of patients. Treatment of Enzyme Replacement Therapy and Hematopoietic Stem Cell Transplantation

Akemi Tanaka1, Takashi Hamazaki1, Torayuki 1042 - Induction of Immune Tolerance in Okuyama2, Yasuyuki Suzuki3, Norio Sakai1,Motomichi Patients With Mucopolysaccharidosis Type I Kosuga2, Michiko Shinpo1, Hiromasa Yabe4, Mika Ishige5, Initiating Enzyme Replacement Therapy Tomo Sawada6,RyiojiKobayashi7, and Ken Tabuchi8 With Aldurazyme 1Osaka City University Graduate School of Medicine, Osaka, Japan Roberto Giugliani1, Petr V. Novikov2, Susan Richards3, 2National Center for Child Health and Development, Tokyo, Japan 3 Gerald F. Cox3, and Yong Xue3 Gifu University Graduate School of Medicine, Gifu, Japan 4Tokai University School of Medicine, Tokyo, Japan 1 Department of Genetics UFRGS and INAGEMP, Medical Genetics 5Nippon University School of Medicine, Tokyo, Japan Service/HCPA, Porto Alegre, Brazil 6Izumi City Hospital, Gushikawa City, Japan 2 Department of Clinical Genetics, Moscow Research Institute for 7Sapporo Kitanire Hospital, Sapporo, Japan Pediatrics and Children Surgery, Moscow, Russia 8Komagome Hospital, Tokyo, Japan 3Genzyme, a Sanofi company, Cambridge, MA, USA Objective: To analyze the course of developmental quotient Objectives: Mucopolysaccharidosis type I (MPS-I) studies in (DQ) in patients with mucopolysaccharidosis type II (MPS-II) dogs have shown that antibodies to laronidase (Aldurazyme; on either enzyme replacement therapy (ERT) or hematopoietic Genzyme, Cambridge, Massachusetts) affect its biodistribution stem cell transplantation (HSCT) to evaluate the efficacy on brain and ability to clear glycosaminoglycans (GAGs). In patients function. Methods: We collected the DQ records of patients with with MPS-I, the high antibody titers correlate with less urinary MPS-II severe form who received HSCT and those who received GAG reduction but not with clinical response. This study was ERT. Patients were divided into 2 clinical phenotypes according designed to determine whether an immunosuppressive regimen to the onset of developmental delay: type C (delay after 2 years of that induced immune tolerance in dogs could be used in age) and type D (delay before 2 years of age). Numbers of patients patients with MPS-I. Methods: This open-label clinical trial in each group were 15 (HSCT, type C), 15 (HSCT, type D), 9 (NCT 00741338) in patients with severe MPS-I (5 years of (ERT, type C), and 11 (ERT, type D). The observation periods age) included a tolerance induction period followed by an were 5 years 5 months to 16 years 3 months and 3 years 6 months immune challenge period (ICP). The immunosuppressive regi- to 6 years in HSCT group and ERT group, respectively. The cor- men consisted of cyclosporine A, azathioprine, and low-dose relation between chronological age and developmental age was weekly Aldurazyme (0.058 mg/kg). Following gradual discon- analyzed by scatter diagram in each group. Results: In patients tinuation of immunosuppressants, patients received full-dose ERT, deterioration of developmental age was observed after age Aldurazyme (0.58 mg/kg) for a total of 24 weeks. Immune tol- 5 both in types C and D patients, which was similar to that of nat- erance was defined as an anti-laronidase immunoglobulin G ural history. In patients receiving HSCT, the scatter diagram was (IgG) antibody titer 1:3200 at the end of the ICP. A sequential almost same as patients receiving ERT. However, 3 of the 30 adaptive design allowed for modification of the immune toler- patients did not show deterioration even after age 5. The DQ val- ance regimen in a second patient cohort if the initial regimen ues of these 3 patients before HSCT were 78 (C), 50 (C), and 75 was unsuccessful (<2 of the 3 patients were immune tolerant). (D), and none of them had either cortical atrophy or hydrocepha- Safety evaluations focused on signs of infection or organ toxi- lus. Conclusion: Hematopoietic stem cell transplantation is a city, blood pressure elevation, and bone marrow suppression. beneficial treatment for the patients with MPS-II especially for Results: None of the 3 patients in cohort 1 and 1 of the 3 those patients with brain involvement, especially when it was per- patients in cohort 2 achieved immune tolerance. A second formed in early stage. Genotyping for the patients with good effi- patient in cohort 2 maintained a low IgG titer after 17 weeks cacy and further prospective studies should be performed. of full-dose Aldurazyme but discontinued the study due to infusion-associated reactions and was considered a treatment failure. Cyclosporine A levels varied and required frequent 1054 - Comparison of the In Vitro Efficacy of monitoring and dose titration. No deaths or other significant adverse events were reported. Conclusion: The results of the Idursulfase and Idursulfase b on Cultured study are inconclusive. The risk, benefit, and feasibility of Fibroblasts of Patients With Hunter Disease immune tolerance induction should be reconsidered in patients 1 2 1 with MPS-I. This study was supported by the Genzyme/Bio- Chihwa Kim , Jinwook Seo , Sumin Lee , Heechun Marin Joint Venture. Kwak1, Yokyung Chung2, and Dongkyu Jin3 Abstracts 57

1Mogam Biotechnology Research Institute, Yongin, South Korea from European mainland and Northern Ireland weekly for 2Green Cross Corporation, Yongin, South Korea intravenous treatment was the biggest challenge. Methods/ 3Samsung Medical Center, Seoul, Korea Results: Planning commenced with help from the MPS society, a registered UK charity providing professional support to Introduction: Mucopolysaccharidosis type II (MPS-II, Hunter individuals and families affected by MPS and related lysoso- syndrome; OMIM 309900) is an X-linked lysosomal storage mal storage disorders. The society also funds and promotes disease caused by a deficiency of iduronate 2-sulfatase (IDS) research for treatments and clinical trials. The society coordi- enzyme, leading to accumulation of glycosaminoglycans nated the travel, hotel accommodation, interpreters, airport (GAGs). The 2 recombinant enzymes idursulfase (Shire transfers, and internal travel. Patients were provided with sub- Human Genetic Therapies, Lexington, Massachusetts) and sistence (ie, meals). This system generally works well. Excep- idursulfase b (Green Cross Corp, Yongin, Korea), used in tions arise when there are incidences of travel outside of the enzyme replacement therapy (ERT) of Hunter syndrome, are European Union or with patient’s resident within the Union but currently available in Korea. These 2 enzymes showed signif- not holding the relevant passport. This involved delicate nego- icant differences in various clinical parameters in a recent clin- tiation and planning with the relevant passport agency and their ical trial (Orphanet J Rare Dis 2013;8:42). It was demonstrated embassy. Our center coordinated transport to and from hotels these proteins have different formylglycine contents that on days of treatments/tests, worked alongside interpreters to importantly related the enzyme activity of sulfatase family be able to clearly communicate with the patient, scheduled enzymes (Glycocojugate J, in press). Methods: The efficacy events within the clinical trial months in advance of patient of GAG degradation enzymes were compared by using skin arrival and handled patients’ expenses. Conclusion: In sum- fibroblasts of patients with Hunter syndrome who had already mary, this demonstrates the importance of medical health pro- accumulated GAGs in lysosome. We measured the cellular fessional working in concert with patients and patient support uptake kinetics and degradation of GAG contents dose and time groups. Forward planning and coordination in these instances dependently in patient cells. Results: An immunocytochemis- are vital to ensure an adequate numbers and continuing partic- try analysis revealed both proteins were well incorporated in ipation in clinical trials where the disease is rare. cultured cells and showed that idursulfase b is taken up faster than idursulfase. The enzyme activities of idursulfase and idursulfase b were 27.4 + 0.31 and 45.4 + 0.93 nmol/min/μg, 1063 - Effects of Enzyme Replacement respectively. Incorporated idursulfase b highly degraded the Therapy Started Late in a Murine Model of GAGs accumulated in cultured Hunter fibroblasts in a dose- Mucopolysaccharidosis Type I dependent manner and showed statistically significant difference at a very low dose, especially. But we didn’t show time- Gabriela Pasqualim1, Guilherme Baldo2,3, Talita G. de dependent effect difference between them. Conclusion: Carvalho1, Angela M. V. Tavares4, Roberto Giugliani5,6, Therefore, these results suggest that idursulfase b is an active 5,6 proteinlikeidursulfasewhichisusedasenzymereplacement and Ursula Matte therapeutic drug for Hunter syndrome. Faster incorporation 1PPGBM, UFRGS, Gene Therapy Center, HCPA, Porto Alegre, into the cells means that the residual time in blood stream is Brazil short after intravenous injection, and this fact can also be 2Gene Therapy Center, HCPA, Porto Alegre, Brazil assumed to reduce the chance of an immune response. 3Department of Physiology, ICBS, UFRGS, Porto Alegre, Brazil 4Health Science Department, Uniritter—Laureate International Universities, Porto Alegre, Brazil 1057 - The Challenges in Coordinating 5PPGBM, UFRGS, Gene Therapy Center, Medical Genetics Service, HCPA, Porto Alegre, Brazil Clinical Trial Attendance for Patients 6 Traveling From Abroad INAGEMP, Porto Alegre, Brazil Introduction: Mucopolysaccharidosis type I (MPS-I) is a 1 2 1 Allison L. Warwick , Christine Lavery , Milligan Alan , rare progressive disorder caused by deficiency of a-L-iduro- Richfield Linda1, Hughes A. Derralynn1 nidase (IDUA), which leads to storage of glycosaminoglycans (GAGs) heparan and dermatan sulfate. There is a 1Royal Free Hospital Foundation Trust, Hampstead, United Kingdom consensus in the literature that early enzyme replacement 2MPS, Buckinghamshire, United Kingdom therapy (ERT) leads to a better outcome, preventing or Introduction: Mucopolysaccharidosis type IVA is an autoso- minimizing irreversible damage. Objective: To evaluate the mal recessive lysosomal storage disorder characterized by short effects of ERT when started late to reverse the disease man- stature, skeletal dysplasia, dental anomalies, and/or corneal ifestations in an MPS-I murine model because many clouding. Intelligence is not affected. Objectives: To meet the patients worldwide are diagnosed late and do not receive challenge of transporting patients safely to a trial center with immediate treatment. Methods: Mucopolysaccharidosis minimal upheaval of daily life, making the transition as easy type I mice received treatment from 6 to 8 months of age as possible. Planning the best way to safely transport patients (ERT6-8months)with1.2mglaronidase/kgevery2weeks 58 Journal of Inborn Errors of Metabolism & Screening and were compared to 8-month-old wild-type (normal) and caregiver/family issues (7.2%). Unavailability of enzyme untreated animals (MPS-I). Results: Enzyme replacement replacement therapy and cannulation difficulties were the rea- therapy when started late was effective in reducing urinary sons for 2.5% and 1.7% of missed infusions, respectively. and visceral GAG to normal levels. Although heart GAG Other reasons (25.4%) included family social problems, con- levels and left ventricular (LV) shortening fraction were flict with other medical procedures, insurance/reimbursement normalized, cardiac function was not completely improved. issues, and drug shipment or transport problems. The reasons Although no significant improvements were found on aortic for 23.0% of missed infusions were unknown or missing. At wall width, treatment was able to significantly reduce heart last evaluation, 50 (7.6%) of the 655 patients had stopped treat- valve thickening. A high variability was found in behavior ment; the most common reason given (36.0%) was the patients tests, with treated animals presenting intermediate results or their parents deciding to stop treatment. Conclusion: Anal- between normal and affected mice, without correlation with ysis of data in HOS reveals that a variety of factors affect com- cerebral cortex GAG levels. Cathepsin D activity in cerebral pliance with treatment; the mostcommonreasonformissingan cortex also did not correlate with behavior heterogeneity. infusion was illness. However, 73% of patients receiving idur- All treated animals developed antienzyme antibodies, but sulfase did not miss a single infusion during this analysis no correlation was found with any parameters analyzed. period, and few patients stopped treatment. Conflicts of Inter- However, intermediary results from locomotion parameters est: Dr Solano has received travel support and honoraria from analyzed are in accordance with the intermediary levels of Shire, BioMarin, and Genzyme Corporation. Morin is a full- heart function, cathepsin D, activated glia, and reduction time employee of Shire. Dr Lampe has received travel support, in TNF-a, and expression in the cerebral cortex. Conclusion: speaker fees, and honoraria from Shire, BioMarin, and Gen- Even if started late, ERT can have beneficial effects on zyme Corporation and partial funding for medical advice. many aspects of the disease and should be considered when- ever possible. Financial support: The study received financial support from FIPE-HCPA, FAPERGS, CAPES, and 1065 - Determination of Kinetic Parameters CNPq. of Enzyme Deficiency in Diagnosis of Mucopolysaccharidosis Type IVA

1064 - Factors Affecting Compliance With Jaqueline Ce´ 1, Ana C. Breier1, Jamila Mezzalira1, Vito´ria Enzyme Replacement Therapy With C. Moraes1, and Janice C. Coelho1 Idursulfase in Patients With Hunter Syndrome: 1Departamento de Bioquı´mica, UFRGS, Porto Alegre, Brazil Data From the Hunter Outcome Survey Introduction: The mucopolysaccharidosis type IVA, called Martha Solano1, Isabelle Morin2, and Christina Lampe3 Morquio syndrome, is characterized biochemically by the accumulation of glycosaminoglycans keratan sulfate and 1Department of Neuropediatrics, Bogota´, Colombia condoitin-6-sulfate in lysosomes, caused by the deficiency of 2Shire, Eysins, Switzerland the N-acetylgalactosamine-6-sulfatase (GALNS) enzyme. 3Rare Disease Centre, Horst Schmidt Clinic, Wiesbaden, Germany Objectives: To determine the kinetic parameters Km and max- Objectives: Enzyme replacement therapy with idursulfase (Ela- imum velocity (Vmax) of GALNS in leukocytes of healthy prase; Shire, Eysins, Switzerland) is used as a long-term treatment individuals in order to improve the diagnosis of mucopolysac- for patients with Hunter syndrome. Treatment consists of weekly charidosis type IVA. Methods: Leukocytes from 6 healthy 0.5 mg/kg intravenous infusions that are generally adminis- individuals were isolated from 10 mL of heparinized blood tered over 3 hours. Patients may sometimes miss scheduled (Skoog and Beck, 1956). N-Acetylgalactosamine-6-sulfatase infusions. This analysis investigated the frequency of, and rea- activity was measured according to van Diggelen et al (1990) sons for, missed idursulfase infusions and stopping treatment. with 4-methylumbelliferyl-b-D-galactoside-6-sulfate (MU- Methods: This analysis used data from the Hunter Outcome bGal-6S) as artificial substrate. The curve of Michaelis- Survey (HOS), a global, multicenter, longitudinal, and obser- Menten (substrate curve) was obtained with MU-bGal-6S solu- vational registry sponsored by Shire that collects real-world tions at concentrations of 1 to 20 mmol/L. The linearity was information on the natural history of Hunter syndrome and the observed, and new points of substrate concentration were long-term effectiveness and safety of idursulfase. Results: As established for the calculation of the Km and Vmax parameters of January 2014, data on missed infusions and stopping treat- using the Lineweaver and Burk plot. Results: The Km and ment were available for 655 patients followed prospectively Vmax of GALNS in leukocytes of healthy individuals were in HOS who had received at least 1 dose of idursulfase. The 7.16 mmol/L and 77.3 nmol/17 h/mg protein, respectively. mean time from treatment start to last clinical evaluation Conclusion: The determination of the kinetic parameters of the recorded in HOS or treatment end was 47.9 months. In total, enzyme N-acetylgalactosamine-6-sulfatase is of great impor- 1319 missed infusions were reported in 177 (27.0%)ofthe tance for the improvement in fluorometric techniques for the 655 patients. The most common reasons given were illness (for diagnosis of Morquio syndrome and also for distinguishing 26.8% of missed infusions), holiday/vacation (13.4%), and healthy individuals affected and heterozygous. Abstracts 59

1068 - Audiological Evaluation of Children Cristina Bento Lemos1, Iliane de Paula Oliveira1, Ana With Hunter Syndrome Receiving Carolina Esposito1, and Dafne Gandelman Horovitz1 Investigational Intrathecal Enzyme 1IFF/FIOCRUZ, Rio de Janeiro, Brazil Replacement Therapy Introduction and Objectives: Enzyme replacement therapy Patricia Roush1, and Joseph Muenzer1 (ERT) is a long lasting treatment and has been changing the natural course of several diseases. It is administered by intrave- 1 Department of Otolaryngology, Head & Neck Surgery, University of nous infusions, and frequent peripheral venous punctures are North Carolina, Chapel Hill, NC, USA essential. Nursing staff is responsible for the technique and Objectives: To present audiological findings obtained from selection of the puncture sites. It demands knowledge of anat- patients with Hunter syndrome (mucopolysaccharidosis type II omy, physiology, and ability to perform the technique. As ERT [MPS-II]) who participated in a Shire-sponsored phase 1/2 study means lifelong infusions, we choose not to place implantable (NCT00920647) and its extension of intrathecal (IT) enzyme venous access, since patients are young and many live in poor replacement therapy with an investigational formulation of socioeconomic and hygienic conditions, leading to additional idursulfase designed for IT administration (idursulfase-IT). risks. Methods: This study was conducted in the outpatient Methods: Eleven boys with severe MPS-II, participating in the day clinic and describes how patients’ venous network is Shire-sponsored study (NCT00920647) over a 2-year period, being used and preserved. Results: A total of 31 patients have underwent audiological evaluations at baseline, 6 months, and received ERT in our institution, with 20 MPS and 2 Pompe 12 months. These patients had evidence of cognitive impairment currently being followed, most under weekly infusions. and adhered to a standard regimen of IV idursulfase; in addition, Patients have been on ERT for 5 months from 9 years of age. these patients received monthly 1-, 10-, or 30-mg doses of inves- Three patients began infusions when they were less than 1 tigational idursulfase-IT. Results: Of the 11 patients, 6 were year of age. At the time of venipuncture, the caliper of the ves- using hearing aids at enrollment and 1 additional patient started sels, condition of the venous network, pain awareness of the using hearing aids during the study. Due to behavioral and cog- region, and flexibility to provide comfort to the patient are nitive challenges, behavioral audiometry was difficult for these evaluated, in order to choose the best puncture site. Appropri- patients and middle ear pathology was frequent. Auditory brain ate hydration is very important. A different puncture site is stem responses (ABRs) were studied under general anesthesia chosen in every infusion for each patient, and the rotation is using both click and tone-burst stimuli. In general, waves I, III, important for venous network recovery. No patient needed and V were identifiable and the overall quality of the waveforms implantable catheter. Our team administered around 3500 allowed us to estimate behavioral thresholds for the majority of infusions; in 2013, and there were 757 ERT infusions, all patients in both ears. In most cases, the I to V intervals were using peripheral veins. In only 3 occasions, venous access was abnormally long, indicative of dysfunction in the auditory neural not possible and the patient had to come for infusion on a dif- pathway. Treatment with monthly idursulfase-IT did not show ferent day. Conclusion: We conclude that it is possible to pre- consistent effects on waveform morphology or on associated serve the venous network and avoid long-term venous access, peak latencies and intervals. Conclusion: Auditory brain stem even in small children. Highly motivated and trained staff response appears to be the best method for estimating the hearing may reduce risk and work with less technology. Conflicts threshold levels in children with MPS-II. Treatment with inves- of Interest: Continuing medical education provided by Bio- tigational idursulfase-IT produced no consistent change in ABR marin, Genzyme, and Shire. in this study. Conflicts of Interests: This study was funded by Shire (NCT00920647). Dr Roush has received consulting fees from Shire. She also serves on the advisory board for Phonak 1079 - Safety and Pharmacodynamic Activity AG. Dr Muenzer has been a consultant to BioMarin Pharmaceu- of Elosulfase ␣ in Pediatric Patients Less Than tical, Shire HGT, Green Cross, and PTC Therapeutics and serves 5 Years of Age With Morquio A Syndrome on advisory boards and speaker’s bureaus for Genzyme, Bio- Marin, and Shire. He is currently the principal investigator for (Mucopolysaccharidosis type IVA) phase I/II IT enzyme replacement clinical trials for MPS-II spon- 1 2 3 sored by Shire Paul Harmatz , Simon Jones , Martin G. Bialer , Rossella Parini4, Ken S. Martin5, Hui Wang5, and Adam Shaywitz5 1076 - Venous Access and Enzyme 1Children’s Hospital Oakland, Oakland, CA, USA Replacement Therapy: Preserving Peripheral 2Manchester Centre for Genomic Medicine, St Mary’s hospital, Venous Network CMFT, MAHSC, University of Manchester, Manchester, England 3North Shore LIJ Health System, Manhasset, NY, USA 1 1 Anneliese Lopes Barth , Ester Nunes Platenik , Celma 4Az.Ospedaliera S. Gerardo, Monza, Italy Dias Maciel1, Rosangela dos Santos Ferreira1, Paula 5BioMarin Pharmaceutical Inc, Novato, CA, USA 60 Journal of Inborn Errors of Metabolism & Screening

Introduction: Morquio A syndrome (MPS-IVA) is character- 2Universidade Federal Do Rio De Janeiro, Rio De Janeiro, Brazil ized by deficient N-acetylgalactosamine 6-sulfatase activity 3Brigham and Womens Hospital, Boston, MA, USA leading to excessive lysosomal storage of the glycosaminogly- Objectives: To report the use of a new desensitization protocol in can, keratan sulfate (KS). Patients have progressive, debilitat- patients with enzyme replacement therapy (ERT) reactions. ing effects including skeletal dysplasia, impaired growth, Methods: We describe 2 patients with mucopolysaccharidosis cardiopulmonary complications, reduced endurance, and (MPS) type I and 1 patient with MPS-VI who developed mild increased mortality. Objective: This study’s primary objective to moderate hypersensitivity reactions during ERT successfully was evaluation of safety elosulfase a enzyme replacement treated with a 3-bag, 12-step rapid desensitization protocol. therapy (ERT) in patients with MPS-IVA <5 years of age. Results: An 11-year-old female with MPS-I presented general- Methods: Safety was monitored in 15 patients with MPS- ized urticaria and lip swelling during her fifth infusion with laro- IVA receiving 52 weeks of intravenous (IV) infusion therapy nidase. The patient was treated and 1 hour later, the infusion was at 2 mg/kg/wk. Pharmacodynamic and growth were also restarted. After 3 minutes, she experienced an episode of wide- assessed. Results: The mean (range) age was 3.1 (0.8-4.9) spread hives and the infusion was stopped. A 6-year-old male years at study entry. The majority (96.4%) of adverse events patient with MPS-I who had started receiving ERT with laroni- (AEs) were mild to moderate. Most commonly reported dase at the age of 2 also presented generalized urticaria minutes drug-related AEs were pyrexia (n ¼ 6, 40.0%) and vomiting after finishing his 24th infusion. During the following infusions, (n ¼ 5, 33.3%). Of the 8 serious AEs, 1 was drug related he had 11 episodes of generalized urticaria, some of them with (hypersensitivity). Of the 758 infusions, 6 (0.8%) administra- angiedema and cough. Two desensitization protocols failed, and tion led to AEs requiring interruption and medical intervention the treatment was stopped due to the severity of the last reaction. with IV antihistamines and/or IV steroids. All patients received A 5-year-old male with MPS-VI under ERT with galsulfase pre- subsequent infusions. There were no study discontinuations or sented a localized urticaria in upper limbs with tachycardia and deaths. Mean +standard deviation (SD) baseline normalized tachypnea, during an infusion after being treated for 2 years. The urinary KS (uKS) was 35.9 + 12.32 μg/mg creatinine, patients with MPS-I had positive skin tests but not the patient with decreased by 46.4% + 19.76% at 8 weeks and was sustained MPS-VI. Serum-specific immunoglobulin E was negative for lar- (43.1% + 22.15%) at 52 weeks. Results were consistent with onidase. Because laronidase and galsulfase are considered studies in older populations demonstrating pharmacodynamic first-line therapy, a 3-bag, 12-step laronidase desensitization effects of ERT on uKS. Standing heights were measured in protocol was elaborated based on previous chemotherapy pro- patients >2 years and in 1 patient of 18 months old (n ¼ 13); tocols, and informed consent was obtained. The target dose lengths were measured in all patients (n ¼ 15). Standing was individually calculated and premedication prescribed heights (in cm) increased by (mean + SD) 6.7% +3.76% from according to the protocol. The desensitization was done in a baseline. Mean (+SD) baseline Z scores for height/length of hospital setting and no reaction occurred while the target doses patients (n ¼ 15) were 1.6 + 1.61 and remained below were reached successfully. Conclusion: This new ERT desen- 50% at 1.9 (1.62) at 52 weeks. Anthropometric data will be sitization protocol with 3 bags and 12 steps provided temporary compared to age-matched, untreated patients with MPS-IVA. clinical tolerance at full therapeutic doses and protected Conclusion: Elosulfase a had a favorable safety profile and against severe reactions. decreased uKS in <5-year-old children, similar to the data from older populations. Continued assessments over longer periods will evaluate the long-term benefit of ERT in this population. Conflicts of Interest: Authors Martin, Wang, and Shaywitz are 1082 - Experience of a Laboratory in Rio de employees and stockholders of BioMarin. All other authors are Janeiro, Brazil, in the Follow-Up of Patients principal investigators for the clinical trial described in this With Mucopolysaccharidosis Types I, II, and abstract and sponsored by BioMarin. These authors may have VI on Enzyme Replacement Therapy provided consulting services, received research grants, participated in advisory board meetings, and/or received speaker hon- Fernanda B. Scalco1, Dafne G. Horovitz2, Juan C. oraria and travel support from BioMarin Pharmaceutical Inc. Llerena2, Marcia G. Ribeiro3, Raquel Boy4, Anneliese L. Barth2, Ana Carolina Esposito2, and Maria Lucia C. 5 1080 - Enzyme Replacement Therapy Oliveira Hypersensitivity and Desensitization 1Laborato´rio de Erros Inatos do Metabolismo (LABEIM)/DBQ/IQ/ UFRJ, Porto Alegre, Brazil Luis Felipe Ensina1,AlexE.deLacerda1, Carolina S. 2Instituto Fernandes Figueira/Fiocruz, Rio de Janeiro, Brazil 3 Aranda1, Gustavo G. G. Da Fonseca2, Ekaterini Goudouris2, Instituto de Puericultura e Pediatria Martaga˜o Gesteira/UFRJ, Rio de 2 2 2 Janeiro, Brazil Fernanda P. Mariz , Evandro Prado , Marcia G. Ribeiro , 4 1 3 Hospital Universita´rio Pedro Ernesto/UERJ, Rio de Janeiro, Brazil Ines C. Camelo-Nunes , and Mariana Castells 5Laborato´rio de Erros Inatos do Metabolismo (LABEIM)/DBQ/IQ/ 1Universidade Federal De Sao Paulo, Sa˜o Paulo, Brazil UFRJ, Porto Alegre, Brazil Abstracts 61

