University of Nevada, Reno
Characterization of the Genes Essential for Mouse Spermatogenesis
A dissertation submitted in partial fulfillment of the requirements for
the degree of Doctor of Philosophy in
Cellular and Molecular Pharmacology and Physiology
by
Qiuxia Wu
Dr. Wei Yan/Dissertation Advisor
May, 2012
THE GRADUATE SCHOOL
We recommend that the dissertation prepared under our supervision by
Qiuxia Wu
entitled
Characterization of the Genes Essential for Mouse Spermatogenesis
be accepted in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
Dr. Wei Yan, Advisor
Dr. Seungil Ro, Committee Member
Dr. Grant W. Hennig, Committee Member
Dr. Sean M. Ward, Committee Member
Dr. Claus Tittiger, Graduate School Representative
Marsha H. Read, Ph. D., Associate Dean, Graduate School
May, 2012
i
Abstract
Spermatogenesis is a complex process that starts with the proliferation of differentiated spermatogonia through mitotic division. Primary spermatocytes produced from differentiated spermatogonia enter the prolonged prophase of meiosis during which
DNA is exchanged by homologous recombination. Primary spermatocytes undergo two meiotic divisions to form haploid spermatids. Haploid spermatids differentiate through the elongation phase and eventually form mature spermatozoa through dramatic morphological changes termed spermiogenesis, during which: 1) the Golgi apparatus forms the acrosome, 2) nuclear chromatin undergoes compaction and condensation, 3) sperm tail is formed and 4) the excess cytoplasm of spermatid is eliminated. Given the complexity of spermatogenesis, the normal development of male germ cells is controlled by both protein-coding genes and small non-coding RNAs. Because of the lack of in vitro models, mouse models are currently the most powerful tools used to study these processes.
KLHL10 (Kelch-like 10) is a spermatid-specific protein, which belongs to a BTB
(Brica-brac, Tramtrack, and Broad-Complex)-Kelch protein superfamily.
Haploinsufficiency of Klhl10 causes male infertility and prevents the genetic transmission of both mutant and wild-type alleles in mice. Therefore, a transgenic rescue strategy was used to overcome the haploinsufficiency of Klhl10 and knockout (KO) mice were generated for studying the function of Klhl10 during spermatogenesis. Klhl10 KO testes exhibited disrupted spermatogenesis, characterized by severe depletion of germ cells, degeneration of spermatids and reduction in the number of late spermatids. In
ii
Klhl10 KO testes, spermatid differentiation was arrested in elongating stage at step 9.
Comparison of protein profiles between control and KO testes revealed that many mitochondrial proteins were up-regulated in Klhl10 KO testes. In addition, COX IV
(mitochondrion marker) staining showed enhanced mitochondria signal in KLHL10 depleted germ cells. Our results indicate that KLHL10 might be involved in regulating mitochondrial protein turnover during late spermiogenesis.
The BTB domain of KLHL10 was reported to directly interact with CUL3 (an ubiquitin E3 ligase), suggesting KLHL10 is involved in the ubiquitination pathway to regulate protein turnover. Using yeast two-hybrid, we screened an adult mouse testis library to identify testicular proteins that can interact with KLHL10 and spermatogenesis- associated proteins 3 (SPATA3) and 6 (SPATA6) were two proteins identified. In vitro co-immunoprecipitation assay revealed that KLHL10 interacts with both SPATA3 and
SPATA6 through the Kelch domain, a substrate-recruiting domain in most of the CUL3-
BTB/Kelch E3 ligase complexes. Therefore, an in vivo ubiquitination assay was performed to examine whether KLHL10 can recruit SPATA3 or SPATA6 for ubiquitination. We found the ubiquitination level of SPATA3, but not SPATA6, was significantly increased upon overexpression of KLHL10, suggesting SPATA3 is a substrate of CUL3-KLHL10 E3 ligase. Our data suggests CUL3-KLHL10 complex is a spermatid-specific ubiquitin E3 ligase that involved in removal of proteins during late spermiogenesis.
Hils1 is another spermatid-specific gene, which encodes a linker histone H1-like protein. The expression of HILS1 overlaps with the expression of transition nuclear proteins (TNP1 and TNP2). While Hils1-/- males were fertile and Tnp1-/- males were
iii subfertile, the double KO (Hils1-/-Tnp1-/-) mice we generated were completely infertile.
Electron microscopy revealed severe nuclear condensation defect in both late spermatids and epididymal sperm of Hils1-/-Tnp1-/- mice. The number of epididymal sperm was highly reduced and most sperm had abnormal morphologies with head-bent-back as predominant defect in Hils1-/-Tnp1-/- mice. Double KO sperm also had a greater susceptibility of DNA to denaturation and elevated levels of protamine 2 precursors.
Injection of mutant cauda epididymal sperm into intact oocyte showed normal fertilization rates, however, most zygotes didn’t develop beyond the 2-cell stage. Single cell PCR revealed that the mRNA expression profile was altered in 2PN and 2-cell mutant embryos compared to WT, suggesting the disruption of paternal nuclear condensation can cause abnormal embryo development at pre-implantation stage.
In addition to gene functional study using universal KO mouse models, we also used conditional KO mouse models to study the functions of small RNAs during spermatogenesis. microRNAs (miRNAs) are produced from short hairpin structures by the cleavages of DROSHA, a RNase III enzyme, in the nucleus and DICER, another
RNase III enzyme, in the cytoplasm. endo-siRNAs are distinguished from miRNAs in that endo-siRNAs are processed from naturally occurring long dsRNAs and the biogenesis of endo-siRNAs is DROSHA-independent but DICER-dependent. To investigate the role of miRNA and/or endo-siRNA in spermatogenesis, we generated
Drosha or Dicer conditional knockout (cKO) mouse lines using Cre-loxP strategy to specifically delete Drosha or Dicer in spermatogenic cells in postnatal testes. Although both Drosha and Dicer cKO males are infertile, Drosha cKO testes appeared to display more severe spermatogenic disruptions than Dicer cKO testes. Microarray analyses
iv revealed transcriptomic differences between Drosha and Dicer-null pachytene spermatocytes or round spermatids. Although levels of sex-linked mRNAs were mildly elevated, meiotic sex chromosome inactivation appeared to have occurred normally in both Drosha and Dicer cKO cells. Our data demonstrate that gene regulation mediated by small RNAs is required for the normal development of male germ cells and male fertility.
Overall, we demonstrated that both protein-coding genes and small RNAs play roles in regulation of male germ cell development. Investigations using mouse models help us gain deeper understanding of the fundamentals of reproductive biology, which will ultimately benefit the human health.
v
Acknowledgements
I would like to thank my dissertation advisor Dr. Wei Yan for accepting me to his research group and guiding me on my research. His instruction, support and encouragement make this dissertation possible. Sincere appreciation goes to my committee members Dr. Seungil Ro, Dr. Grant W. Hennig, Dr. Sean M. Ward and Dr.
Claus Tittiger for their directions on my graduate progression and critical review of my qualifier proposal and this dissertation. I thank the previous and current members of Yan lab for their generous help and contributions to the project.
I want to thank my friends in Reno for traveling with us, tasting gourmet food with us and having fun time with us. Special thanks goes to Shouhua Wang's family for their help and care.
I would like to thank my parents Mr. Zhangxin Wu and Mrs. Xueqin Wu who were always supporting me and encouraging me with their best wishes. Finally I would like to thank my husband, Rui Song. He was always there supporting me and stood by me through good times and bad.
vi
Table of Contents
Abstract………………………………………………………………………………….....i
Acknowledgements………………………………………………………………………..v
Table of Contents…………………………………………………………………………vi
List of Tables……………………………………………………………………………..ix
List of Figures…………………………………………………………………………...... x
List of Abbreviations……………………………………………………………………xiii
Chapter 1: Introduction………………………………………………………………...….1
Human infertility and mouse spermatogenesis……………………………………1
Knockout strategies………………………………………………………………..3
Spermatogenesis studied by knockout mice: protein-coding genes………………5
Spermatogenesis studied by knockout mice: small non-coding RNAs…………...8
Translation to clinical practice and directions for the future……………………...9
Chapter 2: Lack of Klhl10, a spermatid-specific gene, causes male infertility………….20
Abstract…………………………………………………………………………..20
Keywords……………………………………………………………………...…21
Introduction………………………………………………………………………22
Materials and Methods………………………...………………………………....25
Results………...... ………………………………...…………….……….28
Disccusion………...... …………………………………………………...33
References………...... …………………………………………………...45
Chanpter 3: KLHL10 targets SPATA3 for ubiquitination by a CUL3-based E3 ligase during mouse spermiogenesis………...... ………………………………...... 48
vii
Abstract……...... ………………………………………………………...48
Keywords………...... ……………………………………………………49
Introduction………...... ……………………………………………….....50
Materials and Methods………...... …………………………………………….53
Results………...... ……………………………………………………….57
Discussion………...... …………………………………………………...61
References………...... …………………………………………………...68
Chapter 4: Genetic interaction of Hils1 with Tnp1 is essential for late spermiogenesis...70
Abstract………...... ……………………………………………………...70
Keywords………...... ……………………………………………………71
Introduction………...... ………………………………………………….72
Materials and Methods………...... ………………………………………75
Results………...... …………………………………………………...…. 82
Discussion………...... ………………………………………...…………90
References...……...... ………………………………………………..…106
Chapter 5: DROSHA is essential for microRNA production and spermatogenesis...... 110
Abstract………...... ……………….……………………………………110
Keywords………...... …………………………………………………..111
Introduction………...... ………………………………………………...112
Materials and Methods………...... ……………………………..………116
Results……...... …………………………………………………...……121
Discussion………...... ………………………………………………….132
References………...... ……………………………………………….…155
viii
Chapter 6: Summary………...... …………………………………………...... 161
References………...... ………………………………………………….163
ix
List of Tables
1-1. The genes found to be involved in spermatogenesis by knockout………………….13
1-2. Mutations altering small RNA pathways…………………...... 14
2-1. Proteins identified with altered expression levels in the P26 testes of Klhl10+/- and
Klhl10-/-………………….………………….………………….…………………...... 42
4-1. Testis weights and sperm counts of Hils1-Tnp1 mutant males…………………....100
4-2. Abnormal developmental capability of epididymal spermatozoa from Hils1-/-Tnp1-/- mice assessed by Intracytoplasmic Sperm Injection (ICSI) …………………...... 101
6-1. Summary of genes involved in spermatogenesis in our study…………………...... 163
x
List of Figures
1-1. Spermatogenesis…………………………………………………...………………..11
1-2. Strategies for the generation of universal (A) and conditional (B) knockout mice…12
2-1. The transgenic strategy used to generate Klhl10 knockout (KO) mice and genotyping analysis of mutant mice………………………………………………………………….35
2-2. Disrupted spermatogenesis in Klhl10 KO testis…………………………………….36
2-3. Onset of spermiogenesis disruption in Klhl10 mutant testis………………………..38
2-4. Identification of proteins affected by the absence of KLHL10…………………….39
2-5. Immunostaining of COX IV in mouse testicular spermatids……………………….41
2-S1. 2D gel using P26 testes from Klhl10+/- and Klhl10-/- mice...... 44
3-1. KLHL10 interacts with CUL3 through BTB domain……………..……………..…63
3-2. KLHL10 interacts with SPATA3 and SPATA6 through Kelch domain……………64
3-3. The effect of KLHL10 on the ubiquitination of SPATA3 (A) and SPATA6 (B)…..65
3-4. Expression analyses of Spata3 in mouse testis………………………………...... 66
3-5. Expression analyses of Spata6 in mouse testis……………………………………...67
4-1. Normal spermatogenesis in Hils1-/-, Tnp1-/- and Hils1-/-Tnp1-/- testes………...... 93
4-2. Examination of tail abnormalities of cauda epididymal sperm from Hils1-Tnp1 mutant mice using eosin-nigrosin staining……………………………………...... 94
4-3. Chromatin condensation defects of Hils1-Tnp1 mutant spermatids visualized by electron microscopy……………………………………………...... 95
4-4. Acid-urea gel of basic nuclear proteins of epididymal sperm from WT, Hils1-/-, Tnp1-
/-, Hils1+/-Tnp1-/- and Hils1-/-Tnp1-/- mice……………………………………………...... 96
4-5. Acridine Orange (AO) staining of sperm nuclei collected from cauda epididymis...97
xi
4-6. Normal distribution of H3K4me2 and H3K27me3 on gene promoters in Hils1-/-Tnp1-
/- sperm (B) compared to WT (A) ……………………………………………...... 98
4-7. Transcript profile of genes in WT oocyte, WT 2PN, KO (Hils1-/-Tnp1-/-) 2PN, WT 2- cell and KO 2-cell after ICSI……………………………………………...... 99
4-S1. Western blot analyses of TP1, HILS1, TP2, PRM2, and SPEM1 expression in WT,
Hils1-/-, Tnp1-/-, Hils1+/-Tnp1-/- and Hils1-/-Tnp1-/- mouse testes………………………..102
4-S2. HILS1 did not physically interact with TP1…………………………………...... 103
4-S3. Western blot analyses of histone retention in WT and Hils1-/-Tnp1-/- sperm…….104
4-S4. Detection of histone Kcr (lysine crotonylation) in WT, Tnp1-/-, and Hils1-/-Tnp1-/- adult mouse testes by immunofluorescence…………………………………………….105
5-1. Germ cell-specific ablation of Drosha or Dicer in postnatal testes…………...... 139
5-2. Expression of Drosha or Dicer mRNAs, male germ cell miRNAs and endo-siRNAs, as well as 18S, 28S and 45S ribosomal RNAs in pachytene spermatocytes and round spermatids purified from control (Stra8-iCre-Rosa26mTmG+/tg), Drosha cKO (Stra8- iCre-Droshalox/lox-Rosa26mTmG+/tg) and Dicer cKO (Stra8-iCre-Dicerlox/lox-
Rosa26mTmG+/tg) testes. ……………………………………………...... 140
5-3. Inactivation of Drosha or Dicer in spermatogenic cells disrupts spermatogenesis.142
5-4. Onset of germ cell depletion during testicular development in Drosha or Dicer cKO mice……………………………………………...... 144
5-5. Altered mRNA transcriptomes in Drosha- or Dicer-null pachytene spermatocytes and round spermatids……………………………………………...... 145
5-6. qPCR analyses of expression levels of 9 X- and 3 Y-linked mRNA-coding genes in control, Drosha- or Dicer-null pachytene spermatocytes and round spermatids…...... 147
xii
5-7. Evaluation of meiotic sex chromosome inactivation (MSCI) in control (WT),
Drosha- or Dicer-null mid-pachytene and diplotene spermatocytes using double immunofluorescence with anti-γH2AX and HP1β antibodies followed by Cot-1 RNA
FISH……………………………………………...... 148
5-S1. Phase-contrast and fluorescent images of purified pachytene spermatocytes (A) and round spermatids (B) from control, Drosha and Dicer cKO testes...... 150
5-S2. Early stages of spermatogenesis were not affected in Drosha and Dicer cKO testes...... 151
5-S3. Validation of microarray data using SYBR green-based real-time qPCR analyses...... 152
5-S4. RNA FISH analyses on Drosha- or Dicer-null pachytene spermatocytes and spermatogonia (control)...... 153
5-S5. qPCR analyses of levels of three types of transposable elements including IAP,
LINE1 and SINE B2 in control, Drosha- or Dicer-null pachytene spermatocytes (A) and round spermatids (B)...... 154
xiii
List of Abbreviations
Abbreviation Term
2-D/MS Two-dimensional polyacrylamide gel electrophoresis/mass pectrometry
2PN Two-pronuclear zygote
3’UTR Three prime untranslated regions
Acaa2 Acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A
Acadl Acyl-Coenzyme A dehydrogenase, long-chain
Acadm Acyl-Coenzyme A dehydrogenase, medium chain
Actl7a Actin-like 7a
Agfg1 ArfGAP with FG repeats 1
Ahcy S-adenosylhomocysteine hydrolase
Aldh1a2 Aldehyde dehydrogenase family 1, subfamily A2
Aldh1b1 Aldehyde dehydrogenase 1 family, member B1
Aldh2 Aldehyde dehydrogenase 2, mitochondrial
Aldh7a1 Aldehyde dehydrogenase family 7, member A1
Alpl Alkaline phosphatase, liver/bone/kidney
AO Acridine orange
Apaf1 Apoptotic peptidase activating factor 1
Arhgap1 Rho GTPase activating protein 1
Arnt1 Aryl hydrocarbon receptor nuclear translocator
ART Assisted reproductive technologies
Atm Ataxia telangiectasia mutated homolog (human)
Atp5j ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F
BACK BTB and C-terminal Kelch
xiv
Bcl2 B cell leukemia/lymphoma 2
Bmp15 Bone morphogenetic protein 15
Bmp4 Bone morphogenetic protein 4
Bmp8b Bone morphogenetic protein 8b
Brdt Bromodomain, testis-specific
BSA Bovine serum albumin
BTB Brica-brac, Tramtrack, and Broad-Complex c-mos Moloney sarcoma oncogene
Cacybp Calcyclin binding protein
Catsper Cation channel, sperm associated
Ccna1 Cyclin A1
Ccnb1 Cyclin B1
Cct2 Chaperonin containing Tcp1, subunit 2 (beta)
Cdh1 Cadherin 1
ChIP Chromatin immunoprecipitation cKO Conditional knock out
Clic1 Chloride intracellular channel 1
Clock Circadian locomotor output cycles kaput
COX IV Cytochrome c oxidase subunit IV
Cpeb1 Cytoplasmic polyadenylation element binding protein 1
Cul3 Cullin 3
Dazl Deleted in azoospermia-like dBruce Drosophila baculoviral IAP repeat-containing 6
Dgcr8 DiGeorge syndrome critical region gene 8
Dmc1h DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous
xv
recombination (yeast)
Dnmt1 DNA methyltransferase (cytosine-5) 1
Dpp3 Dipeptidylpeptidase 3
Dppa2 Developmental pluripotency associated 2
Dppa5a Developmental pluripotency associated 5A
DSB Double-stranded break dsRNA Double-stranded RNA
DUB Deubiquitylating enzyme
Dync1li2 Dynein, cytoplasmic 1 light intermediate chain 2
ECS Elongin B/C-Cul2/5-SOCS-box protein
Eef1a1 Eukaryotic translation elongation factor 1 alpha 1
Eif4h Eukaryotic translation initiation factor 4H endo-siRNA Endogenous-small-interfering RNA
Erp29 Endoplasmic reticulum protein 29
ES cells Embryonic stem cells
Etfa Electron transferring flavoprotein, alpha polypeptide
Etfb Electron transferring flavoprotein, beta polypeptide
Evx1 Even skipped homeotic gene 1 homolog
Fdxr Ferredoxin reductase
FL Full length
FLP Flippase
Foxd3 Forkhead box D3
FRT Flp recombinase recognition target
Gapdh Glyceraldehyde-3-phosphate dehydrogenase
Gatm Glycine amidinotransferase (L-arginine: glycine amidinotransferase)
xvi
Gdf9 Growth differentiation factor 9
Gnb2l1 Guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1
Gopc Golgi associated PDZ and coiled-coil motif containing
H1foo H1 histone family, member O, oocyte-specific
H1t Histone cluster 1
H1t2 H1 histone family, member N, testis-specific
H2afx H2A histone family, member X
H3K27me3 Histone 3 lysine 27 trimethylation
H3K4me2 Histone 3 lysine 4 dimethylation
H3K4me3 Histone 3 lysine 4 trimethylation
H3K9me3 Histone 3 lysine 9 trimethylation
Hadh Hydroxyacyl-Coenzyme A dehydrogenase
Havcr1 Hepatitis A virus cellular receptor 1
HECT Homologous to E6-AP C-Terminus
HEK293T Human embryonic kidney 293T cells
Hils1 Histone H1-like protein in spermatids 1
Hist1h2ba Histone cluster 1, H2ba
Hist2h2ab Histone cluster 2, H2ab
Hmgcs2 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
Hnrnpa2b1 Heterogeneous nuclear ribonucleoprotein A2/B1
Hoxa4 Homeobox A4
Hoxa9 Homeobox A9
HP1b Heterochromatin protein 1-beta
HPC High percentage chimeric
Hr6b Ubiquitin-conjugating enzyme E2B, RAD6 homology (S. cerevisiae)
xvii
HRP Horseradish peroxidase
HTF Human tubal fluid media i-AAA Intermembrane ATPase associated with various cellular activities
IAP Intracisternal A-particle
ICSI Intracytoplasmic sperm injection
IgG HC Immunoglobulin heavy chain
IgG LC Immunoglobulin light chain
Ilf2 Interleukin enhancer binding factor 2
IP Immunoprecipitation
IVF In vitro fertilization
Jsd Juvenile spermatogonial depletion
Kcr Lysine crotonylation
Kdm5a Lysine (K)-specific demethylase 5A
KLHL10 Kelch-like 10 (Drosophila)
KO Knockout
LASU1 HECT, UBA and WWE domain containing 1
Ldha Lactate dehydrogenase A
LINE1 Long interspersed transposable element 1 loxP Locus of crossover (x) in P1 m-AAA Matrix ATPase associated with various cellular activities
Magea5 Melanoma antigen, family A, 5
Map2k2 Mitogen-activated protein kinase kinase 2
MATH Meprin and TRAF homology
Mcl1 Myeloid cell leukemia sequence 1
Mdh2 Malate dehydrogenase 2, NAD (mitochondrial)
xviii
Memo1 Mediator of cell motility 1
MILI Piwi-like homolog 2 (Drosophila) miRNA MicroRNA
MIWI Piwi-like homolog 1 (Drosophila)
MIWI2 Piwi-like homolog 4 (Drosophila)
Mlh1 MutL homolog 1 (E. coli) mRNA Messenger RNA
Msh4 MutS homolog 4 (E. coli)
Msh5 MutS homolog 5 (E. coli)
Mst77F Male-specific transcript 77F
Mvh DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Myc Myelocytomatosis oncogene
MZT Maternal to zygotic transition
Nanog Nanog homeobox
Ndufs1 NADH dehydrogenase (ubiquinone) Fe-S protein 1
Neo Neomycin resistance gene
Nfs1 Nitrogen fixation gene 1 (S. cerevisiae)
Nlrp5 NLR family, pyrin domain containing 5
Nme7 Non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)
Nt5dc1 5'-nucleotidase domain containing 1
Nxf2 Nuclear RNA export factor 2
OCT Optimal cutting temperature
Ott Ovary testis transcribed
Paics Phosphoribosylaminoimidazole carboxylase,
phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase
xix
PAS Periodic Acid-Schiff staining
PBS Phosphate buffered saline
PGC Primordial germ cell
PCR Polymerase chain reaction
Pdha1 Pyruvate dehydrogenase E1 alpha 1
Pdhx Pyruvate dehydrogenase complex, component X
Pgk1 Phosphoglycerate kinase 1
Pgk2 Phosphoglycerate kinase 2
Pgls 6-phosphogluconolactonase piRNA Piwi-interacting RNA
PIWI P-element induced wimpy testis
Plat Plasminogen activator, tissue
Pmpca Peptidase (mitochondrial processing) alpha
Pold3 Polymerase (DNA-directed), delta 3, accessory subunit
Pou5f1 POU domain, class 5, transcription factor 1
Pramel3 Preferentially expressed antigen in melanoma-like 3
Prdm1 PR domain containing 1, with ZNF domain
Pre-miRNA Precursor microRNA
Pri-miRNA Primary microRNA
Prm1 Protamine 1
Prm2 Protamine 2
Psma3 Proteasome (prosome, macropain) subunit, alpha type 3
Psma7 Proteasome (prosome, macropain) subunit, alpha type 7
Psmc3 Proteasome (prosome, macropain) 26S subunit, ATPase 3
Psmc5 Protease (prosome, macropain) 26S subunit, ATPase 5
xx
Pspc1 Paraspeckle protein 1
Ptgr1 Prostaglandin reductase 1
Qdpr Quinoid dihydropteridine reductase
Rbmy1a1 RNA binding motif protein, Y chromosome, family 1, member A1
RING Really Interesting New Gene
RISC RNA-induced silencing complex
RNA FISH RNA fluorescence in situ hybridization
Rnf Tripartite motif-containing 31
Rps3 Ribosomal protein S3 rRNA Ribosomal RNA
Sall4 Sal-like 4 (Drosophila)
SCF Skp, Cullin, F-box containing complex
SCO Sertoli-cell-only syndrome
SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis
Serpinb6a Serine (or cysteine) peptidase inhibitor, clade B, member 6a
Sfrs6 Serine/arginine-rich splicing factor 6
SINE B2 Short interspersed transposable element B2 sncRNA Small noncoding RNA
Spata3 Spermatogenesis associated 3
Spata6 Spermatogenesis associated 6
Spem1 Sperm maturation 1
Spo11 Sporulation protein, meiosis-specific, SPO11 homolog (S. cerevisiae)
Spp1 Secreted phosphoprotein 1
Srsf6 Serine/arginine-rich splicing factor 6
SSC Spermatogonial stem cell
xxi
Stra8 Stimulated by retinoic acid gene 8
Sucla2 Succinate-Coenzyme A ligase, ADP-forming, beta subunit
Sycp3 Synaptonemal complex protein 3
T Brachyury
Taf7l TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated
factor
Tbx3 T-box 3
Tead2 TEA domain family member 2
Tekt2 Tektin 2
Tekt4 Tektin 4
Tex11 Testis expressed gene 11
Tex16 Testis expressed gene 16
Tg Transgene
Tktl1 Transketolase-like 1
Tnp1 Transition protein 1
Tnp2 Transition protein 2
Trnt1 tRNA nucleotidyl transferase, CCA-adding, 1
TUNEL Terminal deoxynucleotidyl transferase dUTP nick end labeling
Ube1y Ubiquitin-activating enzyme E1, Chr Y 1
UPS Ubiquitin-proteasome system
Uqcrc2 Ubiquinol cytochrome c reductase core protein 2
Usp26 Ubiquitin specific peptidase 26
Usp9y Ubiquitin specific peptidase 9, Y chromosome
Uty Ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome
Vdac2 Voltage-dependent anion channel 2
xxii
WT Wild type
Ybx1 Y box protein 1
Ybx2 Y box protein 2
Yrdc YrdC domain containing (E.coli)
Zar1 Zygote arrest 1
Zic3 Zinc finger protein of the cerebellum 3
Zmpste24 Zinc metallopeptidase, STE24 homolog (S. cerevisiae)
Zn-finger Zinc finger
Zp1 Zona pellucida glycoprotein 1
Zp2 Zona pellucida glycoprotein 2
Zp3 Zona pellucida glycoprotein 3
Zrsr1 Zinc finger (CCCH type), RNA binding motif and serine/arginine rich 1
1
Chapter 1
Introduction
Qiuxia Wu, Wei Yan*
Department of Physiology and Cell Biology, University of Nevada, Reno, NV 89557
*Corresponding Author
1. Human infertility and mouse spermatogenesis
Human infertility affects 10-15% of couples worldwide, with approximately equal contributions from both partners [1]. Despite the advances in clinical diagnostics, many infertile couples continue to be labeled with idiopathic infertility. At present, in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI) are two commonly used procedures in assisted reproductive technologies (ART). IVF requires a minimum of 0.5 million [2] to one million [3] progressive motile spermatozoa in the native semen sample and the complete fertilization failure rate is as high as 50% after IVF [4,5]. IVF has been relatively ineffective in couples who are infertile due to defects in the male’s sperm. The advent of ICSI, a more robust insemination technique, which uses “defective” gametes to achieve fertilization has resulted in higher rates of pregnancy for infertile couples [6].
Both immotile ejaculated spermatozoa and surgically retrieved testicular or epididymal sperm can be used in ICSI [7,8]. Although ART has given infertile couples the opportunities to experience parenthood, the technologies actually circumvent rather than treat infertility and most importantly they bypass the natural barriers that prevent the transmission of genetic defects associated with infertility problem. A deeper understanding of the biology of gametogenesis and translation of knowledge to the clinic
2 would be required for developing true therapies for infertility. Spermatogenesis is a complex process through which germ cells undergo mitosis, meiosis and structural remodeling into the mature spermatozoa. The normal spermatogenesis depends on cellular interactions between germ cells and somatic cells (Sertoili, Leydig and peritubular) and hormonal support from the pituitary gland. Given the complexity of spermatogenesis, in vitro models are considered arduous to achieve, and therefore alternative models need to be constructed. Because mouse spermatogenesis is comparable with human spermatogenesis and it is well defined in developmental and histological terms, mouse models provide us with an attractive alternative.
Testes are composed of numerous thin, tightly coiled tubules called seminiferous tubules. Seminiferous tubules are highly organized structures, which contain germ cells at all maturation stages, with the most mature cells lying closest to the central lumen
(Figure 1). Within the walls of seminiferous tubules are many randomly scattered sertoli cells, which function to support and nourish the immature germ cells (Figure 1). In the adult male mammal, spermatogenesis is divided into three phases: spermatogonial division, meiosis and spermiogenesis. Spermatogonia are heterogeneous cells that are classified into two types-spermatogonial stem cells (SSC) and differentiated spermatogonia [9]. While SSC can colonize a recipient testis after germ cell transplantation, differentiated spermatogonia are unable to colonize the testis [10].
Differentiated spermatogonia undergo proliferation through mitotic division before entering the prolonged meiotic prophase as pre-leptotene spermatocytes. The primary spermatocytes undergo homologous recombination and two successive meiotic divisions to form haploid spermatids. Thereafter, the spermatids undergo spermiogenesis. During
3 spermiogenesis the nucleus of spermatids is profoundly remodeled and compacted, resulting in 20-fold reduction of nucleus space compared to that of somatic cells. The excess cytoplasm of spermatid is removed and tail is assembled to form mature spermatozoa. Ultimately, the mature spermatozoa are released from the sertoli cells into the lumen of the seminiferous tubules, which is termed as spermiation.
2. Knockout strategies
Animal models have been invaluable in reproductive biology and mice have become an important model because of the physiological, anatomical and genomic similarities with humans. Mouse models combined with genetic technologies allow the function of genes involved in sprmatogenesis to be deciphered. Gene knockout strategy has proved to be a powerful tool to study reproduction in vivo. The utilization of homologous recombination to generate targeted mutations in the mouse genome and application of targeted mutagenesis in embryonic stem (ES) cells make it possible to engineer the mouse genome precisely. Targeting vectors are usually designed to contain engineered sequences and selectable markers flanked by homologous sequences [11,12]
(Figure 2A). For example, the gene of interest in Figure 2A will be disrupted by a positive selectable marker and the most commonly used marker is the neomycin resistance (neo) gene (Figure 2A). The targeting vector is then electroporated into ES cells and homologous recombination will incorporate the engineered sequence into the chromosome to replace the original gene. The clones with the correct targeting will be selected by positive selectable marker and verified by PCR or Southern blot analysis
[13,14]. Targeted ES cells are then injected into blastocysts to generate chimeras [15].
4
The offspring are screened for germline transmission of the modified allele, and the F1 heterozygous mice are then intercrossed to produce homozygous mice for further study
(Figure 2A).
Universal knockout of many genes which are essential for both vital process and spermatogenesis may lead to embryonic or early postnatal lethality, which will hinder the study of gene function in adult mice. Therefore, a refined conditional knockout technology (Cre-loxP and Flp-FRT) was developed to induce null mutations in a specific cell population or a specific developmental stage in vivo [16,17] (Figure 2B). The site- specific recombinases (Cre and Flp) are derived from lower organisms, however, they are active in most mammalian cells. They are able to recombine specific sequences of DNA with high fidelity without the aid of cofactors. The recognition site of Cre and Flp is a 34- bp consensus sequence containing two 13-bp inverted repeats flanking an 8-bp non- palindromic core that defines the polarity of the overall sequences, termed loxP [locus of crossover (x) in P1] and FRT (Flp recombinase recognition target) [18,19]. Two mouse lines are required for site-specific recombination. One mouse line expresses the recombinase in a specific tissue or at a specific stage and the other one expresses the conditional allele, a gene fragment flanked by two recognition sites (loxP or FRT)
(Figure 2B). The two mouse lines are intercrossed to generate double transgenic offsprings. Cells expressing recombinase will delete the conditional allele, and in cells not expressing recombinase, the targeted gene will remain intact and functional (Figure
2B). To better control the conditional gene knockout, more efficient Cre (e.g. iCre with optimized mammalian codons) and Flp (e.g. Flpe, a Flp recombinase with improved thermolability) have been developed [20,21]. Generating more tissue-specific Cre or Flp
5 mouse lines with these improved recombinases will have a profound impact on the study of reproduction through the application of this strategy.
3. Spermatogenesis studied using knockout mice: protein-coding genes
Because spermatogenesis in mammals continues through adult life, it requires a continuous supply of differentiating spermatogonia. Mouse mutants with affected spermatogonial development have been generated. For example, Jsd (juvenile spermatogonial depletion) knockout mice can only finish a single wave of spermatogenesis, followed by failure of all type A spermatogonia differentiation [22]
(Table 1). The knockout testes are devoid of all germ cells and resemble the testes of men diagnosed with Sertoli-cell-only syndrome (SCO). Using knockout mouse models, people also identified that Dazl (deleted in azoospermia-like) is essential for the survival of spermatogonia [23,24], the transforming growth factor Bmp8b (bone morphogenetic protein 8b) [25] can regulate germ cell proliferation and initiation of spermatogenesis and inactivation of Apaf1 (apoptotic protease-activating factor 1 gene) induces degeneration of spermatogonia [26] (Table 1).
Primary spermatocytes are very sensitive to genetic manipulation and the disruption of genes that are involved in recombination often leads to meiotic arrest. In humans, meiotic arrest has been a frequent cause of male infertility. Genes that encode components of the meiotic chromosomal machinery (e.g. synaptonemal complex proteins and proteins involved in DNA repair) have been shown essential for meiosis and male fertility in mice [27]. The study of mouse mutants such as Spo11 (sporulation protein meiosis-specific SPO11 homologue) and Dmc1h (disrupted meiotic cDNA 1 homologue)
6 helped us to reveal the temporal order of events during germ cell meiosis (Table 1).
Spo11 encodes a specialized topoisomerase that is responsible for double-stranded break
(DSB) formation [23,24]. Deletion of Spo11 in mouse leads to a sexually dimorphic phenotype-male germ cells are depleted through apoptosis during zygotene stage. [28,29].
Dmc1h encodes a RecA-like enzyme that is involved in strand exchange. The knockout of Dmc1h in mice produces a similar phenotype seen in Spo11 mutant. In both Dmc1h and Sycp3 (synaptonemal complex protein 3) mutants, but not in Spo11 mutants, DNA breakage happens which affects the downstream recombination event [30,31] (Table 1).
In addition to these genes, many other genes also have been shown to be required for meiotic prophase. For example, null mutant mice were found with arrest at the leptotene stage for Atm (ataxia telangiectasia mutated homolog) [32], at the zygotene stage for
Msh4 (mutS homolog 4) [33], Msh5 (mutS homolog 5) [34], and Mvh (mouse Vasa homologue) [35], at the pachytene stage for H2afx (H2A histone family, member X) and
Mlh1 (mutL homolog 1c) [36,37], and at the diplotene stage for Ccna1 (cyclinA1) [38]
(Table 1).
After the completion of mitosis and meiosis, germ cells enter spermiogenesis during which haploid spermatids are remodeled, cytoplasm is eliminated and DNA is compacted. Genes expressed at the post-meiotic stage have been identified and some of them have been proven to be crucial for spermiogenesis by gene knockout studies. To facilitate the compaction and condensation of sperm chromatin during spermiogenesis, somatic histones are replaced sequentially by transition nuclear proteins (Tnp1 and Tnp2)
[39,40] and then highly basic protamines (Prm1 and Prm2) [41]. Inactivation of one allele of either Prm1 or Prm2 results in haploinsufficiency [42] (Table 1). The decrease
7 in the amount of either protamine can disrupt nuclear formation, PRM2 processing and normal sperm function[42] (Table 1). The levels of protamine are disturbed in spermatozoa taken from infertile men [43,44]. Targeted disruption of either Tnp1 or Tnp2 leads to a subfertile phenotype, and the mutant sperm nuclei are less condensed [45,46]
(Table 1). In addition they have revealed a previously unanticipated role of Tnp1 in the repair of DNA-strand breaks [47]. During spermatogenesis, accompanied with the replacement of somatic histones, testis-specific linker histones (H1t, H1t2, and Hils1) are also replaced with transition nuclear proteins and protamines. H1t is predominately expressed in pachytene stage, however, the deletion of H1t does not cause any abnormalities in spermatogenesis [48]. During the elongation of round spermatid, it was shown that H1T2 appears and gradually replaces H1T, and deletion of H1t2 leads to severely reduced fertility in males [49]. In step 9, a third testis-specific H1 subtype, Hils1
(histone H1-like protein in spermatids 1) expression is initiated [50]. Its lack of overlap with core histones suggests that Hils1 might have functions in sperm nuclear condensation through a mechanism distinct from that of other linker histones [50]. It is interesting to notice that like Prm1 and Prm2, both alleles of Klhl10 (kelch homolog 10), a gene exclusively expressed in the cytoplasm of late spermaitds, are required for male fertility. The haploinsufficiency caused by a mutation in one allele of Klhl10 prevents genetic transmission of both mutant and wild-type alleles [51] (Table 1). Gene knockout studies have identified the essential roles of numerous other genes in spermiogenesis [52].
For example, Gopc (golgi associated PDZ and coiled-coil motif containing) and Agfg1
(ArfGAP with FG repeats 1) have been proven to be crucial for acrosome formation
[53,54], Tekt2 and 4 (tektin 2 and 4) have been found to be required for normal flagella
8 structure and function [55,56], Catsper family genes (cation channel, sperm associated 1 to 4) are essential for sperm capacitation [57-60], and Spem1 (sperm maturation 1) plays a critical role in cytoplasm removal [61] (Table 1).
4. Spermatogenesis studied using knockout mice: small non-coding RNAs
Spermatogenesis is controlled not only by the protein-coding genes in the genome, but also by the non-coding regions that produce small non-coding RNAs. microRNAs
(miRNAs) are ~22-nt small RNAs which are produced from short hairpin precursors by the cleavages of two RNase III enzymes, DROSHA in the nucleus and DICER in the cytoplasm. Mature miRNAs bind to mRNAs by base-pairing their 3’UTR resulting in mRNA degradation or translational repression [62]. Consistent with the ubiquitous nature of DICER and its miRNA end products, the absence of Dicer results in embryonic lethality [63] (Table 2). Therefore, conditional knockout of Dicer in male germ cells is required for the functional study of miRNAs in spermatogenesis. A primordial germ cell
(PCG)-specific Cre (Alpl-Cre) inactivates Dicer in early male germ cells and mutants show defective PGC proliferation and spermatogenic arrest caused by impaired proliferation and/or differentiation of spermatogonia, which eventually results in male infertility in the adult [64] (Table 2). Because Dicer deletion in this study begins early at the embryonic stage, it is difficult to understand exactly how and when spermatogenesis is affected by miRNAs in the adult. To address this question, postnatal male germ cell specific deletion of Dicer would be required.
Piwi-interacting RNAs (piRNAs) are ~27-nt small RNAs which are generated from long single-stranded RNA precursors. piRNAs are bound by PIWI proteins (MIWI2,
9
MILI, and MIWI) and together they function in the repression of transposons [65-70]. In mammals, piRNAs are believed to be exclusively expressed in male germ cells, which highlights their unique function in spermatogenesis. The absence of the male germline- specific PIWI proteins results in spermatogenic arrest, which is accompanied with the increased levels of active transposons [66,69,71] (Table 2).
Until recently, endogenous siRNAs (endo-siRNAs) have been identified in mouse oocytes, embryonic stem cells, and spermatogenic cells [72-75]. Despite their similarities with miRNAs in terms of their size (~21-nt), endo-siRNAs can be distinguished from miRNAs in that endo-siRNAs are produced from long double-stranded RNAs, and the biogenesis of endo-siRNA is DICER-dependent but DROSHA-independent [76,77]. Loss of Dicer in mouse oocytes results in decreased levels of endo-siRNAs and increased levels of retrotransposons and mRNAs that are complementary to the endo-siRNAs [73]
(Table 2). The function of endo-siRNAs in spermatogenesis is not well addressed yet.
Considering DICER is involved in both miRNA and endo-siRNA pathways in male germ cells, the future functional dissection of miRNA or endo-siRNA in spermatogenesis would benefit from the combined study of both Drosha and Dicer conditional knockout.
5. Translation to clinical practice and directions for the future
Although findings in knockout mouse models can enlighten our understanding of fundamental knowledge in mammalian spermatogenesis, the translation of these findings to clinical practice and the providing of potential targets for therapeutics are the ultimate goals. One example of the translational research is the study of Klhl10 in infertile human patients. As described above, heterozygous mice of Klhl10 have defects in spermatozoa
10 maturation, resulting in oligozoospermia [51]. The examination of human ejaculate samples of oligozoospermic and normozoospermic infertile men identified missense and/or splicing mutations in KLHL10 in 7/550 (1.2%) of the patients, indicating human
KLHL10 has a dominant effect on human spermatogenesis [78]. Another noteworthy example is the study of Catsper family genes. As mentioned above, targeted deletion of any of four Catsper genes in mouse leads to male infertility [57-60]. Study in human samples showed that CATSPER protein levels are reduced in immotile or less motile sperm [79,80].
In addition to clinical diagnoses, human male contraception is another potential use. Fertile couples have expressed the desire for safe, effective and reversible male contraceptive pills. Therefore, the discoveries of genes crucial for spermatogenesis would be important not only for the dissection of spermatogenesis but also as potential targets for production of male contraception [81].
Current understanding of the genes and mechanisms that direct male reproduction is fundamental for clinical diagnoses and effective therapy. More genetic studies of male infertility are needed for future progress. Ultimately, the research findings from both mouse models and human samples should be translated into clinical practice.
11
Figure 1. Spermatogenesis. Spermatogenesis begins with the division of spermatogonia, which produces spermatogonial stem cells (SSC) and differentiated spermatogonia.
Differentiated spermatogonia undergo mitosis to become primary spermatocytes. Primary spermatocytes continue through meiotic I to mature as secondary spermatocytes. After the completion of meiotic II, secondary spermatocytes generate haploid spermatids, which differentiate into spermatozoa. [modified from bio1100.nicerweb.com].
12
Figure 2. Strategies for the generation of universal (A) and conditional (B) knockout mice. [modified from www.cellmigration.org]. (A) Targeting vectors are engineered to replace an important coding sequence of a gene with a neomycin (Neo) cassette. After electroporation into embryonic stem (ES) cells, the orignial sequence of gene will be replaced by engineered vector fragment by homologous recombination to generate knockout allele.
The correct targeting ES cell clones are identified by Southern Blot and microinjected into blastocysts to generate chimeras. Chimeras mates with WT mice to produce heterozygous knockout mice and homozygous knockout mice can be generated by intercrossing the heterozygous knockout mice. (B) Targeting vectors are engineered to contain two loxP sites flanking an essential part of a gene. ES cell targeting, microinjection and homozygous conditional mice generation are conducted as described in (A). Cre mouse line is crossed with conditional mice line to generate double transgenic offsprings. DNA sequence between loxP sites will be removed in cells expressing Cre to generate knockout allele.
13
Table 1. The genes found to be involved in spermatogenesis by the knockout studies
Knockout Gene Phenotype Spermatogonial Jsd A single wave of spermatogenesis, followed by failure of Division spermatogonial stem cells to differentiate; Infertile Dazl Block at spermatogonial differentiation; Infertile Bmp8b Reduced proliferation and delayed differentiation of spermatogonia; Apoptosis of spermatocytes; Infertile Apaf1 Degeneration of spermatogonia resulting in the absence of sperm; Infertile Meiosis Spo11 Function in double-stranded break (DSB) formation; Knockout blocks at Leptotene/Zygotene stages; Infertile Dmc1h Function as DNA recombination protein (RecA-like); Knockout ends at Zygotene stage; Infertile Sycp3 Function in Axial element formation; Knockout arrests at Zygotene stage; Infertile Atm Function as PI3 kinase; Knockout stops at Leptotene stage; Infertile Msh4, Function in mismatch repair; Knockout blocks at Zygotene stage; Msh5 Infertile Mvh Germ cells cease differentiation by the Zygotene stage and undergo apoptosis; Infertile H2afx Function in DSB recognition; Knockout ends at Pachytene stage; Infertile Mlh1 Function in mismatch repair; Knockout stops at post-Pachytene stage; Infertile Ccna1 Function in control of cell cycle; Knockout arrests at Diplotene stage; Infertile Spermiogenesis Tnp1, Tnp2 Less condensed sperm nulei; Subfertile phenotype Prm1, Disrupts nuclear formation; Haploinsufficiency causes infertility in Prm2 mice Klhl10 Dysmorphic spermatozoa and impaired motility; Haploinsufficiency leads infertility in mice Gopc Lack of acrosome formation; Infertile with globozoospermia Agfg1 Blocking acrosome development; Infertile Tekt2 Impaired structure of flagella; Infertile Tekt4 Impaired motility of flagella; Infertile Catsper1-4 Ion channel-mediated signaling required for hyperactivated motility; Infertile Spem1 Coordinated nuclear elongation, tail growth, and cytoplasm removal; Infertile
14
Table 2. Mutations altering small RNA pathways
Knockout Gene Phenotype Dicer Embryonic lethality due to depletion of ES cells Dicer Reduced proliferation of PGCs and (Alpl-Cre, Dicer deletion starts in spermatogonia leading to spermatogenic arrest; PGCs ) Infertile Dicer Decreased levels of endo-siRNAs and increased (Zp3-Cre, Dicer deletion in oocytes ) expression of their targets; Meiosis I defects; Infertile Miwi2 Block at zygotene - pachytene stages; Up- regulated retrotransposons; Infertile Mili Block at zygotene - pachytene stages; Up- regulated retrotransposons; Infertile Miwi Block at spermatid phase; Increased LINE1 is observed in mice with the disruption of MIWI catalytic activity; Infertile
15
References: 1. De Kretser DM, Baker HW (1999) Infertility in men: recent advances and continuing controversies. J Clin Endocrinol Metab 84: 3443-3450. 2. Verheyen G, Tournaye H, Staessen C, De Vos A, Vandervorst M, et al. (1999) Controlled comparison of conventional in-vitro fertilization and intracytoplasmic sperm injection in patients with asthenozoospermia. Hum Reprod 14: 2313-2319. 3. Fisch B, Kaplan-Kraicer R, Amit S, Zukerman Z, Ovadia J, et al. (1990) The relationship between sperm parameters and fertilizing capacity in vitro: a predictive role for swim-up migration. J In Vitro Fert Embryo Transf 7: 38-44. 4. Molloy D, Harrison K, Breen T, Hennessey J (1991) The predictive value of idiopathic failure to fertilize on the first in vitro fertilization attempt. Fertil Steril 56: 285- 289. 5. Coates TE, Check JH, Choe J, Nowroozi K, Lurie D, et al. (1992) An evaluation of couples with failure of fertilization in vitro. Hum Reprod 7: 978-981. 6. Palermo G, Joris H, Devroey P, Van Steirteghem AC (1992) Pregnancies after intracytoplasmic injection of single spermatozoon into an oocyte. Lancet 340: 17- 18. 7. Devroey P, Liu J, Nagy Z, Tournaye H, Silber SJ, et al. (1994) Normal fertilization of human oocytes after testicular sperm extraction and intracytoplasmic sperm injection. Fertil Steril 62: 639-641. 8. Silber SJ, Nagy ZP, Liu J, Godoy H, Devroey P, et al. (1994) Conventional in-vitro fertilization versus intracytoplasmic sperm injection for patients requiring microsurgical sperm aspiration. Hum Reprod 9: 1705-1709. 9. Morimoto H, Kanatsu-Shinohara M, Takashima S, Chuma S, Nakatsuji N, et al. (2009) Phenotypic plasticity of mouse spermatogonial stem cells. PLoS One 4: e7909. 10. de Rooij DG (2001) Proliferation and differentiation of spermatogonial stem cells. Reproduction 121: 347-354. 11. Folger KR, Wong EA, Wahl G, Capecchi MR (1982) Patterns of integration of DNA microinjected into cultured mammalian cells: evidence for homologous recombination between injected plasmid DNA molecules. Mol Cell Biol 2: 1372- 1387. 12. Smithies O, Gregg RG, Boggs SS, Koralewski MA, Kucherlapati RS (1985) Insertion of DNA sequences into the human chromosomal beta-globin locus by homologous recombination. Nature 317: 230-234. 13. Doetschman T, Gregg RG, Maeda N, Hooper ML, Melton DW, et al. (1987) Targetted correction of a mutant HPRT gene in mouse embryonic stem cells. Nature 330: 576-578. 14. Thomas KR, Capecchi MR (1987) Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell 51: 503-512. 15. Kuehn MR, Bradley A, Robertson EJ, Evans MJ (1987) A potential animal model for Lesch-Nyhan syndrome through introduction of HPRT mutations into mice. Nature 326: 295-298. 16. Branda CS, Dymecki SM (2004) Talking about a revolution: The impact of site- specific recombinases on genetic analyses in mice. Dev Cell 6: 7-28.
16
17. Kwan KM (2002) Conditional alleles in mice: practical considerations for tissue- specific knockouts. Genesis 32: 49-62. 18. Hoess RH, Ziese M, Sternberg N (1982) P1 site-specific recombination: nucleotide sequence of the recombining sites. Proc Natl Acad Sci U S A 79: 3398-3402. 19. McLeod M, Craft S, Broach JR (1986) Identification of the crossover site during FLP-mediated recombination in the Saccharomyces cerevisiae plasmid 2 microns circle. Mol Cell Biol 6: 3357-3367. 20. Shimshek DR, Kim J, Hubner MR, Spergel DJ, Buchholz F, et al. (2002) Codon- improved Cre recombinase (iCre) expression in the mouse. Genesis 32: 19-26. 21. Buchholz F, Angrand PO, Stewart AF (1998) Improved properties of FLP recombinase evolved by cycling mutagenesis. Nat Biotechnol 16: 657-662. 22. Boettger-Tong HL, Rohozinski J, Agoulnik AI, Dohmae K, Nishimune Y, et al. (2001) Identification and sequencing the juvenile spermatogonial depletion critical interval on mouse chromosome 1 reveals the presence of eight candidate genes. Biochem Biophys Res Commun 288: 1129-1135. 23. Ruggiu M, Speed R, Taggart M, McKay SJ, Kilanowski F, et al. (1997) The mouse Dazla gene encodes a cytoplasmic protein essential for gametogenesis. Nature 389: 73-77. 24. Schrans-Stassen BH, Saunders PT, Cooke HJ, de Rooij DG (2001) Nature of the spermatogenic arrest in Dazl -/- mice. Biol Reprod 65: 771-776. 25. Zhao GQ, Deng K, Labosky PA, Liaw L, Hogan BL (1996) The gene encoding bone morphogenetic protein 8B is required for the initiation and maintenance of spermatogenesis in the mouse. Genes Dev 10: 1657-1669. 26. Honarpour N, Du C, Richardson JA, Hammer RE, Wang X, et al. (2000) Adult Apaf- 1-deficient mice exhibit male infertility. Dev Biol 218: 248-258. 27. Cohen PE, Pollard JW (2001) Regulation of meiotic recombination and prophase I progression in mammals. Bioessays 23: 996-1009. 28. Romanienko PJ, Camerini-Otero RD (2000) The mouse Spo11 gene is required for meiotic chromosome synapsis. Mol Cell 6: 975-987. 29. Baudat F, Manova K, Yuen JP, Jasin M, Keeney S (2000) Chromosome synapsis defects and sexually dimorphic meiotic progression in mice lacking Spo11. Mol Cell 6: 989-998. 30. Yoshida K, Kondoh G, Matsuda Y, Habu T, Nishimune Y, et al. (1998) The mouse RecA-like gene Dmc1 is required for homologous chromosome synapsis during meiosis. Mol Cell 1: 707-718. 31. Pittman DL, Cobb J, Schimenti KJ, Wilson LA, Cooper DM, et al. (1998) Meiotic prophase arrest with failure of chromosome synapsis in mice deficient for Dmc1, a germline-specific RecA homolog. Mol Cell 1: 697-705. 32. Barlow C, Liyanage M, Moens PB, Tarsounas M, Nagashima K, et al. (1998) Atm deficiency results in severe meiotic disruption as early as leptonema of prophase I. Development 125: 4007-4017. 33. Kneitz B, Cohen PE, Avdievich E, Zhu L, Kane MF, et al. (2000) MutS homolog 4 localization to meiotic chromosomes is required for chromosome pairing during meiosis in male and female mice. Genes Dev 14: 1085-1097.
17
34. Edelmann W, Cohen PE, Kneitz B, Winand N, Lia M, et al. (1999) Mammalian MutS homologue 5 is required for chromosome pairing in meiosis. Nat Genet 21: 123- 127. 35. Tanaka SS, Toyooka Y, Akasu R, Katoh-Fukui Y, Nakahara Y, et al. (2000) The mouse homolog of Drosophila Vasa is required for the development of male germ cells. Genes Dev 14: 841-853. 36. Celeste A, Petersen S, Romanienko PJ, Fernandez-Capetillo O, Chen HT, et al. (2002) Genomic instability in mice lacking histone H2AX. Science 296: 922-927. 37. Edelmann W, Cohen PE, Kane M, Lau K, Morrow B, et al. (1996) Meiotic pachytene arrest in MLH1-deficient mice. Cell 85: 1125-1134. 38. Liu D, Matzuk MM, Sung WK, Guo Q, Wang P, et al. (1998) Cyclin A1 is required for meiosis in the male mouse. Nat Genet 20: 377-380. 39. Heidaran MA, Kistler WS (1987) Isolation of a cDNA clone for transition protein 1 (TP1), a major chromosomal protein of mammalian spermatids. Gene 54: 281-284. 40. Kleene KC, Flynn JF (1987) Characterization of a cDNA clone encoding a basic protein, TP2, involved in chromatin condensation during spermiogenesis in the mouse. J Biol Chem 262: 17272-17277. 41. Mali P, Kaipia A, Kangasniemi M, Toppari J, Sandberg M, et al. (1989) Stage- specific expression of nucleoprotein mRNAs during rat and mouse spermiogenesis. Reprod Fertil Dev 1: 369-382. 42. Cho C, Willis WD, Goulding EH, Jung-Ha H, Choi YC, et al. (2001) Haploinsufficiency of protamine-1 or -2 causes infertility in mice. Nat Genet 28: 82-86. 43. Steger K, Failing K, Klonisch T, Behre HM, Manning M, et al. (2001) Round spermatids from infertile men exhibit decreased protamine-1 and -2 mRNA. Hum Reprod 16: 709-716. 44. Carrell DT, Liu L (2001) Altered protamine 2 expression is uncommon in donors of known fertility, but common among men with poor fertilizing capacity, and may reflect other abnormalities of spermiogenesis. J Androl 22: 604-610. 45. Zhao M, Shirley CR, Yu YE, Mohapatra B, Zhang Y, et al. (2001) Targeted disruption of the transition protein 2 gene affects sperm chromatin structure and reduces fertility in mice. Mol Cell Biol 21: 7243-7255. 46. Yu YE, Zhang Y, Unni E, Shirley CR, Deng JM, et al. (2000) Abnormal spermatogenesis and reduced fertility in transition nuclear protein 1-deficient mice. Proc Natl Acad Sci U S A 97: 4683-4688. 47. Kierszenbaum AL (2001) Transition nuclear proteins during spermiogenesis: unrepaired DNA breaks not allowed. Mol Reprod Dev 58: 357-358. 48. Lin Q, Sirotkin A, Skoultchi AI (2000) Normal spermatogenesis in mice lacking the testis-specific linker histone H1t. Mol Cell Biol 20: 2122-2128. 49. Tanaka H, Iguchi N, Isotani A, Kitamura K, Toyama Y, et al. (2005) HANP1/H1T2, a novel histone H1-like protein involved in nuclear formation and sperm fertility. Mol Cell Biol 25: 7107-7119. 50. Yan W, Ma L, Burns KH, Matzuk MM (2003) HILS1 is a spermatid-specific linker histone H1-like protein implicated in chromatin remodeling during mammalian spermiogenesis. Proc Natl Acad Sci U S A 100: 10546-10551.
18
51. Yan W, Ma L, Burns KH, Matzuk MM (2004) Haploinsufficiency of kelch-like protein homolog 10 causes infertility in male mice. Proc Natl Acad Sci U S A 101: 7793-7798. 52. Yan W (2009) Male infertility caused by spermiogenic defects: lessons from gene knockouts. Mol Cell Endocrinol 306: 24-32. 53. Yao R, Ito C, Natsume Y, Sugitani Y, Yamanaka H, et al. (2002) Lack of acrosome formation in mice lacking a Golgi protein, GOPC. Proc Natl Acad Sci U S A 99: 11211-11216. 54. Kang-Decker N, Mantchev GT, Juneja SC, McNiven MA, van Deursen JM (2001) Lack of acrosome formation in Hrb-deficient mice. Science 294: 1531-1533. 55. Tanaka H, Iguchi N, Toyama Y, Kitamura K, Takahashi T, et al. (2004) Mice deficient in the axonemal protein Tektin-t exhibit male infertility and immotile- cilium syndrome due to impaired inner arm dynein function. Mol Cell Biol 24: 7958-7964. 56. Roy A, Lin YN, Agno JE, DeMayo FJ, Matzuk MM (2007) Absence of tektin 4 causes asthenozoospermia and subfertility in male mice. FASEB J 21: 1013-1025. 57. Carlson AE, Quill TA, Westenbroek RE, Schuh SM, Hille B, et al. (2005) Identical phenotypes of CatSper1 and CatSper2 null sperm. J Biol Chem 280: 32238-32244. 58. Jin J, Jin N, Zheng H, Ro S, Tafolla D, et al. (2007) Catsper3 and Catsper4 are essential for sperm hyperactivated motility and male fertility in the mouse. Biol Reprod 77: 37-44. 59. Qi H, Moran MM, Navarro B, Chong JA, Krapivinsky G, et al. (2007) All four CatSper ion channel proteins are required for male fertility and sperm cell hyperactivated motility. Proc Natl Acad Sci U S A 104: 1219-1223. 60. Quill TA, Sugden SA, Rossi KL, Doolittle LK, Hammer RE, et al. (2003) Hyperactivated sperm motility driven by CatSper2 is required for fertilization. Proc Natl Acad Sci U S A 100: 14869-14874. 61. Zheng H, Stratton CJ, Morozumi K, Jin J, Yanagimachi R, et al. (2007) Lack of Spem1 causes aberrant cytoplasm removal, sperm deformation, and male infertility. Proc Natl Acad Sci U S A 104: 6852-6857. 62. Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 281-297. 63. Bernstein E, Kim SY, Carmell MA, Murchison EP, Alcorn H, et al. (2003) Dicer is essential for mouse development. Nat Genet 35: 215-217. 64. Hayashi K, Chuva de Sousa Lopes SM, Kaneda M, Tang F, Hajkova P, et al. (2008) MicroRNA biogenesis is required for mouse primordial germ cell development and spermatogenesis. PLoS One 3: e1738. 65. Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, et al. (2006) A novel class of small RNAs bind to MILI protein in mouse testes. Nature 442: 203- 207. 66. Carmell MA, Girard A, van de Kant HJ, Bourc'his D, Bestor TH, et al. (2007) MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline. Dev Cell 12: 503-514. 67. Girard A, Sachidanandam R, Hannon GJ, Carmell MA (2006) A germline-specific class of small RNAs binds mammalian Piwi proteins. Nature 442: 199-202.