Introduction and Objective: The laboratory of inborn errors years with MPS-II (mean: 3.6 + 0.8 years) were enrolled. All of metabolism at the Universidade Federal do Rio de Janeiro 6 patients experienced at least 1 AE. A total of 109 AEs were (LABEIM) detected in the last 25 years 142 cases of mucopo- reported. The most frequent AE was infection (65), followed by lysaccharidoses. Of these, 40 cases of mucopolysaccharidosis gastrointestinal disorder (16) and respiratory disorders (9). A (MPS) II, 23 MPS-III, 22 MPS-IV, 20 MPS-VI, and 13 MPS- patient experienced 1 serious AE (hospitalization due to gastro- I were confirmed. In the remaining 24 patients, it was not pos- enteritis) that was considered not to be treatment related. A sible to determine the MPS type. From 2004, the laboratory ini- total of 11 infusion-related adverse drug reactions (6 urticaria tiated follow-up of patients with MPS from Rio de Janeiro, and 5 cough) were reported in 1 (16.7%) patient. There were Brazil, submitted to enzyme reposition therapy (ERT), by eva- no serious adverse drug reactions and no clinically significant luation of urinary glycosaminoglycans (GAGs). This work changes in vital signs, physical examination, laboratory para- aims to present our experience in biochemical monitoring of meters, or ECG. Of the 6 patients, 4 (66.7%) showed anti- patients with MPS under ERT. Methods: Determination of idursulfase antibodies and neutralizing antibodies on at least GAGs was performed by spectrophotometric method utilizing 1 occasion during the study. At 53 weeks, urinary GAG dimethylmethylene blue; results were expressed as milligram/ reduced by 20.62% + 20.67% from baseline. Conclusion: gram creatinine and compared with a standard curve by age. This study indicates that idursulfase b showed similar safety Results: A total of 33 patients under ERT were monitored. The and efficacy to those of previous results in 6 years or older GAGs of 20 patients (8 MPS-VI, 6 MPS-I, and 6 MPS-II) were patients with Hunter syndrome. evaluated periodically (initially once every week and then once every 2 or 3 months). In the remaining 13 patients, analyses were occasional. In all patients, GAGs reduction was observed 1088 - Desensitization and Slow Continuous and in many cases the values oscillated. The percentage of Infusion in Enzyme Replacement of Patients reduction was significant and varied between 48% and 93%. Conclusion: It was concluded that GAGs excretion in MPS With Hunter Syndrome Having Anaphylaxis reflected each patient’s response to the treatment; those with to Idursulfase a more significant reduction in GAGs, reaching excretion val- 1 2 2 ues close to the normal ones for the age, presented a better clin- Young Bae Sohn , Se Hyun Maeng , Jihyun Kim , 2 2 3 ical response. Kangmo Ahn , Sung Yoon Cho , Han-Wook Yoo , and Lock-Hock Ngu4 1087 - Safety and Efficacy of Enzyme 1Department of Medical Genetics, Ajou University Hospital, Suwon, β Republic of Korea Replacement Therapy With Idursulfase in 2 Children With Hunter Syndrome Younger Department of Pediatrics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, South Korea Than 6 Years of Age 3Department of Pediatrics, Asan Medical Center Children’s Hospital, 1 2 2 University of Ulsan College of Medicine, Ulsan, South Korea Young Bae Sohn , Sung Yoon Cho , and Dong-Kyu Jin 4Genetic Department, Kuala Lumpur Hospital, Kuala Lumpur, 1Department of Medical Genetics, Ajou University Hospital, Suwon, Malaysia Republic of Korea Introduction: Enzyme replacement therapy (ERT) is a treat- 2Department of Pediatrics, Samsung Medical Center, ment of choice in Hunter syndrome. Life-threatening anaphy- Sungkyunkwan University School of Medicine, Seoul, South Korea laxis mediated by anti-idursulfase immunoglobulin E (IgE) Introdution: Idursulfase b (Hunterase) has been used for antibody can occur during ERT. Here, we report 5 cases of enzyme replacement therapy (ERT) of patients with mucopoly- infusion-related anaphylaxis to recombinant human idursulfase saccharidosis type II (MPS-II, Hunter syndrome) 6 years old or (Elaprase; Shire Human Genetic Therapies, Inc, Cambridge, older since 2012 in Korea. Objective: To evaluate the safety Massachusetts). Methods: Five cases (3 Korean and 2 Malay- and efficacy of idursulfase b in children younger than 6 years sian) with Hunter syndrome that had experienced anaphylaxis having Hunter syndrome receiving ERT. Methods: This study during ERT were evaluated by retrospective review of medical was a single-arm, open-label clinical trial. Idursulfase b (0.5 records. The specific IgE antibody was detected by skin prick mg/kg/wk) was administered intravenously for 52 weeks. The test and enzyme-linked immunosorbent assay. Results: The primary end point for safety was adverse events (AEs). Second- median age of the 5 patients was 13 years (8-14 years). In all, ary end points included vital signs, physical examination, elec- 3 patients were attenuated and 2 were severe phenotype. The trocardiogram (ECG), laboratory tests, and anti-idursulfase first anaphylaxis was developed at 122nd (26-136th) infusion antibodies. Efficacy was assessed as a secondary end point rep- of idursulfase. The symptoms of anaphylaxis included general- resented by changes in urinary glycosaminoglycan (GAG) at ized urticaria, facial edema, wheezing, dyspnea, and hypoten- 53 weeks from baseline. In addition, growth indices and devel- sion. Specific IgE antibody against idursulfase were detected opmental milestones (Denver II test) were evaluated as in 2 cases. All patients received ERT by slow continuous infu- exploratory variables. Results: Six children younger than 6 sion over 8 to 30 hours. After successful desensitization, the 62 Journal of Inborn Errors of Metabolism & Screening fatal anaphylaxis was not recurred and total infusion time could 1094 - Impact of Enzyme Replacement Therapy be shortened by 4 to 8 hours. Conclusion: Our experience indi- and Hematopoietic Stem Cell Therapy on cates that life-threatening anaphylaxis mediated by anti- Growth in Patients With Hunter Syndrome idursulfase IgE antibody can occur during ERT in patients with MPS-II. Desensitization and continuous slow infusion are use- Shunji Tomatsu1, Pravin Patel1, Yasuyuki Suzuki2, Akemi ful in these cases. Tanaka3, Hiromasa Yabe4, Shunichi Kato4, Tsutomu Shimada1, Robert W. Mason1, Kenji E Orii5, and Tadao 1089 - Managing Infusion-Associated Reac- Orii2 tion in Mucopolysaccharidosis at a Reference 1Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, Center for Inborn Errors of Metabolism: USA Experience of 10 Years 2Gifu University, Gifu, Japan 3Osaka City University, Osaka, Japan Sandra O. Kyosen1, Carolina S. Aranda1, Sueli Canossa1, 4Tokai University, Tokyo, Japan 1 1 1 Viviani Tiozzo , Patricia Feliciano , Maret M. Rand , Introduction: Patients with Hunter syndrome (mucopolysac- 1 1 Cecilia Micheletti , Tania A. V. A. Seches , Luis F. C. charidosis type II) present with skeletal dysplasia including Ensina1, Dirceu Sole´1, Vania D’Almeida1, and Ana M. short stature as well as central nervous system and visceral Martins1 organ involvement. A previous study on Hunter syndrome indi- 1 cated an impact on brain and heart involvement after hemato- Universidade Federal de Sao Paulo, Saõ Paulo, Brazil poietic stem cell therapy (HSCT) at an early stage but little Objectives: To report the experience on enzyme replacement impact after enzyme replacement therapy (ERT). Meanwhile, therapy (ERT) for mucopolysaccharidosis (MPS) types I, II, impact on growth in patients with Hunter syndrome treated andVIofareferencecenterforinborn errors of metabolism with ERT and HSCT has not been compared until now. We over a period of 10 years. Methods: Retrospective study of recently developed baseline growth charts for untreated medical charts of patients with MPS-I, -II, and -VI who patients with Hunter syndrome to evaluate the natural history underwent ERT from 2004 to 2014. Results: Over the of growth of these patients compared to unaffected controls period of the study, a total of 62 patients with MPS under- (Patel et al, 2014). Method: To assess the impact of ERT and went ERT at the Centro de Referência em Erros Inatos do HSCT on growth, clinical data were obtained from 44 Japanese Metabolismo of Universidade Federal de Sao Paulo, 27 male patients with MPS-II; 26 patients had been treated with (10F/17M) patients with MPS-I, 20 (1F/19M) patients with ERT, 12 patients had been treated with HSCT, and 6 had been MPS-II, and 15 (5F/10M) patients with MPS-VI. The mean treated with both ERT and HSCT. Height and weight were age at first infusion was 5 years 5 months for MPS-I, 6 compared to untreated patients and unaffected controls from years 11 months for MPS-II, and 8 years 01 months for the previous study. Results: We demonstrated (1) that patients MPS-VI. At the time of the study, the patients were under with MPS-II, who had been treated with either ERT or HSCT, ERT for a median period of 4 years (range: 1 year 4 months had increased height and weight when compared to untreated to 7 years 6 months) for MPS-I, 1 year 10 months (range: patients and (2) that HSCT and ERT were equally effective <1monthto7years10months)forMPS-II,and2years in restoring growth of patients with MPS-II. Conclusion: 5months(range:7monthsto6years)forMPS-VI. Hematopoietic stem cell therapy should be considered as one Twenty-six patients (11 MPS-I, 8 MPS-II, and 7 MPS-VI) of the primary therapeutic options for early-stage treatment presented infusion-associated reaction (IAR), most of them of MPS-II, as HSCT has also been reported to have a positive mild that were conducted following our service protocol, effect on brain and heart valve development. and all the patients recovered completely without any complication. The IAR presentedbythepatientswereabdom- inal pain (n ¼ 1), agitation (n ¼ 1), headache (n ¼ 1), 1097 - Enzyme Replacement Therapy in tachycardia (n ¼ 1), skin parlor (n ¼ 2), nausea (n ¼ 3), Newborn Mucopolysaccharidosis IVA Mice: cough (n ¼ 1), hives (n ¼ 7), angioedema (n ¼ 5), cuta- Early Treatment Rescues Bone Lesions neous rash (n ¼ 4), wheezing (n ¼ 3), and fever (n ¼ 10).Only4patientshadmoderateIAR,andin1theERT Shunji Tomatsu1, Adriana M. Montanõ2, Hirotaka was permanently stopped. Two patients are receiving ERT Oikawa3, Vu Chi Dung4, Amiko Hashimoto5, and Monica through the desensitization protocol with 3 bags and 12 2 steps. Conclusion: Enzyme replacement therapy was well L. Guterrez´ tolerated, 42% of patients had any IAR, most of them mild. 1Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, Having a well-established protocol for IAR management USA allows a prompt assistance of the patient, minimizing their 2Saint Louis University, St Louis, MO, USA risks. 3Singapore Institute for Clinical Sciences, Singapore, Singapore Abstracts 63

4Vietnam National Hospital of Pediatrics, Hanoi, Vietnam history of Hunter syndrome and the long-term effectiveness 5Myojinshita Aoki Dermatology Clinic, Tokyo, Japan and safety of idursulfase (Elaprase; Shire) since 2005. The long-term data now available in HOS were used to investigate Introduction: We treated mucopolysaccharidosis IVA (MPS- the effectiveness of idursulfase in a real-world setting over 3 IVA) mice to assess the effects of long-term enzyme replace- years. Methods: As of January 2014, 564 patients followed ment therapy (ERT) initiated at birth, since adult mice treated prospectively in HOS had received at least 1 idursulfase infu- by ERT showed little improvement in bone pathology (Tomatsu sion, after exclusion of females, patients who had received a et al, 2008). To conduct ERT in newborn mice, we used recom- bone marrow transplant, and those enrolled in the TKT018/ binant human N-acetylgalactosamine-6-sulfate sulfatase TKT024 clinical trials. Median age at first treatment was 6.5 (GALNS) produced in a Chinese hamster ovary cell line. years; median treatment duration was 43.4 months. Clinical Method: First, to observe the tissue distribution pattern, a dose measures recorded in HOS at annual time points over 3 years of 250 units/g body weight was administered intravenously in were compared with baseline values; the cohorts analyzed at MPS-IVA mice at day 2 or 3. The infused enzyme was primarily each time point were not identical. Results: Median urinary recovered in liver and spleen, with detectable activity in bone glycosaminoglycan (uGAG) levels, distance walked in the 6- and brain. Second, newborn ERT was conducted after tissue dis- minute walk test, left ventricular mass index, pulmonary func- tribution study. The first injection of newborn ERT was per- tion (forced vital capacity), and liver size had improved after 3 formed intravenously, the second to fourth weekly injections years of treatment compared with baseline (median uGAG, were intraperitoneal, and the remaining injections from 5th to 68.0% vs baseline after 3 years, n ¼ 68). However, the num- 14th week were intravenous into the tail vein. Results: The ber of patients for whom baseline and posttreatment data were MPS-IVA mice treated with GALNS showed clearance of lyso- available was low for some parameters, particularly at 3 years somal storage in liver, spleen, and sinus lining cells in bone mar- (year 1, n ¼ 21–126; year 2, n ¼ 12–88; and year 3, n ¼ 9–68). row. The column structure of the growth plate was organized Conclusion: These findings suggest that a positive trend in the better than adult mice treated with ERT; however, hyaline and clinical effectiveness of idursulfase was generally maintained fibrous cartilage cells in femur, spine, ligaments, disks, syno- over 3 years in these patients in a real-world setting, supporting vium, and periosteum still had storage materials to some extent. the results of previous clinical studies. Hunter Outcome Survey Heart valves were refractory to the treatment. Levels of serum data continue to enhance our understanding of Hunter syn- keratan sulfate were kept normal in newborn ERT mice. drome and its management in everyday practice; ongoing Conclusion: The enzyme, which enters the cartilage before the efforts to improve data quality and completeness, such as the cartilage cell layer becomes mature, prevents disorganization of HOS Moving toward System Enhancement database update, column structure. Early treatment from birth leads to partial will be crucial in maximizing the registry’s long-term potential. remission of bone pathology in MPS-IVA mice. 1109 - Experience With Alternative Regimen 1100 - Clinical Effectiveness of Idursulfase in of Administration of the Enzyme Patients With Hunter Syndrome: 3-Year Replacement Therapy in Patients With Data From the Hunter Outcome Survey Mucopolysaccharidoses I 1 2 3 Joseph Muenzer , Roberto Giugliani , Maurizio Scarpa , Katarıńa Hlavata´1, Anna Sˇalingova´2,Jań Chandoga3, and 4 5 6 Kemi Tanaka , Anna Tylki-Szymanska , Isabelle Morin , Anna Hlavata´1 7 and Michael Beck 12nd Department of Pediatrics Comenius, University Medical School 1Department of Pediatrics, University of North Carolina at Chapel and Children’s University Hospital, Bratislava, Slovakia Hill, Chapel Hill, NC, USA 2Deparment of Laboratory Medicine, Centre of Inherited metabolic 2Department of Genetics/UFRGS and INAGEMP, Medical Genetics Disease, University Children’s Hospital, Bratislava, Slovakia Service/HCPA, Porto Alegre, Brazil 3Institute of Medical Biology, Genetics and Clinical Genetics, Faculty 3Rare Disease Centre, Horst Schmidt Clinic, Wiesbaden, Germany of Medicine, Comenius University, Bratislava, Slovakia 4Department of Pediatrics, Osaka City University Graduate School of Introduction: Mucopolysaccharidoses (MPSs) are a group of Medicine, Abeno-ku, Osaka, Japan inherited lysosomal metabolic disorders, where the absence of the 5Department of Metabolic Diseases, The Children’s Memorial lysosomal enzyme leads to the accumulation of glycosaminogly- Health Institute, Warsaw, Poland cans in lysosomes of the cells in various tissues. According to the 6Shire, Eysins, Switzerland deficient enzyme and clinical manifestations, 8 types of MPSs 7Department of Pediatrics, University Medical Center, Johannes were identified. Mucopolysaccharidosis I together with MPS-II Gutenberg University, Mainz, Germany and MPS-VI belong to the MPSs that are treatable by the admin- Introduction: The Hunter Outcome Survey (HOS) is a global, istration of enzyme replacement therapy (ERT). Methods and multicenter, longitudinal, and observational registry sponsored Results: Enzyme laronidase (Aldurazyme; Genzyme, Cam- by Shire that has been collecting information on the natural bridge, Massachusetts) is administered once a week in 64 Journal of Inborn Errors of Metabolism & Screening intravenous infusion. Foran effective therapy, early diagnosis and been restarted. Conclusion: We conclude that this desensitiza- regular administration of ERT are essential. Enzyme laronidase tion protocol, based on protocols used in other lysosomal dis- (Aldurazyme) is administered in a dose of 0.6 mg/kg once weekly orders such as Pompe disease, appears to have been at least in intravenous infusion. We report our experience in treating partly successful in this patient. Previous published studies patients with MPS-I—Morbus Sheie where due to insufficient reported success with reducing infusion rates to 20 hours but cooperation with the family we modified the regimen of the ERT this is not always practical, especially when ERT is infused administration. Based on the published results from a randomized at home. In selected cases, desensitization may be a more prac- multicenter international study investigating the optimization of tical solution. Conflicts of Interest: Dr Santra has received dosage and safety of administration of laronidase in multiple dos- educational grants and is a principal investigator on clinical ing regimens (Giugliano et al. A dose-optimization trial of laroni- trials sponsored by Biomarin Pharmaceuticals Inc. dase (Aldurazyme) in patients with mucopolysaccharidosis type I. Mol Genet Metab 2008), we changed the dosing regimen to 1.2 mg/kg every 2 weeks. Conclusion: According to our prior 1114 - Idursulfase Treatment in 6 Female observation, this alternative ERT regimen seems to be therapeu- Patients With Hunter Syndrome: Data From tically acceptable. Patients showed improvement in their clinical the Hunter Outcome Survey conditions and the laboratory parameters. However, the long- 1 2 term effects of ERT in this alternative regimen are still unknown. Anna Tylki-Szyman´ska , Maurizio Scarpa , Isabelle Morin3, and Roberto Giugliani4 1Department of Metabolic Diseases, The Children’s Memorial 1111 - Desensitization to Galsulfase for the Health Institute, Warsaw, Poland Treatment of Recurrent Infusion Association 2Rare Disease Centre, Horst Schmidt Clinic, Wiesbaden, Germany Reactions in a Child With 3Shire, Eysins, Switzerland 4 Mucopolysaccharidosis Type VI Department of Genetics/UFRGS and INAGEMP, Medical Genetics Service/HCPA, Porto Alegre, Brazil 1 1 Saikat Santra , Srividya Sreekentam , Catherine A. Introduction: Hunter syndrome is X-linked and therefore 1 1 1 Stewart , Rachel Gould , Anupam B. Chakrapani , and extremely rare in females; little is known about the clinical Suresh Vijay1 manifestations or use of idursulfase (Elaprase; Shire) in female patients. This analysis investigated disease characteristics and 1Birmingham Children’s Hospital, Birmingham, United Kingdom the effectiveness and tolerability of idursulfase in females with Introduction: Mucopolysaccharidosis type VI (Maroteaux- Hunter syndrome. Methods: Data from females enrolled in the Lamy disease) is a severe multisystemic disease in which Hunter Outcome Survey (HOS) were analyzed. Hunter Out- enzyme replacement therapy (ERT) with galsulfase or hemato- come Survey is a Shire-sponsored, global, and observational poietic stem cell transplantation is the only recognized disease- registry of patients with Hunter syndrome. Results: As of Jan- altering treatment. The development of antibodies against uary 2014, 10 of the 970 patients enrolled in HOS were female. infused enzymes is well described and may adversely affect the They were aged between 4.3 and 24.2 years at last HOS visit. clinical response to ERT. We report a 10-year-old patient who Of the 9 female patients for whom information was available, developed recurrent severe infusion-associated reactions neurological manifestations (including cognitive problems), (IARs) after 5 years of ERT in whom ERT was only tolerated pulmonary manifestations (including upper airway infections), with steroid premedication. High titers of antigalsulfase immu- and cardiovascular manifestations (including heart murmur and noglobulin G antibodies were present, but in vitro studies valve disease) were present in 8, 6, and 5 individuals, respec- suggested these were nonneutralizing. Clinical side effects of tively. Of the 10 female patients, 7 were followed prospec- long-term steroid use developed. A desensitization protocol tively, and 6 of them had received at least 1 idursulfase was successful in permitting infusions without the development infusion. A total of 21 adverse events (AEs) were reported in of severe IARs and without the use of steroids. Methods: The 2 patients. In the first patient, 12 nonserious AEs were reported; standard dose of galsulfase (1 mg/kg/dose) was reduced by a 11 were mild in severity, and information on severity was miss- factor of 100 (0.01 mg/kg/dose) and infused at the standard ing for 1 patient. In the second patient, 9 AEs were reported, 4 rates ensuring delivery of the total dose over no less than 4 of which were serious and resulted in hospitalization. All AEs hours in a hospital setting. The administered dose was doubled were considered not to be infusion related. Of the 6 treated each week until the standard dose was reached after 8 weeks. patients, 2 had more than 1 urinary glycosaminoglycan mea- No steroid premedication was given, but premedication with surement available, including 1 within +3 months of treatment loratadine and paracetamol was given. Results: No IARs were start. Urinary glycosaminoglycans were initially elevated observed during the period of desensitization. Occasional IARs above the upper limit of normal but dropped to within the nor- have been observed following 1-year follow-up when the mal range following idursulfase treatment. Conclusion: Anal- patient has returned to home infusions, but these have been ysis of these data from females in HOS showed that clinical much less frequent and severe. Steroid premedication has not manifestations are similar to those seen in male patients and Abstracts 65 that idursulfase infusions were generally well tolerated. Further Conflicts of Interest: Clare Edano: no conflicts of interest. analysis in more patients is required to define the best manage- Mary Malick: no conflicts of interest. Dr Barbara Burton is paid ment approaches in females with Hunter syndrome. Conflicts by the sponsor of the study, BioMarin Pharmaceutical Inc, for of Interest: Dr Scarpa has received grants, travel support, and her services as a consultant and may make presentations about honoraria from Shire, Genzyme Corporation, and BioMarin. her research and clinical activities. Ms Morin is a full-time employee of Shire. Professor Giugliani has received travel grants from Shire, Genzyme, and BioMarin, research grants from Shire, Actelion Pharmaceuticals, Bio- 1117 - Meta-Analysis of Antibody Titers, Marin, Genzyme, and Synageva and honoraria for speaking Safety, and Treatment Outcomes in MPS-I engagements from Shire, Genzyme, BioMarin, and Synageva. Professor Tylki-Szymaska has received travel grants and Receiving Enzyme Replacement Therapy speaker fees from Shire, Genzyme Corporation, BioMarin, and With Laronidase (Aldurazyme) in Clinical Synageva. Studies Yong Xu1, Susan Richards1, Shari Fallet1, Asif ␣ 1115 - Infusion Management of Elosulfase Mahmood1, and Gerald F. Cox1 for Patients With Morquio A Syndrome 1Genzyme, a Sanofi company, Cambridge, MA, USA 1 1 Clare B. Edano , Mary L. Malick , and Barbara K. Introduction/Objectives: Most patients with mucopolysac- Burton1 charidosis I (MPS-I) treated with laronidase (Aldurazyme; Genzyme, Cambridge, Massachusetts) in clinical trials have 1Ann & Robert H. Lurie Children’s Hospital of Chicago, Chicago, IL, developed antilaronidase antibodies. Theoretically, antibodies USA might alter the biological effects of laronidase by inhibiting its Introduction: Morquio A syndrome is caused by a deficiency activity, changing its turnover, limiting its uptake into target in N-acetylgalactosamine-6-sulfatase (GALNS), causing accu- tissues, and/or causing an allergic reaction. The objective of mulation of glycosaminoglycans (GAGs). Patients have multi- this meta-analysis was to determine whether relationships exist systemic impairment and debilitation. Elosulfase a (EA) is an between antilaronidase antibodies and clinical outcomes, enzyme replacement for GALNS, promoting GAG catabolism. hypersensitivity reactions, and urinary glycosaminoglycan We describe results of infusion-associated reaction (IAR) man- (uGAG) reduction in patients with MPS-I receiving laronidase. agement in 7 patients. Methods: Seven patients participated in Methods: Data from 73 patients enrolled in 4 clinical trials of an early access program of EA and received weekly infusions laronidase were used for this meta-analysis. Patients received of 2 mg/kg/wk for 18 to 31 weeks (median ¼ 28 weeks). treatment with the labeled dose of laronidase (0.58 mg/kg/ Patient’s age was 2 to 25 years (median 6 years). Results: Infu- wk) for 26 to 208 weeks. Efficacy parameters included 6- sion compliance was high; only 8% were missed due to illness, minute walk test, percentage of predicted forced vital capacity, surgery, or weather preventing travel. Patients were asked to liver volume, range of motion, left ventricular mass, investiga- consume a light meal and *30 minutes preinfusion were given tor global assessments, and uGAG levels, as appropriate, in nonsedating antihistamines. For patients with history of IARs individual studies. Safety and immunogenicity parameters or other risk factors (eg, allergies), sedating antihistamine was included infusion-associated reactions (IARs), antilaronidase administered with additional agents (eg, H2 blocker, montelu- immunoglobulin (Ig) G antibodies (seroconversion and time kast sodium, or steroids). Antipyretic drugs were optional. Of to seroconversion, peak titer, and overall exposure to IgG anti- the 7 patients, 5 experienced IARs, defined as any adverse bodies over time), enzyme activity inhibition and enzyme cel- events occurring between onset of infusion and 1 day following lular uptake inhibition assays, and hypersensitivity testing (ie, end of infusion, regardless of whether related to treatment. All IgE, complement activation, and serum tryptase). Results: IARs were classified as mild and occurred in 10% of infusions Based on the analysis of selected clinical outcome measures, administered, most of which were manageable with sympto- there was no apparent correlation between antilaronidase IgG matic treatment and/or infusion rate modification. No patients antibodies and efficacy outcomes. Likewise, there was no who had an AE during the infusion required infusion disconti- apparent relationship between antibodies and the occurrence nuation. The most common IARs in these 5 patients were of potential allergic reactions or IARs. There was, however, a headache (3.3%), pallor (3.3%), emesis (3.3%), chest tightness statistically significant inverse correlation between uGAG (2.7%), hives (2.7%), altered heart rate (2.7%), nausea (2.1%), reduction and antibody titer (P ¼ .0001), consistent with indi- light headedness (1.1%), and anxiety (1.1%). All patients vidual study results. Conclusion: This meta-analysis describes who experienced an IAR received and tolerated subsequent the most comprehensive, systematic review of immunogenicity infusions. No patients discontinued treatment. Conclusion: data from clinical studies of Aldurazyme (including long-term Infusion-associated reactions from IV EA infusions were mild follow-up) and involves patients with all MPS-I phenotypes. and successfully managed in the 5 of the 7 patients with Mor- Although the presence of antibodies correlated with impaired quio A Syndrome receiving treatment who experienced them. urinary GAG clearance, no impact on the clinical efficacy or 66 Journal of Inborn Errors of Metabolism & Screening safety of laronidase was observed. This study was funded by adjustment for age. Conclusion: In a mixed-age population the Genzyme/BioMarin Joint Venture. Conflicts of interest: with MPS-II having various genotypes, 50% of patients devel- All authors are employees of Genzyme, a Sanofi company. oped antibodies on treatment with idursulfase. The study shows higher levels of uGAGs in antibody-positive patients, but the association between IRAEs and antibodies is weak, confirming 1118 - Limited Association Between Infusion earlier studies. Conflicts of Interest: This study was funded by Reactions and Anti-Idursulfase Antibodies Shire (NCT00882921). Dr Harmatz has received travel, honor- Developed During Long-Term Idursulfase arium, and consulting fees from BioMarin, Shire, and Alexion Enzyme Replacement Therapy in Patients and has undertaken contracted research for Alexion-Enobia, With Mucopolysaccharidosis II Aged 5 to 35 BioMarin, FerroKin-Shire, Sanofi-Genzyme, and Shire. He has also been the recipient of educational grants from BioMarin, Years Sanofi-Genzyme, and Shire. Dr Giugliani has received consulting fees from and has undertaken contracted research for Ami- Paul Harmatz1, Roberto Giugliani2, Nancy J. 3 4 5 cus, BioMarin, Sanofi-Genzyme, and Shire. In addition, he has Mendelsohn , Ashok Vellodi , Simon A. Jones , Yune received fees from Actelion, BioMarin, Sanofi-Genzyme, and 6 6 6 Kunes , Kenneth Sciarappa , Bonnie Bielefeld , Ann J. Shire. Dr Mendelsohn has received consulting fees and travel Barbier6, Arian Pano6, and Christian J. Hendriksz7 stipends from and has undertaken contracted research for Bio- Marin, Sanofi-Genzyme, and Shire. Dr Vellodi has no conflicts 1Children’s Hospital Oakland, Oakland, CA, USA of interest or disclosures. Dr Jones has received honoraria, 2Department of Genetics/UFRGS, Medical Genetics Service/HCPA, travel grants, or research grants from Shire. Dr Hendriksz has and INAGEMP, Porto Alegre, Brazil received consulting fees from Actelion, BioMarin, GlaxoS- 3Children’s Hospitals and Clinics of Minnesota, Minneapolis, MN, mithKline, and Sanofi-Genzyme and has undertaken contracted USA research for Actelion, Amicus, BioMarin, GlaxoSmithKline, 4Metabolic Medicine Unit, Great Ormond Street Hospital for Sanofi-Genzyme, Shire, and Synageva. Dr Vijayaraghavan has Children NHS Foundation Trust, London, United Kingdom received consulting fees from BioMarin, Sanofi-Genzyme, and 5St Mary’s Hospital, Manchester, United Kingdom Shire and has undertaken contracted research for Shire. Ms 6Shire, Lexington, MA, USA Bielefeld and Drs Kunes, Sciarappa, Barbier, and Pano are all 77Salford Royal NHS Foundation Trust, Salford, United Kingdom employees of Shire. Introduction/Objectives: We conducted a 2-year study to examine the long-term immunogenicity and safety of idursulfase (NCT00882921). The primary and secondary objectives 1123 - The Clinical Effect of Enzyme were to assess the impact of immunoglobulin G antibody Replacement Therapy on Carpal Tunnel status on safety (via infusion-related adverse events [IRAEs]) Syndrome Prior to Bone Marrow Transplant and efficacy (via urinary glycosaminoglycans [uGAGs]). in Patients With Hurler Syndrome Methods: Twenty-six patients with mucopolysaccharidosis II (MPS-II, Hunter syndrome) aged 5 to 35 years who had Ann E. Van Heest1, Mitchell Wyffels1, and Paul Orchard1 received intravenous idursulfase for 6 months prior to entry 1University of Minnesota, Minneapolis, MN, USA were enrolled. Results: Fifteen patients completed the study. In the genotype analysis, 11 patients had a missense mutation, Introduction/Objective: In the past, carpal tunnel syndrome 3 each had a nonsense or frameshift mutation, and 2 had a com- was present in up to 73% of children with Hurler syndrome. plete deletion/rearrangement. Genotype was unavailable for 5 With Food and Drug Administration approval of enzyme patients and 2 patients were unclassifiable. Eleven patients had replacement therapy for treatment of mucopolysaccharide stor- serum anti-idursulfase antibodies at baseline, and 2 additional age diseases (MPSD), is there a change in the frequency of car- patients had developed intermittent antibody seropositivity at pal tunnel syndrome? The purpose of this study is to evaluate week 13. Of the 26 patients, 9 (35%) had 1 sample positive the frequency of carpal tunnel syndrome in 1 patient group with for neutralizing antibodies during the study. Patients with mis- MPSD type IH (Hurler syndrome) treated with enzyme sense mutations were less likely to develop antibodies than replacement therapy prior to bone marrow transplant (BMT). were those with other genotypes. At study entry, uGAG levels Methods: Thirty-four patients with MPSD type 1H treated were low due to prior enzyme replacement therapy and did not with enzyme replacement therapy prior to transplant were eval- change appreciably thereafter. Antibody-positive patients had uated. All patients’ records were reviewed for nerve conduction higher uGAG levels at study entry and throughout the study studies and carpal tunnel surgical intervention. A comparison than did antibody-negative patients at the same time points. of the number of patients requiring surgery as well as the effec- Nine patients reported IRAEs. In this small data set, tiveness of treatment as indicated by objective nerve conduc- antibody-positive patients appeared to have a higher risk of tion study assessment was evaluated. Nerve conduction developing an IRAE than did antibody-negative patients. This velocity and latency were evaluated based upon comparative risk was not statistically significant and decreased after findings on the ipsilateral ulnar nerve. Results: At an average Abstracts 67 follow-up of 26.6 months, 7 (21%) of the 34 patients in the 1-mg group at month 6. Only 5 of the 16 patients were cogni- enzyme treatment group had undergone bilateral carpal tunnel tively testable over time using the Differential Abilities Scale, release for the treatment of symptomatic carpal tunnel syn- 2nd version. Of these, 4 patients who were receiving 10 or 30 drome. Of the 7 patients treated with open carpal tunnel release, mg monthly showed signs of stabilization or a decreased rate follow-up nerve studies were available in 5 patients. Average of decline in cognitive scores over time. The remaining patient, preoperative median nerve latency was 3.78 and average post- who received 1 mg monthly for 6 months, had a decreased score operative median nerve latency was 2.99. Conclusion: Enzyme and was switched to 10 mg in the extension study, after which replacement therapy at the time of BMT is effective at reducing his score stabilized. Conclusion: These data support further the frequency of carpal tunnel syndrome in patients with Hurler development of idursulfase-IT for the stabilization of cognitive syndrome. Although carpal tunnel syndrome is less common in function in moderately affected patients with MPS-II having children with MPSD type 1H after enzyme replacement prior to severe phenotype. Conflicts of Interest: Dr Muenzer has BMT, screening evaluations with nerve conduction velocity received honoraria, educational, and travel grants from Janssen testing is still recommended. For children with MPSD type R&D and Shire and has participated in clinical trials with Bio- 1H, carpal tunnel release remains an effective treatment for Marin Pharmaceutical and Shire. Dr Hendriksz has received improving median nerve conduction. honoraria, educational, and travel grants from Actelion Pharma- ceuticals, BioMarin Pharmaceutical, GlaxoSmithKline, Shire, and Sanofi-Genzyme and has participated in clinical trials with 1126 - Investigational Intrathecal Enzyme Actelion Pharmaceuticals, Amicus Therapeutics, BioMarin Replacement Therapy for Children With Pharmaceutical, GlaxoSmithKline, Shire, Sanofi-Genzyme, and Severe Form of Hunter Syndrome Synageva BioPharma. Dr Stein has received honoraria and travel (Mucopolysaccharidosis II) grants from Shire. Dr Vijayaraghavan has received honoraria and travel grants from Shire and has participated in clinical trials Joseph Muenzer1, Christian J. Hendriksz2, Margot B. with Shire. Dr Santra has received educational and travel grants from Shire and has participated in clinical trials with Shire and Stein1, Zheng Fan1, Shauna Kearney2, Johan Horton2, 2 1 2 BioMarin Pharmaceutical. Dr Solanki has received honoraria Suresh Vijayaraghavan , Victor Perry , Saikat Santra , and travel grants from and has participated in clinical trials with 2 3 3 Guirish A. Solanki , Luying Pan , Nan Wang , Mary Ann BioMarin Pharmaceutical and Shire. Drs Fan, Horton, and Perry Mascelli 3, Kenneth Sciarappa 3, and Ann J. Barbier3 and Ms Kearney have nothing to declare. Drs Mascelli, Pan, Sciarappa, and Barbier and Ms Wang are employees of Shire. 1University of North Carolina at Chapel Hill, Chapel Hill, NC, USA 2Birmingham Children’s Hospital NHS Foundation Trust, Birmingham, United Kingdom 1132 - Combined Therapy With Genistein 3Shire, Lexington, MA, USA and Aldurazyme in an MPS-I Mouse Model Introduction: There is no available effective treatment for Marcelina H. Malinowska1, Wioletta Kobiela1, Joanna A. cognitive impairment in mucopolysaccharidosis II (MPS-II). 1 2 The safety of investigational human recombinant iduronate Jakobkiewicz-Banecka , Magdalena Gabig-Ciminska , 3 2-sulfatase formulated for intrathecal administration (idursul- Grazyna Peszynska-Sularz , Jolanta Paradziej- fase-IT) via an intrathecal drug delivery device (IDDD) was Lukowicz3, and Grzegorz Wegrzyn1 examined in a phase I/II clinical trial and its extension both spon- 1Department of Molecular Biology, University of Gdan´sk, Gdan´sk, sored by Shire. Change in the concentration of glycosaminogly- Poland cans in cerebrospinal fluid (CSF) and change from baseline in 2Laboratory of Molecular Biology (Affiliated With the University of standardized neurocognitive assessments were also assessed. Gdan´sk), Instituite of Biochemistry, Warszawa, Poland Methods: Sixteen cognitively impaired children with MPS-II 3Tri-City Experimental Animal House, Medical University of Gdan´sk, previously treated with weekly intravenous idursulfase (Ela- Gdan´sk, Poland prase; Shire, Lexington, Massachusetts) for 6monthswere enrolled. Four patients per dose group received either no treat- Introduction: Mucopolysaccharidosis type I (MPS-I) results ment or 10, 30, or 1 mg idursulfase-IT monthly for 6 months from deficiency in a-L-iduronidase (IDUA) in lysosomes and while continuing intravenous idursulfase 0.5 mg/kg weekly. subsequent accumulation of glycosaminoglycans (GAG). Clin- Patients continued into an ongoing extension study, receiving ical enzyme replacement therapy (ERT) with intravenous laro- either 10 or 30 mg monthly. Results: No serious adverse events nidase (Aldurazyme; Genzyme, Cambridge, Massachusetts) related to idursulfase-IT were observed. The total time of expo- reverses some aspects of the disease but does not bring neuro- sure to idursulfase-IT was 18 to 53 months. Surgical revision/ logic benefits because the blood–brain barrier blocks the removal of the IDDD was required in 6 of the 12 patients in the enzyme from reaching the central nervous system. On the other first 6 months. Some doses were administered by lumbar punc- hand, substrate reduction therapy with genistein improves neu- ture. The mean CSF glycosaminoglycan concentration was ropathology. We consider the possibility that a combination of reduced by~90% in the 10- and 30-mg groups and *80% in the ERT with SRT might provide some metabolic correction in the 68 Journal of Inborn Errors of Metabolism & Screening visceral organs as well as in the brain. Methods: In 3-month and spleen size, and normal facial morphology and has only study, 8-week-old male and female MPS-I and wild-type mice mild thickening of cardiac valves. He has developed mild received soy-free diet and 5 times a week genistein at dose 160 scoliosis (23), reduced height (crossed from the 90th to mg/kg/d as a suspension in 0.9% NaCl by oral gavage, weekly 3rd centile), and has mild to moderate corneal clouding. intrperitoneal injections of Aldurazyme at dose 100 U/kg, or He has significant skeletal disease including avascular combination of both. At the end point, mice were killed and tis- necrosis of the hips and has also required carpal tunnel sur- sues analyzed for GAG content. Results: After 3 months treat- gery. The older sibling has maintained her initial marked ment, we observed that MPS-I mice responded to all of the improvement in joint range of movement and scoliosis tested therapies in a sex-dependent manner. Combination of mobility. She has softening of her facial features, stabilized ERT and SRT had a positive impact on liver and spleen size, mild cardiac valve pathology, and moderate corneal cloud- however, did not have any greater therapeutic effects on liver ing. Her height is 11.7 cm below the first centile (after cor- and spleen GAG level than the enzyme replacement with recting for scoliosis). Rodding of her spine, which was Aldurazyme. Genistein-treated MPS-I mice had reduced GAG considered necessary prior to initiating ERT, has now been storage compared to untreated control but not to the level deferred until completion of growth. She has required sur- reached when the combined treatment or monotherapy with gery for craniocervical compression and upper cervical an enzyme was applied. None of the tested therapy had impact instability, severe pes cavus, carpal tunnel syndrome, and on GAG storage in the brain. Conclusion: Substrate reduction genu valgum. Her kyphoscoliosis has slowly progressed. therapy with high dose of genistein combined with enzyme Conclusion: Early initiation of ERT prevents or slows the replacement therapy revealed beneficial effects on GAG stor- development of soft tissue features of MPS-VI. The greatest age in visceral organs but did not have impact on the brain. benefits occur with commencing ERT in the first few months of life. These benefits have become more evident over the 10 years of ERT. Even early initiation of ERT does 1135 - Sibling Comparison Study of 10 Years not prevent skeletal disease in the severe phenotype of of Enzyme Replacement Therapy for MPS-VI. Conflicts of Interest: BioMarin supplied the first 5 years of enzyme replacement therapy free of charge as Mucopolysaccharidosis Type VI Starting at part of a research trial. J. McGill and A. Inwood have 3.5 Years and 8 Weeks of Age received funding for travel and accommodation at educa- 1 2 3 tional meetings from BioMarin. Honorariums for presenta- Anita C. Inwood , Glen G. Gole , Geoffrey N. Askin , Paul tionsgivenbyJ.McGillandA.Inwoodhavebeenpaid 4 5 6 Pincus , Jacqueline Cramb , Christopher Whight , John J. to the Royal Children’s Hospital. No other Author has a Hopwood7, and Jim J. McGill1 conflict of interest. 1Department of Metabolic Medicine, Royal Children’s Hospital, Brisbane, Australia 1140 - Delivering Enzyme Replacement 2 University of Queensland Discipline of Paediatrics and Child Health, Therapy for Mucopolysaccharidosis and Royal Children’s Hospital, Brisbane, Australia Other Lysosomal Storage Disorders to the 3Department of Orthopaedics, Mater Children’s Hospital, Brisbane, Australia CNS Across the Blood–Brain Barrier 4 Wesley Orthopaedic Clinic, Wesley Hospital, Brisbane, Australia 1 5Department of Physiotherapy, Royal Children’s Hospital, Brisbane, David John Begley Australia 1Institute of Pharmaceutical Science/Kings College London, London, 6Cardiology Department, Prince Charles Hospital, Brisbane, United Kingdom Australia The restrictive nature of the blood–brain barrier (BBB) means 7LDRU, South Australian Health and Medical Research Institute, that cellular machinery must be in place to deliver macromo- South Australia lecules to the brain. After intravenous infusion, most enzyme Objective: To determine the advantages of early treatment replacement therapy (ERT) does not reach the central nervous with enzyme replacement therapy (ERT) using galsulfase system as the mannose-6-phosphate receptor is downregu- (Naglazyme) in 2 siblings with mucopolysaccharidosis VI lated at the BBB. Delivery of most macromolecules to the (MPS-VI). Previously published comparisons of the siblings brain is achieved by systems of vesicular transcytosis, which were after 3.5 and 7 years of ERT. Methods: Galsulfase are more complex than initially supposed, both in terms of was given weekly at a dose of 1 mg/kg intravenously start- structure and in terms of regulation. Brain endothelial cells ing from 3.5 years and 8 weeks of age, respectively. The exhibit relatively few endocytic vesicles compared to periph- siblings were assessed after 10 years treatment. Results: eral blood vessels but can still deliver macromolecules via 1 Treatment has been well tolerated by both siblings with of the 3 main types of vesicles; the most numerous clathrin- no infusion-associated reactions recorded. The younger sib- coated vesicles containing adaptor protein complex 2, the ling has preserved range of joint movement, normal liver smaller caveolae formed from lipid raft domains of the plasma Abstracts 69 membrane and the large fluid engulfing macropinocytotic attention to any slight, moderate, or severe reactions during vesicles. Both clathrin-coated vesicles, and, to a lesser extent, infusion, which may require interruption of treatment. caveolae endocytose plasma membrane receptors and their Conclusion: The nursing care to the patient with MPS during specific ligands including insulin, transferrin and lipopro- ERT requires training and experience to ensure patient’s teins. This receptor-mediated transcytosis (RMT) delivers the safety and comfort. ligands to the brain and enables their receptors to be recycled back to the plasma membrane. However, once endocytosed, the ligands and/or receptors must be directed toward the cor- 1146 - Mucopolysaccharidoses: Cardiac rect plasma membrane and avoid degradation in the late endo- somes and lysosomes. How this is achieved has not been well Follow-Up and Effects of Enzyme studied, although there is an important role for Rab GTPases Replacement Therapy in targeting vesicles to their correct location and enabling 1 exocytosis. This presentation will discuss what is currently Erlane Marques Ribeiro , Ada Maria Farias Sousa 2 3 known about RMT at the BBB and related cell types and how Borges , Ida Vanessa Schwartz , and Carlos Antoˆnio modified ERT may be able to cross the BBB and deliver Bruno da Silva4 enzyme to the brain. 1Institute of Child, FMUSP, Saõ Paulo, Brazil 2College of Medicine Estaćio de Juazeiro-do-Norte, Estaćio-FMJ, 1142 - Nursing and Enzyme Replacement Juazeiro do Norte, Brazil 3 Therapy Department of Genetics, Federal University of Rio Grande do Sul, Porto Alegre, Brazil Sueli Canossa1,2, Viviani T. Silva2, Carolina S. Aranda2, 4Postgraduate Program in Health Sciences, Federal University of Rio Marco A. Curiati2, Carmen S. C. Mendes2, Maret H. Grande do Norte, Rio Grande do Norte, Brazil Rand2, and Ana M. Martins2 Introduction/Objectives: Mucopolysaccharidoses (MPSs) are metabolic diseases whose progressive accumulation of glyco- 1Elza Nagy Canossa, Brazil saminoglycans affects tissues of all organs, including the heart. 2Centro de Referenciaˆ em Erros Inatos do Metabolismo, The aim of this study was to describe the cardiac abnormalities Universidade Federal de Sao Paulo, Saõ Paulo, Brazil of patients with MPS and report the experience of monitoring Introduction/Objective:Mucopolysaccharidoses (MPSs) are a these cases. Methods: A cohort study of cases with MPS fol- heterogeneous group of metabolic disorders caused by different lowed between 2002 and 2011. Data were obtained from infor- enzymatic defects that increases glycosaminoglycan (GAG). mation of medical records, interviews with patients and Currently, there is treatment available for MPS-I, -II, and -VI families, physical examination, and periodic cardiac evaluation through enzyme replacement therapy (ERT). The aim of this with specific protocol. Results: We included 50 Brazilian study is to report the nursing care in all steps involved in enzyme patients (35 males and 15 female) with a median age of cardiac infusion for the treatment of MPS. Methods: To detail the nur- involvement of 4 years. Cardiac disease was present in all type sing care to patient with MPS during routine infusions of differ- of MPSs, although it occurred earlier and frequently in MPSs ent enzymes in Reference Center for Inborn Errors of I, II, and VI than in MPSs III and IVA. Echocardiographic Metabolism at Universidade Federal de Sao Paulo. Results: alterations were detected in 87% of cases, whereas 68% had Patients with MPS-II (n¼ 13) and patients with MPS-VI abnormal auscultation and 8% presented with cardiovascular (n ¼ 7) were attended at infusion center weekly. Patients with complaint. The most common findings were left valve lesion MPS-I (n ¼ 15) were assessed in different ways (11, weekly/ (78% mitral, 56% aortic, and 40% both) and left ventricular 4, and every other week). The following vital signs were hypertrophy (15%). The most severe cardiac disease was assessed when the patient arrived at the center: temperature, cardiomyopathy. Enzyme replacement therapy could prevent heart rate, respiratory frequency, blood pressure, and oxygen (1 case), improve (1 case), and maintain (4 cases) the cardiac saturation. Patients were questioned whether there is presence lesion. Conclusion: Cardiac involvement is present in most of infection and are using any medicine, including antibiotics. patients with MPS, although there are few clinical signs and If the patient has a history of fever in the last 48 hours or in symptoms. Left valve lesions and ventricular hypertrophy use of antibiotics in the first 72 hours, the infusion is sus- were the most characteristic cardiac finding in MPS. Enzyme pended due to the higher risk of adverse reaction to the infu- replacement therapy may have a significant impact on pro- sion of the enzyme in these situations. If the patient is able to gression of cardiac disease. Conflicts of Interest: Erlane receive the enzyme, venous access (VA) is installed (10 porth Marques Ribeiro has received from BioMarin, Shire, and and 25 simple) and started the infusion as bulla. The signs are Genzyme travel expenses as part of continuous medical checked every 15 minutes during the first hour and then every education, speakers honorarium, and grant as researcher for hour. After the end of treatment, VA was washed with saline. Hunter Outcome Survey. Ida Vanessa Schwartz has received The porth-a-cath is heparinized and simple VA is drawn, also from BioMarin, Shire, and Genzyme travel expenses as part of emphasizing that nursing professionals should always pay continuous medical education and grant as researcher for 70 Journal of Inborn Errors of Metabolism & Screening

Hunter Outcome Survey. The other authors report no conflict 1149 - Joint Amplitude in Children With of interest. Mucopolysaccharidose VI Undergoing Enzyme Replacement Therapy 1148 - Phase 3 Study to Assess the Efficacy Nicolette Celani Cavalcanti1, Ana Carolina Esposito1, and Safety of Recombinant Human Annaliese Barth1, and Dafne Dain Gandelman Horovitz1 b 1 -Glucuronidase in MPS-VII: A Novel Instituto Fernandes Figueira, Fiocruz, Rio de Janeiro, Brazil Randomized, Placebo-Controlled, Blind-Start, and Single-Crossover Design Introduction and Objective: Contractures in mucopolysaccharidosis type VI (MPS-VI) are progressive and restrict and Analyses movement and functionality in those affected by the disease. 1 1 2 This study aimed to verify the degree of joint limitation and Emil Kakkis , Alison Skrinar , and James Signorovitch the evolution of range of motion (ROM) in patients with 1Ultragenyx Pharmaceutical Inc, Novato, CA, USA MPS-VI undergoing enzyme replacement therapy (ERT). 2Analysis Group, Inc, Boston, MA, USA Materials and Methods: A longitudinal study was carried out at Instituto Fernandes Figueira (IFF, Rio de Janeiro, Bra- Background: Mucopolysaccharidosis type VII (MPS-VII, Sly zil) between July 2012, and March 2014, and 7 patients (aged syndrome), a lysosomal storage disorder caused by deficiency 4-11 years) were included. Only 1 child was under regular in b-glucuronidase (GUS), is multisystemic, chronically debil- physical therapy. Three or four goniometric assessments were itating, and life threatening. Preliminary data from the ongoing performed using the mean values for analysis. Investigated open-label studies of recombinant human GUS (rhGUS) in 4 movements were shoulder flexion; extension of elbows, patients and prior successful enzyme replacement therapy wrists, hips, and knees; and dorsal flexion of feet. Results (ERT) experience in MPS diseases comparable to MPS-VII were computed as positive/negative results only for values support the continued development of ERT for MPS-VII. that reached a minimum of 5 above or below the first assess- Objectives: A phase 3 study has been designed to accom- ment. Differences until 5 were considered as unchanged. The modate the extreme rarity and clinical heterogeneity of averages were recorded to check the existing lag and com- MPS-VII, as the traditional randomized controlled study is paredtonormalROM.Results: Discrepant loss of ROM, inappropriate and infeasible. Methods and Results: The with variations from 7.4% to 46.7%, was registered in ana- blind-start study design obscures when patients begin active lyzed joints. Positive comparative results or unchanged treatment through the use of a placebo-crossover design to ROM were obtained in 55.94% of cases, with emphasis on allow more objective assessments of clinical efficacy. The hips, wrists, and knees. The largest comparative losses of study would randomize 12 patients (aged 5-30) 1:1:1:1 to initi- ROM were verified at the joints of feet, elbows, and shoulders. ate double-blind active therapy at different time points from Conclusion: The evolution of ROM in patients undergoing baseline, preceded by 0, 8, 16, or 24 weeks of placebo. All ERT seems to be satisfactory in some of the studied joints; patients receive enzyme for 24 to 48 weeks; 75% of patients some joints, however, did not reach minimal results, dorsal receive placebo for some time. Efficacy assessments are flexion of feet being an example. Longitudinal studies basedoncomparisonofurinaryGAGexcretionandclinical involving more patients and MPS types, as well as longer end points from last pretreatment assessment to 24 weeks follow-up, may provide more consistent data on this patient, posttreatment in all patients. Placebo treatment data allow which particularly affect the quality of life. Enzyme replace- for additional supportive analyses. To address clinical het- ment therapy may help maintaining ROM, although the role erogeneity, a multidomain responder index is intended to of early physical therapy in enhancing ROM must be capture the aggregate effect across multiple clinical domains considered. as a secondary end point. Safety reporting will be improved using a novel Adverse Physiology Related Group reporting intended to synthesize safety symptoms in a priori recognized multidomain symptom groups. Conclusion: The randomized, placebo- 1151 - Hunter Disease: Experience With controlled, blind-start, and single-crossover study maximizes Enzyme Replacement Therapy in 5 treatment outcome assessment in limited sample settings, reduces Argentinian Patients the impact of baseline randomization imbalance, and maintains objectivity in the placebo-controlled, double-blind assessments. Norberto B. Guelbert1,2, Adriana B. Becerra2, Alicia N. Innovative use of safety and efficacy analyses may help studies Giner-Ayala2, Ana M. Oller-Ramirez2, Nidia Azar2, in the small, heterogeneous populations. A phase 3 study is Andrea Delgado2, Dora Martinez2, Sandra Antonozzi2, expected to start in 2014. Conflicts of Interest: EK and AS are 2 employees of Ultragenyx Pharmaceutical Inc. JS is an and Guillermo A. Guelbert employee of Analysis Group Inc, who has received consulting 1Jefe Servicio Enfermedades Metabolicas Hospital de Nin˜os, fees from Ultragenyx Pharmaceutical Inc. Cordoba, Argentina Abstracts 71