19
68. Grivna ST, Beyret E, Wang Z, Lin H (2006) A novel class of small RNAs in mouse spermatogenic cells. Genes Dev 20: 1709-1714. 69. Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Totoki Y, Toyoda A, et al. (2008) DNA methylation of retrotransposon genes is regulated by Piwi family members MILI and MIWI2 in murine fetal testes. Genes Dev 22: 908-917. 70. Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, et al. (2006) Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. Genes Dev 20: 1732-1743. 71. Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, et al. (2011) Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. Nature 480: 264-267. 72. Watanabe T, Totoki Y, Toyoda A, Kaneda M, Kuramochi-Miyagawa S, et al. (2008) Endogenous siRNAs from naturally formed dsRNAs regulate transcripts in mouse oocytes. Nature 453: 539-543. 73. Tam OH, Aravin AA, Stein P, Girard A, Murchison EP, et al. (2008) Pseudogene- derived small interfering RNAs regulate gene expression in mouse oocytes. Nature 453: 534-538. 74. Babiarz JE, Ruby JG, Wang Y, Bartel DP, Blelloch R (2008) Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer- dependent small RNAs. Genes Dev 22: 2773-2785. 75. Song R, Hennig GW, Wu Q, Jose C, Zheng H, et al. (2011) Male germ cells express abundant endogenous siRNAs. Proc Natl Acad Sci U S A 108: 13159-13164. 76. Okamura K, Lai EC (2008) Endogenous small interfering RNAs in animals. Nat Rev Mol Cell Biol 9: 673-678. 77. Kim VN, Han J, Siomi MC (2009) Biogenesis of small RNAs in animals. Nat Rev Mol Cell Biol 10: 126-139. 78. Yatsenko AN, Roy A, Chen R, Ma L, Murthy LJ, et al. (2006) Non-invasive genetic diagnosis of male infertility using spermatozoal RNA: KLHL10 mutations in oligozoospermic patients impair homodimerization. Hum Mol Genet 15: 3411- 3419. 79. Li HG, Ding XF, Liao AH, Kong XB, Xiong CL (2007) Expression of CatSper family transcripts in the mouse testis during post-natal development and human ejaculated spermatozoa: relationship to sperm motility. Mol Hum Reprod 13: 299- 306. 80. Nikpoor P, Mowla SJ, Movahedin M, Ziaee SA, Tiraihi T (2004) CatSper gene expression in postnatal development of mouse testis and in subfertile men with deficient sperm motility. Hum Reprod 19: 124-128. 81. Aitken RJ, Baker MA, Doncel GF, Matzuk MM, Mauck CK, et al. (2008) As the world grows: contraception in the 21st century. J Clin Invest 118: 1330-1343.
20
Chapter 2
Lack of Klhl10, a spermatid-specific gene, causes male infertility
Abstract:
Kelch-like 10 (KLHL10) is a spermatid-specific protein and belongs to a large
BTB (Bric-a-brac, Tramtrack, and Broad-Complex) - kelch protein superfamily.
Inactivation of one allele of Klhl10 led to haploinsufficiency, which causes disruption of spermiogenesis and complete male infertility in mice. Haploinsufficiency prevents germline transmission of the mutant allele, thus Klhl10-/- mice cannot be generated. To overcome haploinsufficiency, we engineered a transgene vector containing the entire mouse Klhl10 coding sequence under the control of Hils1 (Histone H1-like protein in spermatids 1) promoter. By targeting this transgene in the mouse genome, we successfully produced Klhl10-/- mice. While Klhl10+/- males had normal fertility, Klhl10-/- males were completely infertile. The testis of Klhl10 knockout mice exhibited severe disruption of spermatogenesis, characterized by depletion of germ cells, degeneration of spermatocytes and elongating spermatids and reduction in the number of elongating/elongated spermatids. Histological examination of Klhl10-/- developing testes and western blotting of spermiogenic marker proteins showed spermatogenesis of Klhl10-
/- testis was arrested in late spermiogenesis at step 9. Therefore postnatal day (P) 26 testes from both Klhl1+/- control and Klhl10-/- mutant, in which the first wave of spermiogenesis reaches step 9, was selected for 2-D/MS analyses to identify proteins affected by the absence of KLHL10. We identified 56 proteins that had altered expression levels in
Klhl10-/- testis compared to the control. Interestingly, 23 of these proteins belonged to
21 mitochondrial proteins, which are involved in mitochondrial metabolic pathways. Most of the mitochondrial proteins identified had increased expression level in Klhl10-/- testis, indicating KLHL10 might be involved in regulating mitochondrial protein turnover during late spermiogenesis.
Keywords: spermatogenesis, spermiogenesis, mitochondria, ubiquitination, infertility.
22
Introduction:
Spermatogenesis is a process occurring in the seminiferous tubules of adult testes, by which spermatogonia develop into mature spermatozoa. Spermatogenesis can be characterized as 3 phases: spermatogonia division, meiosis and spermiogenesis. It starts with the renewal of spermatogonia stem cell and proliferation of differentiated spermatogina through mitosis. The differentiated spermatogonia then develop into primary spermatocytes, which are committed to meiosis. During meiosis, each diploid spermatocyte undergoes two consecutive divisions to form four haploid spermatids. Then during spermiogenesis, round spermatids differentiate and elongate; the elongated spermatids eventually form mature spermatozoa. In mice, spermiogenesis can be divided into 16 distinct steps according to morphological changes of spermatids. Several major events occur during this phase: the Golgi apparatus forms the acrosome; nuclear chromatin undergoes compaction and condensation; the sperm tail is formed and excess cytoplasm of the spermatid is eliminated followed by releasing of spermatids into the lumen. During spermiogenesis, many unique genes are essential for spermatids development. Inactivation of some of these genes has been shown to result in impairment of male fertility. Previous studies identified more than 600 testis-specific protein-coding genes by in silico database mining and microarray-based expression profiling [1-3], among which ~350 genes are found to be specifically expressed in haploid germ cells [4].
Kelch-like 10 (KLHL10) is a haploid germ cell-specific protein and it is exclusively expressed in elongating and elongated spermatids (steps 9-16) [5]. KLHL10 contains 608 amino acids and is highly conserved between human and mouse. It belongs to a BTB (Brica-brac, Tramtrack, and Broad-Complex)-kelch protein superfamily.
23
KLHL10 contains amino terminal (N’)-BTB/POZ domain, middle-BACK domain, and carboxyl terminal (C’)-6 kelch repeats. BTB domain has been reported to be involved in many cellular processes, such as cytoskeleton organization [6,7], transcription regulation
[8,9] and protein ubiquitination [10-13]. Kelch repeats can form a β-propeller and directly interact with actin filaments [13,14] or target protein substrates for ubiquitination
[15-17]. BACK domain is found in most proteins which contain both BTB and kelch domains and it might be involved in substrate orientation in Cullin 3 (CUL3) based E3 ligase [18]. Haploinsufficiency of Klhl10 causes male infertility with disrupted spermatogenesis characterized by asynchronous spermatid maturation, degeneration of late spermatids, and significant reduction in late spermatid population [5].
Although mutations in KLHL10 have been reported to be associated with reduced sperm count in infertile men [19], the molecular function of Klhl10 during spermiogenesis is largely unknown. Unlike many other kelch repeat proteins that can interact with actin and intermediate filaments, KLHL10 is not an actin-interacting protein
[5]. Our previous study showed that the BTB domain of KLHL10 could directly interact with CUL3 [20], indicating KLHL10 might be involved in ubiquitination pathways, because many studies have shown that BTB domain containing proteins can bind to
CUL3 to form ubiquitin E3 ligase [15] [16,17]. In Drosophila, it was reported that in spermatids, KLHL10, CUL3 and ROC1B can physically interact with each other to form a ubiquitin ligase, which can regulate caspase activation through the ubiquitination and degradation of a caspase inhibitor, dBRUCE [21].
In order to examine whether mammalian KLHL10 is involved in the ubiquitination pathway, Klhl10 knockout mouse model need to be generated. Therefore,
24 in this study, we used a transgenic rescue strategy to overcome the haploinsufficiency of
Klhl10 and generated Klhl10 knockout mice. We report the testicular phenotypes of
Klhl10 knockout mice. In addition, 2-D/MS was performed to examine if protein turnover is affected under the depletion of KLHL10 by comparing the global proteomic profiles between the control and Klhl10-/- testes.
25
Materials and Methods
Histological analyses
Testes were dissected and fixed in Bouin’s solution overnight at 4°C and embedded in paraffin. Sections (5um) were prepared and stained with Periodic-Acid
Schiff (PAS) solution (Sigma-Aldrich).
TUNEL assay
Paraffin testis sections were used for TUNEL analyses of apoptotic cells. TUNEL was performed using the ApoTag Plus Peroxidase In Situ Apoptosis Detection Kit
(Millipore, Billerica, MA), according to the manufacturer’s instructions.
Immunofluorescent microscopy
Testes were dissected and fixed in 4% paraformaldehyde in PBS (pH 7.4) for 2 hr at room temperature. The fixed testes were then incubated with serial sucrose solutions with increasing concentration from 5% to 20% followed by incubation in 20% sucrose in
PBS overnight at 4°C. The testes were then embedded in OCT and 20% sucrose mixture with a volume ratio of 1:1. Cryosections of 10um were permeabilized and washed in PBS for three times, followed by blocking with 1% BSA in PBS for 1hr at room temperature.
Sections were incubated with a mouse COX IV antibody (Abcam, Cat. #14744) at 1:100 dilution in a humidity box overnight at 4°C. After washing 3 times in PBS, samples were incubated with Alexa Fluor ® 488 goat anti-mouse IgG (Invitrogen, Cat. # A-11001) at
1:500 dilution for 1 hr at room temperature. Samples were mounted with Aqua mounting medium with DAPI (Vector Labs) and stored in dark at 4°C. The images were captured using a confocal laser scanning system (Olympus, FV1000).
Western blot
26
20ug of each protein sample was mixed with SDS sample loading buffer, followed by denaturing the samples at 95°C for 5 minutes. The samples were loaded on the Tris-HCl gel and transferred to the nitrocellulose membrane. Membrane was blocked with 5% skim milk for 1 hour at room temperature, followed by incubation with primary antibody for overnight at 4°C. After washing 3 times with PBST (0.1% Tween 20 in
PBS), the membrane was incubated with HRP conjugated secondary antibody (Southern biotech) for 1 hour at room temperature. Protein bands were revealed using chemiluminescent detection reagents (GE Life Sciences). Primary antibodies used in this study were: Rabbit anti-HILS1 (1:1000), Rabbit anti-TNP2 (1:1000), Rabbit anti-TNP1
(1:1000), Rabbit anti-SPEM1 (1:500), Rabbit anti-KLHL10 (1:1000), Mouse anti-Gapdh
(1:1000) (Abcam, Cat. #9484).
2-D gel electrophoresis and mass spectrometry
Proteins were isolated from P26 testes of the control and Klhl10-/- mice and loaded onto a 3-10L 11 cm IPG strip by overnight passive rehydration. Isoelectric focusing was carried out on a Bio-Rad Protean IEF cell using a program as follows: 250
V, linear ramp for 20 minutes; 8000 V, linear ramp for 2 hours 30 minutes; and 8000 V for a total of 20,000 Vhr (all steps with a maximum current of 50 uA per gel). Strips were stored at –80°C, then thawed and incubated twice for 10 minutes each in 8M urea, 2%
SDS, 0.05 M Tris-HCl, pH 8.8, 20% glycerol. The first incubation contained 2% DTT and the second contained 2.5% iodoacetamide. The strips were then layered on 4-20%
Criterion Tris HCl gradient gels and embedded in place with 0.5% agarose, along with
Invitrogen BenchMark Protein Ladder molecular weight markers. Electrophoresis was performed at a constant current of 200 mA until the dye front ran off the gel. Gels stained
27 overnight with Bio-Safe Coomassie stain. Stained gels were imaged on a Bio-Rad
VersaDoc imager. Images of gels were compared using Bio-Rad PDQuest version 8.0.1 software. The spots with significant change (a fold change >1.5 or <-1.5) were cut from gels using a Bio-Rad EXQuest Spot Cutter. Gel spots were then trypsin digested and subjected to obi-trap mass spectrometry. The experiments were performed in triplicate.
28
Results
Generation of Klhl10-/- mice by transgenic rescue
In a previous report, high percentage chimeric (HPC) and heterozygous males of
Klhl10 were completely infertile due to the disrupted spermatogenesis [5]. This haploinsufficiency hindered the germline transmission of the mutant allele, thus Klhl10-/- mice could not be generated. To overcome this problem, we engineered a transgene vector containing the entire mouse Klhl10 coding sequence under the control of Hils1 promoter (Figure 1A). Hils1 is a spermatid-specific gene, which has similar spatiotemporal expression pattern as Klhl10 [22]. By electroporation of the transgene construct into the Klhl10+/- embryonic stem (ES) cells, we obtained transgene-positive
(Hils1-Klhl10+) Klhl10+/- ES cell lines. The transgene will most often integrate into chromosomes other than chromosome 11 where Klhl10 is located. At the chimeric stage, transgene expression will compensate for the decreased expression of KLHL10 due to a null Klhl10 allele. Two Klhl10+/- ES cell lines with 1 or 2 copies of transgene were selected for blastocyst injection and one high percentage chimera that transmitted the mutant allele through the germline to the offspring was obtained. By breeding this high percentage chimera with wild-type (WT) females, we obtained Klhl10 null allele w/o
Hils1/Klhl10+ transgene. By further breeding, we generated Klhl10-/- mice (Figure 1B).
Klhl10-/- males could not produce any offspring when mating with WT females, however, the heterozygous males of Klhl10 generated by this transgenic strategy did not show any abnormality regarding fertility. This finding is inconsistent with the haploinsufficiency of
Klhl10 in a previous report [5]. This might be due to the different genetic backgrounds of the two mouse strains. The haploinsufficiency observed in Klhl10 HPC and heterozygous
29 males were on a mixed (129S6/SvEv-C57BL/6) genetic background [5]. However, after transgenic rescue of the male infertility, Klhl10 mutants were predominantly on C57BL/6 background that was achieved by breeding with C57BL/6 females for several generations. This result is not surprising because many studies already showed distinct phenotypes of haploinsufficiency from different inbred mouse strains [23,24].
Disrupted spermatogenesis in Klhl10 mutant testis
Compared to the littermate controls, the adult mutant (Klhl10-/-) males had smaller testes, (~65% of the controls) (Figure 2A). Morphological observation revealed that both sertoli cell structure and spermatogenesis were disrupted in Klhl10-/- adult testes. Sertoli cell vacuolation was often seen, and some sertoli cells were dislocated from the basal membrane (Figure 2D-2G). Many vacuoles were present within the seminiferous tubules of Klhl10-/- testis, which suggests germ cells were depleted from the tubules into the central lumen (Figure 2D). Both spermatocyte and spermatid degeneration was observed in Klhl10-/- testes. Degenerated spermatocytes with dark basophilic nuclei were frequently located at the basal membrane of the mutant tubules (Figure 2D). We also observed numerous degenerated spermatids, characterized by vacuolated cytoplasm and increased chromosome density in the nucleus (Figure 2F). Some of the degenerated spermatids aggregated together to form multinucleated giant cells indicative of depleting cells (Figure 2E-2G). Spermiogenesis was mostly blocked in the elongating stage in the knockout testes, because most tubules were devoid of elongating and elongated spermatids. In stage VII tubules, although a few late spermatids were observed, they all had an abnormal head shape and the lost proper orientation within the epithelium (Figure
2E). In the cauda epididymis, we did not observe any mature spermatozoa within the
30 mutant epididymis (Figure 2I) compared to the control that has numerous mature spermatozoa (Figure 2H). Many early stage germ cells were present in the knockout cauda epididymis, which were likely to be immature germ cells depleted from the seminiferous tubules (Figure 2I). TUNEL assay revealed more apoptotic germ cells in the mutant seminiferous tubules. In WT testis, apoptosis is a rare event and it is confined to spermatogonia and spermatocytes (Figure 2J). In mutant testis, besides the increased number of apoptotic spermatogonia and spermatocytes, some round spermatids were also
TUNEL-positive (Figure 2K-2M). However, most of the degenerated spermatids were
TUNEL-negative, suggesting haploid germ cells might have alternative cell death pathway other than apoptosis (Figure 2K-2M).
In order to determine the time point when spermatogenesis disruption first occurred, we compared the morphology of developing testes between the control and
Klhl10-/- testes. From P0 to P25, there was no morphological change between the control and Klhl10-/- testis (Figure 3A), suggesting spermatogonia, spermatocytes and round spermatids were not affected by deletion of Klhl10. Because Klhl10 is only expressed in elongating and elongated spermatids (steps 9-16), we did not expect any disruption before the elongating steps during the first wave of spermatogenesis. However, at P26 when step 9 spermatids in the control testis started to elongate, round spermatids in
Klhl10 mutant testis were undergoing degeneration (Figure 3A). This result suggests that spermiogenesis of Klhl10-/- testis was mostly blocked at ~step 9 when spermatids normally start to elongate. Western blot analyses of spermiogenic marker proteins was used to confirm the onset of spermiogenesis disruption in Klhl10-/- testes. Expression level of HILS1, whose expression initiates at step 9, was not changed in Klhl10 mutant
31 testis compared to the control. TNP2 (step 10 marker) and TNP1 (step 11 marker) had highly reduced expression level in the mutant testes. Expression of SPEM1 (step 13 marker) was completely lost in Klhl10-/- testes (Figure 3B). This data confirmed that spermatogenesis in Klhl10-/- males was arrested in late spermiogenesis at step 9. The reduced or absent expression of step 10 to step 13 marker proteins indicates the depletion of late spermatids in Klhl10 mutant testes.
Identification of proteins affected by the absence of KLHL10
As expected, Klhl10-/- testes displayed severe spermatogenesis disruption similar to the high percentage chimera we generated before. However, how Klhl10 participates in the regulation of late spermiogenesis to help spermatid maturation is unknown.
Identification of proteins affected by the absence of KLHL10 can provide an insight into the function of KLHL10 during late spermiogenesis. Therefore, a proteomic strategy was used to compare protein expression profiles between Klhl10+/- and Klhl10-/- testes. Adult
Klhl10 knockout testes were not used for this experiment because the severe germ cell depletion in mutant testes would lead to decreased expression of many late spermatid specific proteins. Instead, P26 Klhl10 null testes were used for this experiment, because spermiogenesis disruption occurrs in the mutant testes at this age and no cell depletion is observed in the seminiferous tubules (Figure 3A). Western blot confirmed that heterozygous testes had half the expression level of KLHL10 compared to WT and null testes had no expression of KLHL10 at P26 (Figure 3C). In total, 12 spots were identified by 2-D gel electrophoresis that had more than a 1.5 fold abundance change in the null testes compared to the heterozygous control. All spots were cut from 2-D gel and subjected to obi-trap mass spectrometry (MS) to determine the protein identities. 56
32 proteins were identified with 100% probability, at least 10% coverage and correct molecular weight (Table 1). Multiple proteins per spot were detected, which might be caused by the crowdedness of proteins on the Criterion gel we used (Table 1). Also, a few proteins were present in multiple spots and the shifting of proteins was likely due to protein modification (Table 1). 23 of these proteins belonged to mitochondrial proteins and the remaining 33 were the proteins that were involved in transcriptional and translational regulation, metabolism processes, and protein degradation pathways (Figure
4A). The mitochondrial proteins identified from 2-D/MS were mostly enzymes participating in the mitochondria metabolic pathways to generate energy (Figure 4B) and most of them had higher expression levels in Klhl10-/- testes compared to the control
(Table 1). In order to verify our 2-D/MS results, we performed immunostaining using mitochondrion inner membrane marker COX IV. Before step 9, the expression patterns of
COX IV were similar between the control and Klhl10-/- round spermatids (Figure 5).
After step 9, in the control, we observed that mitochondria underwent rearrangement and moved to the mid-piece of elongated spermatids (Figure 5). However, in Klhl10-/- spermatids, enhanced expression of COX IV was observed in degenerated spermatids, giant cells and abnormal elongating spermatids (Figure 5), indicating either mitochondria number was increased or mitochondria were expanded with increased mass in KO spermatids. Together, our results suggested that loss of KLHL10 could cause the accumulation of mitochondrial proteins in spermatids.
33
Discussion
We used a transgenic rescue strategy to overcome the haploinsufficiency of
Klhl10 and generated Klhl10-/- mice. Klhl10+/- males showed normal fertility, which is inconsistent with a previous study [5]. This might be due to the different genetic background between the two mouse strains. Klhl10-/- males we generated were completely infertile and spermatogenesis defects resemble that of high percentage chimeras in previous report.
Histological examination of Klhl10-/- developing testes revealed that spermiogenesis was arrested in step 9 spermatids. 2-D/MS was conducted to identify proteins with altered expression level in Klhl10 deleted testes and the up-regulation of mitochondria proteins were detected in Klhl10-/- testes. Because CUL3 has been identified to interact with BTB domain-containing proteins to form ubiquitin E3 ligase complexes, we propose that KLHL10 might have a potential function in ubiquitination process during spermiogenesis. How could the disruption of E3 ligase lead to the upregulation of mitochondrial proteins? Mitochondria are the major sites for energy production in animal cells. Defects in mitochondria can induce a variety of pathologies, therefore, elimination of dysfunctional mitochondrial proteins or the whole damaged mitochondria needs to be tightly regulated to maintain mitochondria homeostasis. It is well known that the turnover of inner mitochondria membrane proteins is mediated by the ATP-dependent proteases, including PIM1/Lon [25,26], i-AAA and the m-AAA proteases [27,28], which serve as important mitochondria quality control systems. In addition, recent evidence also indicates a link between ubiquitin/proteosome system and mitochondrial proteostasis [29-35]. Although ubiquitin/proteosome system is not present
34 in mitochondria, ubiquitin could conjugate to mitochondrial proteins that integrate into the outer mitochondria membrane or the cytosolic factors that regulate mitochondria functions somewhat like a mitochondria quality control mechanism. It is now known that certain outer mitochondria membrane associated proteins are under the control of ubiquitin/proteosom system [36-39]. For example, the degradation of anti-apoptotic proteins, like Bcl-2 and Mcn1, involves polyubiquitination and the activity of 26S proteosome [31,32]. During spermiogenesis, ubiquitination of mitochondria did occur, which is supported by the co-localization of ubiquitin and mitochondria in spermatids and spermatozoa[40]. Given that ubiquitin/proteosome system is not present in the mitochondria, it is interesting to know if cytosolic E3 ligase can promote mitochondria ubiquitination during spermatogenesis. Because the depletion of KLHL10 can cause the accumulation of many mitochondria associated proteins, it is possible that CUL3-
KLHL10 E3 ligase might function in the regulation of mitochondria proteostasis. To determine which mitochondrial proteins can be tagged with ubiquitin would give us information about potential substrates targeted by CUL3-KLHL10 E3 ligase. Our 2-
D/MS result provides us a list of potential proteins whose turnover is mediated by CUL3-
KLHL10 E3 ligase.
In summary, we successfully generated a Klhl10 knockout mouse model. The 2-
D/MS results imply that CUL-KLHL10 E3 ligase might be involved in mitochondria quality control. Klhl10 knockout mouse model would be useful for elucidating the link between ubiquitination and mitochondrial dynamics.
35
Figure 1. The transgenic strategy used to generate Klhl10 knockout (KO) mice and genotyping analysis of mutant mice. (A) A transgene cassette containing Klhl10 open reading frame under the control of mouse Hils1 promoter was inserted into a vector containing a Pgk/Neo minigene cassette.
This construct was then electroporated into previously targeted ES cells (Klhl10+/-). The Klhl10+/- ES cells containing the transgene were injected into blastocysts to produce chimeras. By breeding high percentage chimeras with wild type (WT), mice carrying the null mutant Klhl10 and/or the transgene
(Hils1/Klhl10) will be produced. Further intercross will produce two null alleles. (B) Genotyping analyses of Klhl10 mutants. DNA was isolated from the tail and PCR was used to detect WT allele,
KO allele and transgene (Tg) allele.
36
Figure 2. Disrupted spermatogenesis in Klhl10 KO testes. (A) Comparison of average adult testis weight between the control and Klhl10 KO mice. Testes were collected and weighted from 5 adult males of the control and KO. (B-I) Bouin's solution-fixed, paraffin- embedded testis and cauda epididymis cross sections were stained with periodic acid/Schiff reagent. (B) Normal spermatogenesis in the control (Klhl10+/-) testis. (C-G) Disrupted spermatogenesis in Klhl10-/- testes. Stars: sertoli cell vacuolation; red arrows: sertoli cell dislocation; black arrows: degenerated spermatocytes; V: germ cell vacuolation; green
37 arrows: degenerated spermatids; arrowheads: multinucleated giant cells. (H) Cauda epididymis of the control (Klhl10+/-) mouse had numerous mature spermatozoa. (I) In Klhl10-
/- cauda epididymis, there were a lot of immature germ cells. Spermatozoa were not observed.
(Magnification: B-C, 200X; D-G, 400X) (J-M) TUNEL assay with Bouin's solution-fixed, paraffin-embedded testis cross sections. (J) Two TUNEL-positive germ cells were present in a cross section of the Klhl10+/- testis. (K-M) Numerous TUNEL-positive germ cells were visible in Klhl10-/- testis. Purple arrow: TUNEL positive cells. (Magnification: J-K, 200X; L-
M, 400X)
38
Figure 3. Onset of spermiogenesis disruption in Klhl10 mutant testis. (A) Developing testes at postnatal (P) day 0, P7, P14, P25 and P26 were collected from Klhl10+/- and Klhl10-/- mice. Testis cross sections were stained with periodic acid/Schiff reagent. No morphological difference was detected from P0 to P25 testes between the control and mutant. In P26 KO testis, step 9 spermatids started to degenerate. (B) Western blot analysis of HILS1, TNP2,
TNP1 and SPEM1 expression in adult testes of WT, Klhl10+/- and Klhl10-/-. GAPDH was used as a loading control. (C) Western blot analysis of KLHL10 expression in the testes of
WT, Klhl10+/- and Klhl10-/- mice at P23 and P26. GAPDH was used as a loading control.
39
40
Figure 4. Identification of proteins affected by the absence of KLHL10. (A) Category and proportion of all 56 proteins identified from 2-D/MS with altered expression levels in
P26 Klhl10-/- testis compared to Klhl10+/-. Note that majority of identified proteins are mitochondrial proteins (41%). (B) Schematic representation of metabolic energy generation pathways. Proteins identified from 2-D/MS were plot onto the schematic. Mitochondrial enzymes are shown in red, cytosolic enzymes are shown in green and enzymes that have both cytosolic and mitochondrial localization are shown in black.
41
Figure 5. Immunostaining of COX IV in mouse testicular spermatids. Spermatids of adult Klhl10+/- and Klhl10-/- mice were stained with antibody against COX IV, which is an inner mitochondria membrane protein (Green). Nuclei were stained with DAPI (Blue). Steps of spermatids were labeled with Arabic numerals.
42
Genes upregulated in KO testes Spot number Gene symbol Cellular localization Function 2204 Erp29 Endoplasmic reticulum Involved in protein trafficking Yrdc Plasma membrane A putative ribosome maturation factor Psma3 Cytoplasm and nucleus Proteolysis Clic1 Cytoplasm Chloride transport Pgls Cytoplasm Pentose phosphate pathway Inner mitochondrial 2705 Ndufs1 membrane Electron transport chain Dpp3 Cytoplasm Proteolysis 4604 Cct2 Cytoplasm Assist actin folding Aldh2 Mitochondrial matrix Fatty acid α-oxidation Aldh1a2 Cytoplasm Retinoic acid metabolism Cytoplasm and Aldh7a1 mitochondria Fatty acid α-oxidation Pspc1 Nucleolus Regulation of transcription Pmpca Mitochondria Proteolysis Dync1li2 Cytoplasm Trafficking Arhgap1 Cytoplasm Positive regulation of GTPase activity Pdhx Mitochondrial matrix Catalyzes the conversion of pyruvate to acetyl coenzyme A Tekt4 Cilium Sperm motility Nt5dc1 Unknown Unknown Aldh1b1 Mitochondria Fatty acid α-oxidation 6221 Etfa Mitochondria Fatty acid beta-oxidation Hadh Mitochondria Fatty acid beta-oxidation Memo1 Cytoplasm Regulation of microtubule-based process Gnb2l1 Cytoplasm An adaptor protein in intracellular signal transduction pathways Outer mitochondrial Vdac2 membrane Anion transport cross the mitochondrial outer membrane Hnrnpa2b1 Nucleus mRNA processing 6406 Acaa2 Mitochondrial matrix Fatty acid beta-oxidation Acadl Mitochondrial matrix Fatty acid beta-oxidation Inner mitochondrial Gatm membrane Creatine biosynthesis Map2k2 Cytoplasm Activation of MAPK activity Acadm Mitochondrial matrix Fatty acid beta-oxidation Paics Cytoplasm Purine biosynthesis Psmc5 Cytoplasm Participation in proteasome functions and transcriptional regulation Nme7 Axoneme Ciliary motility Pdha1 Mitochondrial matrix Acetyl-CoA biosynthesis from pyruvate 6506 Psmc5 Cytoplasm Participation in proteasome functions and transcriptional regulation Catalyzes the addition of the CCA terminus to the 3-prime end of tRNA Trnt1 Cytoplasm precursors Cytoplasm and Nfs1 mitochondria Fe-S cluster biogenesis Inner mitochondrial Gatm membrane Creatine biosynthesis Acadl Mitochondrial matrix Fatty acid beta-oxidation 8212 Etfb Mitochondria Fatty acid beta-oxidation Eif4h Cytoplasm Translational initiation Cacybp Cytoplasm Participates in the ubiquitin-mediated degradation of beta-catenin Qdpr Cytoplasm Biopterin recycling Psma7 Cytoplasm and nucleus Proteolysis 8503 Hmgcs2 Mitochondrial matrix Ketone oxidation pathway Inner mitochondrial Fdxr membrane Electron transport chain Eef1a1 Cytoplasm Enzymatic delivery of aminoacyl tRNAs to the ribosome
43
Genes downregulated in KO testes Spot number Gene symbol Cellular localization Function 0005 Hist2h2ab Nucleus Nucleosome structure protein 0504 Acaa2 Mitochondrial matrix Fatty acid beta-oxidation Sucla2 Mitochondrial matrix TCA cycle Inner mitochondrial Uqcrc2 membrane Electron transport chain Ahcy Cytoplasm and nucleus Methionine metabolism Pgk1 Cytoplasm Anaerobic glycolysis Serpinb6a Cytoplasm Negative regulation of endopeptidase activity Ilf2 Cytoplasm and nucleus Positive regulation of transcription Inner mitochondrial 3002 Atp5j membrane Catalyzes ATP synthesis Cytoplasm and 8419 Gapdh mitochondria Anaerobic glycolysis Ptgr1 Cytoplasm Sphingosine and sphingosine-1-phosphate metabolism Hnrnpa2b1 Nucleus mRNA processing Mdh2 Mitochondrial matrix TCA cycle Ldha Cytoplasm Pyruvate fermentation to lactate
Table 1 Proteins identified with altered expression levels in the P26 testes of Klhl10+/-
and Klhl10-/-. In total, 12 spots were identified with more than 1.5 fold expression level
change in control and KO testes. 56 proteins were identified with 100% probability, at least
10% coverage and the right molecular weight. Mitochondrial proteins were shown in red.
44
Figure S1 2D-gel using P26 testes from Klhl10+/- and Klhl10-/- mice. 12 spots (red circles) were cut from the gel and subjected to MS.