2 Centro de Estudio de las Metabolopatıás Congenitas´ (CEMECO), deficiency in a-L-iduronidase. Patients with MPS-I present Hospital de Ninõs, Ca´tedra de Pediatrıá, Torrelodones, Spain with multisystemic involvement and can be treated with enzyme replacement therapy (ERT) with laronidase in dose Introduction: The Hunter disease (HD) is an X-linked multi- of 0.58 mg/kg/wk. Methods: To evaluate the efficacy and systemic lysosomal disease. The deficiency in iduronate safety of ERT through systematic review of literature and sulfatase produces glycosaminoglycans (GAGs) that accumu- meta-analysis. Studies comparing laronidase with other lates in tissues and organs resulting in a broad clinical spec- intervention were searched on Clinical Trials, Cochrane trum with moderate to severe phenotypes. Enzyme Library, MEDLINE, EMBASE, and LILACS databases up replacement therapy (ERT) with recombinant human iduro- to February 18, 2014. Inclusion criteria were randomized nate sulfatase attempts to correct the pathophysiology of controlled trials (RCTs) or—in absence of it—prospective HD reversing and preventing accumulation of GAGs. case series with 5 patients that evaluate relevant out- Objectives: (1) To communicate the relative prevalence of comes. Results: We identified 345 articles, but only 10 met HD in Cemeco, Co´rdoba, and Argentina. (2) To show clinical, the inclusion criteria. In all, 1 RCT comparing idursulfase to biochemistry, enzyme, and molecular experience in these placebo and 09 prospective case series were included in the patients. (3) To assess the effects of ERT with idursulfase in study. It was possible to perform meta-analysis with some 5 patients. Methodology: We review the casuistry of outcomes with the following results: reduction in liver size Cemeco, covering a period of 32 years (1981-2013). The diag- (mean change of 27.5% [confidence interval (CI) 95% noses were confirmed by assay of urinary GAGs, enzymatic 31.6 to 23.4]), normalization of liver size in 87% of assay in plasma, leukocytes and/or dried blood, and molecular patients, and reduction in urinary glycosaminoglycans studies in 6 cases. Results: Fifty-nine patients were diagnosed (68 mg/mg creatinine [CI 95% 74.6 to 61.4]); however, as having some form of mucopolysaccharidosis. Fifteen there were no significant difference in distance covered in (25%) males were HD. The age at diagnosis ranged from 3 the 6-minute walk test (mean change 17.16 m [CI 95% to 10 years. Genotype was identified in 6 patients with 5 dif- 5.9 to 40.2]). Other outcomes included in meta-analysis ferent mutations, 3 of them were new. Two patients were were adverse events related to treatment or infusion (63% found to have ‘‘novo mutation.’’ In its natural evolution, 9 and 47% of patients had at least 1 event, respectively) and patients died around the first decade of life, and 1 died at 2 development of immunoglobulin G antibodies to laronidase years in association with congenital heart disease. Of the (71% of patients). Conclusion: Laronidase can bring some remaining 5 patients, 1 received bone marrow transplantation benefits to patients with MPS; however, the majority of the at 6 years without success. All started with ERT between 10 studies evaluated surrogate end points. Clinical heterogene- and 15 years, with no record of adverse effects, showing ity and small size sample also limited the conclusions about decrease in urinary GAGs and organomegaly and improve- the effect of ERT in MPS-I. Support: CNPq. ment in the quality of life. However, torpid evolution was due to erratic infusions. Two patients died of lung disease and another had sudden death. Conclusion: The HD has a high pre- 1162 - Intrathecal or Intravenous valence in our study. The ERT was beneficial in patients who ␣ received it, but late diagnosis and irregularity in infusions are Recombinant Human -L-Iduronidase factors of high morbidity and mortality. Early diagnosis and Improves Brain Myelination in Canine MPS-I ERT represent a prerequisite for therapeutic success. Patricia I. Dickson1, James M. Provenzale2,3, Steven Chen2, Igor Nestrasil4, Jennifer Yee1, Shih-hsin Kan1, 1161 - Enzyme Replacement With Laronidase Steven Q. Le1, Jacqueline Jens5, Elizabeth Snella5, Miguel for Patients With MPS-I: A Systematic Review A. Guzman6, Charles Vite7, Elsa G. Shapiro4, and N. and Meta-Analysis Matthew Ellinwood5 Taciane Alegra1, Alicia D. Dorneles2, Dauana P. Eizerik1, 1LA BioMed at Harbor-UCLA, Torrance, CA, USA 1 3 2 2Department of Radiology, Duke University, Durham, NC, USA Osvaldo Artigala´s , Tiago V. Pereira , Andry F. Costa , 3 4 Department of Radiology, Emory University, Atlanta, GA, USA and Ida V. D. Schwartz 4Department of Pediatrics, University of Minnesota, Minneapolis, 1Post Graduation Program in Genetics and Molecular Biology, Rio MN, USA Grande do Sul, Brazil 5Department of Animal Science, Iowa State University, Ames, IA, 2Hospital de Clıńicas de Porto Alegre, Porto Alegre, Brazil USA 3Hospital Alemaõ Oswaldo Cruz, Saõ Paulo, Brazil 6Department of Pathology, Saint Louis University, St Louis, MO, USA 4Genetics Department, Federal University of Rio grande do Sul, Porto 7School of Veterinary Medicine, University of Pennsylvania, Alegre, Brazil Philadelphia, PA, USA Introduction: Mucopolysaccharidosis type I (MPS-I) is an Introduction: Children with mucopolysaccharidosis type I autosomal recessive lysosomal storage disorder caused by (MPS-I) show reduced fractional anisotropy (FA, a measure 72 Journal of Inborn Errors of Metabolism & Screening of white matter integrity) on diffusion tensor imaging (DTI) of (MPS) VI (MPS-VI) and identify possible influence of extrin- the corpus callosum (CC) that correlates with diminished atten- sic factors on prognosis. Methodology: Case report of 2 sib- tion. Our studieson MPS-I dogs suggest that reduced volume lings with biochemical diagnosis of the MPS-VI from Monte and FA in the CC are caused by abnormal myelination. We Santo - Bahia, and onset of the ERT in different ages. To com- therefore studied the impact of enzyme replacement therapy pare the clinical assessment and the importance of early treat- (ERT) with recombinant human a-L-iduronidase on abnormal ment. Results: The brothers are 12 and 5 years old and both use myelination in the canine CC. Methods: The MPS-I dogs ERT with galsulfase (rhASB5) weekly, with no reports of received intrathecal (IT) ERT 0.05 mg/kg every 3 months adverse reactions to treatment. The older brother started treat- and/or intravenous (IV) ERT 0.58 to 2.0 mg/kg weekly. ment when he was 6 years old and with clinical manifestations Untreated MPS-I and unaffected carriers were used as controls. of the disease and the youngest, when he was 6 months and Dogs underwent brain magnetic resonance imaging and DTI. asymptomatic. Nowadays, both have corneal clouding, claw Corpus callosum was evaluated using sandwich enzyme- hands, important limitations to the elevation, and extension linked immunosorbent assay for myelin basic protein (MBP), of the upper limbs, pectus carinatum, and arched feet. The reverse transcription-polymerase chain reaction for myelin- older brother has major kyphoscoliosis and difficulties in related gene expression, lipidomics, and electron microscopy. reading and writing, unlike the younger brother who achieves Results: Mean whole CC volumes were lower in MPS-I dogs good academic performance. It was observed that, when start- versus carriers (P ¼ .02). Corpus callosum volume was pre- ing treatment, the elder brother had height and body mass served with IT ERT (P ¼ .006 vs untreated MPS-I). Fractional index equal to 0.947 m (p3) and 16.27 kg/m2 (p50), repec- anisotropy was reduced in MPS-I dogs versus carriers (P ¼ tively, similar values when compared to younger brother new .004). Myelin basic protein in CC of treated MPS-I, untreated with 3 years old, 0.96 m (p50) and 17.57 kg/m2 (p50-98), MPS-I, and carrier dogs correlated with FA (r2 ¼ .56, P ¼ respectively. The younger brother has a more limited exten- .01) and inversely correlated with radial diffusivity (r2 ¼ .51, sion of the lower limbs, which may be related to extrinsic fac- P ¼ .02), demonstrating a relationship between CC myelina- tors. Both perform physical therapy weekly, and only the tion and DTI. We found decreased myelination in MPS-I dogs older brother practices physical activities such as riding bike 6 weeks. Myelin composition was abnormal in MPS-I dogs. daily. Conclusion: Both the patients have the same genetic Neuroimaging findings, MBP, and myelin lipid composition mutation, but early diagnosis and treatment promote a better in the CC was improved with administration of IT ERT, even prognosis. The enzyme has low penetration into bone tissue if started at 4 months. Expression of myelin-related genes in and poorly vascularized structure; however, it is possible that CC improved inMPS-I dogstreated with IT and/orIV ERT begin- regular physical activity, to ride bike, for example, may be to ning at 30 days. Conclusion: Reduced CC volume and FA in contribute to further reduction in joint limitations, especially MPS-I dogs may be caused by abnormal myelination. Intrathecal in the lower limbs. and/or IV ERT improves abnormal myelination in the CC, especially if treatment begins early. Conflicts of Interest: The Los 1176 - Evidence That Enzyme Replacement Angeles Biomedical Research Institute at Harbor-UCLA Med- ical Center and the Department of Pediatrics at Harbor-UCLA Therapy Decreases White Blood Cell GAG (but not the authors) receive royalties from the sale of recom- Storage in Patients With MPS-IVA binant human a-L-iduronidase (laronidase). PID, EGS, and 1 2 2 NME receive research support from BioMarin and/or Gen- Guilherme Baldo , Fabiano Poswar , Andressa Ferhen , 2 2 zyme, which manufacture and distribute laronidase. Rejane Gus Kessler , Fernanda Bender , and Roberto Giugliani2 1172 - Benefits of Early Enzyme Replacement 1Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil 2 Therapy Hospital de Clinicas de Porto Alegre, Porto Alegre, Rio Grande do Sul, Brazil 1 1 Patricia Pontes Cruz , Krysna Pires Lessa , Laercio Objective: To evaluate the effect of enzyme replacement therapy 2 Moreira Cardoso Junior , Emilia Katiane Embiruçu de (ERT) upon glycosaminoglycan (GAG) storage in white blood Arau´jo Leaõ1, and Angelina Xavier Acosta3,4 cells (WBCs) from peripheral blood of patients with MPS-IVA who participated in a phase III double-blind placebo-controlled 1State University of Bahia, Federal University of Bahia (UNEB), randomized clinical trial (Strive, sponsored by BioMarin Pharma- Salvador, Brazil ceutical, Novato, California), comparing weekly infusion (ERT- 2Faculty Medicine of Bahia, Federal University of Bahia (UFBA), W) versus every other week (ERT-EOW). Methods: Three groups Salvador, Brazil of patients were evaluated. In the first group (n ¼ 4), patients were 3Faculty Medicine of Bahia, Salvador, Brazil treated weekly (ERT-W) with 2.0 mg/kg of recombinant human 4Medical Genetics Service HUPES/UFBA, Salvador, Brazil N-acetylgalactosamine-6-sulfatase (BMN110, approved by Food Objective: To evaluate early treatment with enzyme replace- and Drug Administration [FDA] as Vimizin; BioMarin Pharma- ment therapy (ERT) in 2 siblings with mucopolysaccharidosis ceutical). The second group (n ¼ 6) received the same dose every Abstracts 73 other week (ERT-EOW). In the third group (n ¼ 6), patients were involved the skin such as erythema and cutaneous rash infused with placebo (PLA). White blood cells were collected (23% and 30%, respectively); gastrointestinal symptoms such after 6 months of treatment and stained with Giemsa. One hun- as nausea, vomiting, and diarrhea (23% and 21%, respec- dred WBCs were evaluated for GAG granules by a blinded eva- tively); and fever (23% and 27%, respectively). Antihista- luator regarding treatment groups, and cells were classified as mines and antipyretics were administered to treat these (1) cells with no visible GAG granules; (2) with less than 10 gran- acute symptoms of ERT. In some patients, corticosteroids ules; or (3) with more than 10 granules. Results: Comparing PLA were administered to attenuate allergic reactions. Interest- versus both treated groups altogether, ERT increased the number ingly, 7 (21%) patients with MPS-II presented increase in of cells without observed GAG storage (18% of cells in PLA vs blood pressure level, whereas patients with MPS-I did not 52% in ERT treated, P < .01), suggesting it was effective in clear show this finding. Conclusion: In this study, we observed that GAG storage. When the treated groups were separated according the period of the first infusion reaction was similar for both to regimen, ERT-W patients had the biggest improvement (58%, MPSs evaluated as well as the main signs and symptoms of P < .01 vs PLA), while ERT-EOW had intermediate levels of cells infusion reactions. In this context, the continuous monitoring with no GAG (51%, P ¼ .016 vs PLA, not different from ERT- of patients receiving ERT is essential, especially at the begin- W). Also, cells presenting more than 10 granules reduced in both ning of treatment. The introduction of premedication pre- treated groups (21% in PLA vs 9% in ERT-EOW and only 5% in vented infusion-related events in many patients who ERT-W, P < .01 in both cases, without difference between treated previously experienced infusion reactions. groups).Conclusion: Our results support that Vimizinis effective to decrease WBC GAG storage in patients with MPS-IVA. Although both regimens lead to GAG storage decrease, weekly 1195 - Enzyme Replacement Therapy With ERT (as approved by the Food and Drug Administration) showed Double-Dose Laronidase Every Other Week slightly better performance than ERT-EOW. is Safe and Effective: Case Reports and Gly- cosaminoglycan Excretion Patterns in 11 Patients With Mucopolysaccharidosis Type I 1192 - Infusion Reactions Related to Enzyme Replacement Therapy in Pediatric Patients Carolina Moura de Souza1, Dafne Horovitz2, Ana With Mucopolysaccharidoses I and II: Carolina Esposito2, Maria Luicia Oliveira3, Fernanda Frequency and Management Scalco3, Llerena Juan2, Angelina Acosta4, Filippo Vairo1, Laercio Moreira Cardoso Junior4, Emilia Katiane Claúdia Vanzella1, Andressa Federhen2, Clarissa 4 3 1 3 4 Empiruçu Leao , AL Barth , and Roberto Giugliani Gutierrez Carvalho ,Debora´ Cardoso Dantas , Thabata 1 4 4 4 Medical Genetics Service, Hospital de Clinicas de Porto Alegre, Siqueira , Taiane Vieira , and Roberto Giugliani Porto Alegre, Brazil 1Post-Graduation Program in Biological Sciences: Biochemistry, 2Instituto Nacional de Sau´de da Mulher, da Criança e do UFRGS, Porto Alegre, Brazil Adolescente Fernandes Figueira, FIOCRUZ, Rio de Janeiro, Brazil 2Post-Graduation Program in Child in Adolescent Health, UFRGS, 3Laborato´rio de Erros Inatos do Metabolismo, Universidade Federal Porto Alegre, Brazil do Rio de Janeiro, Rio de Janeiro, Brazil 3Neonatology Service, Hospital de Clıńicas de Porto Alegre, UFRGS, 4Serviço de Genetica´ Medica,´ Universidade Federal da Bahia, Porto Alegre, Brazil Salvador, Bahia, Brazil 4Medical Genetics Service, Hospital de Clıńicas de Porto Alegre, Laronidase (Aldurazyme) is approved for enzyme replacement UFRGS, Porto Alegre, Brazil therapy (ERT) in mucopolysaccharidosis I (MPS-I) at the dose Objectives: The aim of this study was to investigate the fre- of 0.58 mg/kg once-weekly intravenous infusions. In a dose- quency of the most common infusion reactions in pediatric optimization trial (Giugliani et al, Mol Genet Metab 2009), an patients with mucopolysaccharidoses (MPS) I and II receiv- alternative regimen of 1.2 mg/kg every other week was proven ing weekly enzyme replacement therapy (ERT) with laroni- efficient and considered acceptable for specific patients. We dase and idursulfase, respectively, as well as describing the aimed to evaluate and compare safety and efficacy of laronidase management of those reactions. Methods: Descriptive and 1.2 mg/kg every 2 weeks versus the 0.58 mg/kg weekly dose in 2 retrospective study including a sample of 13 patients with patients with MPS-I. In all, 11 patients with MPS-I (3 males/5 MPS-I and 33 with MPS-II. Results: In the MPS-I group, 7 females;2Hurler,3Hurler-Scheie,and3Scheie),aged5to25 (53%) patients showed no reaction during the infusion, years, had their dosing regimen changed from 0.58 mg/kg weekly whereas in the MPS-II group, 11 (36%) presented no infusion to 1.2 mg/kg every 2 weeks. All had been on ERT for over 1 year, reaction. The median time for the first infusion reaction for responding well and had not presented adverse events. Preinfu- MPS-I and MPS-II was observed at fifth (2nd to 16th) and sion medication was administered to 50% of the patients. The seventh (1st to 37th) week of infusion, respectively. The main follow-up protocol for MPS-I as recommended by MPS-I Regis- reactions observed in patients with MPS-I and MPS-II try was performed, and urinary glycosaminoglycan (GAG) levels 74 Journal of Inborn Errors of Metabolism & Screening were monitored. The length of the every other week infusion 1206 - Effects of Discontinuing Enzyme regimen ranged from 12 to 39 months (mean 23.2 months). Only Replacement Therapy in the younger patient with Hurler syndrome presented adverse Mucopolysaccharidosis I Mice infusion-related events (4 hyperthermia episodes controlled with antipyretics). No significant differences between mean GAG Ana Paula Schneider1, Gabriela Pasqualim1, Fabiana Q. excretion with 0.58 mg/kg weekly or 1.2 mg/kg every 2 weeks Mayer2,Ba´rbara Z. Martinelli1, Talita G. de Carvalho1, were observed. The double-dose every other week infusions did 1 1 1 not change the disease progression or the urinary GAG excretion. Guilherme Baldo , Roberto Giugliani , and Ursula Matte All families were satisfied with such alternative for ERT, espe- 1Hospital de Clıńicas de Porto Alegre, Porto Alegre, Brazil cially due to less school/work days missed and fewer venipunc- 2Fundaçaõ Estadual de Pesquisa Agropecua´ria, Porto Alegre, Brazil tures. We believe this may be an acceptable treatment for MPS-I. Longer dosing studies involving more patients must be encour- Introduction/Objective: Enzyme replacement therapy (ERT) aged, as this is a long-term therapy and longer interval between for mucopolysaccharidosis I (MPS-I) was approved more than a infusions could be a meaningful change in patients’ quality of life. decade ago. Although efficient in correcting some aspects of the disease, patients need to obtain the enzyme with the public health system, often leading to treatment interruption. Therefore, we 1204 - Evaluation of Biochemical Parameters aimed to evaluate mice that were subjected to treatment interruption and reintroduction of ERT. Methods: Four groups of animals From the Protocol of Nutritional Care of were analyzed. In the first group, MPS-I mice were treated with Patients With Mucopolysaccharidosis ERT (laronidase, 1.2 mg/kg every 2 weeks) from birth (ERT), Undergoing Enzyme Replacement Therapy with no interruption. A second group of mice had treatment inter- at CREIM—UNIFESP rupted from 2 to 4 months of age (ERT-int). These mice were compared to normal (Iduaþ/þ) and untreated MPS-I mice, ana- Renata B. Oliveira1, Beatriz J. Frangipani1, Cintia M. lyzing urinary and tissue glycosaminoglycans (GAGs), heart Gonçalves1, Jose´ A. O. Silva1, Vaneisse C. L. Monteiro1, function, behavior, aortic distension, and antibody formation. All Sandra O. Kyosen1, and Ana Maria Martins1 mice were killed at 6 months. Results: Urinary GAGs were reduced in both treated groups, including during treatment inter- 1 Centro de Referenciaˆ em Erros Inatos do Metabolismo, ruption. Liver, heart, and lung GAG levels were normalized. At 6 Universidade Federal de Sao Paulo, Saõ Paulo, Brazil months, the ejection fraction values were similar to normal mice Introduction: During the follow-up of patients with mucopoly- in both the treated groups. Behavior in the open field test was also saccharidosis (MPS) on enzyme replacement therapy (ERT) at normalized in treated groups. Aortic walls were significantly Centro de Referência em Erros Inatos do Metabolismo, Universi- more distended in ERT-int group. Interestingly, treatment inter- dade Federal de Sao Paulo, an evaluation of semiquantitative food ruption did not lead to antibody formation after its reintroduction, frequency was achieved by the dietitians. An inadequate intake of suggesting that neonatal ERT induced an immune tolerance that vegetables, fruits, fats, and sugars was observed. Based on these was maintained even if the enzyme was reintroduced later in life. results, it was assumed that it would be necessary to do a quanti- Conclusion: We suggest that treatment interruption may have tative assessment of dietary intake and nutritional assessment of deleterious effects on organs that, during the disease course, have relevant biochemical parameters. Objective: To assess the diet- structural changes, such as the aortas. Furthermore, urinary GAG ary intake and biochemical profile of patients with MPSs-I, -II, levels may not accurately reflect disease status since it was not and -VI under ERT. Methodology: The dietary intake was changed after a few weeks of interruption, and yet deleterious assessed by records taken on every other day for 3 days. The bio- effects were found in some organs. Financial support: chemical parameters assessed were the serum concentrations of FAPERGS, FIPE-HCPA, and CNPq. total proteins and fractions, iron, ferritin, transferrin, zinc, folic acid, glucose, total cholesterol and fractions, and triglycerides. Results: In the evaluation of food intake, no mismatches were 1208 - Rapid Improvement in Respiratory found in the consumption of macronutrients in relation to the Parameters in a Patient With total calories; however, low calcium intake was observed in Mucopolysaccharidosis II After 6 Months of 88% of the patients and low iron, vitamin A, zinc, and magne- Enzyme Replacement Therapy sium in approximately 40% of them. In the serum lipid profile analysis, 24% will show a decrease in high-density lipoprotein Filippo Vairo1, Carolina Souza1, Karyn Koladicz1, Simone and 12% an increase in low-density lipoprotein. No changes 2 1 were found in serum concentrations of protein, iron, ferritin, Fagondes , and Roberto Giugliani glucose, zinc, and folic acid. Conclusion: The quantitative 1Medical Genetics Service, Hospital de Clıńicas de Porto Alegre, measurement of food intake in patients with MPS reinforces Porto Alegre, Brazil the need for nutritional counseling and expansion of biochem- 2Pneumology Department, Hospital de Clıńicas de Porto Alegre, ical parameters. Porto Alegre, Brazil Abstracts 75

Mucopolysaccharidosis type II (MPS-II) is a multisystemic there was a marked improvement in all cognitive function and progressively debilitating disorder; however, the rate measures including intelligence quotient scores (4%-8%), of progression varies among the patients. Sleep disturbances visual memory scores (9%-15%), adaptive behavior scores are common disorders in patients with MPS-II, especially (17%), and verbal learning scores (57% total and 104% obstructive sleep apnea. Polysomnography (PSG) has been delayed recall). Attention scores were stable. Brain MRI recommended for evaluation of patients with MPS and is volumetrics revealed 2.7% increase in white matter volume included as a major outcome measure of the efficacy of and 2.1% decrease in gray matter, consistent with changes enzyme replacement therapy (ERT). We report a case of a seen due to normal brain aging. Hippocampal volumes were 13-year-old patient with MPS-II, genotype p.D497G, iduro- significantly decreased (6%-7%), which correlated with nate sulfatase in plasma 3.3 nmol/4 h/mL (NR: 122-463), improved memory outcomes (r ¼ .6-.8). There were no and glycosaminoglycan analysis at the diagnosis of 495 adverse events. Conclusion: This patient with MPS-I μg/mg creatinine (NR: 44-106). He presented umbilical and showed significant improvement in cognitive function dur- inguinal hernia, carpal tunnel syndrome, hypoacusia, and ing the 2-year treatment with IT rhIDU. We speculate that mild pulmonary hypertension. The pretreatment PSG the decrease in hippocampal volume might be due to reduc- showed severe obstructive sleep apnea with apnea–hypop- tion in glycosaminoglycan storage material in that structure. nea index (AHI) of 10.1 events/h of sleep, according to A phase I clinical trial is underway to determine the impact pediatric criteria. After 6 months of weekly ERT, the PSG of IT rhIDU on cognitive function in patients with MPS-I. demonstrated AHI of 0.4 event/h of sleep (0.2 of apnea events and 0.2 of hypopnea events), and the mean oxyhemo- globin saturation during sleep was 98%.Therewereno 1210 - Evaluation of Sleep Architecture and other clinical or surgical interventions besides ERT. Based Respiratory Profile in Children With on this experience, we recommend that any child with MPS-II, even without sleep complains, should undergo a Mucopolysaccharidosis Type VI Before and sleep study since the ERT may rapidly improve respiratory After Enzyme Replacement Therapy parameters. Juliana L. Oliveira1,Ju´lia de Carvalho Lopes1, Regina Terse Trindade Ramos2, Juliana Leal Oliveira1, and 1209 - Intrathecal Delivery of Iduronidase Has 2 Beneficial Effects on Cognitive Function in a Angelina Xavier Acosta Patient With Mucopolysaccharidosis Type I 1Bahia School of Medicine, UFBA, Salvador, BA, Brazil 2Department of Pediatrics, Bahia School of Medicine, UFBA, Igor Nestrasil1, Elsa Shapiro1, Patricia Dickson2, Agnes Salvador, BA, Brazil 2 3 3 1 Chen , Edward Stehel , Sarah McNeil , Alia Ahmed , Introduction: Mucopolysaccharidosis type VI (MPS-VI) is a and Elizabeth Maher3 lysosomal storage disease caused by deficiency in enzyme involved in the degradation of glycosaminoglycans (GAGs). 1University of Minnesota, Minneapolis, MN, USA Consequently, GAGs accumulate in several tissues, including 2Los Angeles Biomedical Institute at Harbor-UCLA University of the upper air way and tracheobronchial tree, which leads to the California – Harbor, Torrance, CA, USA development of obstructive sleep apnea syndrome (OSAS). 3University of Texas Southwestern Medical Center, Dallas, TX, USA The enzyme replacement therapy (ERT) brought clinical and Introduction: Treatment with human a-L-iduronidase (rhIDU, biochemical benefits for these patients, but its effects on sleep laronidase) to replace the deficient enzyme in mucopolysacchar- architecture and polysomnographic respiratory profile still idosis type I (MPS-I) has significantly improved symptoms and need to be better studied. Objective: To evaluate the sleep quality of life. However, progressive cognitive decline has architecture and polysomnographic respiratory profile of become a major problem, despite treatment with intravenous patients with MPS-VI before and after administration of ERT. rhIDU. Intrathecal (IT) administration of rhIDU provides deliv- Methods: This is an observational retrospective cohort study, ery of rhIDU directly to the central nervous system. We studied based on data obtained from medical records, in which 14 IT rhIDU in a single patient with MPS-I who had measureable patients with a diagnosis of MPS-VI were enrolled. Results: decline in memory assessments for neurocognitive decline 18 The mean age at MPS-VI diagnosis was 4.5 years, and the months prior to treatment. Methods: A23-year-oldmanwith mean age at the start of ERT was 6.9 years. Obstructive sleep MPS-I (Hurler-Scheie syndrome) received IT rhIDU (1.74 mg) apnea syndrome was present in 100% of patients at baseline monthly for 3 months and every 3 months thereafter for 2 years. polysomnography, and 78.6% were classified as severe form. Serial cognitive function and structural brain magnetic reso- At the second polysomnography, the mean time on ERT was nance evaluations were conducted. Results: Borderline canal 1.9 + 0.7 years. In this examination, 77.8% of patients met the stenosis of the craniocervical ligamentous complex without criteria for OSAS. Patients also showed decreased latency to complete block of cerebrospinal fluid (CSF) flow was found sleep and increased rapid eye movement latency, increased num- on pretreatment CSF flow study. After 24 months of treatment, ber of arousals, desaturation, and hypoxemia during sleep. 76 Journal of Inborn Errors of Metabolism & Screening

Conclusion: We found no statistically significant improvement and they were very satisfied in taking part of an international in polysomnographic indices after the institution of ERT. This clinical trial. may be partly due to the small sample size and the different elapsed time between the first and the second polysomnography. 1222 - Production of Active Recombinant Human Sulfatases Iduronate 2-sulfate and 1212 - Caregivers’ Perceptions of Enzyme N-acetylgalactosamine-6-sulfate in Replacement Therapy With VIMIZIM Microorganisms (Elosulfase ␣) in Patients With 1 1 Mucopolysaccharidosis IVA Alexander Rodrı´guez-Lo´pez , Dennis Dıáz , Laura Laura1, Jefferson Moreno1, Sergio Dıáz1, Natalia Debora´ Maria Bastos Pereira1, Larissa Silva1, Karine Pimentel1,Ańgela Mosquera1, Carlos Soto1, Olga Bertoldi1, Clarissa Troller Habekost1, Camila Vela´squez2, Alejandra Hernańdez2, Felice Leonardi2, Matzenbacher Bittar1, Andressa Federhen1, and Roberto Ańgela Espejo1, Henry Co´rdoba1, Oscar F. Sańchez2, Giugliani1 Carlos J. Almeciga-Dı´ áz1, and Luis A. Barrerra1 1Hospital de Clinicas de Porto Alegre, Porto Alegre, USA 1Institute for the Study of Inborn Errors of Metabolism, Pontificia Universidad Javeriana, Bogota´ DC, Colombia Introduction: Mucopolysaccharidosis IVA (MPS-IVA or 2 Morquio A) is a progressive autosomal recessive disease Department of Chemical Engineering, Universidad de Los Andes, ´ caused by deficiency in the enzyme galactosamine-6-sulfate Bogota DC, Colombia sulfatase (GALNS; also known N-acetylgalactosamine-6- Objective: Lysosomal enzymes for enzyme replacement ther- sulfate sulfatase) encoded by the GALNS gene. Recently, apy are produced in mammalian cells. Here, we summarize our enzyme replacement therapy (ERT) with VIMIZIM (elosul- results for the production of human lysosomal sulfatases in fase a; Biomarin Pharmaceutical, Novato, California) was Escherichia coli and Pichia pastoris. Methods: Escherichia coli approved in United States by Food and Drug Administration. and the methylotrophic yeast Ppastoriswere used as systems Objectives: To investigate the perceptions of MPS-IVA for the production of sulfatases iduronate 2-sulfate (IDS) and caregivers in regard to the ERT through the use of a treat- N-acetylgalactosamine-6-sulfate. The enzymes were produced ment evaluation questionnaire. Methods: A 6-question at bench and bioreactor (up to 3 L) scales. Different conditions questionnaire was applied to caregivers of 16 clinical trial of temperature, pH, and dissolved oxygen were evaluated. In participants for the study of ERT in Morquio A. Patients addition, presence or absence of native signal peptide was eval- were allocated into 3 different groups: drug every week, uated as well as cotransformation with sulfatase modifying fac- drug every other week alternated with placebo, or placebo tor 1. Results: Recombinant IDS was expressed in PPastoris, every week. Questions included the caregivers’ perceptions although it was found mainly as intracellular aggregates. After about the ERT benefits, side effects, and allocation in the solubilization of aggregates, enzyme activity values reached groups. Results: The median age of patients was 14 years up to 30 U mg1. Also, the production was evaluated by using (rangedfrom5to35).Inall,50% of the caregivers believed optimized and native IDS gene. The highest enzyme activity val- their relatives were in the alternated drug/placebo group, ues were observed under conditions of limited oxygen and using 44% considered their relatives were in the placebo group, the optimized IDS sequence (34-fold higher than those obtained 0% thought their relative was receiving the drug weekly, using the native gene). On the other hand, results show that and 6% didn’t answer the question. The main benefits although a larger amount of human N-acetylgalactosamine-6- appointed were the opportunity of receiving a treatment, the sulfate sulfatase (hGALNS) in Ecoliwas obtained in the inclu- easy access to examinations and medical support, and the sion bodies, only a limited fraction of it was active. Removal of possibility of interaction with other patients. As important the signal peptide had a negative impact on GALNS activation drawbacks, absence from school, frequent traveling, and and secretion, although it reduced the formation of inclusion staying away from home were the main ones. Although bodies. Secretion of recombinant GALNS was favored up to 5 75% of caregivers believed the benefits outweigh the detri- times under semicontinuous culture conditions. N-Acetylgala ments, 25% answered that the advantages partially outweigh ctosamine-6-sulfate sulfatase of 0.29 U mg1 was obtained from the costs. Among the observed benefits, the caregivers Ecoli. Finally, GALNS production was performed in Ppastoris, reported improvement in height and weight gain, emotional and 25.34 U mg1 of purified GALNS without signal peptide stability improvement, and decrease in respiratory symptoms. were obtained. Conclusion: In summary, these results show In a scale from 0 to 10 (really bad to very good), 99% of care- the feasibility for the production of active recombinant IDS givers evaluated the Research Center where the ERT was pro- and GALNS enzyme in Ecoliand Ppastoris, which could vided as grade 10. Conclusion: The majority of caregivers be used for the development of an enzyme replacement ther- believe that the ERT has beneficial effects on the patients’ life apy for Hunter and Morquio A diseases. Abstracts 77