45
References:
1. Lin YN, Matzuk MM (2005) High-throughput discovery of germ-cell-specific genes. Semin Reprod Med 23: 201-212. 2. Schultz N, Hamra FK, Garbers DL (2003) A multitude of genes expressed solely in meiotic or postmeiotic spermatogenic cells offers a myriad of contraceptive targets. Proc Natl Acad Sci U S A 100: 12201-12206. 3. Shima JE, McLean DJ, McCarrey JR, Griswold MD (2004) The murine testicular transcriptome: characterizing gene expression in the testis during the progression of spermatogenesis. Biol Reprod 71: 319-330. 4. Yan W (2009) Male infertility caused by spermiogenic defects: lessons from gene knockouts. Mol Cell Endocrinol 306: 24-32. 5. Yan W, Ma L, Burns KH, Matzuk MM (2004) Haploinsufficiency of kelch-like protein homolog 10 causes infertility in male mice. Proc Natl Acad Sci U S A 101: 7793- 7798. 6. Bomont P, Cavalier L, Blondeau F, Ben Hamida C, Belal S, et al. (2000) The gene encoding gigaxonin, a new member of the cytoskeletal BTB/kelch repeat family, is mutated in giant axonal neuropathy. Nat Genet 26: 370-374. 7. Kang MI, Kobayashi A, Wakabayashi N, Kim SG, Yamamoto M (2004) Scaffolding of Keap1 to the actin cytoskeleton controls the function of Nrf2 as key regulator of cytoprotective phase 2 genes. Proc Natl Acad Sci U S A 101: 2046-2051. 8. Ahmad KF, Melnick A, Lax S, Bouchard D, Liu J, et al. (2003) Mechanism of SMRT corepressor recruitment by the BCL6 BTB domain. Mol Cell 12: 1551-1564. 9. Melnick A, Ahmad KF, Arai S, Polinger A, Ball H, et al. (2000) In-depth mutational analysis of the promyelocytic leukemia zinc finger BTB/POZ domain reveals motifs and residues required for biological and transcriptional functions. Mol Cell Biol 20: 6550-6567. 10. Furukawa M, He YJ, Borchers C, Xiong Y (2003) Targeting of protein ubiquitination by BTB-Cullin 3-Roc1 ubiquitin ligases. Nat Cell Biol 5: 1001-1007. 11. Geyer R, Wee S, Anderson S, Yates J, Wolf DA (2003) BTB/POZ domain proteins are putative substrate adaptors for cullin 3 ubiquitin ligases. Mol Cell 12: 783- 790. 12. Pintard L, Willis JH, Willems A, Johnson JL, Srayko M, et al. (2003) The BTB protein MEL-26 is a substrate-specific adaptor of the CUL-3 ubiquitin-ligase. Nature 425: 311-316. 13. Xu L, Wei Y, Reboul J, Vaglio P, Shin TH, et al. (2003) BTB proteins are substrate- specific adaptors in an SCF-like modular ubiquitin ligase containing CUL-3. Nature 425: 316-321. 14. Prag S, Adams JC (2003) Molecular phylogeny of the kelch-repeat superfamily reveals an expansion of BTB/kelch proteins in animals. BMC Bioinformatics 4: 42. 15. Lee YR, Yuan WC, Ho HC, Chen CH, Shih HM, et al. (2010) The Cullin 3 substrate adaptor KLHL20 mediates DAPK ubiquitination to control interferon responses. EMBO J 29: 1748-1761.
46
16. Furukawa M, Xiong Y (2005) BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Mol Cell Biol 25: 162- 171. 17. Maerki S, Olma MH, Staubli T, Steigemann P, Gerlich DW, et al. (2009) The Cul3- KLHL21 E3 ubiquitin ligase targets aurora B to midzone microtubules in anaphase and is required for cytokinesis. J Cell Biol 187: 791-800. 18. Stogios PJ, Prive GG (2004) The BACK domain in BTB-kelch proteins. Trends Biochem Sci 29: 634-637. 19. Yatsenko AN, Roy A, Chen R, Ma L, Murthy LJ, et al. (2006) Non-invasive genetic diagnosis of male infertility using spermatozoal RNA: KLHL10 mutations in oligozoospermic patients impair homodimerization. Hum Mol Genet 15: 3411- 3419. 20. Wang S, Zheng H, Esaki Y, Kelly F, Yan W (2006) Cullin3 is a KLHL10-interacting protein preferentially expressed during late spermiogenesis. Biol Reprod 74: 102- 108. 21. Arama E, Bader M, Rieckhof GE, Steller H (2007) A ubiquitin ligase complex regulates caspase activation during sperm differentiation in Drosophila. PLoS Biol 5: e251. 22. Iguchi N, Tanaka H, Yamada S, Nishimura H, Nishimune Y (2004) Control of mouse hils1 gene expression during spermatogenesis: identification of regulatory element by transgenic mouse. Biol Reprod 70: 1239-1245. 23. Kiernan AE, Li R, Hawes NL, Churchill GA, Gridley T (2007) Genetic background modifies inner ear and eye phenotypes of jag1 heterozygous mice. Genetics 177: 307-311. 24. Rubio-Aliaga I, Przemeck GK, Fuchs H, Gailus-Durner V, Adler T, et al. (2009) Dll1 haploinsufficiency in adult mice leads to a complex phenotype affecting metabolic and immunological processes. PLoS One 4: e6054. 25. Bender T, Lewrenz I, Franken S, Baitzel C, Voos W (2011) Mitochondrial enzymes are protected from stress-induced aggregation by mitochondrial chaperones and the Pim1/LON protease. Mol Biol Cell 22: 541-554. 26. Van Dyck L, Langer T (1999) ATP-dependent proteases controlling mitochondrial function in the yeast Saccharomyces cerevisiae. Cell Mol Life Sci 56: 825-842. 27. Griparic L, Kanazawa T, van der Bliek AM (2007) Regulation of the mitochondrial dynamin-like protein Opa1 by proteolytic cleavage. J Cell Biol 178: 757-764. 28. Ishihara N, Fujita Y, Oka T, Mihara K (2006) Regulation of mitochondrial morphology through proteolytic cleavage of OPA1. EMBO J 25: 2966-2977. 29. Nijhawan D, Fang M, Traer E, Zhong Q, Gao W, et al. (2003) Elimination of Mcl-1 is required for the initiation of apoptosis following ultraviolet irradiation. Genes Dev 17: 1475-1486. 30. Cuconati A, Mukherjee C, Perez D, White E (2003) DNA damage response and MCL-1 destruction initiate apoptosis in adenovirus-infected cells. Genes Dev 17: 2922-2932. 31. Zhong Q, Gao W, Du F, Wang X (2005) Mule/ARF-BP1, a BH3-only E3 ubiquitin ligase, catalyzes the polyubiquitination of Mcl-1 and regulates apoptosis. Cell 121: 1085-1095.
47
32. Azad N, Vallyathan V, Wang L, Tantishaiyakul V, Stehlik C, et al. (2006) S- nitrosylation of Bcl-2 inhibits its ubiquitin-proteasomal degradation. A novel antiapoptotic mechanism that suppresses apoptosis. J Biol Chem 281: 34124- 34134. 33. Benard G, Neutzner A, Peng G, Wang C, Livak F, et al. (2010) IBRDC2, an IBR-type E3 ubiquitin ligase, is a regulatory factor for Bax and apoptosis activation. EMBO J 29: 1458-1471. 34. Fu NY, Sukumaran SK, Kerk SY, Yu VC (2009) Baxbeta: a constitutively active human Bax isoform that is under tight regulatory control by the proteasomal degradation mechanism. Mol Cell 33: 15-29. 35. Lotan R, Rotem A, Gonen H, Finberg JP, Kemeny S, et al. (2005) Regulation of the proapoptotic ARTS protein by ubiquitin-mediated degradation. J Biol Chem 280: 25802-25810. 36. Yonashiro R, Ishido S, Kyo S, Fukuda T, Goto E, et al. (2006) A novel mitochondrial ubiquitin ligase plays a critical role in mitochondrial dynamics. EMBO J 25: 3618-3626. 37. Karbowski M, Neutzner A, Youle RJ (2007) The mitochondrial E3 ubiquitin ligase MARCH5 is required for Drp1 dependent mitochondrial division. J Cell Biol 178: 71-84. 38. Neutzner A, Benard G, Youle RJ, Karbowski M (2008) Role of the ubiquitin conjugation system in the maintenance of mitochondrial homeostasis. Ann N Y Acad Sci 1147: 242-253. 39. Ziviani E, Tao RN, Whitworth AJ (2010) Drosophila parkin requires PINK1 for mitochondrial translocation and ubiquitinates mitofusin. Proc Natl Acad Sci U S A 107: 5018-5023. 40. Sutovsky P, Moreno RD, Ramalho-Santos J, Dominko T, Simerly C, et al. (2000) Ubiquitinated sperm mitochondria, selective proteolysis, and the regulation of mitochondrial inheritance in mammalian embryos. Biol Reprod 63: 582-590.
48
Chapter 3
KLHL10 targets SPATA3 for ubiquitination by a CUL3-based E3 ligase during mouse spermiogenesis
Abstract:
Spermiogenesis is the last phase of spermatognesis during which spermatids undergo dramatic remodeling and elimination of most organelles and proteins to form spermatozoa. Increasing evidence suggests that ubiquitin-proteasome system (UPS) is involved in removing organelles and proteins as sperms undergo maturation. However, very few ubiquitin ligases and their functions have been identified during spermiogenesis.
Klhl10 is a testis-specific gene which is only expressed in late spermatids (steps 9-16).
Knockout of Klhl10 leads to disruption of spermiogenesis and complete male infertility in mice. In a previous investigation, we showed that CULLIN3 (CUL3), a well-known ubiquitin E3 ligase, interacts with the BTB domain of KLHL10, suggesting a potential role of KLHL10 as an adaptor protein in this spermatid-specific CUL3-based E3 ligase complex. Using yeast 2-hybrid assays, we screened an adult mouse testis library to identify testicular proteins that can interact with KLHL10. We identified numerous
KLHL10-interacting proteins, and spermatogenesis-associated proteins 3 (SPATA3) and
6 (SPATA6) were two among those proteins. Co-immunoprecipitation assay confirmed their interaction and KLHL10 interacts with SPATA3 and SPATA6 through the Kelch domain. Because the Kelch domain usually functions as a substrate-recruiting domain in most of the CUL3-BTB/Kelch E3 ligase complexes, we performed in vivo ubiquitination assays to examine whether KLHL10 can recruit SPATA3 and SPATA6 for ubiquitination.
49
We found the ubiquitination level of SPATA3 was significantly increased upon overexpression of KLHL10, suggesting SPATA3 is a substrate of CUL3-KLHL10 E3 ligase. Our data suggest CUL3-KLHL10 complex is a spermatid-specific ubiquitin E3 ligase which is involved in the removal of proteins during late spermiogenesis.
Keywords: spermiogenesis, ubiquitin ligase, ubiquitination, protein degradation.
50
Introduction:
The ubiquitin-proteasome system (UPS) is responsible for the tightly regulated degradation of numerous proteins that function in various cellular activities, such as cell cycle progression, stress response, circadian rhythms, signal transduction, transcriptional regulation, DNA repair, apoptosis, and the biogenesis of organelles [1,2]. Protein degradation through UPS involves two discrete and consecutive steps: 1) attachment of polyubiquitin to the substrates and 2) breaking down of ubiquitinated substrates by a 26S proteasome complex. Because of the large number of substrates and the high specificity of substrate recognition, the genes encoding the components of UPS system account for
~5% of the genome [3]. Ubiquitination reaction requires three enzymes: E1 (ubiquitin- activating enzyme), E2 (ubiquitin-conjugating enzyme) and E3 (ubiquitin ligase).
Ubiquitin, a peptide of 76 aa (amino acid), is highly conserved among organisms. It is first activated by one predominant E1 in an ATP-dependent manner and then conjugated to one of the 30-40 mamalian E2s through a thioester bond [4]. Finally, ubiquitin is transferred to the substrate by one of hundreds of different E3s [4]. Additional ubiquitin is added to generate polyubiquitin chains, which serve as signals for targeting proteins for degradation by 26S proteasome. After proteasome targeting, most of the ubiquitin is released and recycled by deubiquitylating enzymes (DUBs) [5].
E3s have been classified into HECT (Homologous to E6-AP C-Terminus) and
RING (Really Interesting New Gene) families [6]. While HECT E3s display catalytic activity, RING E3s can bring together the activated ubiquitin and the substrate to the proximity that allows for transfer of ubiquitin from E2 to the substrate [7]. Cullin-based
E3 ligases are one type of RING E3 ligases. The human genome encodes seven different
51
Cullins: Cullin-1, 2, 3, 4A, 4B, 5, and 7 [8,9]. The molecular composition and function of CUL1-based SCF complex and CUL2-based ECS complex have been well characterized. The CUL3-based E3 ligase displays similar composition and structure to
SCF (Skp, Cullin, F-box containing complex) and ECS (Elongin B/C-Cul2/5-SOCS-box protein) complex. However, the BTB-domain containing proteins in CUL3-based E3 ligase incorporate features of Skp1/F-box or ElonginC/SOCS-box dimers, and therefore can bridge CUL3 and the substrate in a single polypeptide [7]. The C-terminal of BTB protein is usually another protein-protein interaction domain, including MATH, Kelch and Zn-finger domains, which serve as binding sites for substrates.
The rate of ubiquitination is high in the testis compared to other organs, and it is increased during spermiogenesis. This might be due to the enhanced protein turnover rate and the rearrangement/elimination of unnecessary organelles during haploid germ cell differentiation [10,11]. KLHL10 is a testis-specific protein and it belongs to the BTB-
Kelch protein family [12], a group of ~50 proteins containing an N-terminal BTB (bric a brac, tramtrack, and broad complex) or POZ (poxvirus zinc finger) domain and several
C-terminal Kelch repeats. In mice, knockout of Klhl10 resulted in depletion of germ cells, degeneration of late spermatids, and significant reduction in late spermatid population. It has been shown that BTB domain of KLHL10 could directly interact with CUL3 [13], indicating it might have a potential function in ubiquitination pathway. Several members of the BTB-Kelch protein family have been described as components of CUL3-based E3 ubiquitin ligases [14-16]. In Drosophila, it has been shown that Drosophila orthologue of the mammalian KLHL10, a testis-specific isoform of CUL3, and ROC1B can physically interact to form an ubiquitin ligase in spermatids, which regulates caspase activation
52 through the ubiquitination and degradation of a caspase inhibitor, dBRUCE [17,18]. In this study, we used yeast two-hybrid screening of mouse testis library to identify
KLHL10 interacting partners and SPATA3 and 6 (Spermatogenesis associated protein 3 and 6) were two proteins identified. Here we showed the interaction of KLHL10 with
SPATA3 and 6 were mediated by Kelch domain and the ubiquitination of SPATA3, not
SPATA6, was regulated by KLHL10. Our results indicated that KLHL10 is a component of testis-specific CUL3-based E3 ligase to regulate the turnover of a testis-specific protein, SPATA3.
53
Materials and Methods:
Generation of constructs
To generate the FLAG-tagged full-length (FL) KLHL10 expression plasmid, the
PCR product of the whole coding region of KLHL10 was firstly subcloned into a pcDNATM3.1/V5-His TOPO® TA vector according to the manufacturer's instructions
(Invitrogen, Grand Island, NY). Then, after enzyme digestion, the FL fragment was inserted into the multiple cloning site of p3XFLAG-Myc-CMVTM-26 expression vector
(Sigma, St. Louis, MO). A similar PCR-based approach was used to generate the deletion mutants FLAG-ΔBTB (aa 1-29 & 138-608), FLAG-ΔBACK (aa 1-138 & 247-608), and
FLAG-ΔKelch (aa 1-285 & 562-608). V5-tagged CUL3, SPATA3 and SPATA6 were generated in the same strategy into pcDNATM3.1/V5-His TOPO® TA vector.
Cell culture, transfection and immunoprecipitation
HEK293T cells were cultured in Dulbecco's Modified Eagle Medium (Invitrogen,
Grand Island, NY) supplemented with 10% fetal bovine serum (Atlanta Biologicals,
Lawrenceville, GA) in a 37°C incubator with 5% CO2. Cell transfection was performed using Lipofectamine 2000 transfection reagent according to the manufacturer's instructions (Invitrogen, Grand Island, NY). Co-immunoprecipitation was performed using Immunoprecipitation Kit (Protein G) (Roche, South San Francisco, CA). Briefly,
24 h after transfection, cells were lysed in a buffer containing 50mM Tris-HCl (pH7.5),
150mM NaCl, 1% Nonidet P40 and 0.5% sodium deoxycholate supplemented with protease inhibitor cocktail (Roche, South San Francisco, CA). One ug of antibody was added into the cell lysates and incubated for 2 h at 4°C. Then protein G agarose was added into the lysates and incubated overnight at 4°C under continuous rotation. After
54 washing, bound proteins were eluted from the agarose by heating the samples for 10 min in a SDS-loading buffer. The eluates were then subjected to SDS-PAGE and western blot as described [13]. The antibodies used for immunoprecipitation and western blot were mouse monoclonal anti-V5 (Invitrogen, Grand Island, NY) and mouse monoclonal anti-
FLAG (Sigma, St. Louis, MO).
Ubiquitination assay in mammalian cell
Cell culture and transfection were performed as described above, but 24 h after transfection, cells were treated with MG132 (Sigma, St. Louis, MO) for 4 h before lysis.
10mM N-ethylmaleimide (Sigma, St. Louis, MO) and 1% SDS was additionally added to the lysis buffer and lysates were boiled for 10 minutes. After pelleting, the supernatants were used for immunoprecipitation as described above.
Yeast two-hybrid
To identify KLHL10-interacting proteins, a yeast two-hybrid system
(MatchMaker, CLONTECH Laboratories, Inc.) was performed according to a previous report [13]. Briefly, we prepared a cDNA prey library using total RNA isolated from adult testes. Using the pGBKT7 vector, we generated a bait construct that expresses the full-length KLHL10 protein. The Y187 competent yeast cells were transformed with the bait construct and then mated with testis library-containing AH109 yeast cells. After mating, clones that grew on selection plates (SD/-Ade/-His/-Leu/-Trp) were isolated and candidate pGADT7-cDNAs were sequenced. For cotransformation assays, pGADT7-
Spata3 cDNA and pGADT7-Spata6 cDNA were used to transform Y187 competent yeast cells together with the bait, respectively. Cotransformations of two empty vectors
(pGBKT7 + pGADT7) and pGBKT7–53 (expressing p53 as a control plasmid) +
55
SPATA3 or SPATA6 were used as controls. The transformed cells were plated on nonselective (SD/-Leu/-Trp) and selective (SD/-Ade/-His/-Leu/-Trp) plates, respectively.
Immunofluorescent microscopy
Testes were dissected and fixed in 4% paraformaldehyde in PBS (pH 7.4) for 2 hr at room temperature. The fixed testes were then incubated with serial sucrose solutions with increasing concentration from 5% to 20% followed by incubation in 20% sucrose in
PBS overnight at 4°C. The testes were then embedded in OCT and 20% sucrose mixture with a volume ratio of 1:1. Cryosections of 10um were permeabilized and washed in PBS for three times, followed by blocking with 1% BSA in PBS for 1hr at room temperature.
Sections were incubated with primary antibodies in a humidity box overnight at 4°C.
Primary antibodies used were: rabbit anti-SPATA3 (1:50 dilution; Sigma, St. Louis,
MO), rabbit anti-SPATA6 (1:100 dilution) and mouse anti-β tubulin (1:500 dilution;
Sigma, St. Louis, MO). After three times washing in PBS, samples were incubated with secondary antibody at a 1:500 dilution for 1 hr at room temperature. Samples were mounted with Aqua mounting medium with DAPI (Vector Labs, Burlingame, CA) and stored in dark at 4°C. The images were captured using a confocal laser scanning system
(Olympus, FV1000).
Semi-quantitative PCR
RNA isolation and cDNA synthesis were performed as described [19]. PCR primers for mouse Spata3 were forward: 5'-CCTCATCTCCGTTCCTGGTA-3' and reverse: 5'-CCGAGGTAGGAGGACATCAA-3'. PCR primers for mouse Spata6 were forward: 5’-CAATGCCAGAATGGTGTTTG-3’ and reverse: 5’-
AGGCCAGAAATCCTCCTCAT-3’. PCR was performed at 25–28 cycles, which were
56 tested to be in the exponential range. Mouse housekeeping gene β-actin was used as a loading control. PCR primers for mouse β-actin were forward: 5'-
CTGTATTCCCCTCCATCGTG-3' and reverse: 5'- GGTGTGGTGCCAGATCTTCT-3'.
57
Results:
KLHL10 interacts with CUL3 through BTB domain
CUL3 is identified as a KLHL10 interacting protein in both yeast two-hybrid system and in vivo immunoprecipitation assay using testis lysate [13]. To further characterize this interaction and localize the interaction domains, we performed co- immunoprecipitation studies in HEK293T cells. We generated four KLHL10 expression constructs, which expressed FLAG tagged full-length (FL) and three domain deletion mutants of KLHL10 (ΔBTB, ΔBACK, and ΔKelch) (Figure 1A). In addition, a CUL3 expression construct was also generated, which can express V5 tagged CUL3. pcDNA3.1/V5-His-Cul3 together with each individual of four Klhl10 expression constructs (p3XFLAG-Myc-CMV-26-Fl, p3XFLAG-Myc-CMV-26-ΔBtb, p3XFLAG-Myc-
CMV-26-ΔBack, p3XFLAG-Myc-CMV-26-ΔKelch) were co-transfected into HEK293T cells. Immunoprecipitation of CUL3 with V5 antibody resulted in clear co-purification of
FLAG tagged FL, ΔBACK and ΔKelch of KLHL10 (Figure 1B), indicating BTB domain of KLHL10 mediated the interaction with CUL3 in mammalian cells. BTB-domain containing proteins have been reported to interact with CUL3 to form ubiquitin E3 ligases, therefore, our result indicates KLHL10 might also involved in ubiquitination pathway.
KLHL10 interacts with SPATA3 and SPATA6 through Kelch domain
Using a yeast two-hybrid screening system, we identified numerous KLHL10- interacting proteins. SPATA3 and 6 (Spermatogenesis-associated proteins 3 and 6) were two among those proteins (Figure 2A). To further characterize the novel interactions between KLHL10 and SPATA3 or SPATA6, we investigated which KLHL10 domains
58 mediate their interactions. V5-SPATA3 and deletion mutants of KLHL10 were over- expressed in HEK293T cells. Pull down of SPATA3 resulted in co-purification of FL,
ΔBTB and ΔBACK mutants of KLHL10. The interaction with SPATA3 was completely abolished when the Kelch domain was deleted (Figure 2B), suggesting the Kelch domain of KLHL10 is required for the interaction with SPATA3. In vitro co-immunoprecipitation revealed that the interaction between SPATA6 and KLHL10 was also mediated by the
Kelch domain.
Ubiquitination of SPATA3 is regulated by KLHL10
Given that KLHL10 directly interacts with CUL3 and SPATA3 via BTB and
Kelch domains respectively, it is possible that KLHL10 functions as an adaptor protein bridging the CUL3-based E3 ligase and its substrate, SPATA3. To examine whether
KLHL10 can regulate SPATA3 ubiquitination, we performed in vivo ubiquitination assay in HEK293T cells (Figure 3A). V5-SPATA3, HA-UB (HA-UBIQUITIN) and FLAG-
KLHL10 were over-expressed in HEK293T cells followed by treatment with proteasome inhibitor MG132. Immunoprecipitation using V5 antibody pulled down SPATA3 and the high-molecular-weight smear characteristic of polyubiquitination was revealed by western blot using HA antibody. We clearly detected increased ubiquitination levels of
SPATA3 upon co-expression of KLHL10 (Figure 3A). The positive effect of KLHL10 over-expression on ubiquitination level of SPATA3 is in agreement with our hypothesis that KLHL10 serves as an adaptor to target SPATA3 for ubiquitination.
Because SPATA6 can also interact with KLHL10 via Kelch domain, we speculated it might be another target of KLHL10 for ubiquitination. To test whether
KLHL10 can promote SPATA6 ubiquitination, we also performed in vivo ubiquitination
59 assay in HEK293T cells (Figure 3B). SPATA6 can be ubiquitinated in mammalian cells as shown by the high-molecular-weight smear of ubiquitinated SPATA6 detected by HA antibody and its ubiquitination level increased after MG132 treatment (Figure 3B).
However, upon co-expression of KLHL10, the ubiquitination level of SPATA6 was not increased, indicating ubiquitination of SPATA6 is not mediated by KLHL10 (Figure 3B).
SPATA3 is preferentially expressed in late spermiogenesis
Spata3 is identified as a testis-specific gene with unknown function [20]. Mouse
SPATA3 is a very small protein with only 192 aa. It has 55.4% identity with human
SPATA3 at the amino acid level. SPATA3 does not share significant homology with any other known proteins in databases. Semi-quantitative PCR (Figure 4A) and western blot
(Figure 4C) analyses of multi-tissues of adult wild-type (WT) mice showed that Spata3 was exclusively expressed in the testis, which is consistent with a previous report [21].
During mouse testicular development, the onset of Spata3 mRNA expression was between postnatal days (P) 20 to 28 (Figure 4B), suggesting Spata3 mRNA was mainly expressed in haploid germ cells. To visualize the cellular localization of SPATA3, immunofluorescence was performed in the adult WT testis using SPATA3 antibody. We observed that SPATA3 was preferentially expressed in elongated spermatids (steps 12-16) and the staining was localized in the cytoplasm (Figure 4D). The spatiotemporal expression pattern of SPATA3 is overlapped with that of KLHL10, suggesting the interaction of SPATA3 and KLHL10 identified using in vitro assay can happen in vivo in mouse spermatids.
Expressional analyses of SPATA6 in testes
60
Spata6 is highly expressed in testis and knockout of Spata6 in mouse can lead to lethality of the chimeric embryos [22]. Mouse SPATA6 contains 488 aa and it has 90.6% identity with human SPATA6. No conserved domains have been identified for SPATA6.
Semi-quantitative PCR analyses of multiple tissues showed that Spata6 mRNA was ubiquitously expressed in all tissues we examined (Figure 5A). Western blot analysis of
SPATA6 protein expression profile was consistent with the result of semi-quantitative
PCR (Figure 5B). During mouse testicular development, Spata6 mRNA was already expressed at P6 and its level was increased especially at P28 and P56 (Figure 5C), indicating haploid germ cells are the major source of Spata6 mRNA in the testis. To determine the cellular localization of SPATA6, immunofluorescence was performed using SPATA6 antibody. The signal in leydig cells was not specific because it was present when using preimmune serum (data not shown). Within seminiferous tubules,
SPATA6 was expressed in both sertoli cells and germ cells (Figure 5D). In sertoli cells, the signal was confined to the nucleus. In germ cells, SPATA6 was expressed in the nucleus starting from pachytene spermatocyte to step 7 round spermatids (Figure 5D). In step 8 spermatids, SPATA6 was localized in manchette-like structures, where it remained up to step 14 (Figure 5D). The subcellular localization of SPATA6 in step 8 - 14 spermatids resembles that of manchette; therefore, co-immunostaining using SPATA6 and β-TUBULIN (a manchette marker) antibodies was performed to determine whether
SPATA6 truly localized in manchette. Stage specific seminiferous tubules were squashed on the slide to prepare single layer spermatogenic cells and samples were co- immunostained with antibodies against SPATA6 and β-TUBULIN. Indeed, SPATA6 was co-localized with β-TUBULIN to the manchette of elongating spermatids (Figure 5E).
61
Discussion:
The connection between spermatogenesis and ubiquitination has been noted since the first knockout for a component of the ubiquitin pathway, HR6B (the ubiquitin- conjugating enzyme), which resulted in male infertility due to disruption of spermatogenesis [23]. Multiple E2s, E3s and DUBs have been identified in different stages of spermtogenesis, indicating specialized ubiquitin pathway is required for specific stage of spermatogenesis. The E3s (e.g. LASU1 and RNFs) identified in testis have been implicated in the functions of histone ubiquitination and nucleosomal removal [24-26].
Given the extensive degradation of proteins and organelles especially during late spermiogenesis, more E3s would be expected in late spermatids to play roles in recognizing their specific substrates for ubiquitination.
In this study, we confirmed that BTB domain of KLHL10 was required for interaction with CUL3. We also identified SPATA3 and 6 as two novel interacting partners for KLHL10 in both yeast two-hybrid screening and in vitro immunoprecipitation and their interactions were mediated by Kelch domain. Although both SPATA3 and 6 interacted with the substrate recognition domain of KLHL10, only the ubiquitination of SPATA3 was regulated by KLHL10. Our results indicate CUL3-
KLHL10 E3 ligase functions in late spermatid-specific ubiquitin pathway and the removal of SPATA3 is dependent on this E3 ligase. The knockout of Klhl10 in mice resulted in the arrest of spermatid development in step 9 when round spermatids start to elongate in WT mice. The phenotypes of Klhl10 KO might be due to the accumulation of specific substrates that play essential roles in spermatid elongation. Because SPATA3 is only expressed in elongated spermatids (steps 12-16), it is more likely that the
62 accumulation of other substrates whose expression initiates at ~step 9 might cause defective spermiogenesis seen in Klhl10 mutant.
Although SPATA6 can be ubiquitinated in mammalian cells, the ubiquitination of
SPATA6 is not enhanced upon over-expression of KLHL10, indicating SPATA6 is not a substrate for CUL3-KLHL10 E3 ligase. The fact that SPATA6 can bind to the substrate recognition domain of KLHL10 does not exclude the possibility that SPATA6 might be a regulator or a co-adaptor of CUL3-KLHL10 ligase. It is interesting that SPATA6 was localized in the manchette of late spermatids. Manchette has been implicated in the function of sorting of structural proteins during nuclear shaping and sperm tail formation
[27-29]. In addition, PSMC3, a protein component of 19S regulatory cap of the 26S proteasome, is localized in the machettee of rat spermatids [29]. It would be interesting to explore whether there is link between SPATA6 and 26S proteasome in spermatids.
Overall, our study demonstrates that CUL3-KLHL10 complex is a spermatid- specific ubiquitin E3 ligase that is responsible for proteasomal degradation of specific proteins and SPATA3 is identified as a substrate for the CUL3-KLHL10 ligase. Further identification of more substrates of CUL3-KLHL10 ligase and functional examination of the substrates will clarify the molecular pathways this E3 ligase involved in.
63
Figure 1. KLHL10 interacts with CUL3 through BTB domain. (A) Schematic illustration of constructs expressing full length (FL) and mutant (ΔBTB, ΔBACK and
ΔKelch) KLHL10. (B) HEK293T cells were transiently transfected with indicated plasmids expressing V5-tagged CUL3 and FLAG-tagged KLHL10. 5% of the lysates were subjected to western blot using anti-V5 and anti-FLAG to examine the transfection efficiency. The rest of the lysates were subjected to IP with anti-V5 and the binding was confirmed by western blot using anti-FLAG.
64
Figure 2. KLHL10 interacts with SPATA3 and SPATA6 through Kelch domain.
(A) Yeast two-hybrid assay. cDNA fragment expressing full-length Klhl10 was subcloned into pGBKT7 vector and used as a bait. Spata3 and Spata6 cloned into pGADT7 were used as prey. The result showed the interaction between KLHL10 and
SPATA3/SPATA6. (B&C) HEK293T cells were transiently transfected with plasmids expressing V5-SPATA3 (B) / V5-SPATA6 (C) and FLAG-KLHL10 (FL or mutants). 5% of the lysates were used for western blot to detect the expression of V5-SPATA3 / V5-
SPATA6 and FLAG-KLHL10. The rest of the lysates were subjected to IP with anti-V5 and the binding was confirmed by western blot with anti-FLAG.
65
Figure 3. The effect of KLHL10 on the ubiquitination of SPATA3 (A) and SPATA6
(B). HEK293T cells were transfected with indicated plasmids and treated with MG132.
5% of the lysates was used for western blot to examine the transfection efficiency. The rest of the lysates was immunoprecipitated with anti-V5 followed by western blot using either anti-V5 to detect pull down efficiency or anti-HA to detect ubiquitinated SPATA3
(A) or SPATA6 (B). V5-SPATA3-(HA-UB)n and V5-SPATA6-(HA-UB)n are polyubiquitinated form of SPATA3 or SPATA6. IgG HC is IgG heavy chain of antibody.
66
Figure 4. Expression analyses of Spata3 in mouse testis. Semi-quantitative PCR analysis of
Spata3 mRNA expression in multiple tissues (A) and developing testes (B) of WT mice. β-actin was used as a loading control. (C) Western blot analysis of SPATA3 in multiple tissues of WT mice. GAPDH is used as a loading control. *labels an unspecific band which has a molecular wight (~25kDa) larger than SPATA3 (21kDa). (D) Immunofluorescence analysis of SPATA3 in testis cross sections of adult WT mouse. SPATA3 expression (green) is confined to the cytoplasm of elongated spermatids (steps 13-16). Blue represents DAPI staining of nuclei of testicular cells, and stages are marked with Roman numerals.
67
Figure 5. Expression analyses of Spata6 in mouse testis. Semi-quantitative PCR analysis of Spata6 mRNA expression in multiple tissues (A) and developing testes (C) of
WT mice. β-actin is used as a loading control. (B) Western blot analysis of SPATA6 in multiple tissues of WT mice. GAPDH is used as a loading control. (D)
Immunofluorescence analysis of SPATA6 in testis cross sections of adult WT mouse.
Green fluorescence represented SPATA6 signal and cell nuclei were counterstained with
DAPI (Blue). Stages were marked with Roman numerals. (E) SPATA6 is localized to the manchette of WT spermatids. Red fluorescence represented SPATA6 signal and β-
TUBULIN (green fluorescence) was used as a marker for manchette. Cell nuclei were counterstained with DAPI (Blue). Spermatid steps were marked with Arabic numerals on the left side of panels.
68
References:
1. Weissman AM (2001) Themes and variations on ubiquitylation. Nat Rev Mol Cell Biol 2: 169-178. 2. Glickman MH, Ciechanover A (2002) The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol Rev 82: 373-428. 3. Weissman AM, Shabek N, Ciechanover A (2011) The predator becomes the prey: regulating the ubiquitin system by ubiquitylation and degradation. Nat Rev Mol Cell Biol 12: 605-620. 4. Hershko A, Heller H, Elias S, Ciechanover A (1983) Components of ubiquitin-protein ligase system. Resolution, affinity purification, and role in protein breakdown. J Biol Chem 258: 8206-8214. 5. Komander D, Clague MJ, Urbe S (2009) Breaking the chains: structure and function of the deubiquitinases. Nat Rev Mol Cell Biol 10: 550-563. 6. Metzger MB, Hristova VA, Weissman AM (2012) HECT and RING finger families of E3 ubiquitin ligases at a glance. J Cell Sci 125: 531-537. 7. Pintard L, Willems A, Peter M (2004) Cullin-based ubiquitin ligases: Cul3-BTB complexes join the family. EMBO J 23: 1681-1687. 8. Willems AR, Schwab M, Tyers M (2004) A hitchhiker's guide to the cullin ubiquitin ligases: SCF and its kin. Biochim Biophys Acta 1695: 133-170. 9. Petroski MD, Deshaies RJ (2005) Function and regulation of cullin-RING ubiquitin ligases. Nat Rev Mol Cell Biol 6: 9-20. 10. Rajapurohitam V, Morales CR, El-Alfy M, Lefrancois S, Bedard N, et al. (1999) Activation of a UBC4-dependent pathway of ubiquitin conjugation during postnatal development of the rat testis. Dev Biol 212: 217-228. 11. Rajapurohitam V, Bedard N, Wing SS (2002) Control of ubiquitination of proteins in rat tissues by ubiquitin conjugating enzymes and isopeptidases. Am J Physiol Endocrinol Metab 282: E739-745. 12. Yan W, Ma L, Burns KH, Matzuk MM (2004) Haploinsufficiency of kelch-like protein homolog 10 causes infertility in male mice. Proc Natl Acad Sci U S A 101: 7793-7798. 13. Wang S, Zheng H, Esaki Y, Kelly F, Yan W (2006) Cullin3 is a KLHL10-interacting protein preferentially expressed during late spermiogenesis. Biol Reprod 74: 102- 108. 14. Furukawa M, He YJ, Borchers C, Xiong Y (2003) Targeting of protein ubiquitination by BTB-Cullin 3-Roc1 ubiquitin ligases. Nat Cell Biol 5: 1001-1007. 15. Pintard L, Willis JH, Willems A, Johnson JL, Srayko M, et al. (2003) The BTB protein MEL-26 is a substrate-specific adaptor of the CUL-3 ubiquitin-ligase. Nature 425: 311-316. 16. Xu L, Wei Y, Reboul J, Vaglio P, Shin TH, et al. (2003) BTB proteins are substrate- specific adaptors in an SCF-like modular ubiquitin ligase containing CUL-3. Nature 425: 316-321. 17. Arama E, Bader M, Rieckhof GE, Steller H (2007) A ubiquitin ligase complex regulates caspase activation during sperm differentiation in Drosophila. PLoS Biol 5: e251.
69
18. Kaplan Y, Gibbs-Bar L, Kalifa Y, Feinstein-Rotkopf Y, Arama E (2010) Gradients of a ubiquitin E3 ligase inhibitor and a caspase inhibitor determine differentiation or death in spermatids. Dev Cell 19: 160-173. 19. Song R, Ro S, Michaels JD, Park C, McCarrey JR, et al. (2009) Many X-linked microRNAs escape meiotic sex chromosome inactivation. Nat Genet 41: 488-493. 20. Fu JJ, Lu GX, Li LY, Liu G, Xing XW, et al. (2003) [Molecular cloning for testis spermatogenesis cell apoptosis related gene TSARG1 and Mtsarg1 and expression analysis for Mtsarg1 gene]. Yi Chuan Xue Bao 30: 25-29. 21. Li L, Liu G, Fu JJ, Li LY, Tan XJ, et al. (2009) Molecular cloning and characterization of a novel transcript variant of Mtsarg1 gene. Mol Biol Rep 36: 1023-1032. 22. Oh C, Aho H, Shamsadin R, Nayernia K, Muller C, et al. (2003) Characterization, expression pattern and chromosomal localization of the spermatogenesis associated 6 gene (Spata6). Mol Hum Reprod 9: 321-330. 23. Roest HP, van Klaveren J, de Wit J, van Gurp CG, Koken MH, et al. (1996) Inactivation of the HR6B ubiquitin-conjugating DNA repair enzyme in mice causes male sterility associated with chromatin modification. Cell 86: 799-810. 24. Liu Z, Oughtred R, Wing SS (2005) Characterization of E3Histone, a novel testis ubiquitin protein ligase which ubiquitinates histones. Mol Cell Biol 25: 2819- 2831. 25. Lu LY, Wu J, Ye L, Gavrilina GB, Saunders TL, et al. (2010) RNF8-dependent histone modifications regulate nucleosome removal during spermatogenesis. Dev Cell 18: 371-384. 26. Nian H, Zhang W, Shi H, Zhao Q, Xie Q, et al. (2008) Mouse RING finger protein Rnf133 is a testis-specific endoplasmic reticulum-associated E3 ubiquitin ligase. Cell Res 18: 800-802. 27. Kierszenbaum AL (2001) Spermatid manchette: plugging proteins to zero into the sperm tail. Mol Reprod Dev 59: 347-349. 28. Kierszenbaum AL (2002) Intramanchette transport (IMT): managing the making of the spermatid head, centrosome, and tail. Mol Reprod Dev 63: 1-4. 29. Rivkin E, Cullinan EB, Tres LL, Kierszenbaum AL (1997) A protein associated with the manchette during rat spermiogenesis is encoded by a gene of the TBP-1-like subfamily with highly conserved ATPase and protease domains. Mol Reprod Dev 48: 77-89.
70
Chapter 4
Genetic interaction of Hils1 with Tnp1 is essential for late spermiogenesis
Abstract:
Hils1 encodes a linker histone H1-like protein exclusively expressed in elongating and elongated spermatids. We generated Hils1 knockout (KO) mice and to our surprise, the KO males were fertile. Given that HILS1 expression overlaps with that of transition nuclear proteins 1 and 2 (TP1 and TP2), we explored the potential genetic interactions between Hils1 and Tnp1 or Tnp2 by generating double KO mice. While Tnp1-/- males were subfertile, both Hisl1+/-Tnp1-/- and Hils1-/-Tnp1-/- (double KO) male mice were completely infertile. A severe nuclear condensation defect was observed in step 13 spermatids from Hils1-/-Tnp1-/- mice by electron microscopy. In double KO mice, the number of epididymal sperm was highly reduced and most sperm showed abnormal morphology, with head-bent-back as the prominent defect. DNA damage and abnormal processing of protamine 2 were more severe in double KO sperm, compared to single KO sperm. However, in vitro immunopreciptiation assay did not detect the direct physical interaction between HILS1 and TP1. Compared to WT, double KO sperm had normal level of histone retention and distribution pattern of histone markers (H3K4me2 and
H3K27me3). Injection of cauda epididymal sperm from Hils1-/-Tnp1-/- mice into intact oocytes showed a normal fertilization rate, however, most zygotes didn’t develop beyond the 2-cell stage. Single cell PCR revealed that maternal mRNA degradation and embryonic gene activation were disrupted in mutant embryos. Our data suggested that
71
Hils1 genetically interacts with Tnp1 during late spermiogenesis and this interaction is essential for normal sperm production, male fertility and early embryonic development.
Keywords: late spermiogenesis, linker histone, transition nuclear proteins, histone modification, infertility, maternal to zygotic transition.
72
Introduction:
Spermiogenesis, the haploid phase of spermatogenesis, is a process during which round spermatids develop into elongated spermatids, and then highly differentiated spermatozoa. The distinct morphological changes of haploid germ cell are closely related to the alteration of nuclear chromatin organization [1,2]. Upon nuclear condensation initiating, transcription ceases and somatic histones and testis specific linker histones
(e.g. H1T, H1T2, HILS1) are gradually removed and replaced by other proteins and finally result in protamines as the major nuclear proteins [3]. Unlike somatic histones which package DNA into nucleosomes, protamines package sperm genome into a near crystalline state that results in dramatic reduction in sperm nuclear volume, to less than
5% of a somatic cell nucleus [4]. The extensive remodeling of the paternal genome also protects the paternal genome from physical and chemical damage when sperm passage through female reproductive tract.
In fish and birds, histones are directly replaced by protamines [3]. However, in mammals, histones are first replaced by intermediate proteins called transition nuclear proteins (TPs) which in turn are replaced by protamines [5]. Two major TPs, TP1 and
TP2, are present in rodent spermatids [6]. Both TP1 and TP2 are small arginine and lysine rich basic protein, with 6,200 Da and 13,000 Da molecular weight respectively.
TPs constitute about 90% of basic nuclear proteins between histone removal and protamine replacement [7,8]. While TP1 sequence is highly conserved among many mammals, TP2 is poorly conserved [7,9]. In vitro studies showed that TP1 could decrease
DNA melting temperature [10] and relax DNA into nucleosomal core particles [11], suggesting it can facilitate histone removal. TP2 can increase DNA melting temperature
73 and compacts DNA into nucleosomal cores, indicating it has function in DNA condensation [12]. While 60% of Tnp1 null mice are infertile, Tnp2 null mice are fertile but produce smaller litter size [13,14]. Surprisingly, no morphological abnormalities were detected in the sperm nuclei of Tnp2-/- mice and only subtle abnormalities were detected in Tnp1-/- mice [13,14]. Both Tnp1 and Tnp2 null mice had compromised sperm viability, progressive motility and sperm tail configuration [8]. Compared to Tnp1-/- or Tnp2-/- mice, Tnp1+/-Tnp2+/- mice had fewer defects, suggesting these two proteins do not have completely redundant functions [15].
HILS1 (histone H1-like protein in spermatids 1) is exclusively and abundantly expressed in elongating and elongated spermatids (steps 9-15) [16]. Phenogenetic analysis of HILS1 gene showed that it is closely related to H1t [16]. It can bind to the nucleosome and DNA in vitro as a linker histone with a lower affinity compared to histone H1.1[16]. Because HILS1 is expressed in late spermatids that do not contain core histones, HILS1 may have additional functions, e.g. nuclear condensation, other than being the linker histone. The disruption of Mst77F, a purported homologue of Hils1 in
Drosophila melanogaster, leads to male sterility and the nuclei remain round in mutant spermatids [17]. In addition, the levels of Hils1 transcripts in spermatozoa from asthenozoospermic men were significantly reduced compared to normozoospermic men
[18].
In this study, we first generated Hils1-/- knockout mice; however, we found that both male and female mutants have normal fertility. Given that the expression pattern of
HILS1 (steps 9-15) overlaps with the pattern of TPs (steps 10-14), we speculate that
Hils1 may genetically interact with Tnp1 or Tnp2 and participate in nuclear remodeling.
74
Therefore, double knockout mice were generated and Hils1-/-Tnp1-/- male mice were found to be completely infertile. Here, we report the characterization of the double knockout mice and abnormalities in the sperm from these animals that may affect the pre- implantation development of embryos.
75
Methods and Materials:
Histological analyses
Testes were dissected and fixed in Bouin’s solution overnight and embedded in paraffin. Sections (5um) were prepared and stained with periodic-acid Schiff.
TUNEL assay
Bouin-fixed paraffin embedded testis sections were used for TUNEL analyses of apoptotic cells by ApoTag Plus Peroxidase In Situ Apoptosis Detection Kit (Millipore,
Billerica, MA) according to the manufacturer’s instructions.
Testicular and epididymal sperm counting
Testes were homogenized in 1ml PBS for 2 min, followed by sonication to remove sonication-sensitive cells before counting the number of sonication-resistant spermatid head (steps 12-16). Caput or cauda epididymis was dissected and chopped in
PBS. After incubation at 4°C for 30 min, the released sperm were passed through a 100-
µm-pore-size filter before counting the sperm number. Hemocytometer was used for all countings.
Eosin-nigrosin staining of cauda epididymal sperm
Cauda epididymis was chopped in HTF media and incubated at 37°C for 10 min.
One drop of supernatant containing released sperm was mixed with two drop of 5% eosin
(Fertility Solutions, Cleveland, OH) and after mixing, 3 drops of 10% nigrosin (Fertility
Solutions, Cleveland, OH) was added. Then, 10ul of the mixture was smeared on pre- warmed slide and air-dried. The prepared slide was used for examination of sperm morphology under 40X microscope. For each genotype, 3 mice were used and 500 sperm were counted for each individual.
76
Electron microscopy
Testes were dissected from adult mice and placed in a Petri dish containing PBS.
Stage-specific pools of the seminiferous tubules were prepared as described [19]. The pools of tubules were fixed in cold 3% paraformaldehyde-3% glutaraldehyde in 0.1 M cacodylate buffer containing 0.2% picric acid (pH 7.4) for 2 hr at room temperature and then post-fixed in 1.0% OsO4 in 0.1 M cacodylate buffer (pH 7.2-7.4) for 1 hr.
Dehydration, embedding, sectioning, and staining of samples were performed as previously described [20].
Nuclear protein isolation and acid-urea gel electrophoresis
Epidydimal sperm nuclei were prepared as described by [14]. Cauda epididymides were chopped in PBS to allow the releasing of sperm. The released sperm were then filtered through 100-µm-pore-size filter and pelleted. After resuspension in water containing protease inhibitors, sperm were sonicated and the nuclei were purified by centrifugation through 5% sucrose in a 0.2X concentration of MP buffer (5 mM
MgCl2, 5 mM sodium phosphate, pH 6.5) with 0.25% Triton X-100 at 740 g for 5 min.
Purified nuclei were dissolved in guanidine hydrochloride and DTT. After sonication, proteins were isolated with urea, mercaptoethanol, and NaCl [21]. DNA was precipitated by adding HCl to 0.5 M. After centrifugation, the supernatant was dialyzed against 0.1M
HCl and then protein was precipitated with TCA. Half of the isolated proteins were aminoethylated by incubation with ethyleneimine to allow separation of P1 and mature
P2 [22]. Proteins were then electrophoresed in acid-urea-18% polyacrylamide gel and stained with Coomassie blue.
Western blot analysis of sperm histone retention
77
Sperm were squeezed from cauda epididymis in PBS and filtered through 100-
µm-pore-size filter. After pelleting, sperm were resuspended in somatic cell lysis buffer
(0.1% SDS, 0.5% Triton X-100) to get rid of somatic cells. After washing twice in PBS, sperm number was counted using hemocytometer counting chamber. Sperm were resuspended in SDS loading buffer at a final concentration of 2x104 sperm/ul. Equal number of sperm (2x105) from each sample was loaded on SDS-PAGE and subjected to western blot as described [23]. Primary antibodies used were rabbit anti-γ-H2A.X
(1:1000 dilution, Abcam, Cambridge, MA), rabbit anti-H3K9me3 (1:1000 dilution,
Abcam, Cambridge, MA), rabbit anti-H3K4me3 (1:250 dilution, Abcam, Cambridge,
MA) and rabbit anti-H3 (1:500 dilution).
Acridine orange (AO) staining
Cauda epididymis was chopped in HTF medium and incubated at 37°C for 10 min. The supernatant containing sperm was used to make medium thick smears on slides.
The slides were fixed in freshly prepared Carnoy solution (3 parts methanol/1 part glacial acetic acid) for 2 hours and air-dried before staining. After staining with 0.019% AO solution (Polysciences, Warrington, PA) for 5 minutes, the slides were gently rinsed in a stream of deionized water and then mounted with Aqua-Mount slide mounting media
(Fisher Scientific, Pittsburgh, PA). Samples were examined on a fluorescence microscope. For each genotype, 3 mice were used and 300 sperm were counted for each individual to quantify the percentage of sperm with green, yellow or red fluorescence.
Constructs generation and co-immunoprecipitation assay
The whole coding region of Tnp1 was amplified from testis cDNA of an adult wild-type mouse by PCR and then subcloned into a pcDNATM3.1/V5-His TOPO® TA
78 vector according to the manufacturer's instructions (Invitrogen, Grand Island, NY). Then, after enzyme digestion, the Tnp1 fragment was inserted into the multiple cloning site of p3XFLAG-Myc-CMVTM-26 expression vector (Sigma, St. Louis, MO) to generate the
FLAG-tagged TP1 expression plasmid. V5-tagged HILS1 expression plasmid was generated by inserting the PCR amplified full length Hils1 fragment into pcDNATM3.1/V5-His TOPO® TA vector.
HEK293T cells were cultured in Dulbecco's Modified Eagle Medium (Invitrogen,
Grand Island, NY) supplemented with 10% fetal bovine serum (Atlanta Biologicals,
TM Lawrenceville, GA) in a 37°C incubator with 5% CO2. p3XFLAG-Myc-CMV -26-TP1 and pcDNATM3.1/V5-His-HILS1 were co-transfected into HEK293T cells using
Lipofectamine 2000 according to the manufacturer’s instructions (Invitrogen, Grand
Island, NY). Co-immunoprecipitation assay was performed using Immunoprecipitation
Kit (Protein G) (Roche, South San Francisco, CA). Briefly, 24 h after transfection, cells were lysed in a buffer containing 50mM Tris-HCl (pH7.5), 150mM NaCl, 1% Nonidet
P40 and 0.5% sodium deoxycholate supplemented with protease inhibitor cocktail
(Roche, South San Francisco, CA). One ug of antibody was added into the cell lysates and incubated for 2 h at 4°C. Then protein G agarose was added into the lysates and incubated overnight at 4°C under continuous rotation. After washing, bound proteins were eluted from the agarose by heating the samples for 10 min in a SDS-loading buffer.
The eluates were then subjected to SDS-PAGE and western blot as described [23]. The antibodies used for immunoprecipitation and western blot were mouse monoclonal anti-
V5 (Invitrogen, Grand Island, NY) and mouse monoclonal anti-FLAG (Sigma, St. Louis,
MO).
79
Immunofluorescent microscopy
Testes were dissected and fixed in 4% paraformaldehyde in PBS (pH 7.4) for 2 hr at room temperature. The fixed testes were then incubated with serial sucrose solutions with increasing concentration from 5% to 20% followed by incubation in 20% sucrose in
PBS overnight at 4°C. The testes were then embedded in OCT and 20% sucrose mixture with a volume ratio of 1:1. Cryosections of 10um were permeabilized and washed in PBS for three times, followed by blocking with 1% BSA in PBS for 1hr at room temperature.
Sections were incubated with rabbit anti-Kcr (1:500 dilution) in a humidity box overnight at 4°C. After three times washing in PBS, samples were incubated with secondary antibody at 1:500 dilution for 1 hr at room temperature. Samples were mounted with
Aqua mounting medium with DAPI (Vector Labs, Burlingame, CA) and stored in dark at
4°C. The images were captured using a confocal laser scanning system (Olympus,
FV1000).
Cross-linked chromatin immunoprecipitation (ChIP)
Sperm collected from cauda epididymis were lysed in somatic cell lysis buffer
(0.1% SDS, 0.5% Triton X-100) to get rid of contaminating somatic cells. After washing twice in PBS, sperm number was counted using hemocytometer counting chamber. 1x107 sperm were used for one ChIP. Fixation was performed with 0.5% formaldehyde for 10 min at RT, followed by adding 125mM glycine to quench formaldehyde cross-linking.
After washing twice in PBS, sperm was lysed in the lysis buffer (1%SDS, 10mM EDTA,
10mM DTT, 50mM Tris, pH8.1) for 1 hr at RT. Sonication was performed using a bioruptor (Diagenode UCD-200) to obtain sheared chromatin with fragment size of 300-
1000 bp. Chromatin immunoprecipitation was performed using ChIP Assay Kit
80
(Millipore, Billerica, MA) according to the manufacturer's instructions. Antibodies used for ChIP were: rabbit α-H3K4me2 (Millipore, Billerica, MA) and rabbit α-H3K27me3
(Millipore, Billerica, MA). After reverse cross-linking and proteinase K digestion, DNA was purified using QIAquick PCR Purification Kit (QIAGEN, Valencia, CA). Real-time
PCR was performed using the SYBR Green PCR Master Mix (Applied Biosystems,
Carlsbad, CA) on the 7900HT Fast Real-Time PCR machine (Applied Biosystems,
Carlsbad, CA). Results were calculated by a percent input method and 1% of starting chromatin was used as input. Primers used were according to a previous report [24].
Intracytoplasmic sperm injection (ICSI)
ICSI was performed as described [25,26], with some modifications. Briefly, sperm was collected from cauda epididymis in 500µl Hepes-CZB and pelletted at 700 g for 5 min. The sperm pellet was resuspended in 200µl NIM/PVA medium and sonicated to separate sperm head and tail. 1-2 µl of sperm suspension was then mixed with 50µl
NIM/PVA medium. Single sperm head was picked and injected into WT oocyte by Piezo electric power manipulator at room temperature. Oocytes following ICSI were transferred to KSOM+AA medium under mineral oil and cultured in a 37°C incubator with 5% CO2.
Single cell PCR
Oocyte, 2PN (two-pronuclear zygote) and 2-cell embryo were collected from
ICSI using a mouth pipette aided by a finely pulled glass tip. Cell lysis, sequence specific reverse transcription and cDNA amplification were performed using CellsDirectTM One-
Step qRT-PCR Kit (Invitrogen, Grand Island, NY) according to the manufacturer's instructions. Gene expression profile was examined using SYBR Green-based real-time quantitative PCR on a 7900HT Fast Real-Time PCR machine (Applied Biosystems,
81
Carlsbad, CA). Primers used were listed in Table S1. Actb was used as an internal control.
82
Results
Normal testicular morphology of Hils1-Tnp1 mutant mice
In order to investigate the physiological role of Hils1 in vivo, Hils1 knockout
(KO) mice were generated. The body weight and growth rate of Hils1-/- mice were normal compared with WT mice. Both female and male Hils1-/- mice we generated had normal fertility. Given the similar spatiotemporal expression pattern between HILS1 and
TP1/TP2 (Transition nuclear proteins 1/2), we hypothesized that HILS1 may genetically interact with TP1 or TP2 during late spermiogenesis. Therefore, we generated Hils1-/-
Tnp1-/- and Hils1-/-Tnp2-/- double KO mice by intercrossing Hils1-/- with Tnp1-/- or Tnp2-/- mice. While Hils1-/-Tnp2-/- males showed similar fertility to Tnp2-/- males, both Hils1-/-
Tnp1-/- and Hils1+/-Tnp1-/- males were completely infertile. There were no pups delivered from five Hils1+/-Tnp1-/- and five Hils1-/-Tnp1-/- adult male mice mated with WT females.
Western blot analyses confirmed the complete absence of HILS1 and TP1 protein in
Hils1-/-Tnp1-/- testes (Figure S1).
Compared to WT and single KOs, the testis weights and sperm counts were not reduced in Hils1-/-Tnp1-/- mice (Table 1). Light microscopic examination of the testes from Hils1-/-Tnp1-/- showed robust spermatogenesis similar to WT and single KOs
(Figure 1A). Hils1 and Tnp1 are only expressed in elongating and elongated spermatids, therefore, the knockout of both genes were not likely to affect earlier steps of spermatogenesis. TUNEL assay revealed that only a few apoptotic germ cells in Hils1-/-
Tnp1-/- testis cross-sections, which were indistinguishable from WT (Figure 1B).
Therefore, germ cell apoptosis is not the cause of impaired male fertility of Hils1-/-Tnp1-/- mutant.
83
Abnormalities of cauda epididymal sperm from Hils1-Tnp1 mutants
Because HILS1 and TP1 are only expressed in steps 9-15 and 10-14 spermatids respectively, the knockout of both genes would mostly affect mature sperm. Indeed, the caput and cauda epididymal sperm counts showed about 50% decrease in Hils1-/-Tnp1-/-, compared to WT and single KOs (Table 1). To examine the abnormalities of mature sperm in Hils1-/-Tnp1-/- mice, we performed eosin-nigrosin staining of cauda epididymal sperm. This staining distinguishes live and dead sperm based on the integrity of sperm membrane and also allows examination of sperm morphology. Sperm abnormalities were classified into four major categories: the sperm head-bent-back onto midpiece, the principle piece folding at different angles, the cytoplamic droplet located on the midpiece and the cytoplamic droplet located below the midpiece and principle piece junction.
The majority of WT and Hils1-/- sperm were viable (95.2% and 95.6% respectively) and of those, most sperm had normal shape (Figure 2A). The percentage of head-bent-back onto midpiece accounted for 4.4% in WT and 2.3% in Hils1-/- (Figure
2A). The number of sperm with principle piece folding was slightly increased in Hils1-/- to 7.1% compared to 0.9% in WT (Figure 2A). The relatively normal morphology of
Hils1-/- sperm is consistent with the normal male fertility of Hils1-/- mice. However, the percentage of viable sperm was decreased to 39.7% in Tnp1-/-, and even worse in Hils+/-
Tnp1-/- and Hils1-/-Tnp1-/- (to 21.9% and 21.6% respectively) (Figure 2A). In both Tnp1-/- and double KOs, most live sperm showed severe shape abnormalities, with head-bent- back onto midpiece as the dominant defect. The dislocation of cytoplamic droplet was a relatively rare defect in mutants.
84
Most sperm were dead in Tnp1-/-, Hils+/-Tnp1-/- and Hils1-/-Tnp1-/- mice (60.3%,
78.1% and 78.4% respectively). The head-bent-back was the major phenotype seen in the dead sperm of mutants. In Tnp1-/-, 27.4% sperm showed head-bent-back and it increased to ~63% in both Hils+/-Tnp1-/- and Hils1-/-Tnp1-/- (Figure 2B). Interestingly, the head- bent-back phenotype was also detected in mice deficient of Spem1, however to more severe extent, all sperm in Spem1-/- showed head-bent-back and the wrapping of the tail around the bent head [20]. However, western blot analyses of total testis lysate did not detect the difference in SPEM1 expression levels among WT, Hils1-/-, Tnp1-/-, Hils+/-
Tnp1-/- and Hils1-/-Tnp1-/- (Figure S1), which suggests that HILS1 and TP1 may affect cytoplasm removal by the pathway different from SPEM1.