8. Transplantation/Immunology 2Servicio de Hematologıá y Oncologıá, Hospital Privado Centro Medico´ de Co´rdoba, Co´rdoba, Argentina Introduction: Hurler syndrome is the most severe form of 1016 - Outcomes After Hematopoietic Stem mucopolysaccharidosis I (MPS-I). Due to the enzyme replacement therapy (ERT), it does not cross the blood–brain barrier Cell Transplant for Children With I-Cell and hence does not prevent neurological complications. The Disease hematopoietic stem cell transplant (HSCT) is the preferred 1 1 1 and more effective therapy for this syndrome. Objective: To Troy Lund , Weston Miller , Sarah Cathey , and Paul report our experience with the combination of HSCT–ERT as 1 Orchard early treatment in MPS-IH. Case 1: Male at 8 months of age 1University of Minnesota, Minneapolis, MN, USA diagnosed with bone dysostosis (lumbar gibbus) and psychomotor retardation and elevated urinary glycosaminoglycans Introduction: Mucolipidosis type II (ML-II) is a rare but severe (GAGs) and a-iduronidase deficiency (0.093 nmol/h/mg pro- lysosomal storage disorder affecting localization of enzymes to tein). Genotyping: Heterozygous (p.P533R known mutation the lysosome, generally resulting in death before the 10th birth- and p.N350fs previously unreported). He started ERT at 11 day. Hematopoietic stem cell transplant (HSCT) has been used months (laronidase 0.58 mg/kg/wk) normalizing the excretion to successfully treat some lysosomal storage diseases, although of GAGs. At 17 months, an HSCT (a 9/10 HLA-mismatched there have been only 2 case reports in the use of HSCT to treat unrelated cord blood) was performed without complications. ML-II. Methods: For the first time, we describe the combined Two months after HSCT, the chimerism was 57.2% and dosages international experience in the use of HSCT for ML-II in 22 of a-iduronidase normalized (10.6 nmol/h/mg protein). The ERT patients. Transplant-related data and outcomes were obtained was maintained for 3 months post-HSCT. Currently, the child is from the Center for International Blood & Marrow Transplant 4 years old, with normal brain magnetic resonance imaging, and Research. Results: The median age of transplant was 9 months mild to moderate mental retardation. Case 2: Girl diagnosed at (range 2-20 months) with 14 children receiving umbilical cord 14 months with lumbar gibbus and bilateral hips luxation. Mild blood and the 8 receiving bone marrow grafts. The majority of the hydrocephalus. Background: Botulism at 2 months of age. Ele- conditioning regimens were myeloablative in intent. Ninety-five vated urinary GAGs (560 mg/g creatinine) and a-iduronidase percent of the patients engrafted with both neutrophil and plate- deficient (0 nmol/h/mg protein) Genotyping: heterozygous lets. The overall survival was low with only 5 (27%) patients alive (p.W402X/p.P533R known mutations). She began with ERT at at last follow-up. Median survival after transplant was 29.7 15 months of age and GAGs were normalized; at 20 months, months, and the most common cause of death posttransplant was HSCT was performed (a 10/10 HLA-matched unrelated cord cardiovascular complications, most likely due to disease progres- blood) and presented febrile neutropenia and reactivation of sion. Importantly, survivors were globally delayed in develop- cytomegalovirus. Forty-five days after HSCT, the chimerism ment and often required complex medical support such as was 99.2% and normal values of a-iduronidase were obtained. gastrostomy tubes for nutrition, had no ambulation, and required The ERT was kept for 3 months post-HSCT. Currently, she is tracheostomy with mechanical ventilation. Conclusion: 2 years old and remains clinically stable. Conclusion: Hemato- Although HSCT has demonstrated efficacy in treating some poietic stem cell transplant resulted in a successful strategy for LSDs, the neurologic outcome and survival for patients with getting normal enzyme levels in these patients. Early diagnosis ML-II were poor and not clearly different from the natural history and ERT helped good results at the time of the HSCT. of the disease. New medical and cellular therapies should be sought perhaps through substrate reduction, enzyme replacement, or gene therapy. 1041 - Outcome of Unrelated Hematopoietic Stem Cell Transplantation in Children With Hurler Syndrome in an Argentinean Public 1032 - Effectiveness of Hematopoietic Stem Pediatric Hospital Cell Transplantation in Combination With 1 1 1 Enzyme Replacement Therapy in Raquel Staciuk , Hernan Eiroa , Carlos Figueroa , 1 1 1 Mucopolysaccharidosis Type I-Hurler Mariana Roizen , Silvia Pizzi , Analia Julia , and Luisa Bay1 1 1 Norberto B. Guelbert , Adriana B. Becerra , Alicia N. 1Hospital de Pediatrıá ‘‘J.P. Garrahan’’, Buenos Aires, Argentina Giner1, Nidia Azar1, Nadia A. Gomez1, Sandra L. Antonozzi1, Lourdes A. Peralta1, Ana L. Basquiera2, Introduction: Hurler syndrome is the severe form of mucopo- 1 2 lysaccharidosis type I. The hematopoietic stem cell transplan- Guillermo A. Guelbert , and Adriana Berretta tation (HSCT) is the best treatment option to prevent the 1Servicio Enfermedades Metabo´licas, Hospital de Ninõs de Cordoba, central nervous system (CNS) compromise. The HSCT is rec- Co´rdoba, Argentina ommended for children younger than the age of 2 with no CNS 78 Journal of Inborn Errors of Metabolism & Screening compromise. Objective: Description of unrelated HSCT out- of natural-killer group 2, member D (NKG2D) ligand expres- comes with Hurler syndrome. Method: Retrospective cohort. sion was performed by flow cytometry in 8 patients with MPS Patients with clinical features of Hurler syndrome and a-L- type II. Additionally, immunoglobulin (Ig) G, IgM, and IgA iduronidase enzyme activity <10% were included. All patients total antibodies were measured. Results: The results showed received enzyme replacement treatment since diagnoses till that this family with MPS has a quantitative deficiency in HSCT. The HSCT were done between April 2010 and May NK and B cells. Normal values for TCD4þ, TCD8þ, and IgG, 2012. Outcome: The median age at diagnosis was 11.8 IgM, and IgA antibodies were observed. Conclusion: These months (range, 8.1-17.7); median age at HSCT was 21.9 results suggest that this family with MPS has a primary immu- months (range, 20.5-26.6). The median time between diag- nodeficiency, which may explain the occurrence of recurrent noses and HSCT is 9 months (range, 7-14). Sex: 2 boys and respiratory infections and indicate a greater predisposition to 2 girls. All of them received myeloablative conditioning Bu/ the development of cancer, becoming imperative periodic Cy. Stem Cell Source: Cord blood (CB) 2, peripheral blood screening of these patients. Financial Support: FAPESP No. (PB) 2. Graft Versus Host Disease (GVHD) Prophylaxis: 2010/52694-8. Tacrolimus given to all patientspluscorticoidsinCBand methotrexate in PS. Nucleated cell dose in CB > 8.5 107/ 1099 - Long-Term Therapeutic Efficacy of kgandCD34inPB>5.5 106/kg. All of them achieved complete hematopietic reconstitution. The median time of Allogenic Bone Marrow Transplantation in a follow-up was 19 months (range, 3-47). Complications: Patient With Mucopolysaccharidosis Type Hemolytic anemia, 1 patient; cytomegalovirus reactivation, IVA 2 patients; Epstein-Barr virus, 1 patient; adenovirus, 1 patient; 1 2 2 acute GVHD, 3 patients; and chronic GVHD (cGVHD), 3 Shunji Tomatsu , Yasutsugu Chinen , Takeshi Higa , patients, one of them with severe cGVHD. One patient Yasuyuki Suzuki3, Tadao Orii3, and Nobuyuki Hyakuna3 showed graft failure with autologous reconstitution on day 1Nemours/Alfred I. duPont Hospital for Children, Wilmington, DE, þ98 posttransplant. The other 3 achieved complete chimer- USA ism and normal enzyme level. One patient died on day 2University of the Ryukyus, Okinawa, Japan þ577 posttransplant due to refractory GVHD-related sepsis. 3Gifu University, Gifu, Japan Conclusion: The unrelated HSCT is a possible treatment in our country. The main hazards are the delay in the search of Introduction: Mucopolysaccharidosis IVA (MPS-IVA) is an unrelated donor, the transplant-related morbimortality, one of the lysosomal storage diseases. It is caused by the defi- and graft failure. ciency in N-acetylgalactosamine-6-sulfate sulfatase (GALNS). Deficiency in this enzyme leads to accumulation of the specific 1051 - Immunological Abnormalities in a glycosaminoglycans keratan sulfate and chondroitin-6-sulfate. This accumulation has a direct impact on cartilage and bone Family With Mucopolysaccharidosis Type II development, resulting in systemic skeletal dysplasia. There With a De Novo Missense Mutation in the is no curative therapy for this skeletal dysplasia. Method: Iduronate 2-sulfatase Gene This report describes long-term therapeutic efficacy in a 15- year-old boy with a severe form of MPS-IVA who received 1 2 2 Leuridan C. Torres , Diogo C. Q. Soares , Jose´ F. Franco , successful allogeneic bone marrow transplantation (BMT) and Chong Ae Kim2 from his human leukocyte antigen-identical carrier sister. Results: The level of the GALNS enzyme in the recipient’s 1Translational Research Laboratory, Instituto de Medicina Integral lymphocytes reached almost half of normal level within 2 Prof. Fernando Figueira (IMIP), Recife, Brazil years after BMT. For the successive 9þ years post-BMT, 2Medical Genetics Unit - HC-FMUSP, Saõ Paulo, Brazil GALNS activity in his lymphocytes maintained the same Introduction: Mucopolysaccharidoses (MPSs) are a group of level as the donor’s, and the level of urinary uronic acid was inherited metabolic disorders characterized by deficient activ- reduced. Lumbar bone mineral density increased around 50% ity of catabolic enzymes in the lysosomes and its consequent 1 year later post-BMT and was kept consistent. Radiographs abnormal accumulation of deposits of glycosaminoglycans. showed that the figures of trochanter major and minor The lysosomal dysfunction caused by these deposits is respon- appeared, while the epiphyseal dysplasia in the femoral cap sible for the clinical manifestations. Although the lysosome is was almost unchanged. Loud snoring and apnea disappeared. essential for the functioning of the immune system, some Vital capacity increased to around 20% for the first 2 years authors suggest that patients with MPSs have immune abnorm- and was maintained. Activity of daily life was improved in alities, similar to patients with primary immunodeficiencies. work/study efficacy, respiratory status, sleep, joint pain, and Objectives: To evaluate the main mechanisms involved in cel- frequency of infection. Conclusion: Allogenic BMT in a lular immune response in a nonconsanguineous Brazilian fam- patient with MPS-IVA shows improvement in the clinical ily with 8 individuals affected by MPS type II. Methods: The manifestations, suggesting that BMT is one of the therapeutic immunophenotyping of T, B, and natural killer (NK) cells and options. Abstracts 79

1102 - Progression of Hip Dysplasia in 1128 - Hematopoietic Stem Cell Patients With MucopolysaccharidosisI Transplantation in a Patient With Hurler After Successful Hematopoietic Mucopolysaccharidosis II at 14 Months of Age Stem Cell Transplantation ZoltańNyul1,AlexanderSo´lyom1, Anita Strehn´ 2, Katalin Shauna A. Kearney1, Robert N. Jobe1, Eveline J. Komlo´si3,KingaHadzsiev3,Ga´bor Benyo´2, Csaba Kassa2, Langereis1, Matthijs M. Den Os1, Catherine Breen2, KrisztiańKa´llay2,Bela´ Melegh3, and Gergely Krivań2 2 2 3 Simon A. Jones , Jean Mercer , Paula M. Kelly , Jim 1Pediatric Hospital, University of Pecs,´ Pecs,´ Hungary 3 4 5 Kennedy , Ann O’Maera , Rick R. Van Rijn , Ralph 2United St Istvań and St La´szlo´ Hospital, Budapest, Hungary Sakkers3, Klane K. White3, and Frits A. Wijburg1 3Department of Medical Genetics, University of Pecs,´ Pecs,´ Hungary 1Department of pediatric metabolic diseases, Emma Children’s Introduction: Due to its uncertain effectiveness, hematopoie- Hospital, AMC, Amsterdam, the Netherlands tic stem cell transplantation (HSCT) is generally not indicated 2Genetic Medicine, Central Manchester University Hospitals, St in patients with mucopolysaccharidosis II (MPS-II; Hunter). Mary’s Hospital, Manchester, United Kingdom The reason for this lack of effectiveness when compared to 3Department of Orthopaedic Surgery, Our Lady’s Children’s patients with MPS-I (Hurler) is unknown. With the advent of Hospital, Dublin, Ireland enzyme replacement therapy (ERT) for MPS-II, the question 4National Centre for Inherited Metabolic Disorders, Children’s of whether or not to subject a child to the dangers of HSCT has University Hospital, Dublin, Ireland been even more skewed toward avoiding the procedure. The fact 5Department of Radiology, AMC, the Netherlands that ERT does not cross the blood–brain barrier, however, means that severely affected patients with Hunter syndrome having cen- Introduction: Dysostosis multiplex contributes significantly tral nervous system (CNS) disease will progress in spite of therapy. to the morbidity of patients with Hurler syndrome (MPS- The question remains, in cases where a diagnosis of MPS-II is IH), even after a successful hematopoietic stem cell transplan- made early, whether the chance of sustained therapeutic effect tation (HSCT). A characteristic form of hip dysplasia (HD), makes HSCT a reasonable option for parents and physicians to which often requires surgical intervention, is one of the more consider. Methods: The patient was diagnosed with MPS-II at frequent signs. No detailed studies are available on the course 11 months of age, after our recent diagnosis in his 3-year-old of HD over time in patients with MPS-IH after HSCT. We brother. Enzyme replacement therapy was initiated in both seek to describe in detail the radiological aspects of progres- patients. His brother demonstrated appreciable symptoms of CNS sion of HD in these patients and identify risk factors and involvement. This offered a rare opportunity to anticipate the prognostic features. These data may be of prognostic younger child’s disease course. The parents requested that both value and might be used in the assessment of therapeutic children be submitted for consideration for HSCT. Based on the efficacy on bone disease for new therapeutic strategies. available literature and data on HSCT in MPS-II, along with expert Methods: Longitudinal data were obtained from digi- opinions, the younger brother was approved for transplantation. tallyscoredpelvicx-raystudies of patients with MPS- Results: Allogeneic HSCT transplant with a matched, unrelated IH using OrthoGon software for parameters including but donor was performed successfully, with initial good engraftment not limited to acetabular index (AI), migration index, and near-normal iduronate 2-sulfatase activity. Unfortunately, Smith index, and neck-shaft angle. Scoring was done 100 days after transplant donor chimerism started to decline, with independently by 2 blinded observers. Additional infor- a related decrease in enzyme levels as well. Conclusion: This case mation on genotype and transplantation conditions and illustrates the difficulties encountered when considering HSCT as outcome were obtained. Results: Between50and70 a therapeutic option in Hunter disease, particularly when a very patients with MPS-IH will be included. Currently, data on the early diagnosis is made and CNS involvement can be anticipated. first 11 patients (22 hips, 70 x-rays) are fully analyzed. Intra- and Our patients are still receiving ERT and follow-up continues. interobserver variation analysis showed ICCs ranging from 0.81 to 0.995 (mean 0.95). Acetabular index was, at the end of follow- 9. General Management up, in the range of severe HD in 16 hips, mild in 4, and in 2 hips no HD was observed. The AI showed an increasing deviation from the reference values over time. All patients had coxa valga with 1009 - Adolescents With a Metabolic neck shaft angles up to 170. Twenty hips were displaced laterally and/or superiorly. Conclusion: Progressive HD as well as coxa Disorder in an Adult Service: A Review of the valga and hip displacement are highly prevalent in patients with Process of Transitional Care to Close the Gap MPS-IH after HSCT. The applied scoring method is highly reli- and Promote a Safe Smooth Transition able and reproducible. This study will also provide insight into 1 2 risk factors and prognostic features. Conflicts of Interest: Sup- Lorraine Thompson , Christian Hendriksz , Briony ported by an unrestricted educational grant from Genzyme. McNelly1, and Carly Bleakley1 80 Journal of Inborn Errors of Metabolism & Screening

1Salford Royal Hospital, Manchester, England, United Kingdom airway obstruction upon induction which did not resolve with air- 2Manchester University, Manchester, United Kingdom way maneuvers or laryngeal mask airway insertion. He subsequently had several episodes of upper airway obstruction Objectives: To understand the approach required to prepare requiring resuscitation; and therefore, tracheostomy was planned young adults to take ownership of their own health in preparation following awake fiberoptic intubation. Methods: Topical local for adulthood. Identify the gaps and address any reasonable anesthesia was supplemented by sedation using 2 midazolam changes to improve patient safety and the patient experience. boluses of 1 mg each and remifentanil target-controlled infusion Method: We looked at our cohort of patients and compared this (TCI) 1.0 to 3.0 ng/mL. One episode of desaturation resolved after with a previous audit 2 years earlier. We examined the documen- a reduction in remifentanil TCI and nasal endotracheal intubation tation and will discuss recommendations for change. We looked was performed using a 5.0-mm internal diameter Microcuff tube. at the role of the transitional team members to include the process Anesthesia was induced and a challenging tracheostomy was per- to address capacity and legal implications as appropriate. We dis- formed. Results and Conclusion: Many patients with MPS have cuss case studies with the aid of patient stories. Findings: The OSA and obstruct quickly on induction of anesthesia. Intraopera- number of patients in this study between April 2013 to March tive postobstructive pulmonary edema has also been reported. The 2014 was 72 in total. The number of patients has more than standard age-adjusted formula for endotracheal tubes does not doubled in comparison with 2011 to 2012. In all, 16% of these apply, and performing an emergency tracheostomy is hazardous patients had a diagnosis of a learning disability. In all, 39% of due to the extreme posterior position of the trachea. Any anes- patients had a lysosomal storage disorder and 61% had a general thetic/sedative agent should be given judiciously to avoid the sig- metabolic condition. In all, 8% completed transition passports. nificant risk of airway obstruction. Every anesthetic should be Conclusion: During 1:1 consultations with the nurse, there was tailored for patients with MPS, delivered by an experienced team an open discussion when the young adult would ask questions and with a widerange ofairwayequipment toavoid unforeseen airway engage in conversation about themselves. The transition passport catastrophes. Conflicts of Interest: Mr Iain Bruce and Jane was not well received, and the rate of return was 8%.Thisresulted Roberts have received honoraria and education grants from in having incomplete records at the time of transition and took Shire/Biomarin and Genzyme. more time at the adult visit. The invitation to attend the adult hospital on the same day as the pediatric appointment was well received. This allows for patient records to be updated should 1086 - Physiotherapeutic Treatment After an abrupt admission occur prior to adult hospital outpatient visit. Total Hip Arthroplasty in Patient With Type A process has been established to enable capacity issues to be VI Mucopolysaccharidoses: A Case Report identified and ensure smooth transition for people with learning disabilities. In principle, the idea of patient held and completed Ba´rbara Bernardo R Silva1, Maria Do Carmos Mb records are good but in practice this will need to be driven by Duarte2, Livia B Andrade2, Marcelo S Kerstenetzky2, and health care professionals. Ka´tia RRS Lacerda3 1 1067 - Awake Intubation in an Adult Patient Associaçaõ Pernambucana de Mucopolissacaridoses, Saõ Paulo, Brazil With Hunter Syndrome 2Instituto de Medicina Integral Prof. Fernando Figueira, Recife, Brazil 3Instituto de Desenvolvimento Educacional, Brazil Jane Collette Roberts1, Larisa Mihoreanu2, and Mohit Jain2 Objective: To describe the phases and the evolution of phy- 1Manchester Centre for Genomic Medicine, Manchester, United siotherapy of a patient with mucopolysaccharidosis type VI Kingdom (MPS-VI) who underwent total hip arthroplasty (THA). 2BioMarin Europe Ltd, London, United Kingdom Method: A case report of a male patient with MPS-VI, 38- Objective: To describe awake intubation in an adult patient with year-old, sedentary, and underwent 10 sessions of 55 minutes mucopolysaccharidosis II (MPS-II) with obstructive airway dis- of physiotherapy. The pre- and postassessments were done by ease and discuss the potential hazards of anesthetics in patients measuring the range of motion of the lower limbs and muscle with MPS. The MPSs are a rare group of inherited lysosomal stor- strength through goniometry and the functional independence age disorders caused by an enzyme deficiency. The associated measure (FIM) test. The physical therapy aimed at improving widespread deposition of glycosaminoglycans results in macro- the range of motion of the right leg as well as the muscle glossia,supraglottic narrowing, tracheomalacia, cardiorespiratory strength while decreasing pain reduction in the limb, aiming disease, and skeletal problems. Airway problems under anesthesia for a easy return to daily activities. The routine consisted of include obstruction, difficult/failed intubation, and the need for active-assisted stretching, application of taping, use of tran- emergency tracheostomy. This 18-year-old patient with MPS-II scutaneous and functional electrical nerve stimulation, and (Hunter syndrome) had disease complications including obstruc- resistance exercise with weight bearing as well as balance tive sleep apnoea (OSA). Computed tomography showed devia- training and gait. Two months after THA, the patient under- tion and tracheal narrowing to 11 4mm2. Previous surgery wenta6-minutewalktest.Results: This study demonstrated had been abandoned after general anesthesia resulted in complete improvements in muscle strength and in range of motion Abstracts 81 ranging from 4 to 19, especially of hip flexion (before: 82 using a spinal brace jacket is an acceptable alternative. Care after 101). We obtained significant data of hip abduction, should be taken to ensure accurate measurements are taken going from strength grade 3 to grade 5, recovery of balance to ensure a good fit. Temporary plaster bracing may be needed and gait retraining (before THA the patient reported that he in the immediate postoperative period. wasn’t able to walk up to 20 m, with severe pain and imbalance). After 2 months, he was able to walk 388 m without interruption and without pain, only fatigue (borg 7), which 1138 - Levomepromazine as a Treatment for can be explained by his compromised respiration due to the Nonepileptic Movement Disorder in pathology. Greater functional independence was also noted; Advanced Sanfilippo Disease before, the total FIM was 102: modified dependency (assis- (Mucopolysaccharidosis Type III) tance up to 25% of the tasks) and after treatment it rose to 118 (modified independence). Conclusion: Physiotherapy Saikat Santra1, Louise M. Simmons1, and Evangeline played an important role in the rehabilitation of patient stud- Wassmer1 ied with MPS-VI undergoing THA. 1Birmingham Children’s Hospital, Birmingham, United Kingdom Introduction: Mucopolysaccharidosis type III (MPS-III) is a 1112 - Cervical Spine Surgery Without Halo neurodegenerative lysosomal storage disorder that leads to cog- Orthosis Immobilization in Children With nitive decline as the disease advances. Along with this, patients MPS Disorders have seizures; however, it is increasingly being appreciated that many patients additionally have a nonepileptic movement 1 1 1 Saikat Santra , Guirish Solanki , and Suresh Vijay disorder (NEMD) that can be distressing. Medical treatment for 1Birmingham Children’s Hospital, Birmingham, United Kingdom these movements is unsatisfactory. Levomepromazine is a low- potency antipsychotic medication with effects on multiple Introduction: Cervical spine instability (CSI) and cervical receptors and is widely used in Europe for the treatment of cord compression (CCC) occur frequently in the mucopolysac- anxiety, agitation, and nausea in palliative care. We report on charidoses, especially mucopolysaccharidoses type VI (MPS- our experience of using levomepromazine in the palliative care VI, Maroteaux-Lamy disease) and type IV (MPS-IV, Morquio of patients with MPS-III. Methods: A total of 30 patients with Disease). Standard surgical treatment involves cervical decom- MPS-III were treated at our hospital between 2004 and 2014, of pression and/or stabilization with a period of external fixation whom 16 (53%) were being treated through the end stage of with an HO. Concomitant skeletal deformity can make the their disease and 13 (43%) died. Case records were retrospec- application of an HO difficult in some young children with tively reviewed for evidence of NEMD which was judged to be MPS-IV and MPS-VI. We report our experience of performing present in 9 (56%) of those in end-stage disease however combined cervical spinal decompression and stabilization may have been underrecognized in historical patients. Where using a custom-made brace for immobilization in 3 children levomepromazine (Nozinan 25 mg tablets; Sanofi-Avensis, with MPS disorders. Methods: Two children with MPS-IV Paris, France) was considered suitable it was prescribed at a (aged 7 and 10) and 1 with MPS-VI (aged 3) were identified starting dose of 6.25 mg twice daily and increased according as requiring surgery for CCC with CSI based on clinical and to response. Treatment efficacy was judged subjectively by radiological findings. Skeletal deformity, including pectus car- carer report and objectively in some patients by the use of an inatum, precluded the use of a HO, and the patients were indi- ActiGraph (ActiGraph, Florida) to measure the frequency of vidually measured for custom-made spinal brace jackets to upper limb movements. Results: Of the 9 patients with provide postoperative immobilization. Recombinant human advanced MPS-III having NEMD, 8 (89%) received treatment bone morphogenetic protein was also used in the 2 patients with levomepromazine. Subjective improvement in NEMD with MPS-IV to aid bone fusion. Results: Preoperative brace severity and distress was reported in all 8 (100%) children. size measurements proved inaccurate in the immediate post- actigraphy demonstrated a reduced frequency of upper limb operative period due to surgical delay and postoperative swel- movements wherever performed. Levomepromazine was well ling. Temporary immobilization with plaster braces was tolerated with the most frequent side effect reported being required until postoperative swelling had settled and patients sedation. No patient stopped treatment due to side effects. were remeasured for individual plastic braces. Radiological Conclusion: Levomepromazine appears to be a well-tolerated studies (computed tomography) confirmed satisfactory post- and effective medication for the management of distressing operative alignment was maintained in all patients. Bone fusion NEMD in advanced MPS-III. was demonstrated within 8 weeks and was satisfactory by 12 weeks with no complications. The brace was well tolerated by the patients, the main concern being interference with 1201 - A Case Report of an 8-year-old Hispa- mouth opening and requiring refashioning of the chin section. nic Male With Likely Mucolipidosis Type III g Conclusion: We conclude that where skeletal deformity precludes the application of an HO, noninvasive immobilization Stephanie R. Cagle1, and Li Hong2 82 Journal of Inborn Errors of Metabolism & Screening

1Emory Healthcare, Decatur, GA, USA reduction therapy (SRT) for MPS disorders and other lysoso- 2Emory University, Atlanta, GA, USA mal storage diseases (LSDs). The aim of this work was to determine the effects of flavonoids, used alone or in combina- Objective: To present the case of an 8-year-old Hispanic male tions, on expression of genes coding for proteins involved in with likely mucolipidosis type IIIg (ML-IIIg). Methods: Review GAG metabolism. Methods: Cultures of wild-type (human of the medical chart, laboratory results, and interviews with the dermal fibroblast [HDFa]) and MPS type II (Hunter disease) patient and his father. Results: Mucolipidosis type III is a rare human fibroblasts were treated with flavonoids (genistein, autosomal recessive genetic disorder caused by deficient uridine kaempferol, daidzein, and mixtures of them), and transcrip- diphosphate N-acetylglucosamine-1-phosphotransferase (UDP- tomic signatures were determined by DNA microarray analy- GlcNAc-1-phosphotransferase) activity. This enzyme is required ses, followed by quantitative real-time polymerase chain for the synthesis of mannose 6-phosphate (M6P) recognition reaction (qRT-PCR). Results: Testing the effects of flavo- markers on enzymes that are targeted to the lysosome. noids on human fibroblast transcriptome, we found that gen- When UDP-GlcNAc-1-phosphotransferase enzyme activity istein, kaempferol, and combination of these 2 compounds is deficient, enzymes that require the M6P marker are incor- induced dose- and time-dependent remarkable alterations in rectly targeted and leave the cell. Thus, these lysosomal transcript profiles of GAG metabolism genes. They included enzymes become elevated in the plasma of affected individu- genes coding for enzymes involved in GAG biosynthesis as als. The UDP-GlcNAc-1-phosphotransferase consists of 3 well as those required for GAG degradation. Interestingly, subunits: a, b,andg. The ML-III a/b is caused by mutations effects of the mixture of genistein and kaempferol were in N-acetylglucosamine-1-phosphate transferase, a and b sub- stronger than those revealed by any of these compound used units (GNPTAB) gene, whereas ML-IIIg is caused by muta- alone. Forty-five genes were chosen for further verification tions in GNPTG gene. One cannot distinguish between the 2 in HDFa and MPS-I fibroblasts by using qRT-PCR. Interest- types clinically or biochemically. Common symptoms include ingly, monitoring particular messenger RNA levels in dysostosis multiplex, progressive joint stiffness, short stature, HDFa, we found that genistein, kaempferol, and mixture scoliosis, and cardiac valve disease. Here, we present the case of of these compounds significantly stimulate expression of an 8-year-old Hispanic male who was referred for suspected TFEB, a gene coding for the transcription factor, which was mucopolysaccharidosis (MPS) due to x-rays identifying signs demonstrated previously to act as a master positive regulator consistent with dysostosis multiplex. An MPS enzyme panel was of lysosomal biogenesis. Conclusion: Flavonoids affect normal with the exception of the 2 enzymes analyzed in plasma, expression of some genes coding for enzymes involved in which were markedly elevated. This led toward a diagnosis of metabolism of GAGs. Moreover, these compounds stimulate ML-III. As ML-IIIa/b is more common than ML-IIIg, GNPTAB biogenesis of lysosomes by activation of TFEB expression. gene sequencing was performed. These results were normal, Effects of mixtures of different flavonoids act more effi- indicating the likely diagnosis to be ML-IIIg. Conclusion: At ciently than each compound used alone. the time of abstract submission, GNPTG sequencing was pending. This diagnosis should be confirmed since this is the first case report of ML-IIIg in a Hispanic individual. 1021 - Higher Vector Dose is Required for the 10. Novel Therapies Reversal of Neurological Disorders of Mucopolysaccharidosis IIIB by Systemic rAAV9-hNAGLU Gene Delivery 1019 - Effects of Flavonoids on Expression of Genes Coding for Proteins Involved in Haiyan Fu1, Aaron Meadows1, F Jason Duncan1, Glycosaminoglycan Metabolism Bartholomew Naughton1, Darren Murrey1, K Reed Clark1, 1 1 1 1 2 Kim McBride , Kevin Flanigan ,andDouglasMcCarty Grzegorz Wegrzyn , Magdalena Gabig-Ciminska , 1 Joanna Jakobkiewicz-Banecka1, Marta Moskot2, Anna Center for Gene Therapy, Research Institute at Nationwide Children’s Hospital, Columbus, OH, USA Kloska2, and Elwira Smolinska2 Introduction/Objectives: We have previously demonstrated 1Department of Molecular Biology, University of Gdansk, Gdan´sk, the functional benefits of systemic recombinant adenoassociated Poland viral 9 human a-N-acetylglucosaminidase (rAAV9-hNAGLU) 2Institute of Biochemistry and Biophysics, Polish Academy of gene delivery in young, presymptomatic mucopolysaccharidosis Sciences, Warszawa, Poland IIIB (MPS-IIIB) mice (4-6-week-old). However, MPS-IIIB is a Introduction/Objectives: Flavonoids were previously found cumulative disease, and the reversibility of pathology has to modulate efficiency of synthesis of glycosaminoglycans been a major concern for translation. This is particularly rel- (GAGs), compounds that are accumulated in cells of patients evant to the central nervous system because the majority of with mucopolysaccharidoses (MPSs). Therefore, flavonoids patients are diagnosed after severe neurological symptoms have been proposed as potential drugs for the use in substrate have developed. To expand the clinical relevance of this Abstracts 83 approach, this study investigated the therapeutic potential of and blood (397 transcripts). Importantly, of the dysregulated systemic rAAV9-hNAGLU gene for treating advanced blood transcripts, 22 are known to be enriched in the brain MPS-IIIB. Methods: We treated 3 cohorts of 4- to 6- and linked to broad neuronal functions. More importantly, month-old MPS-IIIB mice with different intravenous (IV) the scAAVrh74-hSGSH treatment also led to the correction doses of rAAV9-CMV-hNAGLU vector in a single injec- of the majority of the transcriptional abnormalities in the tion. The therapeutic effects were assessed by longevity, brain (95.9%) and blood (97.7%),ofwhich182and290 behavior, and tissue analyses. Results: At 1E13vg/kg, the transcripts were normalized in the brain and blood, respec- vector treatment resulted in low levels of recombinant tively. Conclusion: A single systemic rAAVrh74 gene deliv- NAGLU (rNAGLU) expression in tissues and a limited ery was functionally beneficial, leading to a complete or increase in long-term survival but had no detectable impact near-complete correction of molecular pathology in MPS- on behavioral performance in the water maze assay. How- IIIA mice. The blood transcriptional profiles may reflect the ever, an IV injection of 2E13vg/kg or 1E14vg/kg-mediated biopathological status of MPS-IIIA and respond well to effec- efficient long-term restoration of NAGLU activity and the tive treatments, offering the biomarker potential for disease correction of lysosomal storage pathology throughout the progression and therapeutic assessments. central nervous system as well as in somatic tissues, leading to significant improvement in behavioral performance in the water maze and significantly extended survival. Conclu- 1048 - Gene Therapy in sion: Mucopolysaccharidosis type IIIB is reversible to a cer- Mucopolysaccharidosis IIIA Mice at Later tain extent if sufficient vector is administered, and treating advanced MPS-IIIB requires higher vector doses than treat- Stages of the Disease Using Systemic Self- ing the disease at earlier stages. Complementary Adenoassociated Viral 9 Treatment