Abnormalities in chromatin condensation in spermatids from Hils1-Tnp1 mutant mice
Light microscopic examination of testicular histology of Hils1-/-Tnp1-/- did not reveal any abnormalities regarding spermatid elongation and head condensation; therefore, electron microscopy was used to examine chromatin condensation in mutant spermatids. At step 11, chromatin condensation had not occurred in the spermatid heads from both WT and mutants, and chromatin appeared as fine filament-like structure (panel a-d in Figure 3A). During step 12 to step 13, chromatin condensation took place in WT and chromatin fibers were thickened and moved closer to each other (panel e in Figure
3A). During this stage, dramatic abnormalities of chromatin condensation were observed in the nuclei of Hils1-/-, Tnp1-/- and Hils1-/-Tnp1-/- sperm (panel f-h in Figure 3A). As previously reported [13], rod shaped chromatin condensation units were observed in the nuclei of condensing sperm of Tnp1-/- (panel f in Figure 3A). In Hils1-/-, snowflake-like
85 structures that looked less condensed than rod-shaped structures were dispersed through the nuclei (panel g in Figure 3A). Hils1-/-Tnp1-/- sperm displayed similar condensation defects as Tnp1-/-, showed by the rod-shaped chromatin condensation units within nuclei
(panel h in Figure 3A). During step 13 to step 14, the most dramatic condensation occurred in the sperm heads of both WT and mutants (panel i-l in Figure 3A) and after step 14, when chromatin became too darkly stained, it was difficult to observe any defects in mutants (panel m-p in Figure 3A).
In Hils1-/- and Tnp1-/- mutants, most epididymal sperm showed relatively highly condensed chromatin compared to WT (panel r and s in Figure 3A). However, in Hils1-/-
Tnp1-/- mutants, we observed numerous epididymal sperm with severe defects, e.g. sperm with swollen heads and cytoplasm surrounding it (panel a in Figure 3B), sperm which had rod-shaped chromatin condensation units within their head (panel b in Figure 3B), sperm that had a distorted head shape (panel c in Figure 3B) and sperm that had a disrupted nuclear membrane as well as disordered nuclear material (panel d in Figure
3B).
Abnormal P2 processing and increased DNA damage in Hils1-Tnp1 mutant mice
In mature sperm, protamine 1 (P1) and protamine 2 (P2) are the most abundant nuclear proteins packaging the male genome. It has been reported that elevated levels of premature P2 concomitant with the increased ratio of P1/P2 are related to male infertility in human patients [27,28]. Therefore, we isolated basic proteins from cauda epididymal sperm and examined the P2 processing. Our results showed that P2 processing was complete in WT, with all P2 in mature form (Figure 4). In Tnp1-/-, intermediate precursor forms of P2 were present, with preP2/11, preP2/16 and preP2/20 as predominant forms
86
(Figure 4), which is consistent with a previous report [13]. In Hils1-/-, partially processed
P2 was present, although in smaller quantities compared to Tnp1-/- (Figure 4). Both Hils+/-
Tnp1-/- and Hils1-/-Tnp1-/- mutants displayed a similar P2 processing abnormality compared with Hils1-/- and Tnp1-/- (Figure 4). Therefore, our result suggests that both
Hils1 and Tnp1 are required for normal P2 processing and the elevated level of premature
P2 in Hils1-/-Tnp1-/- sperm might contribute to the infertility.
Perturbation of the P1/P2 ratio, which is mostly caused by an elevated level of premature P2, is associated with low sperm count, decreased sperm motility, and increased DNA damage [28-32]. Therefore, we used acridine orange (AO) staining to examine DNA damage in epididymal sperm of Hils1-Tnp1 mutants. AO is a metachromatic fluorochrome that can fluoresces red when bound to single-stranded DNA and green when bound to double-stranded DNA. AO staining of sperm nuclei after acid denaturation provides a measurement of DNA denaturability. All WT sperm showed green fluorescence (Figure 5), indicating all DNA was kept in double-stranded form.
Similar to WT, all Hils1-/- sperm showed green fluorescence (Figure 5), suggesting no
DNA damage happened when Hils1 is deleted. However, about 5% red sperm and 12% yellow sperm were observed in Tnp1-/- mice (Figure 5). The amount of sperm fluorescing red and yellow increased to 9% and 20% respectively in Hils-/-Tnp1-/-, indicating a greater susceptibility of DNA to denaturation compared to Tnp1-/- (Figure 5).
No interaction between HILS1 and TP1
Given that HILS1 expression overlaps with that of TP1, we performed in vitro immunoprecipitation assay to examine whether HILS1 physically interacts with TP1.
Constructs that expressed V5-tagged HILS1 and FLAG-tagged TP1 were co-transfected
87 into HEK293T cells. Immunoprecipitation of HILS1 using anti-V5 did not result in co- purification of FLAG-tagged TP1 (Figure S2), suggesting HILS1 did not directly interact with TP1 in vitro.
Histone modification pattern in Hils1-Tnp1 mutant sperm
Although protamines are the major nuclear proteins associated with DNA in mature sperm, histones have been reported to reside at specific sequences in human and mouse spermatozoa [33-37]. An abnormal P1/P2 ratio resulting from aberrant P2 processing might disturb the retention of histones. Therefore, we first examined whether histone retention level is altered in the mature sperm from Hils1-/-Tnp1-/- mice. Our result showed that the level of γ-H2A.X, H3K9me3, H3K4me3 and H3 were not changed in
Hils1-/-Tnp1-/- sperm compared to WT (Figure S3).
Recently, two histone modifications, Histone H3 Lys4 dimethylation (H3K4me2) and histone H3 Lys27 trimethylation (H3K27me3), were reported to differentially mark the promoter region of genes that are relevant in development, spermatogenesis and cellular homeostasis [24]. H3K4me2 and H3K27me3 are distinct modifications associated with transcription activation and repression, respectively [38-40]. ChIP assay was performed to examine whether the enrichment pattern of these two histone modifications were changed in Hils1-/-Tnp1-/- sperm. In both WT and Hils1-/-Tnp1-/- sperm, we observed that H3K4me2 was enriched on housekeeping genes and some of the developmental regulators, and H3K27me3 mostly marked developmental regulators
(Figure 6). In addition, neither H3K4me2 nor H3K27me3 showed strong enrichment on the promoters of spermatogenesis associated genes (Figure 6). No significant differences of distribution of these two marks were detected between WT and Hils1-/-Tnp1-/-,
88 indicating that the depletion of TP1 and HILS1 doesn't affect H3K4me2 and H3K27me3 targeting loci in sperm. Another histone modification, Kcr (histone lysine crotonylation) was recently discovered to mark either active promoters or potential enhancers [41]. Kcr was highly enriched in sex chromosomes and specifically marked testis-specific genes in round spermatids, and it has genome wide distribution following the general shutdown of transcription in elongating spermatids [41]. Immunofluorescence was performed to examine whether Kcr distribution was altered in spermatid nuclei of Hils1-/-Tnp1-/-. As shown in Figure S4, histone Kcr had similar enrichment pattern in WT, Tnp1-/- and Hils1-
/-Tnp1-/- germ cells. As previously reported, Kcr staining was confined in a single dot-like structure within the nuclei of round spermatids (steps 2-8) while it universally labeled the whole genome in elongating serpmatids (steps 9-12) (Figure S4). Our results indicate that
Kcr distribution in germ cells was not affected by deletion of Hils1 and Tnp1.
Impaired embryonic development of mutant sperm following ICSI
Hils1-/-Tnp1-/- mutant males were sterile by natural mating; therefore ICSI is required for studying the fertilization ability of mutant sperm and the developmental potential of mutant sperm nuclei within oocyte. Our result showed that Hils1-/-Tnp1-/- sperm could successfully fertilize WT oocytes and form distinct paternal and maternal pronuclei. The fertilization rate (~70%) is comparable to WT (~80%) (Table 2).
However, defects were detected during the maternal to zygotic transition (MZT) stage.
Only 35% of mutant zygotes developed into 2-cell embryos, compared to 80% of WT.
Most of the mutant zygotes were arrested in 2PN (two-pronuclear zygote) stage with separated paternal and maternal genome. For mutant 2-cell embryos, only 6% of them reached blastocyst stage, compared to 44% of WT. The defects are very distinct from
89
Tnp1-/- mutants, whose sperm were capable of fertilizing oocytes by ICSI and progress through normal development to blastocyst stage [15]. For continued development, two major functions need to be executed during MZT: the oocyte-specific transcripts need to be largely degraded by the 2-cell stage and novel transcripts that are not expressed in oocyte need to be activated. To examine whether these two events are disrupted in mutant zygotes and embryos, we performed single cell PCR to compare the transcription profile between WT and mutant. We examined the mRNA expesssion levels of 43 genes, including oocyte-specific genes, embryo-specific genes and genes studied in ChIP assay.
These genes are grouped into two sets based on their expression pattern in WT samples: set one with decreased or completely abolished expression in 2-cell embryos compared to oocytes and set two with increased expression in 2-cell embryos compared to oocytes
(Figure 7). As shown in Figure 7, although the expression levels of maternal transcripts were similarly decreased in both WT and mutant 2-cell stage; most of them were significantly higher in mutant 2PN compared to WT 2PN (Figure 7). In addition, compared to WT, the expression of most novel transcripts was highly reduced in mutant
2-cell embryos (Figure 7). Our results indicate that mutant 2PN zygotes cannot efficiently degraded maternal transcripts and the zygotic genome cannot be fully activated in mutant
2-cell embryos.
90
Discussion:
Linker histones usually have more than one form within a species and they are less conserved between organisms compared to core histones. The study of somatic linker histones has revealed that many organisms could live without linker histone H1, which might be due to the presence of multiple H1 subtypes encoded by separate genes [42].
Tissue-specific linker histones have been identified in both testis (H1t, H1t2, Hils1) and oocyte (H1foo). Hils1 knockout (KO) mice we generated in this study showed normal fertility similar to WT mice, however, Hils1-/-Tnp1-/- mice were completely infertile, indicating a coordinated function between Hils1 and Tnp1 is crucial for male fertility.
Although the number of mature sperm was normal in both Hils1-/- and Tnp1-/- males, it was significantly reduced in Hils1-/-Tnp1-/- males. Chromatin condensation defect in step13 spermatids of Hils1-/-Tnp1-/- mice was similar to Tnp1-/- with rod-shaped condensation units in the nuclei. However, more severe defects were frequently observed in the nuclei of epididymal sperm from Hils1-/-Tnp1-/- mice, which is not seen from Hils1-
/-and Tnp1-/- mice (Figure 3). The less condensed chromatin in the nuclei of Hils1-/-Tnp1-/- sperm might be due to the deposition of abnormal P2 in sperm genome and deletion of either Hils1 or Tnp1 could affect the normal P2 processing (Figure 4). DNA integrity was comprimized in Hils1-/-Tnp1-/- sperm shown by the presence of DNA double-strand breaks (Figure 5) and it is more severe than the single KOs. In addition, tail configuration was also disrupted in both Tnp1-/- and Hils1-/-Tnp1-/- mature sperm and
Hils1-/-Tnp1-/- sperm has a two-fold increase in the head-bent-back phenotype (Figure 2).
Although direct physical interaction of HILS1 and TP1 was not detected, Hils1-/-Tnp1-/-
91 males always have more severe phenotypic defects compared to any of the single KOs, suggesting Hils1 and Tnp1 have genetic interaction during late spermiogenesis.
The deletion of Hils1 and Tnp1 not only disrupts the production of normal sperm, but also comprimizes the development of early embryos following ICSI. Unlike Tnp1-/- sperm, which were able to facilitate the development of oocytes into blastocysts following ICSI [15], ooctyes injected with double KO sperm cannot progress through the maternal-zygotic transition (MZT). Defects in both maternal mRNA degradation and embryonic gene activation prevent the continued development of mutant embryos. It is interesting to explore how deletion of Hils1 and Tnp1 results in arrest of embryos. It is reported that any perturbations in epigenetic modifications or in DNA integrity will affect early embryonic development [43]. Epigenetic modifications includes DNA methylation and histone modification [43]. It is unlikely that DNA methylation is disrupted in double
KO sperm, because the DNA methylation pattern has already been determined during the time when primordial germ cells reach the genital ridge [44-47]. About 1-2% of mouse genome is associated with nucleosomes in mature sperm and the histone-bound DNA is shown to associated with gene-dense regions and enriched for developmentally regulated promoters [48]. The examination of histone modification in this study did not reveal any difference between WT and double KO. However, the number of genes we selected is limited; therefore, it is helpful to examine the histone modification pattern at a genome wide level. In addition, DNA integrity is likely to be comprimized in double KO sperm shown by the increased DNA double-strand break (Figure 5). This damage could be fatal to the mature sperm because they lack a repair system [43]. It is not clear how DNA damage occured in Tnp1-/- and Hils1-/-Tnp1-/- sperm, perhaps the incomplete condensed
92
DNA is not sufficiently protected by protamines and susceptible to endonucleases during the last steps of spermiogenesis and epididymal transport [27,49].
The results from this study are informative for both clinical diagnostics of male infertility and assisted reproductive technologies. Infertility due to male factors is commonly treated by ICSI. The defective sperm from infertile men are usually characterized as having decreased motility, elevated levels of premature P2, loss of membrane integrity and DNA damage with unknown etiology [27,50-52]. The similarity of poor sperm found in both infertile men and Hils1-Tnp1 mutants indicates these defects can be caused by deletion of a few specific genes, like Hils1 and Tnp1. Additionally, the suitability of using these defective sperm for ICSI should be considered because poor
DNA integrity can affect the outcome of ICSI with decreased fertilization and pregnancy rate [43] .
93
Figure 1. Normal spermatogenesis in Hils1-/-, Tnp1-/- and Hils1-/-Tnp1-/- testes. (A)
Periodic acid/Schiff reagent stained testis cross-sections of wild type (WT), Hils1-/-,
Tnp1-/- and Hils1-/-Tnp1-/- mice. All mutant testes showed robust spermatogenesis like
WT. (B) TUNEL analyses of apoptotic cells. Only a few TUNEL positive germ cells
(arrows) are detected in the cross sections from both WT and Hils1-/-Tnp1-/- testes.
(Bar=20um)
94
Figure 2. Examination of tail abnormalities of cauda epididymal sperm from Hils1-
Tnp1 mutant mice using eosin-nigrosin staining. Upper panel showed five categories of sperm morphology. Hand drawings (left) represent sperm morphology observed after eosin-nigrosin staining (right). Lower panel is the quantification of each category in live
(A) or dead (B) sperm. Total number of live and dead sperm was normalized to 100%.
95
Figure 3. Chromatin condensation defects of Hils1-Tnp1 mutant spermatids visualized by electron microscopy. (A) Comparison of spermatid nuclear condensation among WT, Hils1-/-, Tnp1-/- and Hils1-/-
Tnp1-/- mice. (Magnifications: a, i-l, p,q 19000X; b 34000X; c-g, m-o 13500X; h 10500X; r-t 25000X) (B)
Abnormal epididymal sperm observed from Hils1-/-Tnp1-/- mutant. (Magnifications: a 135000X; b, d
25000X; c19000X)
96
Figure 4. Acid-urea gel of basic nuclear proteins of epididymal sperm from WT,
Hils1-/-, Tnp1-/-, Hils1+/-Tnp1-/- and Hils1-/-Tnp1-/- mice. preP2/11, preP2/16 and preP2/20 represent premature P2 forms generated by proteolytic cleavage before the 11th,
16th and 20th amino acids. Part of the basic nuclear proteins was treated with ethyleneimine to separate P1 and mature form of P2.
97
Figure 5. Acridine Orange (AO) staining of sperm nuclei collected from cauda epididymis. Upper panel are images of sperm nuclei stained with AO. Lower panel is quantification of sperm number in each category. Green, yellow and red bars represent the percentage of sperm with green, yellow and red fluorescence respectively.
98
Figure 6. Normal distribution of H3K4me2 and H3K27me3 on gene promoters in
Hils1-/-Tnp1-/- sperm (B) compared to WT (A). Results are represented as a percentage of the material immunoprecipitated from input chromatin, which is determined by the
SYBR Green-based real-time PCR analyses. 3 replicates were done for each ChIP assay.
Genes were selected based on a previous report [24].
99
Figure 7. Transcript profile of genes in WT oocyte, WT 2PN, KO (Hils1-/-Tnp1-/-)
2PN, WT 2-cell and KO 2-cell after ICSI. Genes in set 1 are those have decreased expression in WT 2PN or WT 2-cell embryos compared to WT oocytes. Genes in set 2 are those have higher expression in WT 2-cell embryos compared to WT oocytes.
100
Genotype Testis weight, Sperm heads Sperm per Sperm per mg per testis, Caput epididymis, cauda epididymis, x106 x106 x106 WT 112.5±1.1 16.09±1.82 2.6±0.35 13.32±1.32 Hils1-/- 119.3 ±1.8 16.81±1.09 2.74±0.18 14.58±2.68 Tnp1-/- 142.1 ±3.2 26.33±1.45 3.59±0.78 14.53±1.19 Hils1-/-Tnp1-/- 134.6 ±4.2 18.76±1.15 1.24±0.09* 6.57±0.2*
Table 1 Testis weights and sperm counts of Hils1-Tnp1 mutant males
Mice (n=5) were used at age of 8 weeks to 24 weeks. All values are means ± standard errors. * P<0.05 calculated by student T-test.
101
No. of No. of No. NO. of 2-cell Blastocysts/2 oocyte 2PN/Total No. of Genotype experiments of 2-cell embryos/2PN cell embryos surviving oocyte (%) blastocysts 2PN embryos (%) (%) ICSI
WT 7 128 103 80.47 82 79.61 36 43.91
Hils1-/- 5 73 51 69.86 18 35.29* 1 5.56* Tnp1-/-
Table 2 Abnormal developmental capability of epididymal spermatozoa from Hils1-
/-Tnp1-/- mice assessed by Intracytoplasmic Sperm Injection (ICSI)
* P<0.05 calculated by student T-test.
102
Figure S1 Western blot analyses of TP1, HILS1, TP2, PRM2, and SPEM1 expression in WT, Hils1-/-, Tnp1-/-, Hils1+/-Tnp1-/- and Hils1-/-Tnp1-/- mouse testes.
103
Figure S2 HILS1 did not physically interact with TP1. HEK293T cells were co- transfected with plasmids expressing FLAG-tagged TP1 and V5-tagged HILS1. 5% of the lysates were subjected to western blot to examine the transfection efficiency. The rest of the lysates were subjected to IP with anti-V5 and the binding was examined by western blot with anti-FLAG.
104
Figure S3 Western blot analyses of histone retention in WT and Hils1-/-Tnp1-/- sperm.
105
Figure S4 Detection of histone Kcr (lysine crotonylation) in WT, Tnp1-/-, and Hils1-/-
Tnp1-/- adult mouse testes by immunofluorescence. Red represents Kcr signal and blue represents DAPI staining. Stages are marked with Roman numerals. (Bar=40um)
106
References:
1. Fawcett DW, Anderson WA, Phillips DM (1971) Morphogenetic factors influencing the shape of the sperm head. Dev Biol 26: 220-251. 2. Dooher GB, Bennett D (1973) Fine structural observations on the development of the sperm head in the mouse. Am J Anat 136: 339-361. 3. Oliva R, Dixon GH (1991) Vertebrate protamine genes and the histone-to-protamine replacement reaction. Prog Nucleic Acid Res Mol Biol 40: 25-94. 4. Wyrobek AJ, Meistrich ML, Furrer R, Bruce WR (1976) Physical characteristics of mouse sperm nuclei. Biophys J 16: 811-825. 5. Wouters-Tyrou D, Martinage A, Chevaillier P, Sautiere P (1998) Nuclear basic proteins in spermiogenesis. Biochimie 80: 117-128. 6. Grimes SR, Jr., Meistrich ML, Platz RD, Hnilica LS (1977) Nuclear protein transitions in rat testis spermatids. Exp Cell Res 110: 31-39. 7. Alfonso PJ, Kistler WS (1993) Immunohistochemical localization of spermatid nuclear transition protein 2 in the testes of rats and mice. Biol Reprod 48: 522-529. 8. Meistrich ML, Mohapatra B, Shirley CR, Zhao M (2003) Roles of transition nuclear proteins in spermiogenesis. Chromosoma 111: 483-488. 9. Kremling H, Luerssen H, Adham IM, Klemm U, Tsaousidou S, et al. (1989) Nucleotide sequences and expression of cDNA clones for boar and bull transition protein 1 and its evolutionary conservation in mammals. Differentiation 40: 184- 190. 10. Akama K, Sato H, Hasegawa S, Shimada I, Nakano M (1998) Transition protein 1 from boar late spermatid nuclei having DNA-melting activity is a dimeric protein. Biochem Mol Biol Int 44: 315-323. 11. Singh J, Rao MR (1988) Interaction of rat testis protein, TP, with nucleosome core particle. Biochem Int 17: 701-710. 12. Baskaran R, Rao MR (1990) Interaction of spermatid-specific protein TP2 with nucleic acids, in vitro. A comparative study with TP1. J Biol Chem 265: 21039- 21047. 13. Yu YE, Zhang Y, Unni E, Shirley CR, Deng JM, et al. (2000) Abnormal spermatogenesis and reduced fertility in transition nuclear protein 1-deficient mice. Proc Natl Acad Sci U S A 97: 4683-4688. 14. Zhao M, Shirley CR, Yu YE, Mohapatra B, Zhang Y, et al. (2001) Targeted disruption of the transition protein 2 gene affects sperm chromatin structure and reduces fertility in mice. Mol Cell Biol 21: 7243-7255. 15. Shirley CR, Hayashi S, Mounsey S, Yanagimachi R, Meistrich ML (2004) Abnormalities and reduced reproductive potential of sperm from Tnp1- and Tnp2- null double mutant mice. Biol Reprod 71: 1220-1229. 16. Yan W, Ma L, Burns KH, Matzuk MM (2003) HILS1 is a spermatid-specific linker histone H1-like protein implicated in chromatin remodeling during mammalian spermiogenesis. Proc Natl Acad Sci U S A 100: 10546-10551. 17. Jayaramaiah Raja S, Renkawitz-Pohl R (2005) Replacement by Drosophila melanogaster protamines and Mst77F of histones during chromatin condensation
107
in late spermatids and role of sesame in the removal of these proteins from the male pronucleus. Mol Cell Biol 25: 6165-6177. 18. Jedrzejczak P, Kempisty B, Bryja A, Mostowska M, Depa-Martynow M, et al. (2007) Quantitative assessment of transition proteins 1, 2 spermatid-specific linker histone H1-like protein transcripts in spermatozoa from normozoospermic and asthenozoospermic men. Arch Androl 53: 199-205. 19. Kotaja N, Kimmins S, Brancorsini S, Hentsch D, Vonesch JL, et al. (2004) Preparation, isolation and characterization of stage-specific spermatogenic cells for cellular and molecular analysis. Nat Methods 1: 249-254. 20. Zheng H, Stratton CJ, Morozumi K, Jin J, Yanagimachi R, et al. (2007) Lack of Spem1 causes aberrant cytoplasm removal, sperm deformation, and male infertility. Proc Natl Acad Sci U S A 104: 6852-6857. 21. Balhorn R, Gledhill BL, Wyrobek AJ (1977) Mouse sperm chromatin proteins: quantitative isolation and partial characterization. Biochemistry 16: 4074-4080. 22. Balhorn R, Weston S, Thomas C, Wyrobek AJ (1984) DNA packaging in mouse spermatids. Synthesis of protamine variants and four transition proteins. Exp Cell Res 150: 298-308. 23. Wang S, Zheng H, Esaki Y, Kelly F, Yan W (2006) Cullin3 is a KLHL10-interacting protein preferentially expressed during late spermiogenesis. Biol Reprod 74: 102- 108. 24. Brykczynska U, Hisano M, Erkek S, Ramos L, Oakeley EJ, et al. (2010) Repressive and active histone methylation mark distinct promoters in human and mouse spermatozoa. Nat Struct Mol Biol 17: 679-687. 25. Kimura Y, Yanagimachi R (1995) Development of normal mice from oocytes injected with secondary spermatocyte nuclei. Biol Reprod 53: 855-862. 26. Stein P, Schultz RM (2010) ICSI in the mouse. Methods Enzymol 476: 251-262. 27. Bench G, Corzett MH, De Yebra L, Oliva R, Balhorn R (1998) Protein and DNA contents in sperm from an infertile human male possessing protamine defects that vary over time. Mol Reprod Dev 50: 345-353. 28. de Yebra L, Ballesca JL, Vanrell JA, Corzett M, Balhorn R, et al. (1998) Detection of P2 precursors in the sperm cells of infertile patients who have reduced protamine P2 levels. Fertil Steril 69: 755-759. 29. de Yebra L, Ballesca JL, Vanrell JA, Bassas L, Oliva R (1993) Complete selective absence of protamine P2 in humans. J Biol Chem 268: 10553-10557. 30. Carrell DT, Liu L (2001) Altered protamine 2 expression is uncommon in donors of known fertility, but common among men with poor fertilizing capacity, and may reflect other abnormalities of spermiogenesis. J Androl 22: 604-610. 31. Aoki VW, Liu L, Carrell DT (2005) Identification and evaluation of a novel sperm protamine abnormality in a population of infertile males. Hum Reprod 20: 1298- 1306. 32. Oliva R (2006) Protamines and male infertility. Hum Reprod Update 12: 417-435. 33. Gatewood JM, Cook GR, Balhorn R, Bradbury EM, Schmid CW (1987) Sequence- specific packaging of DNA in human sperm chromatin. Science 236: 962-964.
108
34. Gardiner-Garden M, Ballesteros M, Gordon M, Tam PP (1998) Histone- and protamine-DNA association: conservation of different patterns within the beta- globin domain in human sperm. Mol Cell Biol 18: 3350-3356. 35. Wykes SM, Krawetz SA (2003) The structural organization of sperm chromatin. J Biol Chem 278: 29471-29477. 36. Pittoggi C, Renzi L, Zaccagnini G, Cimini D, Degrassi F, et al. (1999) A fraction of mouse sperm chromatin is organized in nucleosomal hypersensitive domains enriched in retroposon DNA. J Cell Sci 112 ( Pt 20): 3537-3548. 37. Hammoud SS, Nix DA, Zhang H, Purwar J, Carrell DT, et al. (2009) Distinctive chromatin in human sperm packages genes for embryo development. Nature 460: 473-478. 38. Hublitz P, Albert M, Peters AH (2009) Mechanisms of transcriptional repression by histone lysine methylation. Int J Dev Biol 53: 335-354. 39. Mohn F, Weber M, Rebhan M, Roloff TC, Richter J, et al. (2008) Lineage-specific polycomb targets and de novo DNA methylation define restriction and potential of neuronal progenitors. Mol Cell 30: 755-766. 40. Ezhkova E, Pasolli HA, Parker JS, Stokes N, Su IH, et al. (2009) Ezh2 orchestrates gene expression for the stepwise differentiation of tissue-specific stem cells. Cell 136: 1122-1135. 41. Tan M, Luo H, Lee S, Jin F, Yang JS, et al. (2011) Identification of 67 histone marks and histone lysine crotonylation as a new type of histone modification. Cell 146: 1016-1028. 42. Sirotkin AM, Edelmann W, Cheng G, Klein-Szanto A, Kucherlapati R, et al. (1995) Mice develop normally without the H1(0) linker histone. Proc Natl Acad Sci U S A 92: 6434-6438. 43. Jenkins TG, Carrell DT (2011) The paternal epigenome and embryogenesis: poising mechanisms for development. Asian J Androl 13: 76-80. 44. Reik W, Dean W, Walter J (2001) Epigenetic reprogramming in mammalian development. Science 293: 1089-1093. 45. Hajkova P, Erhardt S, Lane N, Haaf T, El-Maarri O, et al. (2002) Epigenetic reprogramming in mouse primordial germ cells. Mech Dev 117: 15-23. 46. Seki Y, Hayashi K, Itoh K, Mizugaki M, Saitou M, et al. (2005) Extensive and orderly reprogramming of genome-wide chromatin modifications associated with specification and early development of germ cells in mice. Dev Biol 278: 440- 458. 47. Seki Y, Yamaji M, Yabuta Y, Sano M, Shigeta M, et al. (2007) Cellular dynamics associated with the genome-wide epigenetic reprogramming in migrating primordial germ cells in mice. Development 134: 2627-2638. 48. Arpanahi A, Brinkworth M, Iles D, Krawetz SA, Paradowska A, et al. (2009) Endonuclease-sensitive regions of human spermatozoal chromatin are highly enriched in promoter and CTCF binding sequences. Genome Res 19: 1338-1349. 49. Szczygiel MA, Moisyadi S, Ward WS (2003) Expression of foreign DNA is associated with paternal chromosome degradation in intracytoplasmic sperm injection-mediated transgenesis in the mouse. Biol Reprod 68: 1903-1910.
109
50. Barroso G, Morshedi M, Oehninger S (2000) Analysis of DNA fragmentation, plasma membrane translocation of phosphatidylserine and oxidative stress in human spermatozoa. Hum Reprod 15: 1338-1344. 51. Muratori M, Piomboni P, Baldi E, Filimberti E, Pecchioli P, et al. (2000) Functional and ultrastructural features of DNA-fragmented human sperm. J Androl 21: 903- 912. 52. Lopes S, Sun JG, Jurisicova A, Meriano J, Casper RF (1998) Sperm deoxyribonucleic acid fragmentation is increased in poor-quality semen samples and correlates with failed fertilization in intracytoplasmic sperm injection. Fertil Steril 69: 528-532.
110
Chapter 5
DROSHA is essential for microRNA production and spermatogenesis
Abstract:
DROSHA is a nuclear RNase III responsible for cleaving primary microRNAs
(pri-miRNAs) into precursor microRNAs (pre-miRNAs) and thus is essential for the biogenesis of canonical miRNAs. DICER is a cytoplasmic RNase III that not only cleaves pre-miRNAs to produce mature miRNAs, but also dissects naturally formed/synthetic double stranded RNAs to generate small interfering RNAs (siRNAs).
To investigate the role of canonical miRNA and/or endo-siRNA production in spermatogenesis, we generated Drosha or Dicer conditional knockout (cKO) mouse lines by inactivating Drosha or Dicer exclusively in spermatogenic cells in postnatal testes using the Cre-loxp strategy. Both Drosha and Dicer cKO males were infertile due to disrupted spermatogenesis, characterized by depletion of spermatocytes and spermatids leading to oligoteratozoospermia or azoospermia. The developmental course of spermatogenic disruptions was similar at the morphological level between Drosha and
Dicer cKO males, but Drosha cKO testes appeared to display more severe spermatogenic disruptions than Dicer cKO testes. Microarray analyses revealed transcriptomic differences between Drosha- and Dicer-null pachytene spermatocytes or round spermatids. Although levels of sex-linked mRNAs were mildly elevated, meiotic sex chromosome inactivation appeared to have occurred normally. Our data demonstrate that unlike DICER, which is required for the biogenesis of several small RNA species,
111
DROSHA is essential mainly for the canonical miRNA production, and DROSHA- mediated miRNA production is essential for normal spermatogenesis and male fertility.
Keywords: small noncoding RNAs, germ cells, post-transcriptional regulation, RNA interference, and infertility.
112
Introduction:
Spermatogenesis refers to the process through which male germline stem cells undergo mitotic multiplication, meiotic chromosomal reduction and haploid differentiation, and eventually become male gametes called spermatozoa/sperm in the testis [1-3]. Although spermatogenesis can be divided into mitotic, meiotic and haploid/spermiogenesis phases based upon the three major cellular events, these processes actually occur concurrently within the seminiferous epithelium and specific cellular associations are formed among developing male germ cells and between germ cells and their supporting somatic cells (e.g. Sertoli cells and peritubular myoid cells)
[1,2]. These complex, and highly regulated cellular processes require multi-layered regulatory networks, which have been shown to involve regulators that function at both transcriptional (e.g. transcription factors, epigenetic modulators, large noncoding RNAs, etc.) and post-transcriptional (small noncoding RNAs, RNA-binding proteins, etc.) levels
[4-10]. Among the small noncoding RNAs (sncRNAs) identified to date, miRNAs have been demonstrated to play a role as post-transcriptional regulators through binding to the
3’ untranslated regions (3’UTRs) of mRNAs and thereby affecting mRNA stability and translational efficiency [11-13].
The canonical miRNA biogenesis pathway has largely been defined and it involves the processing of miRNA primary transcripts [i.e. primary miRNAs (pri- miRNAs)] into precursor miRNAs (pre-miRNAs) by the microprocessor complex consisting of mainly DROSHA, an RNase III, and its cofactor DGCR8 (also called
PASHA) in the nucleus[14,15]. Exportin 5 then exports pre-miRNAs to the cytoplasm, where DICER, another RNase III, further cleaves the pre-miRNAs to produce two mature
113 miRNAs. Mature miRNAs serve as sequence guides by directing their associated effector complexes (e.g. RNA-induced silencing complex, RISC) to their targets, which are usually located in the 3’UTRs of mRNAs, and exert effects, which can be stabilization/destabilization of mRNAs, or activation/suppression of translation depending on cellular context and functional status [16-19]. DROSHA recognizes pri- miRNAs, which are long primary transcripts derived from RNA Pol II-mediated transcription from a miRNA locus or loci of several miRNA genes forming a cluster, and containing one or multiple stem-loop regions formed by sequences of future mature miRNAs [20,21]. Unlike DROSHA, DICER not only cleaves stem-loop structures in pre- miRNAs, but also dissects double stranded RNAs (dsRNAs), either exogenous synthetic ones introduced into the cell or naturally occurring ones in the cell, into small RNAs, such as mature miRNAs, small interfering RNAs (siRNAs) and endogenous siRNAs
(endo-siRNAs) [22,23]. Therefore, ablation of Dicer affects the production of all DICER- dependent small RNAs, whereas loss of Drosha or Dgcr8 affects largely the formation of pre-miRNAs and consequently mature miRNA production [20,21].
Inactivation of Dicer in mice leads to embryonic lethality at ~embryonic day 7.5
(E7.5) [24], suggesting an essential role in post-implantation embryonic development.
Conditional knockout (cKO) of Dicer in various organs or cell lineages has revealed that
DICER is required for normal development and function of almost every single cell type or organ tested so far [25-45], suggesting an essential role of DICER-dependent small noncoding RNAs (sncRNAs) in normal physiology of the cell or organs. Ablation of
DGCR8, a cofactor of DROSHA essential for the RNase III activity of DROSHA, results in embryo lethality in ~E6.5, implying an essential role of miRNAs in early embryonic
114 development [46]. By comparing phenotypes of cKO mice deficient of Dicer or Dgcr8 in developing oocytes, two studies discovered that it is endo-siRNAs, but not miRNAs that are essential for normal oocyte development and maturation, and miRNA functions in developing oocytes are largely suppressed [47,48]. These data suggest that although both
DICER and DROSHA are involved in miRNA biogenesis, the effects of ablation of
DICER or DROSHA can be different because they control the production of different species of sncRNAs. Thus, a comparative study of Dicer and Drosha cKO mice may reveal phenotypes unique to either Dicer or Drosha inactivation.
Several previous studies have reported an essential role of DICER in primordial germ cell development and spermatogenesis by analyzing cKO mice with Dicer inactivation in the male germline at different developmental time points [49-53].
However, given that Dicer ablation simultaneously eliminates multiple sncRNA species
[46-48,54], the phenotype cannot be ascribed solely to miRNAs. To evaluate the specific role of miRNAs, germline-specific inactivation of Drosha or Dgcr8 is required. In addition, one common problem associated with the Cre-loxp strategy in generating cKO mice is the incomplete penetrance of Cre expression/activity in the targeted cell type, which usually leads to hypomorphism and mosaicism [55-57]. To overcome this problem, we generated two compound cKO mouse lines, in which Drosha or Dicer was specifically inactivated in postnatal male germ cells and meanwhile the Cre-expressing male germ cells were labeled with membrane-bound EGFP (mG) as a reporter to monitor true Drosha-null or Dicer-null spermatogenic cells in vivo. The present study was designed with the following aims: 1) To define the physiological role of Drosha in miRNA biogenesis and in spermatogenesis in vivo. 2) To compare potential phenotypic
115 differences between Drosha and Dicer cKO males. Any differences should reflect the potential roles of endo-siRNAs as Drosha cKO cells lack only canonical miRNAs, whereas Dicer cKO cells are deficient in both canonical miRNAs and endo-siRNAs. 3)
To determine transcriptomic changes in purified Drosha-null or Dicer-null spermatogenic cells, which have never been performed thus far. Here we report our findings.
116
Materials and Methods:
Generation of postnatal male germline-specific Drosha or Dicer knockout mice
All of the animal work performed was approved by the Institutional Animal Use and Care Committee (IACUC) of the University of Nevada, Reno. Dicerlox/lox [30] (The
Jackson Laboratory) and Droshalox/lox mice [58] were bred with Stra8-iCre [59] (The
Jackson Laboratory) mice to generate Stra8-iCre-Dicer+/lox and Stra8-iCre-Drosha+/lox offspring. These heterozygotes were further crossed with Dicerlox/lox and Droshalox/lox mice to obtain Stra8-iCre-Dicerlox/lox and Stra8-iCre-Droshalox/lox males. Rosa26mTmG mice [60] (The Jackson Laboratory) were used as a Cre reporter line to visualize the Cre- expressing cells. Female Stra8-iCre-Dicerlox/lox and Stra8-iCre-Droshalox/lox were crossed with Dicerlox/lox-Rosa26mTmGtg/tg and Droshalox/lox-Rosa26mTmGtg/tg males, respectively, to produce Stra8-iCre-Dicerlox/lox-Rosha26mTmG+/tg and Stra8-iCre-Droshalox/lox-
Rosha26mTmG+/tg offspring for morphological analyses, spermatogenic cell purification and the subsequent molecular analyses.
Histological and immunohistochemical analyses
Testes were dissected and fixed in Bouin’s solution overnight at 4°C followed by paraffin embedding. Paraffin sections (5µm) were prepared and stained with the Periodic-
Acid Schiff (PAS) solution (Sigma-Aldrich) for histological analyses. For observing membrane-bound Tomato Red (mT) and EGFP (mG) in control and cKO testes and for immunofluorescent analyses, cryosections were prepared. Testes from control (Stra8- iCre-Rosha26mTmG+/tg), Drosha cKO (Stra8-iCre-Droshalox/lox-Rosha26mTmG+/tg) and
Dicer cKO (Stra8-iCre-Dicerlox/lox-Rosha26mTmG+/tg) were dissected and fixed in 4% paraformaldehyde in PBS (pH 7.4) for 2 hours at room temperature. The fixed testes were
117 then incubated with serial sucrose solutions with increasing concentration from 5% to
20% followed by incubation in 20% sucrose in PBS overnight at 4°C. The testes were then embedded in OCT and 20% sucrose mixture with a volume ratio of 1:1.
Cryosections of 10µm were either stained with DAPI to visualize the cell nuclei for morphological analyses, or subject to immunofluorescent analyses. Cryosections were mounted using the Aqua mounting medium (Fisher Scientific, Pittsburg, PA) and stored in dark at 4°C for imaging analyses. Images were captured using confocal laser scanning system (Olympus, FV1000).
TUNEL assay
Paraffin testis sections were used for TUNEL analyses of apoptotic cells. TUNEL was performed using the ApoTag Plus Peroxidase In Situ Apoptosis Detection Kit
(Millipore, Billerica, MA), according to the manufacturer’s instructions.
Purification of pachytene spermatocytes and round spermatids from adult control and cKO testes
Pachytene spermatocytes and round spermatids were purified from control (Stra8- iCre-Rosha26mTmG+/tg) and cKO (Stra8-iCre-Droshalox/lox-Rosha26mTmG+/tg and Stra8- iCre-Dicerlox/lox-Rosha26mTmG+/tg) adult testes using a STA-PUT method as previously described [61,62]. Briefly, the gradient of 2%-4% BSA was formed in the sedimentation chamber. Single cell suspension of germ cells was loaded on the top of the 2%-4% BSA gradient. After 3 hours, the 2%-4% BSA gradient was unloaded from the bottom of the sedimentation chamber. According to the unit gravity, the initial fractions were cells with larger radius like pachytene spermatocytes, and the later fractions were cells with smaller radius like round spermatids. Cell types and purity collected from each fraction were
118 examined using phase and fluorescent microscopy (Carl Zeiss, Axioplan2).
Small and large RNA isolation
mirVanaTM miRNA Isolation Kit (Ambion, Grand Island, NY) was used to isolate both large and small RNA fractions from purified pachytene spermatocytes and round spermatids following the manufacturer’s protocol.
Small RNA cDNA synthesis and qPCR
Poly (A) tails were added to the 3’ ends of small RNAs by using poly (A) tailing kit (Ambion). mirVanaTM Probe & Marker Kit (Ambion) was used to purify the poly
(A) tailed small RNAs. After purification, 25µl poly (A)-tailed small RNAs, 2µl 10mM dNTP, and 1µl reverse transcription primer (2ug/µl) were mixed together. The mixture was heated at 65°C for 5 minutes and incubated on ice for 1 minute. Eight µl 5× First-
Strand Buffer, 2µl 0.1 M DTT, 1µl RNase OUT (Invitrogen, Ambion, Grand Island, NY), and 1µl SuperScript III Reverse Transcriptase (Invitrogen) were added to mixture and incubated at 50°C for 60 minutes. The sequence of reverse transcription primer is
CGAATTCTAGAGCTCGAGGCAGGCGACATGGCTGGCTAGTTAAGCTTGG
TACCGAGCTCGGATCCACTAGTCC(T)25VN. 40µl H2O was added to the mixture, the concentration of the small RNA cDNAs was measured, and they were diluted into
25ng/µl as PCR working templates. By using the forward primers containing small RNA specific sequences (Table S1) and the universal reverse primer, TaqMan-based real time
PCR was performed to examine the expression of small RNAs. The sequence of TaqMan probe was 5’FAM-CTCGGATCCACTAGTC-MGB3’ and U6 snoRNA was used as an endogenous control.
Large RNA cDNA synthesis and qPCR
119
After large RNAs including total mRNAs were isolated using the mirVanaTM miRNA Isolation Kit (Ambion), DNA contamination was removed by DNase treatment using DNA-free™ DNase (Ambion). After DNase treatment, 25µl large RNA was mixed with 2µl 10mM dNTP, and 1µl Random Primers (3µg/µl, Invitrogen). The mixture was heated at 65°C for 5 minutes and incubated on ice for 1 minute. 8µl 5X First-Strand
Buffer, 2µl 0.1 M DTT, 1µl RNase OUT (Invitrogen), and 1µl SuperScript III Reverse
Transcriptase (Invitrogen) were added to the mixture and incubated at 50°C for 60 minutes. 40µl H2O was added to the mixture, the concentration of the large RNA cDNAs was measured, and then they were diluted into 25ng/µl as PCR working templates. By using gene specific forward and reverse primers (Table S1), SYBR Green-based real-time quantitative PCR was performed to examine mRNA expression levels. Gapdh or β-Actin was used as an internal control. IAP, LINE1 and SINE B2 primer sequences are listed in
Table S1.
Microarray analysis
Large RNAs including total mRNAs were isolated from purified pachytene spermatocytes and round spermatids of control (Stra8-iCre-Rosha26mTmG+/tg) and cKO
(Stra8-iCre-Droshalox/lox-Rosha26mTmG+/tg and Stra8-iCre-Dicerlox/lox-
Rosha26mTmG+/tg) testes using the mirVanaTM miRNA Isolation Kit (Ambion), and
DNA contamination was removed using DNA-free™ DNase (Ambion). RNA purity was examined by measuring A260/280 ratios using a spectrophotometer (NanoDrop,
Wilmington, DE) and RNA quality was analyzed using the Bioanalyzer (Agilent
Technologies, Santa Clara, CA). Each sample was prepared in two biological replicates.
These RNA samples were then subject to labeling, hybridization, washing, data
120 acquisition and analyses as described previously [63]. Briefly, 2ug of total mRNA from each sample was labeled and then hybridized to the Affymetrix mouse gene 1.0 ST array.
Arrays were stained and washed using the Affymetrix GeneChip Fluidics Station 400 and scanned using a GeneArray Scanner 2500A. Microarray Suite 5.0 software was used to view the data and statistical analysis was performed using GeneSpring 7.0 software.
RNA FISH
RNA FISH analyses of de novo transcription of a Y-linked gene Uty was performed as described [64,65]. Cot-1 RNA FISH in conjunction with immunofluorescent staining was carried out following a published protocol [66].
121
Results:
Generation of postnatal male germ cell-specific Drosha or Dicer conditional knockout mice
Global inactivation of either Dgcr8 [46] or Dicer [24] leads to embryonic lethality, precluding functional analyses of postnatal germ cell development. To specifically inactivate Drosha or Dicer in postnatal male germ cells, we crossed a
Drosha-loxp (Droshalox/lox [58]) or a Dicer-loxp (Dicerlox/lox [30]) line with a Stra8
(stimulated by retinoic acid gene 8)-iCre transgenic line [59], which has been shown to express codon-improved Cre (iCre) recombinase exclusively in male germ cells with an initial expression in the differentiating spermatogonia at postnatal day 3 (P3) [59]. The
Drosha conditional allele has two loxp sites flanking exon 9 and the excision of exon 9 induced by iCRE recombination would lead to frame shift and result in multiple stop codons in exon 11 [58]. The Dicer conditional allele contains two loxp sites flanking exon 23 of Dicer, which encodes for the most part of the second RNase III domain [30], and thus iCRE-mediated recombination would inactivate DICER cleavage activity. It has been reported that after iCre-mediated recombination, the activity of DROSHA or
DICER is completely lost [30,58].
To visualize the iCre-mediated germ cell-specific deletion of Drosha or Dicer,
Stra8-iCre-Droshalox/lox and Stra8-iCre-Dicerlox/lox mice (herein called Dicer or Drosha cKO mice, respectively) were further crossed with a global double-fluorescent Cre reporter mouse line Rosa26mTmGtg/tg [60] to generate Drosha and Dicer compound knockout mice (Stra8-iCre-Droshalox/lox-Rosa26mTmG+/tg and Stra8-iCre-Dicerlox/lox-
Rosa26mTmG+/tg, herein called Drosha and Dicer reporter cKO mice, respectively). In
122 these compound knockout mice, cells without Cre activity expressed membrane-targeted tandem dimer Tomato Red fluorescent protein (mT), whereas cells with Cre activity had the loxp-flanked mT cassette deleted, thus allowing the expression of a downstream membrane-targeted EGFP (mG) cassette. Therefore, Cre-expressing cells showed green fluorescence on the cytoplasmic membrane, representing the true knockout cells. By introducing the fluorescent reporter allele into the Drosha or Dicer cKO background, we could determine the penetrance of Cre expression and activity, monitor the morphological changes of “true” KO cells and purify the KO cells for molecular analyses.
The membrane-bound EGFP (mG) was first observed in spermatogonia in the testes of control, Drosha and Dicer reporter cKO mice at ~P4 (Figure 1), which is consistent with the previous report showing an initial expression in differentiating spermatogonia at P3 in the Stra8-iCre mouse line [59]. It is noteworthy that only a small proportion of spermatogonia displayed mG expression at P4 and the number of mG- positive spermatogenic cells increased from P7 to P21 (Figure 1). By P40, the highest levels of mG were observed in the cell membrane of elongated spermatids and the intensity of mG was higher in round spermatids and spermatocytes than in spermatogonia
(Figure 1). The fact that almost all of the spermatocytes and round spermatids at P21 and
P40 were mG-positive is consistent with the previous report showing iCre expression starts in type A spermatogonia and ends in preleptotene spermatocyte [59]. Based upon the spatiotemporal expression patterns of mG, we conclude that the iCre-mediated
Drosha or Dicer deletion occurred to full penetrance by P21, and in the adult cKO testes, all pachytene spermatocytes and haploid germ cells were truly Drosha- or Dicer-null.
Inactivation of Drosha or Dicer in postnatal spermatogenic cells
123
We purified pachytene spermatocytes and round spermatids using the STA-PUT method [62,67,68] and purity of the two cell types was >95% based upon counting of mG
(green) vs. mT (red) cells (Figure S1). Using these highly pure pachytene spermatocytes and round spermatids, we performed qPCR to examine levels of Drosha or Dicer mRNAs. Levels of Drosha and Dicer mRNAs were significantly reduced in the Drosha- and Dicer-null pachytene spermatocytes and round spermatids, respectively (Figure 2A,
2B), suggesting the mG-positive spermatogenic cells were mostly those true cKO cells.
Drosha mRNA levels in the two Dicer-null spermatogenic cell types remained unchanged, whereas levels of Dicer mRNAs in Drosha-null pachytene spermatocytes and round spermatids were slightly elevated. The difference may represent a compensatory effect by Dicer in response to the Drosha loss and Drosha appeared to be unresponsive to the Dicer ablation. These data further demonstrated that the mT/mG reporter-based strategy indeed truthfully reflected the iCre activity and confirmed inactivation of the floxed Drosha or Dicer allele in spermatogenic cells in these cKO male mice.
DROSHA is required for miRNA biogenesis and DICER is essential for the production of both miRNAs and endo-siRNAs
We further examined levels of 5 representative miRNAs and 5 representative endo-siRNAs in control, Dicer- or Drosha-null pachytene spermatocytes and round spermatids (Figure 2C, 2D). These 10 sncRNAs are known to be preferentially expressed in wild-type (WT) spermatogenic cells [54,62,68]. Levels of the 5 miRNAs examined were significantly lower in either Drosha- or Dicer-null pachytene spermatocytes (Figure
2C) or round spermatids (Figure 2D) than in control cells, suggesting that both Drosha and Dicer are required for the biogenesis of miRNAs. In contrast, levels of 5 endo-
124 siRNAs in Drosha-null cells were comparable to those in controls, but were significantly downregulated in Dicer-null pachytene spermatocytes (Figure 2C) or round spermatids
(Figure 2D), suggesting that endo-siRNA production is dependent upon DICER, but independent of DROSHA. These results are consistent with and are supportive of the current concept of DICER and DROSHA activities and the biogenesis of miRNAs and endo-siRNAs [69]. Based upon the difference, any phenotypic variations observed between the Dicer and Drosha cKO mice can, in theory, be ascribed to endo-siRNAs because endo-siRNA production in Drosha-null germ cells is unaffected, whereas miRNAs are absent in both Drosha- and Dicer-null male germ cells.
A previous report suggests that DROSHA may be involved in the 45S pre-rRNA processing pathway and DROSHA inactivation may thus affect the production of 18S and
28S rRNAs, leading to translational defects and cell death [70]. To examine whether
DROSHA deficiency can lead to defective production of 18S and 28S rRNAs in vivo, we analyzed levels of 18S and 28S rRNAs in control, Drosha and Dicer cKO pachytene spermatocytes and round spermatids using qPCR (Figure 2E and 2F). No significant changes in levels of 18S and 28S rRNAs, as well as their precursor 45S rRNAs were observed among control, Drosha and Dicer cKO pachytene spermatocytes (Figure 2E).
In round spermatids, both 18S and 28S rRNA levels showed no changes, whereas 45S rRNA levels were slightly upregulated (Figure 2F). These data suggest that a lack of
DROSHA does not significantly affect 18S/28S rRNA production. This finding is consistent with an earlier report showing DGCR8 inactivation does not affect the 45S rRNA processing pathway [46]. Given that the microprocessor consisting of DROSHA and DGCR8 functions exclusively in pri-miRNA processing [71,72], DROSHA
125 inactivation, similar to DGCR8 knockout [46], results in mainly, if not exclusively, a deficiency of canonical miRNA production.
Drosha or Dicer cKO mice display severe disruptions in both meiotic and haploid phases of spermatogenesis
Fertility tests by breeding Drosha or Dicer cKO males with WT adult females indicated that neither Drosha nor Dicer cKO males were fertile despite their normal mating behavior. To investigate the causes of infertility in Drosha or Dicer cKO male mice, we performed morphological analyses on Drosha or Dicer cKO testes at both gross
(Figure 3A, B) and light microscopic (Figure 3C, D) levels. The adult Drosha or Dicer cKO testes were much smaller in size (Figure 3A) than control testes of their heterozygous littermates (Stra8-iCre-Drosha+/lox and Stra8-iCre-Dicer+/lox). By analyzing the testis weight during testicular development (Figure 3B), a significant decrease in testis weight was initially observed at P21 in both Drosha and Dicer cKO males, and by
P40, the cKO testes weighted ~50% of the control testes. Consistent with the reduced testis weight, examination of the testis histology revealed severe germ cell depletion in both adult Drosha (Figure 3C) and Dicer (Figure 3D) cKO testes. While littermate controls displayed robust spermatogenesis (Figure 3C, panel a and Figure 3D, panel a), both Drosha and Dicer cKO testes showed severely disrupted seminiferous epithelia containing few or no elongated spermatids (panel b in Figure 3C and 3D). The presence of numerous vacuoles (arrows in panels c and d in Figure 3C, 3D) and multinucleated
“giant” cells (arrowheads in panel d in Figure 3C, 3D) was indicative of active spermatogenic cell depletion. Accordingly, the control epididymis contained numerous spermatozoa (panel e in Figure 3C, 3D), whereas the cKO epididymis was largely devoid
126 of spermatozoa (panel f in Figure 3C, 3D). The spermatogenic cells that were depleted were mainly spermatocytes and early spermatids in both cKO testes. Interestingly,
Drosha cKO testes appeared to be more severely disrupted than Dicer cKO testes at least at histological levels (pane b in Figure 3C, 3D) because a lot more spermatogenic cells were present in Dicer cKO testes than in Drosha cKO testes. To quantify the phenotypic differences between Drosha and Dicer cKO testes, we analyzed the proportions of seminiferous tubule cross-sections that were devoid of elongating/elongated spermatids
(Figure 3E) or contained vacuoles/multi-nucleated “giant” cells (Figure 3F). In control testes, almost all tubule cross-sections contained either elongating (steps 9-11) or elongated (Steps 12-16) spermatids. In contrast, ~23% and ~7% of tubule cross-sections in Drosha and Dicer cKO testes were devoid of elongating/elongated spermatids, respectively (Figure 3E). Moreover, vacuoles or multinucleated “giant” cells were observed in only ~1% of the control tubule cross-sections, whereas ~43% and ~24% of the tubule cross-sections in Drosha and Dicer cKO testes contained numerous vacuoles and/or multinucleated cells, respectively (Figure 3F). These data suggest that Drosha cKO testes displayed more severe spermatogenic cell depletion than Dicer cKO testes.
Nevertheless, the depleted spermatogenic cell types were mainly spermatocytes and spermatids in both cKO testes, suggesting an essential role for either Drosha or Dicer to support the meiotic and haploid phases of spermatogenesis in mice.
Consistent with partial Cre penetrance in P4 and P7 cKO testes (Figure 1), no discernable histological changes were observed in either Drosha or Dicer cKO testes at these time points (Figure S2). By P14, histological changes in the seminiferous epithelial structures became discernable in both Drosha and Dicer cKO testes (Figure 4A). Mid-
127 pachytene spermatocytes were reduced in number and some displayed cytoplasmic shrinkage with highly condensed nuclei resembling structural features of early apoptotic cells. Depletion of pachytene spermatocytes became more and more obvious/severe afterwards, and the severity of disruptions reached the maximum at P28. At P40, although the germ cell depletion was still ongoing, the rate of depletion appeared to decrease because seminiferous epithelia of both cKO testes contained all types of spermatogenic cells despite in a lower number compared to controls. TUNEL assays revealed enhanced apoptosis in spermatocytes in both Drosha and Dicer cKO testes
(Figure 4B). Interestingly, round spermatids that were being depleted were TUNEL- negative, supporting the notion that massive depletion of round spermatids is mainly achieved through detaching from the seminiferous epithelium instead of the classic apoptotic pathway [73-75]. Histological analyses of the developing testes (Figure 4) further supported this observation in the adult cKO testes (Figure 3), suggesting the spermatogenic cell types that were depleted were mainly pachytene spermatocytes and spermatids, and the disrupted spermatogenesis accounts for the infertility phenotype of either Drosha or Dicer cKO male mice.
Altered mRNA transcriptomes in Drosha- or Dicer-null spermatogenic cells
Using the Affymetrix mouse gene 1.0 ST array, we determined the mRNA transcriptomes in pachytene spermatocytes and round spermatids purified from control
(heterozygous littermates), Drosha or Dicer cKO mice [62,67,68]. Among 28,853 mRNAs probed, 575 and 660 mRNAs displayed significant changes (a fold change >1.5 or <-1.5, p<0.05 using ANOVA statistical tests) in Drosha-null pachytene spermatocytes and round spermatids, respectively (Figure 5A, panels a and c). 457 and 1731 mRNAs
128 showed significantly altered expression levels in Dicer-null pachytene spermatocytes and round spermatids, respectively (Figure 5A, panels b and d). There appeared to be more mRNAs with altered expression levels in the Dicer-null (a total of 2,188) than in Drosha- null (a total of 1,235) spermatogenic cells (Table S2). This may suggest that the absence of both miRNAs and endo-siRNAs in Dicer-null spermatogenic cells have a more profound impact on mRNA levels than the lack of miRNAs alone in Drosha-null spermatogenic cells.
Despite the fact that some mRNAs showed similar changes in both Drosha- and
Dicer-null spermatogenic cells (Figure 5B), many mRNAs with altered expression levels appeared to be unique to either of the two genotypes. For example, levels of 393 mRNAs were altered in Drosha-null pachytene spermatocytes and these mRNAs were not changed in Dicer-null pachytene spermatocytes. Similarly, 275 mRNAs displayed altered levels in Dicer-null pachytene spermatocytes, which were not changed in Drosha-null pachytene spermatocytes. Meanwhile, both Drosha- and Dicer-null pachytene spermatocytes shared 182 mRNAs with significant changes in their expression levels.
These differences suggest Drosha and Dicer may functionally overlap with each other, but they do have their unique impact on steady-state levels of mRNAs. This may be due to the contribution of endo-siRNAs because Dicer-null spermatogenic cells lack both canonical miRNAs and endo-siRNAs, whereas Drosha-null cells are devoid of canonical miRNAs only. Overall, the microarray analyses revealed that both miRNAs and endo- siRNAs could indeed affect the steady-state levels of mRNAs either directly or indirectly, and this notion is consistent with recent reports demonstrating that miRNAs mainly function to regulate mRNA stability [76]. In addition, mRNAs with altered levels in both
129
Drosha- and Dicer-null cells may reflect the effect of miRNAs, whereas the differences in altered mRNAs may highlight the function of endo-siRNAs. The Affymetrix Mouse
Gene 1.0 ST array contains a number of pri-miRNAs and interestingly, levels of pri- miRNAs for 4 miRNA clusters including miR-29 (29a and 29b-1), miR-30 (30b and
30d), miR-34 (34b and 34c) and miR-19 (17, 19b-1 and 92a-1) clusters displayed 3-10 fold upregulation in Drosha-null pachytene spermatocytes and round spermatids, whereas their levels remained unchanged in Dicer-null cells (Table S2 and Figure S3). Elevated levels of pri-miRNAs may result from the accumulation of pri-miRNAs due to the lack of
DROSHA, which can cleave pri-miRNAs into precursor-miRNAs. To validate the microarray data, we chose 43 transcripts identified to be dysregulated in either Drosha or
Dicer-null spermatogenic cells and performed qPCR (Figure S3). Our qPCR results were consistent with the microarray data (Figure S3 and Table S2).
Sex-linked mRNA genes are upregulated in both Drosha- and Dicer-null pachytene spermatocytes
By examining microarray data, we found several X- or Y-linked genes (e.g. Ott,
Nxf2, Usp9y, Ube1y, etc.), which are known to be suppressed in pachytene spermatocytes due to meiotic sex chromosome inactivation (MSCI), were upregulated a 2-4 fold in
Drosha-null pachytene spermatocytes (Table S2), suggesting a potential defect in MSCI.
We therefore chose 9 X-linked (Magea5, Nxf2, Ott, Pramel3, Taf7l, Tex11, Tex16, Tktl1,
Usp26) and 3 Y-linked (Rbmy1a1, Ube1y, Usp9y) genes and examined their mRNA levels in control, Drosha- or Dicer-null pachytene spermatocytes. Levels of these 12 sex- linked mRNAs were indeed upregulated by ~2 fold in either Drosha or Dicer-null pachytene spermatocytes (Figure 6). Both our qPCR data (Figure 6) and previously
130 published microarray data [77] showed that these 12 mRNAs are drastically upregulated
(by 10-20 fold) in round spermatids following MSCI. The 2 fold upregulation may not be significant physiologically considering their much higher levels in round spermatids.
Generally these sex-linked mRNA genes were still largely suppressed, but just to a lesser extend. However, MSCI is known to be essential for meiotic progression and even a slight relaxation in MSCI may result in disruptions [64,78]. So we examined de novo transcription using RNA FISH in conjunction with immunofluorescent staining of γ-
H2AX (sex body marker) and HP1β (heterochromatin marker) [64-66,79]. The absence of transcription on the sex chromosomes in the mid-pachytene stage is shown in Figure 7.