1022 - Therapeutic Benefits and the Douglas M. McCarty1, Kimberly Zaraspe1, and Haiyan Correction of Broad Molecular Impairments Fu1 in a Mouse Model of Mucopolysaccharidosis 1The Research Institute at Nationwide Children’s Hospital, IIIA by Systemic hSGSH Gene Delivery Using Columbus, OH, USA an AAVrh74 Vector Inroduction: The reversibility of neuropathic of lysosomal storage diseases, including mucopolysaccharidosis IIIA Haiyan Fu1, F. Jason Duncan1, Bartholomew Naughton1, 1 1 1 (MPS-IIIA), is a major goal in therapeutic development due Kimberly Zaraspe , Darren Murrey , Tierra Ware , to typically late diagnoses and a large population of untreated 1 1 1 Aaron Meadows , K. Reed Clark , Kim McBride , and patients. In this study, we used a self-complementary adenoas- Douglas McCarty1 sociated viral (scAAV) 9 vector expressing human N-sulfoglucosamine sulfohydrolase (SGSH) to test the efficacy of 1Center for Gene Therapy, Research Institute at Nationwide treatment at later stages of the disease. Methods: We treated Children’s Hospital, Columbus, OH, USA MPS-IIIA mice at 1, 2, 3, 6, and 9 months of age, with an intra- Objectives: This study was performed to assess the therapeu- venous injection of scAAV9-U1a-hSGSH vector (5E12vg/kg). tic potential of a systemic human N-sulfoglucosamine sulfo- Results: The treatment led to restoration of SGSH activity and hydrolase (hSGSH) gene delivery approach for treating reduction in glycosaminoglycan (GAG) content to normal lev- mucopolysaccharidosis IIIA (MPS-IIIA), using a novel ade- els throughout the central nervous system (CNS) and somatic noassociated viral vector (AAVrh74) that has the ability to tissues in all treated groups. In mice treated at 2, 3, or 4 months cross the blood–brain barrier (BBB). Methods: Aself- of age, learning ability in the Morris water maze at 7.5 months complementary AAVrh74 (scAAVrh74) vector was devel- of age was improved, and life span was normalized. In mice oped to deliver the hSGSH gene. The scAAVrh74-hSGSH treated at 6 months of age, behavioral performance was vector was injected intravenously into 4 to 6-week-old impaired at 7.5 months but did not decline further when MPS-IIIA mice (5E12vg/kg). Behavior, longevity, and tissue retested at 12 months of age, and life span was increased but analyses were performed to assess the therapeutic benefits. not normalized. A group of mice treated at 9 months of age Results: The treatment resulted in global central nervous sys- showed no improvement in life span, although the lysosomal tem (CNS) and widespread somatic restoration of SGSH storage pathology in the CNS was cleared. Conclusion: Muco- activity, clearance of CNS and somatic tissue glycosamino- polysaccharidosis IIIA is functionally reversible over a range glycan storage, improved behavior performance, and signifi- of ages. Although systemic scAAV9-SGSH gene delivery in cantly extended survival. A genome-wide gene expression very advanced MPS-IIIA can correct GAG storage in the CNS array in MPS-IIIA mice detected broad molecular abnormal- and periphery, it may not have significant functional benefit, ities with significant dysregulation (2-fold, FDR 10) of likely due to severe chronic tissue damage that is no longer numerous genes and transcripts in the brain (314 transcripts) reversible. The study suggests that there is a potential for 84 Journal of Inborn Errors of Metabolism & Screening intervention in MPS-IIIA at intermediate stages of the disease 1Institute for the Study of Inborn Errors of Metabolism, Pontificia using systemic gene therapy and extends the clinical relevance Universidad Javeriana, Bogota´, Colombia of our systemic scAAV9-hSGSH gene delivery approach. Objective: Mucopolysaccharidosis IVA (MPS-IVA) is a lysosomal storage disease produced by the deficiency in N-acetylgalac- 1071 - Improvement in Protein Folding as a tosamine-6-sulfate sulfatase (GALNS), which degrades keratan Possible Treatment of and chondroitin-6-sulfate. Gene therapy is among the possible Mucopolysaccharidosis Type IIIB treatments options for this disease. Recent reports have demonstrated the efficiency of adenoassociated viral (AAV) and Olga L. M. Meijer1, Frits Wijburg1, and Naomi van Vlies1 lentiviral vectors for the delivery of GALNS gene, allowing the induction of high expression levels. To continue the evaluation 1Department of pediatric metabolic diseases, Academic Medical of these vectors, in this study, we explored the correlation Center, Amsterdam, the Netherlands between GALNS activity, transduction efficacy, gene expres- Introduction/Objective: Mucopolysaccharidosis type IIIB sion, keratan sulfate levels, and total hexosaminidase activity. (MPS-IIIB or Sanfilippo syndrome type B) is caused by a Methods: Human embryonic kidney 293 (HEK293) cells and deficiency in the lysosomal enzyme N-acetyl-a-glucosami- Morquio A skin fibroblast were transduced with AAV and nidase (NAGLU), leading to lysosomal accumulation of lentiviral vectors, with or without sulfatase modifying factor heparan sulfate. Mucopolysaccharidosis type IIIB is charac- 1(SUMF1).N-Acetylgalactosamine-6-sulfate sulfatase and terizedbysevereprogressiveneurocognitive deterioration total hexosaminidase activity were assayed in cell lysates using and to date, no disease-modifying treatment is available for a fluorogenic substrate. Keratan levels were measured in Mor- this devastating condition. Most enzyme deficiencies in quio A fibroblasts lysates using Dot-Blot with a monoclonal patients with MPS-IIIB are caused by missense mutations antikeratan antibody. Transduction efficacy and gene expres- that presumably lead to misfolding of the protein and subse- sion were assayed by real-time polymerase chain reaction. quent degradation. In other lysosomal storage disorders, Results: N-Acetylgalactosamine-6-sulfate sulfatase activity chaperone therapy has been shown to ameliorate the enzyme was detected in HEK293 cells transduced with AAV and lenti- deficiency in in vitro experiments. Chaperones are small viral vectors. For AAV vectors, SUMF1 coexpression allowed molecules able to stabilize the misfolded proteins, thereby a marked increase in GALNS activity, while with lentiviral increasing their residual enzyme activity and improving dis- vectorsanincreaseinactivitywas not observed at higher vec- ease outcome. It is assumed that a residual enzyme activity tors concentrations or SUMF1 coexpression. Transduction of of >10% of normal levels may ameliorate the course of the Morquio A fibroblasts allowed GALNS activity ranging from disease in patients with MPS-IIIB. The aim of this study 20% to 50% of wild-type levels. Noteworthy, these enzyme was to identify mutations in the NAGLU gene that may activity levels had a significant impact on keratan sulfate and benefit from chaperone therapy. Methods: First, the total hesoxaminidase levels. Conclusion: These results showed NAGLU activity assay was optimized to accurately measure that enzyme activity levels below 50% of wild-type levels can very low enzyme activities (as detected in patients with have a significant impact on biochemical markers such as keratan MPS-III). Next, folding sensitive mutations were identified sulfate levels and impairment of secondary biomarkers. by culturing fibroblasts of patients with MPS-IIIB at 30C Although in vivo experiments are still necessary, these results and 37C for 14 days and subsequent analysis of NAGLU will support the future endeavors for Morquio A gene therapy. activity. Results: After optimization of the assay, we identified several folding sensitive mutations. An increase in enzymatic activity >10% of reference values was seen in 1122 - PEGylated Cationic Nanoemulsions as 7ofthe8celllinesincubatedat30C. Conclusion: This a Gene Transfer System to study shows that improved protein folding leads to higher Mucopolysaccharidosis Type I Murine Model enzyme activity in fibroblasts of patients with MPS-IIIB, 1 1 2 demonstrating the feasibility of chaperone therapy for Michelle Fraga , Dirnete Diel , Talita G. De Carvalho , MPS-IIIB. Currently, these cell lines are used to identify Fernanda Bruxel1, Ursula Matte2, and Helder F. small molecules that enhance protein folding and might Teixeira1 serve as therapy for MPS-IIIB in the future. 1Pharmaceutical Sciences Graduate Program of UFRGS and Gene Therapy Center - ERC - HCPA, Brazil 1108 - In Vitro Evaluation of Adenoassociated 2Genetics and Molecular Biology Graduate Program of UFRGS and and Lentiviral Vectors for Morquio A Gene Therapy Center -ERC – HCPA, Brazil

1 1 Introduction: Mucopolysaccharidosis I (MPS-I) is an autosomal Carlos J. Almeciga , Angelica M. Herren˜o , Hector M. disease caused by a-L-iduronidase (IDUA) deficiency, leading to 1 1 1 Barbosa , Juliana Herrera , Rocio Cuaspa , Carlos J. intracellular accumulation of dermatan and heparan sulfate in dif- Almeciga-Diaz´ 1, and Luis A. Barrera1 ferent tissues. Objective: This study aimed at evaluating the Abstracts 85 application of cationic nanoemulsions complexed with a plasmid Hematopoietic stem cell transplantation (HSCT) circumvents containing the gene that encodes for IDUA (pIDUA) by adsorp- this via monocyte trafficking and engraftment in the brain as tion or by encapsulation as a gene transfer system in the MPS-I microglia but is ineffectual for MPS-IIIA which has no treat- murine model. Methods: Nanoemulsions consisting of an oil ment. To increase enzyme in HSCT, we designed a lentiviral core of medium chain triglycerides stabilized by the cationic lipid gene therapy vector overexpressing SGSH specifically in bone 1,2-dioleoyl-3-trimethylammonium-propane and 1,2-dioleoyl- marrow monocytes using a myeloid-specific promoter sn-glycero-3-phosphoethanolamine (NE) and 1,2-distearoyl-sn- (CD11b) to drive transgene expression (LV-CD11b-coSGSH). glycero-3-phosphoethanolamine conjugated polyethylene glycol We previously demonstrated that lentiviral-mediated gene ther- (DSPE-PEG; neutral endopeptidase [NEP]) phospholipids were apy to augment the SGSH enzyme in transplanted MPS-IIIA prepared by high-pressure homogenization. Formulations were hematopoietic stem cells is curative in MPS-IIIA mice, cor- obtained by either adsorption (NEA and NEPA) or encapsulation recting MPS-IIIA behavior, increasing SGSH to 500% of nor- (NEE and NEPE) of preformed pIDUA/cationic lipid complexes mal in bone marrow and 11% of normal in brain, and at þ4/ charge ratio. Release of pIDUA from all complexes was normalizing glycosaminoglycan storage and neuroinflamma- evaluated after incubation with culture medium with FBS. tion. Methods: We are currently optimizing stem cell gene The NEPA and NEPE complexes were administered through therapy for patients with MPS-IIIA to prove its safety and effi- intravenous injection in the tail vein of MPS-I knockout cacy in human bone marrow. The colony-forming units assay mice using 30 mgofpIDUA.Animalswerekilled48hours was used to investigate transduction efficiency, gene expres- after injection. Liver, lung, kidney, and spleen were isolated sion, lineage skewing, and toxicity of our SGSH lentiviral vec- andflashfrozeninliquidnitrogenforbiochemicalandgene tor in human HSCs. Quantitative polymerase chain reaction expression analysis. Results: The pIDUA complexation and was used to evaluate vector copy number and the SGSH activ- stability against DNAse I degradation were demonstrated by ity assay to determine enzyme expression levels. Results: We agarose gel assay. The physicochemical properties and sta- have successfully optimized transduction of CD34þ human bility of complexes in the presence of serum proteins were HSCs with lentiviral vector encoding green fluorescent protein mainly influenced by the presence of DSPE-PEG; and there- (GFP) to 70% or more with consistency and demonstrate no fore, in vivo studies were performed only with NEPA and evidence of lineage skewing or toxicity of SGSH vector in NEPE. Following intravenous treatment in MPS-I knockout human HSCs. Furthermore, SGSH expression levels were mice, complexes caused a significant increase in IDUA improved by 900% in transduced human HSCs. Conclusion: activity (fluorescence assay; P < .05, compared to untreated Stem cell gene therapy is a promising prospective treatment MPS-I, analysis of variance, and Tukey post hoc) and for MPS-IIIA. Once safety and efficacy experiments are com- expression (reverse transcription-quantitative polymerase plete, good manufacturing practice-grade lentiviral vector will chain reaction) in different organs, especially in the lungs be manufactured for a phase I/II clinical trial. for NEPA and in the liver for NEPE. Conclusion: Such preclinical results demonstrate that these nanocomplexes repre- 1131 - The Effect of Nonsteroidal sent a potential therapeutic system for the treatment of MPS-I. Anti-Inflammatory Drugs on Cellular Glycosaminoglycan Level 1130 - Myeloid-Driven Stem Cell Gene Joanna A. Jakobkiewicz-Banecka1, Marta Moskot2, Therapy for Mucopolysaccharidosis IIIA Pawel Mozolewski2, Grzegorz Wegrzyn3, and 2 1 1 1 Magdalena Gabig-Ciminska Brian W. Bigger , Ana Sergijenko , Stuart Ellison , 1 Alexander Langford-Smith1,AiyinLiao1, Claire Department of Molecular Biology, University of Gdan´sk, Gdan´sk, 1 1 1 Poland Pickford , Fiona Wilkinson , Kia Langford-Smith , 2 1 2 3 Laboratory of Molecular Biology (affiliated with the University of Catherine Merry ,SimonJones, and Rob Wynn Gdan´sk), Instituite of Biochemistry, Warszawa, Poland 1University of Manchester, Manchester, United Kingdom 3Department of Molecular Biology, University of Gdan´sk, Gdan´sk, 2St Marys Hospital, London, United Kingdom Poland 3Royal Manchester Children’s Hospital, Manchester, United Objectives: Research on the implementation of the nonenzy- Kingdom matic substrate reduction therapy (SRT) using glycosamino- Introduction: Mucopolysaccharidosis (MPS) type IIIA (MPS- glycan (GAG) metabolism modulators such as nonsteroidal IIIA) is a pediatric lysosomal storage disease caused by anti-inflammatory drugs (NSAIDs) to treat mucopolysac- mutations in N-sulfoglucosamine sulfohydrolase (SGSH). N- charidoses (MPSs) with neurological symptoms is the con- Sulfoglucosamine sulfohydrolase deficiency results in heparan cept of this research. We intend to validate the extent of sulfate storage and a severe progressive neurodegenerative dis- action of acetaminophen, indomethacin, and nimesulide, ease. Enzyme replacement therapy is potentially feasible but agents with proved and documented effective blood–brain fails because enzyme cannot cross the blood–brain barrier. barrier penetration properties, and to learn interactions at 86 Journal of Inborn Errors of Metabolism & Screening the molecular level in terms of expression modulation of the choroid plexus epithelia to deliver the missing enzyme to GAG metabolism genes by these substances. Methods: the cerebrospinal fluid (CSF) of MPS-IIIB mice. Methods: Cytotoxic and antiproliferative activities of selected The rhNAGLU-IGF2 complementary DNA was cloned into the NSAIDs (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazo- AAV vector plasmid and recombinant AAV5 vector was gen- lium bromide tests) followed by kinetics of GAG synthesis erated by triple transfection method. The expression of the (35S and 3H incorporation) and total GAGs quantification recombinant protein was confirmed by NAGLU activity assay (fluorescence microscopy) plus gene expression profiling and Western blot. A pilot in vivo study was performed in MPS- bymeansofHumanHT-12v4ExpressionBeadChipand IIIB mice by injecting 5x10E10 vector genomes (vgs) of quantitative real-time polymerase chain reaction (qRT-PCR) rAAV5-rhNAGLU-IGF2 to the lateral ventricles of adult mice custom panel in the presence of tested compounds versus and 5x10E9 vg in neonatal mice. Results: Immunohistochem- control with the use of a model biological material in form istry and enzyme activity were studied 2 weeks after viral injec- of human dermal fibroblasts (HDFa) and MPS cell lines tion. The NAGLU activity reached twice the normal level. constitute our study plan. Results: No remarkable cytotoxi- b-Hexosaminidase activity, which is abnormally elevated in city and antiproliferation features of acetaminophen, indo- MPS-IIIB, was significantly reduced in the AAV5-treated methacin, and nimesulide were observed in the range of mice. Tissue evaluations showed NAGLU-IGF2 expression tested conditions. Moreover, we found that the latter 2 sig- in the choroid plexus epithelium. The NAGLU-IGF2 was also nificantly inhibited GAG synthesis in both HDFa and MPS detected in brain parenchyma, even contralateral to the injec- fibroblasts treated with NSAIDs when compared to tion, indicating delivery from the CSF. Testing to evaluate the untreated cells. Further tests, including total GAGs quantifi- efficacy of the AAV5 gene therapy to correct the lysosomal cation by means of fluorescence microscopy as well as gene storage in brain tissues is in progress. Conclusion: Our results expression profiling via DNA microarrays and qRT-PCR are suggest that the combination of M6P/IGF2 receptor-mediated currently conducted and will be reported. Conclusion: The endocytosis and choroid plexus-targeted viral gene therapy action of the tested NSAIDs (especially indomethacin and may overcome the major obstacles for enzyme replacement nimesulide), in term of their use as potential drugs for SRT, therapy for MPS-IIIB and enable permanent, efficient distribu- exhibits at the moment a promising strategy and realistic tion of NAGLU throughout the brain. chance for treatment of some metabolic disorders, especially those with damage of central nervous system. 1157 - New Treatment Strategies for Mucolipidoses II and III: A Study Focusing on Premature Degradation of GNPTAB and 1144 - Delivery of ␣-N-acetyl-glucosaminidase GNPTG Messenger RNA Insulin-Like Growth Factor 2 Fusion Protein via Choroid Plexus-Directed Gene Therapy in Ida Vanessa Doederlein Schwartz1, Renata V. Velho2, Mucopolysaccharidosis IIIB Mice Fernanda Sperb-Ludwig3, and Ursula S. Matte4 1 Shih-hsin Kan1, Steven Q. Le1, Marie Reine Haddad2, Department of Genetics and Molecular Biology, Universidade 2 2 2 Federal do Rio Grande do Sul, Porto Alegre, Brazil Eun-Young Choi , Anthony Donsate , Stephan G. Kaler , 2 2 PGP in Genetics and Molecular Biology, Universidade Federal do Rio and Patricia I. Dickson Grande do Sul, Porto Alegre, Brazil 1Los Angeles Biomedical Research Institute at Harbor-UCLA Medical 3PGP in Healthy Sciences, Universidade Federal do Rio Grande do Center, Torrance, CA, USA Sul, Porto Alegre, Brazil 2Eunice Kennedy Shriver National Institute of Child Health and 4Gene Therapy Center of Hospital de Clı´nicas de Porto Alegre, Porto Development at NIH, Bethesda, MD, USA Alegre, Brazil Introduction: Mucopolysaccharidosis type IIIB (MPS-IIIB; Introduction: Mucolipidosis II and III (ML-II/III) are Sanfilippo B) is an inherited neurodegenerative disorder for rare autosomal recessive disorders caused by defects in the N- which no effective treatment is currently available. The cause acetylglucosamine-1-phosphotransferase (GlcNAc-1-phospho- of MPS-IIIB is deficiency in the lysosomal enzyme, a-N- transferase) complex, which is composed of 3 subunits, a, b,and acetyl-glucosaminidase (NAGLU), and resultant storage of g. Mutations in the gene encoding the a and b-subunits (N- heparan sulfate. Recombinantly produced NAGLU shows acetylglucosamine-1-phosphate transferase, a and b subunits inadequate mannose 6-phosphorylation (M6P), which limits [GNPTAB]) lead to ML-II a/b, or to the clinically milder condi- cellular uptake. We found that a modified human NAGLU tion, ML-III a/b. Mucolipidosis IIIg arises from mutations in fused to the receptor-binding motif of insulin-like growth fac- the GNPTG gene encoding the g subunit of GlcNAc-1- tor 2 (hNAGLU-IGF2) can enhance entry into MPS-IIIB fibro- phosphotransferase. To date, the only available specific blasts via M6P/IGF2 receptor-mediated endocytosis. In this treatment for these disorders is bone marrow transplantation but study, we used a recombinant adenoassociated virus, serotype with conflicting results. The objective of this work is to evaluate 5 (AAV5) vector expressing rhNAGLU-IGF2 that targets whether the messenger RNA (mRNA) transcribed from Abstracts 87

GNPTAB and GNPTG genes in patients with ML II/III is target of with high-resolution tandem mass spectrometry in negative ion premature degradation and, therefore, not easily suitable to the mode and compared with the formation of mature enzyme by readthrough associated with aminoglycosides. Methodology: Western blotting as well as the activation of enzyme activity. Cells from 7 patients with ML-II/III, with previously defined gen- Results: Only small portions of the total substance load present otype, were cultured for 24 hours with or without geneticin or in culture media were actually taken up into cells. Intracellular chloramphenicol. After this period, culture medium and cells concentrations reached a maximum after 12 hours and did were collected and used for enzyme assay. Furthermore, RNA hardly increase thereafter. Increase in precursor maturation was extracted from the cells. The lysosomal hydrolases, b-galac- as well as activity in contrast was considerably delayed and tosidase, b-glucuronidase, and a-mannosidase were measured by increased steadily until 72 hours of chaperone exposure. fluorometric technique. Results: Regarding b-galactosidase and Conclusion: The desynchronized time course of chaperone a-mannosidase, no statistical difference was found between uptake and intracellular effects are not explained by current treated and untreated cells both in the culture medium and in the concepts of ER stabilization and improved transport of enzyme fibroblasts. However, regarding b-glucuronidase, treated cells precursors into the lysosomal compartment. Further data, for showed a decrease in its activity only in the culture medium (n example, on subcellular handling are required to understand the ¼ 4 of the7 patients). Discussion/Conclusion: These results show effects on chaperone-sensitive enzyme mutants. a subtle biochemical improvement in cells from some patients with ML-II and -III associated with the use of aminoglycosides, References which could indicate that the mRNA of GNPTAB and GNPTG 1. Fantur K, Hofer D, Schitter G, et al. DLHex-DGJ, a novel genes is target of premature decay. At this moment, we are work- derivative of 1-deoxygalactonojirimycin with pharmacological ing to quantify mRNA in these patients and to evaluate the effect chaperone activity in human G(M1)-gangliosidosis fibroblasts. of NMD inhibitors. Support: CNPq, FAPERGS. Mol Genet Metab 2010;100(3):262-268. 2. Fantur KM, Wrodnigg TM, Stu¨tz AE, et al. Fluorous iminoalditols act as effective pharmacological chaperones against gene products 1159 - Studies on the Intracellular Handling of from GLB1 alleles causing GM1-gangliosidosis and Morquio B DL-Hex DGJ, a Potential Chaperone for the disease. J Inherit Metab Dis 2012;35(3):495-503. Therapy of GM1 Gangliosidosis and Morquio B Disease 1160 - Ataluren as a Potential New Treatment for Nonsense Mutation Eduard Paschke1, Bernhard Blank-Landeshammer1, Mucopolysaccharidosis Type 1 1 2 3 Thomas Kaiser , Guenter Fauler , Tanja M. Wrodnigg , 1 2 2 3 1 Robert J. Spiegel , David M. Bedwell , Kim M. Keeling , Arnold E Stuetz , and Werner Windischhofer 1 2 1 1 Allen Reha , Dan Wang , Marla Weetall , and Ellen M. Department of Pediatrics, Medical University of Graz, Graz, Australia 1 2Clinical Institute of Medical and Chemical Laboratory Diagnostics, Welch Medical University of Graz, Graz, Australia 1PTC Therapeutics Inc, South Plainfield, NJ, USA 3Glycogroup, Institute for Organic Chemistry, Technical University of 2Department of Microbiology, University of Alabama at Birmingham, Graz, Graz, Australia Birmingham, AL, USA

Introduction: Two lysosomal storage disorders, Morquio B dis- Introduction: A nonsense mutation in the a-L-iduronidase ease (MBD) and GM1 gangliosidosis (GM1), are caused by (IDUA) gene is the cause of disease in 60% to 80% of muco- defects in galactosidase b1 (GLB1), the gene coding for lysoso- polysaccharidosis type I (MPS-I) cases. The IDUA gene mal b-galactosidase (b-gal). In GM1 fibroblasts, the activity encodes a-L-iduronidase, deficiency of which causes progres- against synthetic substrates can be raised by N-acyl derivatives sive glycosaminoglycan (GAG) accumulation and the MPS-I of deoxygalactonojirimycin (DGJ). This mutation-specific effect phenotype, including multiple somatic and neurological is thought to stabilize misfolded enzyme precursors by binding of defects. Ataluren, an oral investigational drug, suppresses non- chaperones to the catalytic site and by improving their transport to sense mutations by enabling ribosomal readthrough of prema- the lysosomes. We recently characterized novel N-acyl deriva- ture stop codons and production of full-length, functional tives of DGJ acting as competitive inhibitors, normalizing the protein. Effects of ataluren in nonsense mutation MPS-I subcellular distribution, processing of b-gal precursors, and (nmMPS I) were assessed in 2 preclinical models. Methods: enhancing the activity of synthetic substrates in sensitive GLB1 Effects of ataluren on a-L-iduronidase activity were determined mutants.1,2 The metabolic fate of chaperones and their effects in (1) an Idua-W402X knock-in mouse model carrying a non- on the turnover of natural substrates (eg, GM1 ganglioside) is sense mutation corresponding to the IDUA-W402X mutation unknown. Methods: Time- and concentration-dependent uptake in humans. After 14 days of treatment with a range of ataluren of methyl 6-f[N2-(dansyl)-N6-(1,5-dideoxy-D-galactitol-1,5- concentrations, mice were killed and brain, liver, heart, lung, diyl)-L-lysyl]aminog hexanoate (DLHex-DGJ)1 into normal and spleen, and kidney tissue were collected and assessed for GAG GM1 fibroblasts was studied by detection of a dansyl fragment levels and (2) fibroblasts isolated from Idua-W402X mouse 88 Journal of Inborn Errors of Metabolism & Screening embryo littermates. After treatment with a range of ataluren analyzed. Results: Improved GFP expression was observed concentrations, GAG levels were assessed. Results: Statisti- in animals that had received the GFP virus containing the cally significant GAG-level reductions in ataluren-treated ver- CAG promoter at the 3-week time point. Conclusion: We sus untreated Idua-W402X mice were observed in the brain, have now generated an AAV vector containing HGSNAT liver, heart, lung, and spleen but not in the kidney. Partial including the CAG promoter using the Rh10 serotype for ther- restoration to wild-type GAG levels was observed. As in precli- apy of MPS-IIIC. Efficacy of intracranial AAV-HGSNAT nical models of other nonsense mutation diseases, the ataluren will be presented at this meeting. concentration–response relationship was bell shaped. Similar results were seen in the in vitro model of nmMPS1. Conclusion: These nonclinical proof-of-mechanism studies support further 1165 - Long-Term Efficacy Following Intra- evaluation of ataluren as a treatment of nmMPS1 and other CSF Administration of AAV9-Sulfamidase in lysosomal storage diseases caused by nonsense mutations. the Treatment of Mucopolysaccharidosis IIIA Even low levels of restored a-L-iduronidase function can alleviate the MPS-I phenotype. Given that ataluren is admi- Sara Marco´1,2, Albert Ribera1,2, Garcıá Miquel1,2, nistered systemically, crosses the blood–brain barrier, and Villacampa Pilar1,2, Motas Sandra1,2, Molas Maria1,2, penetrates other tissues relevant to the disease, there is pot- 1,2 1,2 1,2 ential for ataluren treatment to attenuate the cardiac and Roca Carles , Melia` Cristian , Ayuso Eduard , Leoń 1,2 1,2 3 3 neurological defects associated with nmMPS1, alone or in Xavier , Maggioni Luca ,Anõr Sonia , Andaluz Ana , combination with enzyme replacement therapy or hemato- Ruberte Jesu´s4, Haurigot Virginia1,2, and Bosch Fatima1,2 poietic stem cell transplantation. Conflicts of Interest: RJS, 1CBATEG - Universitat Auto` noma de Barcelona, Bellaterra, Spain AR, MW, and EMW are employees of PTC Therapeutics, Inc, 2Department of Biochemistry and Molecular Biology, UAB, and hold financial interests in the company. Bellaterra, Spain 3Animal Medicine and Surgery, School of Veterinary Medicine, UAB, 1164 - Development of an Adenoassociated Bellaterra, Spain 4 Viral Vector for Mucopolysaccharidosis IIIC CBATEG and Animal Health and Anatomy, School of Veterinary Medicine, UAB, Bellaterra, Spain 1 2 1 Claire O’Leary , Andre Antunes , Helen Parker , Els Introduction/Objectives: Mucopolysaccharidosis type IIIA 2 2 1 Henckaerts , Michael Linden , Fiona Wilkinson , Alexey (MPS-IIIA) or Sanfilippo A syndrome is an autosomic reces- V. Pshezhetsky3, and Brian Bigger1 sive lysosomal storage disease caused by deficiency in sulfamidase, a sulfatase involved in the stepwise degradation of the 1University of Manchester, Manchester, United Kingdom glycosaminoglycan (GAG) heparan sulfate (HS). Because of 2Kings College London, London, United Kingdom enzyme deficiency, HS accumulates in the lysosomes of cells, 3University of Montreal, Montreal, Canada causing cell dysfunction and, eventually, cell death, in tissues Introduction: Mucopolysaccharidoses (MPS) type IIIC is an and organs of the whole body, but affecting predominantly the autosomal recessive neurodegenerative lysosomal storage dis- central nervous system (CNS). We previously demonstrated order caused by the lack of the heparan sulfate (HS)-degrading in MPS-IIIA mice that intracisternal delivery to the cere- enzyme heparan sulfate acetyl-CoA:a-glucosaminide N-acetyl- brospinal fluid (CSF) of sulfamidase-encoding adenoasso- transferase (HGSNAT). Inherited deficiency in HGSNAT leads ciated viral 9 (AAV9) vectors mediated whole-body disease to storage of HS and results in central nervous system distur- correction through transgene expression throughout CNS and bance including developmental delays, behavioral difficulties, liver as soon as 4 months after vector administration. The aim of sleep disturbances, and dementia. The biggest challenge in this study was to evaluate the long-term efficacy of this gene developing therapies for MPS is to achieve efficient delivery therapy approach. Methods: Adenoassociated viral 9 vectors across the blood–brain barrier and into the central nervous sys- encoding for the sulfamidase gene were administered via cis- tem. Gene therapy has great potential for treating MPS-IIIC. terna magna to adult MPS-IIIA mice to evaluate the therapeutic The adenoassociated viral (AAV) vector system has been long-term (>10 months follow-up) efficacy of the therapy on used in a number of studies for neurological correction includ- CNS and somatic pathology through biochemical, histopatholo- ing an ongoing clinical trial for the related disease MPS-IIIA; gical, and functional measurements. We also administered vec- therefore, intracranial injection of AAV has the potential to tors encoding for the canine sulfamidase to adult healthy Beagle restore brain enzyme levels and correct neurological input. dogs to evaluate safety and to monitor long-term expression of Methods: An AAV vector was generated using the Rh10 ser- the transgene in a large animal model. Results: This study pro- otype containing green fluorescent protein (GFP) controlled vides evidence for the long-term biochemical, histological, and by either a cytomegalovirus or a chicken b actin (CAG) pro- behavioral correction of the disease phenotype following moter. Stereotaxic injection into the striatum was performed AAV9-based sulfamidase gene transfer to MPS-IIIA mice. using coordinates from a mouse atlas. Mice were killed at Moreover, in healthy Beagle dogs, a single intra-CSF adminis- 1-week and 3-week postinjection, and GFP expression was tration of AAV9 vectors encoding for canine sulfamidase at the Abstracts 89 therapeutic dose resulted in a long-term (>18 months) stable Angela Vandelli2, Flavio Forni2, Maurizio Scarpa1, and increase in sulfamidase activity in the CSF, in the absence of any Rosella Tomanin1 safety concerns. Conclusion: Overall, these results demonstrate 1University of Padova, Padova, Italy the long-term efficacy and safety of intra-CSF AAV9 sulfami- 2 dase gene transfer and support the clinical translation of this University of Modena and Reggio Emilia, Modena, Italy approach for the treatment of MPS-IIIA. Conflict of Interest: Introduction: Enzyme replacement therapy (ERT) is the most Eduard Ayuso and Fatima Bosch are coinventors on a patent common therapeutic strategy applied to several lysosomal stor- application for the use of AAV vectors for the treatment of age disorders including mucopolysaccharidosis type I (MPS-I) MPS-IIIA. and II (MPS-II). Both diseases are characterized by a totally or partially defective activity of lysosomal enzymes involved in 1178 - Development of a Gene Therapy the catabolism of the glycosaminoglycans (GAGs), which Approach to Treat Mucopolysaccharidosis therefore heavily accumulate within cellular compartment and in the extracellular matrix. Although presenting several forms Type IIIB of clinical severity and disease progression, both pathologies affect most of the organ systems, and about two-thirds of the Albert Ribera1, Sara Marco´1, Miquel Garcia1, Sandra 1 1 1 1 patients show neurological impairment. Enzyme replacement Motas , Pilar Villacampa , Carles Roca , Xavier Leoń , therapy, applied to both diseases in the last years, has produced 1 1 1 Luca Maggioni , Victor Sańches , Sergio Munõz , Jesu´s some clinical improvements, but it cannot treat the central ner- Ruberte1, Virginia Haurigot1, and Fatima Bosch1 vous system impairment due to its inability to cross the blood– brain barrier (BBB). Methods: We produced polymeric nano- 1Universitat Auto` noma de Barcelona, Barcelona, Spain particles (poly(lactic-co-glycolic acid) nanoparticles [PLGA- Introduction/Objectives: Mucopolysaccharidosis type IIIB NPs]) modified with 7 amino acid glycopeptides (g7), able to (MPS-IIIB) is an autosomal recessive lysosomal storage disease drive NPs across the BBB in rodents. Before going into func- caused by the a-N-acetylglucosaminidase enzyme deficiency, tional and efficacy study, we studied the ability of these biode- involved in the stepwise degradation of the glycosaminoglycan gradable and biocompatible PLGA-NPs in carrying across the (GAG) heparan sulfate (HS). Accumulation of undegraded HS BBB the fluorescein isothiocyanate-tagged albumin (FITC- leads to lysosomal pathology, which in turn results in severe pro- albumin), as a model drug with a high molecular weight, sim- gressive neurodegeneration as well as somatic disease affecting ilar to that of the enzymes used in ERT. In vivo experiments, on several organs. Patients die between the first and second decades both wild-type (Wt) and knockout (Ko) mouse models for of life. Since there is no effective cure for this disease, new ther- MPS-I and MPS-II, were performed by intravenously inject- apeutic approaches are needed. The aim of this study was to ing g7-NPs loaded with FICT-albumin, together with a develop a new gene therapy-based approach to counteract central plethora of control samples. Results: Results clearly showed nervous system (CNS) and somatic manifestations in the MPS- that g7-NPs are able to cross the BBB in all treated mice (Wt IIIB mouse model. Methods: Viral vectors coding for the a-N- and Ko) and to deliver FITC-albumin to the brain; interest- acetyl-glucosaminidase (NAGLU) protein were developed and ingly, we found qualitative and semiquantitative evidences administered to adult MPS-IIIB mice, and the effects of the ther- of a higher grade of brain accumulation of g7-NPs loaded with apy on CNS and somatic pathology were assessed through bio- albumin in Ko-brains with respect to Wt ones. Conclusion: chemical, histopathological, and functional measurements. These results lay the basis for a possible successful set of pilot Results: Three months after vector administration, MPS-IIIB- experiments on the ability of enzyme-loaded g7-NPs to treated mice showed increased NAGLU activity levels in CNS, deliver sufficient amount of the drug to the brain district, liver, and serum, which led to a correction of CNS and somatic hopefully exerting a corrective effect on the neurological lysosomal GAG accumulation. The severe neuroinflammation manifestations. characteristic ofMPS-IIIB wasalso corrected. Moreover,thegene therapy-based treatment succeeded in correcting behavioral deficits and dramatically improved survival. Studies of gene expres- 1191 - Treatment of Mucopolysaccharidosis I sion profiling further confirmed the therapeutic potential of the approach. Conclusion: This study demonstrates that our novel Mice With Microencapsulated Cells gene therapy approach simultaneously corrects CNS and somatic Overexpressing IDUA Implanted in the MPS-IIIB disease following a single vector administration. Omentum or Subcutaneous Tissue Talita G. de Carvalho1, Barbara Z. Martinelli1, Valeska L. 1184 - BBB Crossing in Lysosomal Storage Lagranha1, Giuseppe A. Testa1, Guilherme Baldo1, Disorders: A Nanoparticle-Based Approach Nelson Kretzmann Filho1, Ursula Matte1, and Roberto 1 Laura Rigon1, Marika Salvalaio1, Giovanni Tosi2, Daniela Giugliani Belletti2, Francesca D’Avanzo1, Barbara Ruozi2, Maria 1Hospital de Clıńicas de Porto Alegre, Porto Alegre, Brazil 90 Journal of Inborn Errors of Metabolism & Screening

Objective: The aim of this study was to evaluate the effect of trees as they know it. Patient records and death certificates are treatment in mucopolysaccharidosis I (MPS-I) mice treated with being used to identify alive and family members who died with microencapsulated cells overexpressing a-L-iduronidase (IDUA) confirmed or suspected Fabry disease based on patterns of in 2 different sites of implant. Methods: Recombinant cells over- inheritance. Early results suggest in our first family cohort that expressing IDUA were encapsulated in sodium alginate and there are 4 generations of females with Fabry disease before it implanted in the omentum (n ¼ 10) or subcutaneous (n ¼ 8) tissue affected a male in the direct line. Changes in life expectancy will of 4-month-old MPS-I mice. Three animals from each group were also be evaluated by reviewing death certificates available since killed 24 hours later. The remaining animals were killed after 2 1837. In each arm of the family, members will be asked about months (omentum group) or 4 months (subcutaneous group) of the impact the Fabry disease has had on their lives, the way they treatment. Control groups consisted of untreated MPS-I and nor- learnt about Fabry disease, and the support they received during mal mice of same age. Urine and blood samples were collected testing and diagnosis. Findings from this study will aid the devel- during treatment. After killing, microcapsules were recovered opment of best practice guidelines for managing the diagnosis of and organs (liver, kidney, and heart) were collected for IDUA Fabry disease in extended family members. activity assay, glycosaminoglycan (GAG) measurement, and histological analysis. Results: Both the omentum and the subcutaneous groups showed an increase in IDUA activity in the liver, 1059 - Biochemical Characterization of a kidney, and heart after 24 hours of the implant. At the end of treat- Sample of Brazilian Patients With ment, an increase in IDUA activity was only observed in the heart Mucolipidosis II/III and a Purpose of for the omentum group, while in the subcutaneous group, IDUA Diagnostic Protocol activity was higher in liver, kidney, and heart. Serum IDUA activity increased at 7 and 15 days of treatment for the omentum group Taciane Alegra1, Maira Burin2, and Ida V. D. Schwartz3 and at 15, 30, and 45 days for the subcutaneous group. Regarding 1Post Graduation Program in Genetics and Molecular Biology, GAGs levels, a decrease in urinary GAG was observed after 7 Federal University of Rio Grande do Sul, Porto Alegre, Brazil days in the omentum group. In the subcutaneous group, no differ- 2Medical Genetics Service, Hospital de Clıńicas de Porto Alegre, ence was found. Tissue GAGs levels remained elevated. Conclu- Porto Alegre, Brazil sion: We observed an increase in IDUA activity in evaluated 3Genetics Department, Federal University of Rio Grande do Sul, tissues in both groups. However, it was not sufficient to reduce tis- Porto Alegre, Brazil sue GAG levels, possibly due to immune response against the bio- material or the enzyme produced. Support: FIPE-HCPA, Introduction: Mucolipidoses (MLs) II and III are rare lysoso- FAPERGS, CAPES, and CNPq. mal diseases secondary to N-acetylglucosamine phosphotransferase (GlcNac-phosphotransferase) deficiency, leading to 11. Related Diseases increased activity of lysosomal hydrolases in plasma, reduced activity in fibroblasts, and normal activity in leukocytes. First step in diagnosis is clinical suspicion; the definite involves identification of the deficiency in the GlcNAc- 1007 - Pedigree Analysis in Patients With phosphotransferase activity, available only in rare centers of Fabry Disease: Evaluating Changes in Referral research. Thus, the GlcNac activity is measured indirectly, by and Diagnosis Over Successive Generations assessing many lysosomal enzymes in leukocytes, fibroblasts, and plasma. However, there is no consensus to what enzymes 1 2 Christine Lavery , Derralynn Hughes , Uma should be investigated, and a panel is randomly researched in Ramaswami2, Chris Hendriksz3, and Tarek Hiwot4 different places, with weak evidence that gives basis to this practice. Objective: To characterize lysosomal hydrolases 1Society of Mucopolysaccharide Diseases, MPS House, Amersham, activity in ML II/III, in order to propose a diagnostic protocol. United Kingdom Methods: Cross-sectional study, including patients with clini- 2Royal Free Hospital, London, United Kingdom cal and biochemical diagnosis of ML II or III. We analyzed 3Salford Royal Foundation Trust, Manchester, United Kingdom enzymes investigated at least in 4 patients, measured in plasma 4University Hospital, Birmingham, United Kingdom and fibroblasts, electing to the protocol those enzymes with the Fabry disease is a progressive X-linked lysosomal storage dis- largest differences from the reference values and lower costs. ease that can affect multiple generations of the same family. Mean difference in activities between MLs II and III were com- Understanding of the natural history and management of Fabry pared using t test. Results: A total of 37 patients were included disease in males and females have improved substantially in the (type II ¼ 24 and III ¼ 13), all with lysosomal enzymes eval- recent decades. It is of interest to determine whether this prog- uated in plasma and 15 in fibroblasts. Among enzymes in ress is reflected in changes in the number of patients diagnosed plasma, there was a mean increased activity in the following in a single family, patient experience of learning they may be at enzymes: a-mannosidase, a-L-iduronidase, a-N-acetylgalacto- risk of Fabry disease, and subsequent diagnosis. To investigate saminidase, a-N-acetylglucosaminidase, hexosaminidase, idur- these, 3 large Fabry cohort families have shared their family onate sulfatase, and b-glucuronidase; only chitotriosidase was Abstracts 91 normal. Among enzymes evaluated on fibroblasts, there was neuronal genes. Moreover, c-Abl inhibition reduces choles- diminished activity: neuraminidase, a-L-iduronidase, a-manno- terol accumulation. With these novel data, we suggest sidase, b-galactosidase, esfingomielinidase, b-glucuronidase, that c-Abl/HDAC2 pathway is a possible target for NPC hexosaminidase, iduronate sulfatase, and a-N-acetylglucosami- treatment. nidase; only b-glucosidase was normal. Discussion/Conclusion: Our data suggest some differences in biochemical phenotype of MLs II and III. Taking into consideration the cost of 1120 - Genetic Characterization of A359D, the enzyme assay, number of patients evaluated in our sample, the Most Frequent SMPD1 Mutation, Causing the biggest difference in normal values, and the possibility of performing the same test on different samples, the following Niemann-Pick Type B Disease in Chilean were chosen: arylsulfatase A, a-mannosidase, a-iduronidase, Patients and hexosaminidase. Paulina Mabe1, M. Acunã2, P. Martıńez2, M. Lagos2,M. Gonzalez3, J. F. Miquel2, J. L. Santos2, E. Schuchman4, 1085 - Epigenetic Alterations in Niemann- 2 and S. Zangulo Pick Type C Models: Neuronal Gene Repres- 1 sion Mediated by the c-Abl/HDAC2 Pathway Hospital Exequiel Gonza´lez Cortes,´ Santiago de Chile, Santiago, Chile 2 Pablo Contreras1, Marcelo Gonza´lez1, Alejandra Facultad de Medicina, Pontificia Universidad Cato´lica de Chile, 1 1 Santiago, Chile Alvarez , and Silvana Zanlungo 3INTA, Universidad de Chile, Santiago, Chile 1Universidad Cato´lica de Chile, Santiago, Chile 4Mount Sinai School of Medicine, New York, NY, USA Introduction: Niemann-Pick type C (NPC) disease is a neuro- Background/Aims: Niemann-Pick disease type B (NPDB) is degenerative lysosomal cholesterol storage disorder resulting a recessive hereditary disorder caused by deficiency in acid from loss-of-function mutations in either the NPC1 or the sphingomyelinase (ASM) due to mutations in the sphingo- NPC2 genes. Recently, histone deacetylases (HDAC) inhibi- myelin phosphodiesterase 1 (SMPD1) gene. The A359D tors have emerged as possible cholesterol lowering drugs for mutation has been described only in Chilean patients. Our NPC treatment due to the expression induction of several genes goal was to characterize the frequency of the A359D muta- involved in cholesterol metabolism and neuronal function. Pre- tion in the healthy Chilean population. Additionally, we viously, our laboratory has shown that c-Abl activity is included the first clinical and genetic characterization of increased in NPC and Alzheimer disease (AD) models and sta- A359D homozygous patients. We also wanted to determine bilizes HDAC2 levels in AD models. Our principal objective whether this mutation originated from a common ancient was to evaluate whether c-Abl activity induces upregulation founder and its effect on ASM activity. Methods: We ana- of HDAC2 and in this way, the inhibition of neuronal genes lyzedthefrequencyoftheA359Dmutationin1691geno- expression in NPC models. Methods: We used different NPC mic DNA samples from healthy individuals by Taqman models: (1) pharmacological models: primary cultures of hip- allelic discrimination. We included the clinical data of 13 pocampal neurons (7DIV), Hepa 1-6, and neuronal HT22 A359D homozygous patients. In 6 of them, the haplotype cells were treated with U18666A (U18) and (2) genetic was determined using different genetic markers. Effect of models:NPC1nullfibroblastsandNPC1nullmice.We A359D on ASM activity was determined in cells transfected treated the cells and animals with the c-Abl inhibitor, ima- with wild-type and A359D cDNAs constructions and in tinib, and evaluated (1) HDAC2 levels by immunoblot and fibroblasts of patients. Results: The frequency of the immunofluorescence, (2) the recruitment of HDAC2 in the A359D mutation was 1/105.7 and the theoretical prevalence promoter of neuronal genes (GluR1, NR2a, synaptotagmin of NPDB in Chile, due to this mutation, is 1/44.960. All 13 I, and synaptophysin) by chromatin immunoprecipitation patients analyzed have moderate to severe NPDB pheno- assay, (3) the expression of these neuronal genes by real- type, increase hepatic transaminases, and normal cognition time polymerase chain reaction, and (4) cholesterol levels development. Six of them showed a conserved haplotype by filipin staining. Results: We found increased HDAC2 and shared a 280-kb region around the SMPD1 gene, indi- levels in both U18-treated primary hippocampal neurons cating that the mutation originated from a common ancient and the cerebellum and brain of NPC1 null mice. Treatment ancestor. Cells expressing the A359D ASM protein showed with imatinib (1) induced a decrease in HDAC2 levels, (2) a4.2% acid sphingomyelinase activity. Similar activity was prevented HDAC2 recruitment on neuronal gene promoters, found in fibroblasts of patients, confirming this variant has a and (3) reduced neuronal gene repression. Interestingly, c- functional effect and is responsible for NPDB disease. Con- Abl inhibitor reduced cholesterol accumulation in Hepa 1- clusion: The A359D mutation is frequent in the healthy 6 and neuronal HT22 U18-treated cells and in the fibroblast Chilean population and has a common ancient founder. NPC1 genetic model. Conclusion: c-Abl induces an Homozygous patients have a moderate to severe NPDB phe- increase in HDAC2 levels promoting the repression of notype. This mutation reduces ASM activity considerably. 92 Journal of Inborn Errors of Metabolism & Screening

Conflicts of Interest: P. Mabe: meetings and courses sup- suggesting that this dietary supplementation could be useful ported by Genzyme, Shire, and BioMarin. Conferences sup- for the treatment of patients with NPC. ported by Genzyme and BioMarin. Clinical trials supported by Genzyme. 1163 - Phenotype Versus Genotype: Are Skin, Hair, and Eyes of Patients With Mucolipidosis 1134 - Mitochondrial Dysfunction and II/III Lighter Than Expected? Oxidative Stress: A Pathogenic Mechanism 1 2 3 for Niemann-Pick Type C Disease Taciane Alegra , Fernanda S. Ludwig , Ana V. Bau , Maria C. Bortolini1, Caio C. S. Cerqueira4, and Ida V. D. 1 1 1 Elisa I. Balboa , Tamara A. Marin , Juan F. Castro , Schwartz5 2 1 Alejandra R. Alvarez , and Silvana Zanlungo 1Post Graduation Program Genetics and Molecular Biology, Federal 1Departamento de Gastroenterologıá, Facultad de Medicina, University of Rio Grande do Sul, Porto Alegre, Brazil Pontificia Universidad Cato´lica de Chile, Santiago, Chile 2Gene Therapy Center, Hospital de Clıńicas de Porto Alegre, Porto 2Biologıá Celular y Molecular, Facultad de Cs Biolo´gicas Pontificia Alegre, Brazil Universidad Cato´lica de Chile, Santiago, Chile 3Federal University of Health Sciences of Porto Alegre, Porto Alegre, Brazil Introduction: Niemann-Pick type C (NPC) disease is a neuro- 4Centro Nacional Patagoˆnico (Cenpat/Conicet), Chubut, Argentina visceral lipid storage disorder involving cholesterol accumu- 5Genetics Department, Federal University of Rio Grande do Sul, lation in lysosomes and impaired cholesterol homeostasis. Porto Alegre, Brazil The pathogenic mechanism linking the accumulation of intracellular cholesterol with cell death in NPC disease is currently Introduction: Mucolipidoses (ML) II and III are lysosomal unknown. Oxidative stress has been observed in tissues from storage disorders due to N-deficiency in acetylglucosamine NPC mice and in NPC cellular models. Recent evidence phosphotransferase (GlcNAc-phosphotransferase) , the enzyme strongly suggests that mitochondrial cholesterol accumulation responsible for correct targeting of hydrolases to the lyso- and dysfunction play an important role in NPC pathogenesis. somes. There is empiric evidence that patients with ML-II/III One of the proteins involved in cholesterol transport from have eyes, skin, and hair lighter than expected. Our hypothesis lysosomes to mitochondria is lysosomal metastatic lymph is that melanogenesis is altered in (at least) a subset of patients node 64 (MLN64). Objectives: To evaluate the involvement with ML-II/III due to the disruption of vesicular targeting and of MLN64 in mitochondrial dysfunction and cholesterol accu- melanosomes function. Objectives: To evaluate the degree of mulation in vivo and in vitro and to analyze whether antioxi- pigmentation of skin, hair, and eyes in a sample of patients with dant therapies can ameliorate the mitochondrial dysfunction ML-II/III seen at a Brazilian reference center for LSD. and neurodegeneration in NPC cells and mice, respectively. Methods: The study comprises multiples strategies, but this Methods: In NPC models and in cells where MLN64 was report deals with the phenotype–genotype association between downregulated/overexpressed, we evaluated expression of the degree of pigmentation and the single-nucleotide poly- MLN64 and mitochondrial fusion/fission proteins by Western morphisms (SNPs) previously known to be strongly associated blot, oxidative stress, and mitochondrial membrane potential with pigmentation in humans. Eighteen patients (type II n ¼ 9, (MMP) using fluorescent probes and mitochondrial choles- type III a/b n ¼ 6, and type III g ¼ 3), and their parents, were terol content by high-performance liquid chromatography. evaluated in relation to phenotype characteristics of skin, hair, Niemann-Pick type C cells and mice were treated with pirace- and eyes using the Fitzpatrick and the Red-Green-Blue scales tam, vitamin E, and GSHEE and mitochondrial function, sur- and the visual classification as well. The following SNPs were vival, coordination, and locomotor function were evaluated. analyzed: rs1126809 (TYR gene), rs16891982 (SLC45A2 Results: An increase in MLN64 expression was associated gene), rs1426654 (SLC24A5 gene), and rs1129038 (HERC2 with mitochondrial dysfunction in NPC cells and oxidative gene). Results/Discussion: Single-nucleotide polymorphism damage in livers from NPC mice. Livers from mice overex- rs1126809 was not concordant with skin color in 1 of the 18 pressing MLN64 showed mitochondrial dysfunction, patient (ML II) and for eye color in 2 of the 18 patients (ML increased mitochondrial cholesterol, and oxidative stress. II ¼ 1); the nonconcordant patients were lighter than expected. Treatment with MLN64-siRNA restored MMP and decreased For rs16891982, 2 of the 18 patients (ML II ¼ 1; ML III a/b ¼ mitochondrial superoxide production in NPC cells. Vitamin E 1) had lighter skin and 2 of the 18 had darker skin color than delayed the loss of weight, improved coordination and loco- expected (ML II ¼ 1). Differences between ML-II and ML- motor function, and increased the survival of NPC mice. Con- III or between ML-IIIa/b and ML-IIIg were not found with clusion: Increased mitochondrial cholesterol accumulation regard to the evaluated outcomes. Conclusion: Although the mediated by MLN64 overexpression could be one of the sample is small and other genes can also influence the pheno- pathogenic mechanisms mediating mitochondrial dysfunction type, our data suggest there is a subset of patients with ML-II/ and increased oxidative stress in NPC disease. Treatment with III who may present defects in melanogenesis. Support: vitamin E can delay neurodegeneration in NPC mice, CNPq/FAPERGS Abstracts 93

1171 - Poor Response to Early Enzyme Olsen7, Hilde Monica Stensland8, Nilssen Oivind8, Replacement Therapy in an Argentinean Anne-Marie Thuesen9, Thea Pearl10, Ulla Haugsted10, Patient With Infantile Pompe Disease: It Is Flemming Wibrand1, Paul Saftig11, Judith Blanz11, All About Antibodies? Simon Jones12, Anna Tylki-Szymanska13, Nathalie Guffon.Fouiloux13, and Michael Beck14 Analia M. Cabrera1, Humberto E. Fain1, Hernan 1Department of Clinical Genetics, Copenhagen University Hospital, Amartino2, Daniela Roldan1, Ronald Coteluzzi1, Maria R. 1 1 Rigshospitalet, Denmark Aldao , and Viviana M. Buiras 2Zymenex A/S (Chiesi Group), Hilleroed, Denmark 3 1Hospital de Ninõs V.J.Vilela, Rosario, Argentina Department of Psychiatry and Neurochemistry, Sahlgrenska 2Hospital Universitario Austral, Pilar, Argentina University Hospital, Mo¨lndal, Sweden 4Larix, CRO, Ballerup, Denmark Objective: To describe the clinical outcome and response to 5Department of Clinical Biochemistry and Pharmocology, Odense alglucosidase a treatment in a patient with infantile Pompe dis- University Hospital, Denmark ease with unusual genotype. Method: CS, male first child of a 6Department of Paediatrics and Adolescent Medicine, Rigshospitalet, nonconsanguineous couple. At birth, he had a mild cardiome- Copenhagen, Denmark galy, with normal cardiac function. In his first month of life, his 7Department of Otorhinolaryngology, University Hospital, weight gain was insufficient and he developed hypotonia with Rigshospitalet, Copenhagen, Denmark progressive respiratory difficulties. At hospital admission, he 8Department of Clinical Medicine, Medical Genetics, University of was severely hypotonic but alert and had a mild hepatomegaly, Tromsø, Tromsø, Norway with a mild elevation in aspartate aminotransferase and alanine 9Psykolog 2, Virum, Denmark transaminase. Enzymatic test confirmed Pompe disease: a-glu- 10Department of Occupational Therapy and Physiotherapy, cosidase (GAA) 3.71 nmol/h mg (6.61-34.14 nmol/h mg) and Rigshospitalet, Copenhagen, Denmark Rel. NGA/IGAA: 409.6. The patient started enzyme replace- 11Biochemisches Institut, Christian-Albrechts-Universita¨ t Kiel, ment therapy (ERT) with 20 mg/kg/dose of alglucosidase a Germany (Myozyme; Genzyme, Cambridge, Massachusetts) during his 12Genetic Medicine, St Mary’s Hospital, University of Manchester, second month of life. Results: The patient required invasive United Kingdom ventilation in his first week of treatment and is still requiring 13Department of Metabolic Diseases, The Children’s Memorial it 16 months later. The cardiomegaly did not improve, and his Institute Poland, Warszawa, Poland gross motor development evaluated (Alberta Motor Scale) at 14Hopital Eduard Herriot, Service de Pediatre,´ Lyon, France the beginning of the treatment and after 16 months is poor. 15Villa Metabolica Universita¨ ts-Kinderklinik Mainz, Germany We received the extracted GAA DNA sequencing, and 2 heterozygous GAA mutations were detected: c.236_246del and Introduction: a-Mannosidosis is a rare lysosomal storage dis- c.377G>A. These mutations were described only in 1 patient order caused by deficiency in a-mannosidase. The clinical pic- who died at age 10 months before ERT. Cross-reactive immu- ture is varied and includes growth impairment, motor nological material (CRIM) status was not investigated due to disturbances, intellectual disabilities, facial characteristics, and difficulties in shipping fibroblasts samples. We are not able hearing impairment consequent to accumulation of uncatabo- to predict the CRIM status by genotype in this patient. The lized oligosaccharides. A recombinant human a-mannosidase antibody status titers after 12 months of treatment were enzyme (rhLAMAN) has been developed for weekly intrave- 6400, but the inhibition of enzyme activity test was negative. nous enzyme replacement therapy. We present the preliminary Conclusion: Although further investigation is required, the data after 18 months of treatment. Methods: A total of 10 c.236_246del/c.377G>A genotype seems to be associated with patients (7-17 years of age) were treated with rhLAMAN for severe phenotype and bad response to ERT in spite of the fact it 18 months (9 completed) in a single-arm, phase I-II trial. Effi- was started very early. We emphasize the importance of obtain- cacy was assessed by evaluation of motor function (6-minute ing CRIM status in every patient with Pompe disease in order to walk test [6MWT], 3-min stair climb test [3MSCT], and provide immunomodulatory treatment when necessary. Bruininks-Oseretsky test of motor proficiency second edition) and cognitive function (Leiter-R), measurement of oligosaccharides in serum, urine, and cerebrospinal fluid (CSF), and neurodegeneration biomarkers in CSF. Results: Oligosacchar- 1180 - Enzyme Replacement Therapy in ides: S-, U-, and CSF-oligosaccharides decreased by 89.9% Children and Adolescents With ␣- (P < .001), 23.8% (P ¼ .108), and 10.7% (P ¼ .107), respec- Mannosidosis: An 18-Month Follow-Up tively. The CSF biomarkers: CSF-NFLp, CSF-GFAp, and CSF-t protein decreased by 29.8% (P ¼ .005), 41.2% (P < 1 1 2 Line Borgwardt , Christine I. Dali , Jens Fogh , Jan-Eric .001), and 9.5% (P ¼ .104), respectively. Motor function: Ma˚nsson3, Klaus Juul Olsen4, Hans Christian beck5, Kim improvements were observed in 3MSCT (average¼þ39 steps, G Nielsen6, Lars Holme Nielsen7, Steen Oestergaard P ¼ .004) and in 6MWT (þ71 m, P ¼ .009). Cognitive 94 Journal of Inborn Errors of Metabolism & Screening function: improvement in the total equivalence age of 6 months 1229 - Farber Disease: Differential Diagnosis was observed during the 18 months in Leiter-R test (P ¼ .022). for Early Contractures and Arthritis Conclusion: These preliminary data show a relevant improvement across several clinical and biochemical end points after Alexander So´lyom1, Nesrin Karabul2, Ivan Galanin3, 18 months of treatment with rhLAMAN in patients with a- Calogera Simonaro4, and Edward Schuchman4 Mannosidosis. A 12-month, multicenter, double-blinded, ran- 1 domized, and placebo-controlled phase 3 trial is ongoing to Pediatric Rheumatology, Pediatric Hospital, University of Pecs,´ Pecs,´ confirm efficacy and safety of rhLAMAN. Hungary 2Villa Metabolica, Children’s Hospital, University Medical Center, Mainz, Germany 1188 - Gangliosides and Neurodegeneration: 3Plexcera Therapeutics LLC, New York, NY, USA A New Inborn Error of Glycosphingolipid 4Mount Sinai School of Medicine, New York, NY, USA Metabolism Presenting as Complicated Introduction: Farber disease is an ultrarare lysosomal stor- Hereditary Spastic Paraplegia age disease (LSD) resulting from the inherited deficiency in acid ceramidase and the accumulation of ceramide. Cera- 1 2 Charles M. Lourenço , Giovanni Stevanin , Stephan mide is a proinflammatory and proapoptotic lipid implicated Zuchner3, and Wilson Marques Jr1 in the pathogenesis of cartilage disorders. Farber has a heterogeneous presentation ranging from a severe phenotype 1Neurogenetics Unit, Clinics Hospital of Ribeirao Preto, University of with respiratory and central nervous system (CNS) invol- Sao Paulo, Saõ Paulo, Brazil vement with an average life expectancy of <2 years, to a 2Centre de Recherche de l’Institut du Cerveau et de la Moelle moderate phenotype typically including joint swelling, sub- epiniere, Paris, France cutaneous nodules, contractures, and pain. Awareness of 3John P. Hussman Institute for Human Genomics, Miami, FL, USA Farber disease is limited due to its rarity, and moderate Introduction: Hereditary spastic paraplegias (HSPs) comprise a cases might be initially considered to be juvenile idiopathic complex and heterogeneous group of neurological disorders. arthritis (JIA) or another LSD such as mucopolysaccharido- Although majority of cases of HSPs are due to genes involved in sis (MPS). Methods: To test the hypothesis that moderate axonal growth or vesicular trafficking, there are genes involved Farber disease has been diagnosed as JIA in practice, we in complex metabolic pathways that can cause HSP. Objective: conducted a literature search for moderate Farber disease To report a new hereditary metabolic cause of HSP in a Brazilian case studies, defined as reaching >2 years of age without family caused by enzyme deficiency in b-1,4-N-acetyl- organomegaly or CNS involvement. We have additionally galactosaminyl transferase 1 (B4GALNT1), involved in ganglio- developed a targeted clinical questionnaire, and diagnostic side biosynthesis. Methods: After excluding the traditional inborn code-based patient selection method to better assess the errors of metabolism (IEMs) associated with HSPs and molecular prevalence of Farber disease among children with polyarti- analysis of spastic paraplegia (SPG) 11 and SPG15 genes, whole cular joint disease. Results: Of the 84 unique articles and exome sequencing was performed. All sequencing results were 35 Farber disease case studies, 40% described patients with analyzed by the Genomes Management Application (GEM.app). moderate disease (36% initially diagnosed with JIA). Results: Mutations in the B4GALNT1 gene (in the SPG26 locus) Conclusion: Moderate Farber cases may be diagnosed as were identified in all affected patients in the family; parents were JIA or an attenuated form of MPS due to primary involve- heterozygous carriers of the mutation. Patients affected by this dis- ment of the joints and connective tissue. Differential diag- ease have early-onset spastic paresis, mild intellectual disability, nosis can be made by accounting for the comparatively cerebellar ataxia, strabismus, and some can develop psychiatric early-onset, progressive symmetric arthritis, presence of disturbance. Male hypogonadism was also noticed. Brain mag- subcutaneous nodules, and an unusual, hoarse cry or voice netic resonance imaging showed nonspecific white matter changes in patients with Farber disease. Acid ceramidase enzyme in older patients. Conclusion: Although there are many IEMs therapy (recombinant human acid ceramidase) is currently involved in the ganglioside catabolism presenting as neurodegen- under development and is expected to enter clinical trials erative disorders, this enzyme deficiency is the second human dis- in 2015. Screening of the population of children with sym- order identified in the pathway of ganglioside biosynthesis, metric joint contractures and/or arthritis for other symptoms suggesting that other human diseases can be caused by metabolic of Farber disease will hopefully reveal patients who then errors leading to glycosphingolipid synthesis defect. can benefit from disease-specific care and treatment. Abstracts 95

Author Index Barbier AJ 31, 66, 67 Abé-Sandes K 7 Barbosa HM 84 Abed SN 5 Barbosa PO 6 Aboulnasr AAL 37 Barrera LA 17, 18, 26, 84 Acosta A 7, 22, 73 Barrerra LA 76 Acosta AX 7, 25, 72, 75 Barreto GE 40 Acosta EB 12 Barros-Angueira F 46 Acosta JC 26 Barth A 70 Acosta MA 46 Barth AL 17, 23, 24, 55, 59, 60, 73 AcunãM 91 Basquiera AL 77 Adintori E 36 Bau AV 92 Aglan MS 31 Bay L 77 Aguiar O 1 Bazarragchaa M 12 Ahmed A 10, 75 Becerra AB 11, 54, 70, 77 Ahn K 61 Beck HC 93 Al-Sayed M 42 Beck M 19, 63, 93 Alan M 57 Bedwell DM 87 Alcantara MA 45, 46 Begley DJ 68 Aldao MR 93 Behu´lova´D 35 Alegra T 45, 48, 71, 90, 92 Bell L 51 Almeciga CJ 40, 84 Bellesso S 2 Almeciga-Diaz CJ 40, 84 Belleti D 89 Alméciga-Dıáz CJ 17, 76 Bender F 7, 35, 72 Alvarez A 91 Benmansour A 38 Alvarez AMC 46 Benyo´G 79 Alvarez AR 92 Berretta A 77 Alves AF 28 Bertoldi K 76 Amartino H 93 Bessems GJHJM 18 Amorim T 7 Bezerra PGM 11 Andaluz A 88 Bhagwat S 36 Andrade LB 11, 80 Bialer MG 59 Anõr S 88 Bielefeld B 66 Antonozzi S 70 Bigger BW 3, 22, 85, 88 Antonozzi SL 54, 77 Bittar CM 27, 76 Antunes A 88 Blank-Landeshammer B 87 Antunes C 38 Blanz J 93 Aoyagi-Scharber M 36 Bleakley C 79 Aranda CS 16, 21, 27, 60, 62, 69 Bochernitsan A 7 Arash L 20 Bochernitsan AN 8 Ardila YA 26 Bonatto D 38 Ardila YA 25 Borbolato G 38 Artigala´s O 71 Borges AMFS 23, 69 Askin GN 68 Borgwardt L 93 Atwood R 39 Borri ML 27 Auray-Blais C 29, 37 Bortolini MC 92 Ausseil J 3 Bosch F 88, 89 Ayala A 32 Boy R 7, 60 Ayala P 43 Braga MC 35 Ayuso E 88 Braulke T 45 Ayyad A 5 Braunlin E 53 Azar N 54, 70, 77 Breen C 79 Babaykina M 9 Breier AC 38, 58 Balboa EI 92 Brion K 46 Baldo G 4, 15, 57, 72, 74, 89 Brown J 36 Baraqoni N 5 Bruce IA 22 96 Journal of Inborn Errors of Metabolism & Screening

Brusius-Facchin AC 8, 35 Costa AP 24 Bruxel F 84 Costa R 2 Bugaeva EV 14 Costa-Carvalho BT 16 Buiras VM 93 Cox GF 56, 65 Bulacios S 11 Cramb J 68 Bullens S 36 Crawford B 36 Bullock H 20 Cruz CU 47 Bunting S 36 Cruz PP 72 Burin M 7, 35, 90 Cruz RW 21 Burin MG 7 Cuaspa R 84 Burton BK 14, 31, 65 Curiati MA 16, 21, 27, 69 Cabral MB 21 D’Almeida V 35 Cabrera AM 93 D’Avanzo 89 Caciotti A 39, 42 D’Almeida V 62 Cagle SR 81 D’Almeida V 3, 16 Caillaud C 38 D’Almeida V 1 Camelo-Nunes IC 60 da Fonseca GGG 60 Campij P 11 da Rocha NS 51 Canossa S 16, 21, 62, 69 Dali CI 93 Carbarcas L 25, 26 Dani C 38 Carvalho CG 73 Dantas DC 73 Carvalho EDF 6 Darin J 36 Carvalho KM 6 Davidson K 39, 42 Carvalho MDF 6 Davis JM 31 Carvalho TG 4, 74 de Carvalho TG 57, 84, 89 Castells M 60 de Lacerda AE 60 Castro JF 92 De Pace R 45 Cateluzzi R 93 DeAngelis VA 12 Cathey S 77 Decker C 14 Cavalcanti NC 70 Delaney K 9, 10, 20 CéJ 58 Delgado A 54, 70 Cerqueira CCS 92 Deps TD 27 Cerqueira WOS 22 Derralynn HA´ 57 Chakrapani AB 64 Devos AS 18 Chandoga J 35, 63 Dıáz D 76 Chen A 75 Dıáz S 76 Chen S 71 Dickson P 36, 75 Chernavina E 9 Dickson PI 71, 86 Chinen Y 78 Diel D 84 Cho SY 6, 41, 54, 61 Doljoo Z 12 Choi EY 86 Donsate A 86 Choi Y 3 Dorneles AD 71 Chung Y 56 Dridi L 2, 3 Church HJ 22, 42 Du C 39 Cismondi AI 11 Duarte MCMB 11, 80 Civallero G 35 Duncan FJ 82, 83 Clark KR 82, 83 Dung VC 62 Clatterbuck C 5 Dvora´kova´L 35 Cleary M 20 Echeverri O 25, 26 Coelho JC 38, 58 Edano CB 65 Coll MJ 42 Eichler S 39 Contreras P 91 Eiroa H 77 Co´rdoba H 76 Eizerik DP 71 Costa AAP 17 Ekanayake J 42 Costa AF 71 El Bougdady N 31 Abstracts 97

Ellinwood NM 71 Garlobo L 12 Ellison S 85 Garzoń DA 18 Ensina LF 60 Gavrilov DK 34 Ensina LFC 62 Ge Y 12 Esko J 36 Gensen CP 12 EspanãM 32 Gevorkyan A 9 Espejo A 76 Giese AK 38 Espinosa E 25 Gieselmann V 36 Esposito AC 17, 23, 24, 55, 59, 60, 70, 73 Giner AN 54, 77 Eufrazino C 8, 28 Giner-Ayala NA 70 Facchin AC 41 Giraldo G 43 Facchin ACB 42 Giugliani L 15, 24 Faghfoury H 28 Giugliani R 4, 7, 8, 14, 15, 19, 24, 27, Fagondes S 74 32, 34, 35, 41, 44, 48, 53, Fagondes SC 27 56, 57, 63, 64, 66, 72, 73, Fain HE 93 74, 76, 89 Fallet S 5, 65 Gole GG 68 Fan Z 67 Gomes ILS 22 Fateen EM 31, 37 Gomez L 11 Fauler G 87 Gomez NA 54, 77 Federhen A 7, 27, 73, 76 Gonçalves CM 21, 74 Feio RHF 23, 52 Gonzales J 40 Feliciano P 16, 27, 62 Gonzalez J 49 Ferhen A 72 Gonzalez M 91 Fernandes M 4 Gonza´lez M 91 Ferreira NY 3 Gonzalez-Del Angel A 45, 46 Ferreira RS 59 Gort L 42 Fietz MJ 42, 46 Goudouris E 60 Figueroa C 77 Gould R 16, 64 Filho HSM 51 Grechanina EY 14 Filho NK 89 Grechanina YB 14 Flanigan K 82 Grigoryeya L 3 Fogh J 93 Guarany NR 51, 52 Forni F 89 Guelbert GA 54, 70, 77 Fouad M 31 Guelbert NB 11, 14, 54, 70, 77 Fraga M 84 Guevara JM 18, 25, 26 França EC 27 Guffon N 14, 53 Francis-Lyon P 39 Guffon.Fouiloux N 93 Franco JF 78 Guio JCA 21, 43 Frangipani BJ 74 Gulati S 43 Freitas NE 21 Gupta N 43 Frohbergh M 12 GurjaõMM 8 Frusciante M 38 Guterrez ML 62 Fu H 82, 83 Gutierrez ML 18 Fuji T 34 Guzman MA 71 Fukushi M 34 Habekost CT 24, 76 Funchal CS 38 Haddad MR 86 Futatsumori H 34 Hadzsiev K 79 Gabig-Ciminska M 67, 82, 85 Ha´jkova´Z 3 Galanin I 94 Halac IN 11 Galvis J 49 Hamartz P 14, 20 Garcıá F 44, 47 Hamazaki T 56 Garcia M 88, 89 Hamilton-Kay C 55 Garcia R 43 Hansikova´H 3 Garcia-Ortiz JE 30 Harmatz P 39, 53, 59, 66 98 Journal of Inborn Errors of Metabolism & Screening

Hartmann M 20 Jones SA 14, 20, 66, 79 Hashimoto A 62 Juan L 73 Haslett P 9, 10, 20 Juarez-Osuna JA´ 30 Haugsted U 93 Julia A 77 Haurigot V 88, 89 Junior LMC 72, 73 He X 12 Jurecka A 26 Heales S 29 Kabra M 43 Hedge M 42 Kaiser T 87 Heest AEV 66 Kakkis E 70 Henckaerts E 88 Kaler SG 86 Hendriksz C 14, 51, 53, 79, 90 Ka´llay K 79 Hendriksz CJ 31, 66, 67 Kan SH 71, 86 Herman R 36 Karabul N 12, 19, 94 Hernańdez A 76 Kassa C 79 Hernandez-Amariz MF 39 Kassahn K 46 Herreno AM 84 Kato S 62 Herrera J 84 Kaur P 43 Hidalgo PK 11 Kearney S 67 Higa T 78 Kearney SA 50, 79 Hiwot T 90 Keeling KM 87 HlavataÁ 35, 63 Kelly K 33 Hlavata´K 35, 63 Kelly PM 79 Holder II 5 Kennedy J 79 Hong L 81 Kerstenetzky MS 11, 80 Hoogeveen-Westerveld M 43 Kessler RG 72 Hopwood JJ 68 Ketteridge D 53 Horovitz D 7, 23, 73 Khan S 36, 42 Horovitz DDG 55, 70 Kim C 56 Horovitz DG 24, 59, 60 Kim CA 48, 78 Horton J 67 Kim CAK 7 Hoz CMP 12 Kim J 61 Hrebıćek M 2, 3 Kim OH 13 Hughes D 90 Kitajima JP 48 Huh R 13, 41 Kliemann LM 15 Hulkova´H 2, 3 Kloska A 82 Hyakuna N 78 Ko AR 6, 13, 41, 54 Ibrahim MM 31 Kobayashi R 56 Ichinkhorloo P 12 Kobiela W 67 Iee J 41 Kok F 48 Inwood AC 68 Koladicz K 74 Ishige M 56 Kollmann K 36 Jain M 19, 50, 51, 80 Komlo´si K 79 Jakobkiewicz-Banecka J 82, 85 Kornfeld S 48 Jakobkiewicz-Banecka JA´ 67 Kosuga M 56 Jay S 12 Kovac V 10 Jens J 71 Krivań G 79 Jesina P 10 Kroos MA 43 Jesuıńo KCT 7 Kubashi F 41 Jin D 56 Kubaski F 8, 13, 32, 33, 42 Jin DK 6, 13, 54, 61 Kunes Y 66 Jobe RN 50, 79 Kwak H 56 John AB 27 Kwun Y 13, 41 Jones AS 55 Kyosen SO 16, 62, 74 Jones J 22 Kyu D 41 Jones S 26, 53, 59, 85, 93 Lacerda KRRS 80 Abstracts 99

Lacerda L 42 Mallozi MC 16 Lacey JM 34 Mañsson JE 93 Ladino L 8 Marco´S 88 Lago-Lestoń R 46 Marin TA 92 Lagos M 91 Marinho J 38 Lagranha VL 4, 89 Mariz FP 60 LaMarr WA 33 Markmann S 36 Lampe C 19, 51, 53, 58 Marques Jr W 94 Langereis EJ 22, 79 Marques JS 52 Langford-Smith A 3, 85 Marques-Lourenco C 44 Langford-Smith K 85 Martin KS 59 Laranjeira F 42 Martinelli BZ 4, 38, 74, 89 Larsen MP 6 Martinez D 70 Laura L 76 Martıńez P 91 Lavery C 16, 50, 51, 57, 90 Martins AM 1, 14, 16, 21, 27, 35, 62, 69, 74 Lavoie P 29, 37 Martins C 2, 3, 48 Lawrence R 36 Mascelli MA 67 Le S 36 Mason RW 13, 17, 32, 33, 34, 62 Le SQ 71, 86 Matern D 34 Leaõ EKEA 22, 25, 72, 73 Matte U 4, 7, 15, 38, 57, 74, 84, 86, 89 Leaõ-Teles E 53 Matte US 47 Lee J 13 Maurer RL 15 Lee S 56 Mayer FQ 4, 74 Lee SY 13 McBride K 82, 83 Lefe`bvre JF 48 McCarty D 82, 83 Leistner-Segal S 7, 8, 35, 41, 42, 48 McGill JJ 68 Lemos LR 21 McNeil S 75 Lemos PCB 59 McNelly B 79 Leoń X 88, 89 Meadows A 82, 83 Leonardi F 76 Mealiffe M 39 Lessa KP 72 Medeiros NS 38 Liao AY 85 Medeiros PFV 8, 28 Lin P 53 Meijer OLM 84 Lin SP 14 Melegh B 79 Linda R 57 Melia C 88 Linden M 88 Mello AS 38 Llerena JC 24, 60 Melo HA 8 Lopes JC 75 Mendelsohn NJ 31, 66 Louenço CM 94 Mendes CSC 16, 27, 69 Lourenço CM 7, 34, 45 Mendes VB 49 Ludwig NF 45, 47, 48 Mendoza-Ruavalcaba SC 30 Lund T 29, 77 Meng F 12 Luz KP 23 Mengel E 19, 20 Lynch M 6 Mengel KE 14 Mabe P 91 Mercer J 22, 55, 79 Machado FS 38 Merry C 85 Maciel CD 55, 59 Mezzalira J 58 Mackenzie WG 13, 17, 32, 33 Micheletti C 62 Maeng SH 61 Mihoreanu L 50, 80 Magera MJ 34 Miller N 39, 42 Maggioni L 88, 89 Miller W 29, 77 Maher E 75 Miquel JF 91 Mahmood A 65 Mishra P 43 Malick ML 65 Mitchell J 14 Malinowska MH 67 Molas M 88 100 Journal of Inborn Errors of Metabolism & Screening

Moncayo MA 18 Oliver D 50 MontanõAM 17, 32, 33, 62 Oller-Ramirez AM 70 Monteiro KM 4 Olsen KJ 93 Monteiro VCL 74 Olsen SO 93 Montoya JC 44, 47 Orchard P 29, 66, 77 Mooney S 39, 42 Orii KE 18, 32, 62 Moraes VC 58 Orii T 13, 17, 18, 32, 33, 34, 62, 78 Moreira AA 28 Oron TR 39 Moreira GA 16 Ortega AL 28 Moreno J 76 Os MMD 79 Moreno LJ 44, 47, 49 Oussoren E 18 Morin I 6, 58, 63, 64 Pachajoa H 39 Moro E 2 Pacheco N 32 Morrone A 39, 42 Pajares S 42 Moskot M 82, 85 Pal AR 22 Mosquera A 76 Pan L 31, 67 Motas S 88, 89 Paneque AL 12 Mozolewski P 85 Pano A 31, 66 Muenzer J 31, 59, 63, 67 Paredes-Garmero EJ 1 Munõz S 89 Parini R 14, 59 Munoz T 28 Parker H 88 Murrey D 82, 83 Paschke E 44, 87 Nagieva KF 14 Pasquali M 36 Nair N 20 Pasqualim G 57, 74 Namazova-Baranova L 9 Patel P 13, 17, 18, 33, 62 Napier-Ionascu N 20 Patti CL 16 Napy GC 8 Paul K 44 Nascimento C 1 PearlT 93 Naughton B 82, 83 Peralta LA 77 Nepomuceno FG 28 Pereira DMB 24, 76 Nestrasil I 9, 10, 71,75 Pereira POB 52 Ngu LH 61 Pereira TV 71 Nielsen KG 93 Pereira VG 3, 35 Nielsen LH 93 Perry V 67 Novikov PV 56 Peszynska-Sularz G 67 Nyul Z 79 Peszynska-Sularz J 67 O’Leary C 88 Philippo S 55 O’Maera A 79 Pickford C 85 Ochoa E 8 Pijnappel PWWM 43 Oglesbee D 34 Pimentel N 76 Oguma T 34 Pinã-Aguilar RE 40 Ohmi K 3 Pincus P 68 Oikawa H 62 Piscia-Nichols C 53 Oivind N 93 Pizzi S 77 Okuyama T 56 Platenik EM 55, 59 Olaye A 51 Plug I 18, 43 Oldham HM 13 Pohl S 45 Oliveira ACB 27 Polgreen L 29 Oliveira F 3 Polkhoo K 12 Oliveira IP 59 Pollard L 42 Oliveira J 75 Poloni JF 38 Oliveira JL 75 Pordeus IA 27 Oliveira ML 73 Poswar F 72 Oliveira MLC 60 Poupetova´H 35 Oliveira RB 74 Prado E 60 Abstracts 101

Prieto JC 43 Sakkers R 79 Prospero RG 19 Salazar DA 40 Provenzale JM 71 Salazar LV 19 Pshezhetsky AV 2, 3, 48, 88 SˇalingovaÁ 63 Pulido NF 25, 26 Salvalaio M 2, 89 Pulles TAW 6 Sańchez A 44, 47, 49 PurificaçaõA 7 Sańchez OF 76 Pyragius T 46 Sańchez V 89 Quartel A 53 Santana JS 25 Queiroz MT 3, 35 Santillań-Hernańdez Y 40 Radwan A 31 Santos H 52 Rafaelli CL 7 Santos JL 91 Raiman J 28 Santos SL 8 Ramaswami U 90 Santra S 42, 64, 67, 80, 81 Ramos RTT 75 Sapra S 43 Rand MH 16, 27, 69 Satizabal JM 44, 47, 49 Rand MM 62 Sawada T 56 Raymond KM 34 Scalco F 73 Reha A 87 Scalco FB 60 Reis MA 52 Scarpa M 63, 64, 89 Ribas G 35 Schneider AP 74 Ribeiro EM 69 Schuchman E 91, 94 Ribeiro EM 23 Schuchman EH 12 Ribeiro EM 7, 23, 69 Schwartz IV 69 Ribeiro I 42 Schwartz IVD 41, 45, 47, 48, 49, 51, 52, 71, Ribeiro MG 7, 51, 60 86, 90, 92 Ribera A 88, 89 Schwarz E 36 Richards S 56, 65 Sciarappa K 66, 67 Riello AP 17 Seches TAVA 62 Rigon L 89 Semotok J 28 Rijn RRV 79 Seo J 56 Rinaldo P 34 Sepu´lveda N 8 Roberts JC 55, 80 Sergijenko A 85 Robledo HH 11 Shaffer TH 13 Roca C 88, 89 Shapiro E 9, 10, 20, 75 Rocha D 52 Shapiro EG 71 Rocha KC 1 Shastri SS 43 Rocha V 52 Shaywitz A 59 Rodriguez EA 40 Shibata Y 34 Rodrı´guez-Lo´pez A 76 Shimada T 13, 17, 18, 32, 33, 34, 62 Roizen M 77 Shinpo M 56 Roldan D 93 Signorovitch J 70 Rolfs A 38 Sihn YB 6 Roush P 59 Silva BBR 11, 80 Roychowdhury M 43 Silva CAB 69 Rozdzynska-Swiatkowska A 26 Silva DS 17, 24, 25 Ruberte J 88, 89 Silva JAO 74 Rudser K 10 Silva L 76 Ruijter GJ 18, 43 Silva LCS 7, 23 Ruı´z-Botero F 39 Silva TO 28 Ruozi B 89 Silva VT 69 Ryles A 39 Silva-Jose TD 30 Saftig P 93 Simmons LM 81 Saif MA 22 Simonaro C 94 Sakai N 56 Simonaro CM 12 102 Journal of Inborn Errors of Metabolism & Screening

Siqueira T 73 Torres LC 78 Skrinar A 70 Tortorelli S 34 Slasor P 14 Tosi G 89 Smolinska E 82 Tufik S 16 Snella E 71 Tumurkhuu M 12 Soares DCQ 78 Tylee KL 22, 42 Sohn YB 13, 41, 54, 61 Tylki-Szymanska A 63, 64, 93 Solanki G 42, 80 Uribe A 32, 49 Solanki GA 67 Vaca JJ 18 Solano M 19, 21, 58 Vairo F 73, 74 Sole D 62 Valadares E 7 SoléD 16 Valadares ER 27 So´lyom A 12, 19, 79, 94 Valayannopoulos V 14 Soto C 76 van den Hout HJMP 18 Souza C 74 van der Ploeg AT 18, 43 Souza CFM 15 van Meel E 48 Souza CM 73 van Vlies N 84 Souza ICN 23, 52 Vandelli MA 89 Sperb-Ludwig F 45, 47, 48, 49, 86, 92 Vanderver A 31 Spiegel RJ 87 Vanz AP 52 Sreekentam S 64 Vanzella C 24, 73 Staciuk R 77 Vargas C 35 Stehel E 75 Vashakmadze N 9 Stein MB 67 Velasco H 49 Steiner C 7 Velasco HM 21 Stensland HM 93 Vela´squez O 76 Stevanin G 94 Velho RV 45, 47, 48, 86 Stewart CA 64 Vellodi A 14, 66 Stewart FJ 26 Vera-Loaiza A 40 Stréhn A 79 Verma G 43 Stuetz A 87 Viana GM 1 Sukhanova N 9 Vieira DKR 55 Suzuki Y 17, 18, 32, 33, 34, 56, 62, 78 Vieira SMV 15 SvobodovaÉ 3 Vieira T 73 Tabuchi K 56 Vieira TA 27 Tanaka A 56, 62 Vijay S 42, 64, 80 Tanaka K 63 Vijayaraghavan S 67 Tanyalcin MT 30 Villacampa P 88, 89 Tapiero SM 21 Vincelette J 36 Tavares AMV 57 Vite C 71 Teixeira HF 84 Vollebregt A 43 Tesarova´M 3 Wang D 87 Testa GA 89 Wang H 59 Thacker MM 17 Wang N 31, 67 Thelen M 36 Wang R 42 Theroux M 17 Ware T 83 Thomas B 36 Warwick AL 57 Thompson L 79 Wassmer E 81 Thuesen AM 93 Webster K 36 Tilky-Szymanska A 26 Weetall M 87 Tiozzo V 16, 62 Wegrzyn G 67, 82, 85 Tomanin R 2, 89 Welch EM 87 Tomatsu S 13, 17, 18, 32, 33, 34, 62, 78 Whight C 68 Toralles MB 7 White KK 79 Torres DA 23 Whitley C 9, 10, 20 Abstracts 103

Wibrand F 93 Wynn RF 22 Wijberg FA 22 Xu Y 65 Wijburg F 14 Xue Y 56 Wijburg FA 79 Yabe H 56, 62 Wijburn F 84 Yamaguchi S 32, 33, 34 Wilke M 52 Yamamoto JUS 35 Wilkie E 16 Yang K 14 Wilkinson F 85, 88 Yasuda E 13, 17, 18, 32, 33 Wilkinson FL 3 Yee J 71 Windischhofer W 87 Yoo HW 61 Windischofer W 44 Yund B 10 Wink MR 4 Zancan I 2 Wohlenberg M 38 Zangulo S 91 Wraith J 53 Zanlungo S 91, 92 Wrodnigg TM 87 Zaraspe K 83 Wyffels M 66 Zawadzki KA 39 Wynn R 85 Zuchner S 94