Given the slight upregulation of sex-linked mRNAs may reflect a MSCI maintenance defect in diplotene spermatocytes, we further examined de novo transcription using Cot-1
RNA FISH assays. The sex body remains largely HP1β-positive and Cot-1-negative, suggesting a lack of discernable transcriptional activities even in diplotene stage (Figure
7). These data suggest that MSCI is established normally in either Drosha- or Dicer-null pachytene spermatocytes and the maintenance of MSCI may have been slightly disrupted, causing the upregulation of sex-linked mRNAs. But the MSCI defects, if any, may be too minor to be detected due to the limited resolution of the techniques utilized.
Levels of transposable elements remain unchanged in either Drosha- or Dicer-null spermatogenic cells
Several studies have reported that Dicer deficiency in either somatic or germ cells can lead to upregulated levels of repetitive elements [50,80,81]. To study whether
Drosha-deficient spermatogenic cells display transposable element (TE) derepression, we examined levels of IAP (intracisternal A particle element), LINE1 (long interspersed
131 nuclear element 1) and SINE B2 (short interspersed nuclear element B2) in purified control, Drosha- or Dicer-null pachytene spermatocytes or round spermatids (Figure S5).
Similar to Dicer-null pachytene spermatocytes, Drosha-null pachytene spermatocytes displayed normal levels of the three types of TEs. Levels of the three types of TEs appeared to be altered in either Dicer- or Drosha-null round spermatids, but statistical analyses revealed no significant differences (Figure S5). Consistent with one recent report [49], all three types of TEs showed no significant upregulation in the testes of a male germ cell-specific Dicer cKO mouse line. However, a recent independent study [50] identified the upregulation of SINE B1 and B2 in Dicer-deficient early spermatocytes
(Ddx4-Cre-Dicerlox/lox) and upregulation of SINE B1, B2 and LINE1 in Dicer-deficient late spermatocytes. The discrepancy may result from the onset of Dicer inactivation due to different Cre lines used.
132
Discussion:
Labelling knockout (KO) cells with fluorescent proteins allows cellular changes in vivo to be monitored and purification of KO cells for molecular analyses
Cre-loxp-mediated conditional knockout (cKO) system allows the inactivation of a gene of interest along a specific cell linage and thus can overcome the embryonic lethality problem often associated with the global/universal knockout approach. Both
Dicer and Dgcr8 global inactivation leads to embryonic lethality [24,46], thus preventing the analyses of their functions during germ cell development. The routine method of determining Cre activity is to cross a Cre line with a reporter line that expresses either an enzyme (e.g. β-galactosidase, luciferase, etc.) or a fluorescent protein (e.g. EGFP, tomato
Red, etc.), and reporter-expressing cells are automatically assumed to represent the site of
Cre activity in the cKO mice. Several cKO mouse lines in which Dicer was selectively inactivated in the male germ line during fetal or postnatal development have been generated [49-53]. However, one of the Cre mouse lines used is known to display partial penetrance of Cre expression and/or Cre activity in the targeted cell lineage [82]. The incomplete Cre penetrance can lead to mosaicism/hypomorphism and the phenotype observed thus cannot reflect the true effects of a complete ablation of Dicer. In addition, three of these studies used total testes to conduct the molecular analyses [49,52,53].
Given that the total testes contain both somatic and developing male germ cell types, and the true cKO cells are only a proportion of the total germ cells, analyses performed using total testes are contaminated by normal or changed expression in other non-cKO cell types. Thus phenotypes observed and molecular analyses performed more likely represent a hypomorphic scenario. In the present study, by introducing the dual
133 fluorescence reporter allele (mT/mG) into the loxp homozygous background, we generated two compound cKO lines, in which Cre-expressing cells expressed membrane- bound EGFP (mG) and Cre-negative cells expressed membrane-bound tomato red (mT) fluorescence. In this way, we could not only monitor the developmental course of cellular disruptions in vivo (Figure 1), but we could also purify the cKO cells based upon mG or estimate their purity after purification based upon the ratio of green vs. red cells (Figure
S1). Given the gradual expression of mG in spermatogonial population during early postnatal development and the weak expression of mG in spermatogonia in adult testes
(Figure 1), inactivation of Drosha or Dicer in these cells are likely incomplete and spermatogonia may have remained partially functional, which was sufficient to support their development. Therefore, the lack of discernable morphological disruptions in spermatogonial populations cannot exclude a role of Drosha or Dicer in the mitotic phase of spermatogenesis because spermatogonia. In contrast, the full penetrance of Cre activity in spermatocytes and spermatids was consistent with the fact that these two cell types were those showing the most severe depletion in developing and adult cKO testes. In addition, the highly pure (>95% of purity) pachytene spermatocytes and round spermatids allowed us to determine expression levels of small RNAs and sex-linked mRNAs, as well as microarray analyses of the whole mRNA transcriptome in the cKO cell types rather than in the total testes. Generation of cKO lines with reporter capability represents an improved way of studying effects of cell- or tissue-specific inactivation of a particular gene because it allows in vivo observation of the time course and the degree of cellular disruptions, and easy purification of the cKO cells for molecular analyses.
134
Phenotypic differences between Drosha and Dicer cKO germ cells may reflect the role of endo-siRNAs
Using morphological and transcriptomic analyses, we identified differences between Drosha and Dicer cKO testes (Figure 3-5). The differences may reflect deficiencies in endo-siRNAs because Drosha-null spermatocytes and round spermatids only lack canonical miRNAs, whereas Dicer-null spermatocytes and spermatids are devoid of not only canonical miRNAs, but also endo-siRNAs and maybe other DICER- dependent small noncoding RNAs (sncRNAs). A comparative study of the phenotype of
Dicer and Dgcr8 cKO females has revealed that although inactivation of Dicer in developing oocytes leads to female infertility due to oocyte development/maturation defects, Dgcr8-null oocytes develop normally and can be fertilized by WT sperm and produced normal pups [46,81]. Two subsequent studies have demonstrated that miRNA functions are largely suppressed in developing oocytes and even in preimplantation embryos, whereas endo-siRNAs are required for the same processes [47,48]. Given the fact that Drosha cKO testes displayed more severe morphological disruptions (Figure 3), it is plausible to speculate that the male germ cell-expressed endo-siRNAs may have a
“protective” effect because the lack of miRNAs alone in Drosha cKO mice appeared to cause more severe disruptions to spermatocytes and round spermatids than the ablation of both miRNAs and endo-siRNAs in Dicer cKO testes. Nevertheless, the time course and severity of spermatogenic disruptions in these two cKO lines were largely similar, which is consistent with the fact these two RNase III enzymes are involved in a common pathway: canonical miRNA biogenesis [69]. Supporting this notion, mRNA transcriptomic analyses revealed that many of the altered mRNAs are shared between
135 cKO spermatocytes (182 mRNAs) and round spermatids (428 mRNAs) (Figure 5 and
Table S2) of the two genotypes. However, the Drosha-null pachytene spermatocytes and round spermatids indeed have their unique transcriptomes represented by 393 mRNAs in pachytene spermatocytes and 232 mRNAs in round spermatids that were not changed in
Dicer-null pachytene spermatocytes and round spermatids, respectively. It is noteworthy that Dicer-null round spermatids had 1,303 mRNAs, levels of which were not altered in
Drosha-null round spermatids, suggesting the absence of both canonical miRNAs and endo-siRNAs can cause more changes in mRNA levels than the lack of canonical miRNAs alone (1,731 vs. 660 mRNAs). In general, effects of Drosha deficiency on mRNA expression in both pachytene spermatocytes and round spermatids were the same
(575 vs. 660 mRNAs). In contrast, the Dicer absence displayed much more profound impact on the mRNA expression in round spermatids than in pachytene spermatocytes
(1,731 vs. 457 mRNAs). These data indicate that miRNAs and/or endo-siRNAs affect, either directly or indirectly, the steady-state levels of mRNAs mainly in round spermatids in the adult testes.
Like endo-siRNAs, miRNAs can affect steady-state levels of mRNAs
Previously it was believed that miRNAs mainly function as post-transcriptional regulators by binding to the 3’UTRs and induce translational suppression [17,83]. Recent data, however, have demonstrated that some miRNAs can increase translation efficiency
[84], and miRNAs generally can enhance the stability of their target mRNAs [76].
Endo-siRNAs theoretically can induce mRNA degradation through the RNAi mechanism
[54,85,86]. The fact that the Drosha deficiency alone (lack of canonical miRNAs only)
136 can induce changes in ~600 mRNAs in either pachytene spermatocytes (575 mRNAs) or round spermatids (660 mRNAs) suggest that miRNAs have a role in the mRNA stability control. More mRNAs were altered in Drosha-null pachytene spermatocytes than in
Dicer-null pachytene spermatocytes (575 vs. 457 mRNAs), which is consistent with the more severe morphological disruptions in Drosha than in Dicer cKO testes observed
(Figure 3). In contrast, Dicer inactivation, which led to deficiency in both miRNAs and endo-siRNAs, caused changes in ~1,700 mRNAs in round spermatids, which is much more than that in Drosha-deficient round spermatids (660 mRNAs), suggesting that endo-siRNAs can cause more changes in mRNA levels. This is consistent with the fact that endo-siRNAs are directly associated with mRNA stability. Also, this implies a more significant role of endo-siRNAs in round spermatids than in pachytene spermatocytes in the regulation of mRNA stability. Among these mRNAs with altered levels, the majority displayed upregulation (Figure 5), suggesting that endo-siRNAs and/or miRNAs can induce mRNA degradation. miRNAs and/or endo-siRNAs are not essential for the initiation of MSCI, but may be involved the maintenance of MSCI
A ~2 fold increase in mRNA levels of many X- or Y-linked genes in both Drosha and Dicer-null pachytene spermatocytes suggests a relaxation of the suppressive status due to meiotic sex chromosome inactivation (MSCI). However, the genes examined all displayed de-suppression once male germ cell development progressed from spermatocytes to round spermatids, which has been documented in a previous transcriptomic study [77] and the present study (Figure 6). In round spermatids, levels of these X- or Y-linked genes are ~8-16-fold higher than their levels in pachytene
137 spermatocytes. Therefore, when these much higher levels were compared with much lower levels in pachytene spermatocytes, a ~2 fold increase is still 4-8-fold lower than levels in round spermatids, indicating that these genes were still largely suppressed and the disruption in MSCI is thus minimal, as reflected by the mild increase in X- or Y- linked mRNA gene expression (Figure 6). Consistent with this notion, analyses on MSCI using two independent RNA FISH techniques (Figure 7 and Figure S4) demonstrated a lack of de novo transcription and normal formation of the sex body in either Drosha- or
Dicer-null pachytene spermatocytes. These data suggest that miRNAs and/or endo- siRNAs are not required for the establishment of MSCI. But in the absence of these sncRNAs, the maintenance of MSCI may have been compromised to some extent. But these potential disruptions appeared to be subtle/minor, which are beyond the detection sensitivity/resolution of the techniques used (i.e. RNA-FISH in conjunction with immunofluorescent staining). The potential minor MSCI defects may contribute to the severe depletion of pachytene spermatocytes observed in both Drosha and Dicer cKO testes because defective MSCI is not compatible with meiotic progression and thus
MSCI-defective spermatocytes must be eliminated through apoptosis by the meiotic checkpoint mechanism [64,78]. The fact that many spermatocytes managed to form round spermatids suggests that the disruption of MSCI is minor.
In summary, data from the present study demonstrate an essential role of Drosha in canonical miRNA biogenesis in vivo, and the deficiency in Drosha or the lack of
DROSHA-dependent miRNAs can lead to disrupted spermatogenesis and male infertility.
Like Dicer, Drosha is essential for both the meiotic and haploid phases of spermatogenesis. Endo-siRNAs appear to have more profound impact on the mRNA
138 stability than miRNAs do in round spermatids, suggesting a critical role of this novel sncRNA species in the regulation of mRNA stability in the haploid phase of spermatogenesis. The phenotypes observed may represent direct or indirect effects of canonical miRNA and/or endo-siRNAs deficiency. Nevertheless, our data, together with other similar studies [49,50], demand further investigations on the molecular mechanism underlying the spermatogenic defects observed in both Drosha- and Dicer-deficient testes.
139
Figure 1. Germ cell-specific ablation of Drosha or Dicer in postnatal testes. Cross-sections of seminiferous tubules of control (Stra8-iCre-Rosa26mTmG+/tg), Drosha cKO (Stra8-iCre-
Droshalox/lox-Rosa26mTmG+/tg) and Dicer cKO (Stra8-iCre-Dicerlox/lox-Rosa26mTmG+/tg) testes at postnatal day 4 (P4), P7, P14, P21 and P40. Expression of membrane-bound EGFP (mG) is indicative of Cre expression and activity. mG was first detected in some of the spermatogonia in
P4 testes. The number of mG-positive germ cells increased with testicular development. In P21 testes the highest levels of mG were observed in spermatocytes and round spermatids. In P40, mG was detected in almost all spermatogenic cells, but the highest levels were observed in the cytoplasmic membrane of elongated spermatids. Note that prior to P21, not all germ cells were mG-positive. Bars=20µm.
140
Figure 2. Expression of Drosha or Dicer mRNAs, male germ cell miRNAs and endo- siRNAs, as well as 18S, 28S and 45S ribosomal RNAs in pachytene spermatocytes and round spermatids purified from control (Stra8-iCre-Rosa26mTmG+/tg), Drosha cKO
141
(Stra8-iCre-Droshalox/lox-Rosa26mTmG+/tg) and Dicer cKO (Stra8-iCre-Dicerlox/lox-
Rosa26mTmG+/tg) testes. A. qPCR analyses of Drosha and Dicer mRNA levels in
Drosha- or Dicer-null pachytene spermatocytes. B. qPCR analyses of Drosha and Dicer mRNA levels in Drosha- or Dicer-null round spermatids. C. qPCR analyses of levels of 5 miRNAs (mir-106a-5p, mir-470-5p, mir-465-3p, mir-741-3p, and mir-20b-5p) and 5 endo-siRNAs (T56, T59, T13, T27, T49) known to be highly expressed in wild-type pachytene spermatocytes and round spermatids in control, Drosha- or Dicer-null pachytene spermatocytes. D. qPCR analyses of levels of 5 miRNAs and 5 endo-siRNAs known to be highly expressed in wild-type pachytene spermatocytes and round spermatids in control, Drosha- or Dicer-null round spermatids. E. qPCR analyses of levels of 18S, 28S and 45S rRNAs in control, Drosha- or Dicer-null pachytene spermatocytes. F. qPCR analyses of levels of 18S, 28S and 45S rRNAs in control,
Drosha- or Dicer-null round spermatids.
142
Figure 3. Inactivation of Drosha or Dicer in spermatogenic cells disrupts spermatogenesis. A. Reduced testis size in adult Drosha cKO (Stra8-iCre-Droshalox/lox) and Dicer cKO (Stra8-iCre-Dicerlox/lox) mice. B. Testis weights of P14, P21, P40 and adult control, Drosha or Dicer cKO mice. The number within each column indicates the
143 total number of individual testes measured for each group. C. Periodic Acid-Schiff (PAS) staining of cross-sections of the Drosha cKO testis and cauda epididymis. The control
(Stra8-iCre-Drosha+/lox) testis showed robust spermatogenesis (a), whereas the Drosha cKO testis displayed severe germ cell depletion (b-d). Vacuoles (arrows) and multinucleated “giant’ cells (arrowheads), both of which are hallmarks of severe spermatogenic cell depletion, were present throughout the seminiferous epithelium (c, d).
While the control epididymis was filled with spermatozoa (e), the Drosha cKO epididymis contained few spermatozoa and round spermatids probably representing those detached from the seminiferous epithelium and sloughed into the lumen and ended up in the epididymis (f). D. PAS staining of cross-sections of the Dicer cKO testis and cauda epididymis. The control (Stra8-iCre-Dicer+/lox) testis showed normal spermatogenesis (a), whereas the Dicer cKO testis showed active germ cell depletion (b-d). Similar to the
Drosha cKO testis, vacuoles (arrows) and multinucleated “giant’ cells (arrowheads) were noticed in the seminiferous epithelium (c, d). The Dicer cKO epididymis contained reduced number of spermatozoa and depleted round spermatids (f) as compared to the control epididymis (e). Bars=20µm. E. Percentage of seminiferous tubule cross-sections devoid of elongating or elongated spermatids in control, Drosha and Dicer cKO testes.
Bars with different letters are statistically significant (P<0.01, ANOVA). F. Percentage of seminiferous tubule cross-sections containing vacuoles and/or multinucleated “giant” cells in control, Drosha and Dicer cKO testes. Bars with different letters are statistically significant (P<0.01, ANOVA).
144
Figure 4. Onset of germ cell depletion during testicular development in Drosha or Dicer cKO mice. A. Bouin's solution-fixed, paraffin-embedded cross-sections of the control
(heterozygous littermates), Drosha (Stra8-iCre-Droshalox/lox) and Dicer (Stra8-iCre-
Dicerlox/lox) cKO testes were stained with the Periodic Acid-Schiff (PAS) reagent. Germ cell depletion was first detected at P14 and became more and more severe between P17 and P28 in both Drosha and Dicer cKO testes. B. TUNEL assays of apoptotic germ cells in control, Drosha or Dicer cKO testes at P14, P21 and P40. Note that enhanced apoptosis was mainly observed in spermatocytes (brown staining).
145
Figure 5. Altered mRNA transcriptomes in Drosha- or Dicer-null pachytene spermatocytes and round spermatids. A. Microarray analyses revealed numerous mRNAs displaying altered expression levels in Drosha- (a, c) or Dicer-null (b, d) pachytene spermatocytes (a, b) and round spermatids (c, d). Each dot represents one mRNA transcript. Yellow dots are those upregulated mRNAs with a fold change of >1.5
(p<0.05 in ANOVA), while blue dots indicate the downregulated ones with a fold change of <-1.5 (p<0.05 in ANOVA). B. Number of mRNAs with significantly altered levels in Drosha- and/or Dicer-null pachytene spermatocytes (a) and round spermatids (b). 575
146 and 457 mRNAs displayed either up- or down-regulated levels in Drosha and Dicer-null pachytene spermatocytes, respectively. Among the 850 mRNAs with altered levels, 182 were found in both Drosha- and Dicer-null pachytene spermatocytes (a). Levels of 660 and 1,731 mRNAs were altered in Drosha- and Dicer-null round spermatids, respectively.
Among the 1,963 mRNAs changed, 428 were shared between the Drosha- and Dicer-null round spermatids (b).
147
Figure 6. qPCR analyses of expression levels of 9 X- and 3 Y-linked mRNA-coding genes in control, Drosha- or Dicer-null pachytene spermatocytes and round spermatids. All of the 9 X- linked genes (Magea5, Nxf2, Ott, Pramel3, Taf7l, Tex11, Tex16, Tktl1, Usp26) and 3 Y-linked genes (Rbmy1a1, Ube1y, Usp9y) examined have been shown to be largely suppressed during meiotic sex chromosome inactivation (MSCI) and thus their levels in pachytene spermatocytes are at minimal levels. But once MSCI is completed, these genes are highly expressed in round spermatids. Levels of these genes in control pachytene spermatocytes were used as the normalizer. Gapdh was used as an internal control. The experiments were performed in biological triplicates.
148
Figure 7. Evaluation of meiotic sex chromosome inactivation (MSCI) in control (WT),
Drosha- or Dicer-null mid-pachytene and diplotene spermatocytes using double immunofluorescence with anti-γH2AX and HP1β antibodies followed by Cot-1 RNA
149
FISH. A, B, C. In mid pachytene spermatocytes, XY body becomes prominent and protrudes from rest of the nuclei in the mid pachytene stage. Cot-1 signal was almost completely depleted from XY body and γH2AX accumulated on XY body and HP1β only localized on X-centromere at this stage (small dots in the XY body). No significant difference was observed among both control (A), Drosha- (B) and Dicer-null (C) mid- pachytene spermatocytes, suggesting MSCI was initiated and developed normally in either Drosha- or Dicer-null pachytene spermatocytes. D, E, F. In the diplotene phase,
HP1β was localized to the entire XY body. XY body became DAPI-intense and moved towards inside of the nuclei. Depletion of Cot-1 signals was the same between control and mutants. More than 50 cells with HP1β negativity on XY body (mid pachytene) and
>50 cells with HP1β positivity on XY body (late pachytene to diplotene) were examined.
However, no clear difference was detected between control and mutants. Dotted circle:
XY body.
150
Figure S1 Phase-contrast and fluorescent images of purified pachytene spermatocytes (A) and round spermatids (B) from control, Drosha and Dicer cKO testes. Green cells are the Cre-expressing pachytene spermatocytes or round spermatids, whereas the rare red cells represent non-Cre-expressing spermatogonia or somatic cells
(i.e. Sertoli or Leydig cells). All panels are in the same magnification. Bar=20µm.
151
Figure S2 Early stages of spermatogenesis were not affected in Drosha and Dicer cKO testes. Cross sections of P4, P7, and P12 testes from control, Drosha (Stra8-iCre-
Droshalox/lox-Rosa26mTmG+/tg), and Dicer (Stra8-iCre-Dicerlox/lox-Rosa26mTmG+/tg) cKO testes were stained with the Periodic Acid-Schiff reagent. No histological difference was observed between the control and cKO testes. All panels are in the same magnification.
Bar=20µm
152
Figure S3 Validation of microarray data using SYBR green-based real-time qPCR analyses. 43 mRNAs displaying differential expression levels in pachytene spermatocytes and/or round spermatids purified from control, Drosha and Dicer cKO testes in the microarray analyses were chosen for qPCR analyses and the patterns of changes are consistent with the microarray data.
153
Figure S4 RNA FISH analyses on Drosha- or Dicer-null pachytene spermatocytes and spermatogonia (control). Ongoing transcription of the Y-linked gene Uty was detected in spermatogonia, but not in either Drosha- or Dicer-null pachytene spermatocytes. The sex body showed normal γH2AFX immunoreactivity (green).
Bars=5µm.
154
Figure S5 qPCR analyses of levels of three types of transposable elements including
IAP, LINE1 and SINE B2 in control, Drosha- or Dicer-null pachytene spermatocytes
(A) and round spermatids (B).
155
References:
1. Clermont Y (1972) Kinetics of spermatogenesis in mammals: seminiferous epithelium cycle and spermatogonial renewal. Physiological reviews 52: 198-236. 2. Hermo L, Pelletier RM, Cyr DG, Smith CE (2010) Surfing the wave, cycle, life history, and genes/proteins expressed by testicular germ cells. Part 1: background to spermatogenesis, spermatogonia, and spermatocytes. Microscopy research and technique 73: 241-278. 3. Yan W (2009) Male infertility caused by spermiogenic defects: lessons from gene knockouts. Molecular and cellular endocrinology 306: 24-32. 4. Idler RK, Yan W (2011) Control of messenger RNA fate by RNA binding proteins: an emphasis on mammalian spermatogenesis. Journal of andrology. 5. Bettegowda A, Wilkinson MF (2010) Transcription and post-transcriptional regulation of spermatogenesis. Philosophical transactions of the Royal Society of London Series B, Biological sciences 365: 1637-1651. 6. He Z, Kokkinaki M, Pant D, Gallicano GI, Dym M (2009) Small RNA molecules in the regulation of spermatogenesis. Reproduction 137: 901-911. 7. Paronetto MP, Sette C (2010) Role of RNA-binding proteins in mammalian spermatogenesis. International journal of andrology 33: 2-12. 8. Braun RE (1998) Post-transcriptional control of gene expression during spermatogenesis. Seminars in cell & developmental biology 9: 483-489. 9. Rajender S, Avery K, Agarwal A (2011) Epigenetics, spermatogenesis and male infertility. Mutation research 727: 62-71. 10. Trasler JM (2009) Epigenetics in spermatogenesis. Molecular and cellular endocrinology 306: 33-36. 11. Djuranovic S, Nahvi A, Green R (2011) A parsimonious model for gene regulation by miRNAs. Science 331: 550-553. 12. Bartel DP (2009) MicroRNAs: target recognition and regulatory functions. Cell 136: 215-233. 13. Bartel DP, Chen CZ (2004) Micromanagers of gene expression: the potentially widespread influence of metazoan microRNAs. Nature reviews Genetics 5: 396- 400. 14. Yang JS, Lai EC (2011) Alternative miRNA biogenesis pathways and the interpretation of core miRNA pathway mutants. Molecular cell 43: 892-903. 15. Murchison EP, Hannon GJ (2004) miRNAs on the move: miRNA biogenesis and the RNAi machinery. Current opinion in cell biology 16: 223-229. 16. Meister G (2007) miRNAs get an early start on translational silencing. Cell 131: 25- 28. 17. Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 281-297. 18. Rissland OS, Hong SJ, Bartel DP (2011) MicroRNA destabilization enables dynamic regulation of the miR-16 family in response to cell-cycle changes. Molecular cell 43: 993-1004.
156
19. Schnall-Levin M, Rissland OS, Johnston WK, Perrimon N, Bartel DP, et al. (2011) Unusually effective microRNA targeting within repeat-rich coding regions of mammalian mRNAs. Genome research 21: 1395-1403. 20. Lee Y, Han J, Yeom KH, Jin H, Kim VN (2006) Drosha in primary microRNA processing. Cold Spring Harbor symposia on quantitative biology 71: 51-57. 21. Tomari Y, Zamore PD (2005) MicroRNA biogenesis: drosha can't cut it without a partner. Current biology : CB 15: R61-64. 22. Carthew RW, Sontheimer EJ (2009) Origins and Mechanisms of miRNAs and siRNAs. Cell 136: 642-655. 23. Jaskiewicz L, Filipowicz W (2008) Role of Dicer in posttranscriptional RNA silencing. Current topics in microbiology and immunology 320: 77-97. 24. Bernstein E, Kim SY, Carmell MA, Murchison EP, Alcorn H, et al. (2003) Dicer is essential for mouse development. Nature genetics 35: 215-217. 25. da Costa Martins PA, Bourajjaj M, Gladka M, Kortland M, van Oort RJ, et al. (2008) Conditional dicer gene deletion in the postnatal myocardium provokes spontaneous cardiac remodeling. Circulation 118: 1567-1576. 26. Davis TH, Cuellar TL, Koch SM, Barker AJ, Harfe BD, et al. (2008) Conditional loss of Dicer disrupts cellular and tissue morphogenesis in the cortex and hippocampus. The Journal of neuroscience : the official journal of the Society for Neuroscience 28: 4322-4330. 27. Frezzetti D, Reale C, Cali G, Nitsch L, Fagman H, et al. (2011) The microRNA- processing enzyme Dicer is essential for thyroid function. PloS one 6: e27648. 28. Georgi SA, Reh TA (2010) Dicer is required for the transition from early to late progenitor state in the developing mouse retina. The Journal of neuroscience : the official journal of the Society for Neuroscience 30: 4048-4061. 29. Georgi SA, Reh TA (2011) Dicer is required for the maintenance of notch signaling and gliogenic competence during mouse retinal development. Developmental neurobiology 71: 1153-1169. 30. Harfe BD, McManus MT, Mansfield JH, Hornstein E, Tabin CJ (2005) The RNaseIII enzyme Dicer is required for morphogenesis but not patterning of the vertebrate limb. Proceedings of the National Academy of Sciences of the United States of America 102: 10898-10903. 31. Ho JJ, Marsden PA (2008) Dicer cuts the kidney. Journal of the American Society of Nephrology : JASN 19: 2043-2046. 32. Huang T, Liu Y, Huang M, Zhao X, Cheng L (2010) Wnt1-cre-mediated conditional loss of Dicer results in malformation of the midbrain and cerebellum and failure of neural crest and dopaminergic differentiation in mice. Journal of molecular cell biology 2: 152-163. 33. Huang TC, Saharabuddhe NA, Kim MS, Getnet D, Yang Y, et al. (2012) Regulation of Lipid Metabolism By Dicer Revealed Through SILAC Mice. Journal of proteome research. 34. Kanellopoulou C, Muljo SA, Kung AL, Ganesan S, Drapkin R, et al. (2005) Dicer- deficient mouse embryonic stem cells are defective in differentiation and centromeric silencing. Genes & development 19: 489-501.
157
35. Kim GJ, Georg I, Scherthan H, Merkenschlager M, Guillou F, et al. (2010) Dicer is required for Sertoli cell function and survival. The International journal of developmental biology 54: 867-875. 36. Lei L, Jin S, Gonzalez G, Behringer RR, Woodruff TK (2010) The regulatory role of Dicer in folliculogenesis in mice. Molecular and cellular endocrinology 315: 63- 73. 37. Meng DM, Wang L, Xu JR, Yan SL, Zhou L, et al. (2011) Fabp4-Cre-mediated deletion of the miRNA-processing enzyme Dicer causes mouse embryonic lethality. Acta diabetologica. 38. Mudhasani R, Puri V, Hoover K, Czech MP, Imbalzano AN, et al. (2011) Dicer is required for the formation of white but not brown adipose tissue. Journal of cellular physiology 226: 1399-1406. 39. Muljo SA, Ansel KM, Kanellopoulou C, Livingston DM, Rao A, et al. (2005) Aberrant T cell differentiation in the absence of Dicer. The Journal of experimental medicine 202: 261-269. 40. Nagaraja AK, Andreu-Vieyra C, Franco HL, Ma L, Chen R, et al. (2008) Deletion of Dicer in somatic cells of the female reproductive tract causes sterility. Molecular endocrinology 22: 2336-2352. 41. Nakamura M, Ando R, Nakazawa T, Yudazono T, Tsutsumi N, et al. (2007) Dicer- related drh-3 gene functions in germ-line development by maintenance of chromosomal integrity in Caenorhabditis elegans. Genes to cells : devoted to molecular & cellular mechanisms 12: 997-1010. 42. Pan Y, Balazs L, Tigyi G, Yue J (2011) Conditional deletion of Dicer in vascular smooth muscle cells leads to the developmental delay and embryonic mortality. Biochemical and biophysical research communications 408: 369-374. 43. Saal S, Harvey SJ (2009) MicroRNAs and the kidney: coming of age. Current opinion in nephrology and hypertension 18: 317-323. 44. Sequeira-Lopez ML, Weatherford ET, Borges GR, Monteagudo MC, Pentz ES, et al. (2010) The microRNA-processing enzyme dicer maintains juxtaglomerular cells. Journal of the American Society of Nephrology : JASN 21: 460-467. 45. Tang KF, Wang Y, Wang P, Chen M, Chen Y, et al. (2007) Upregulation of PHLDA2 in Dicer knockdown HEK293 cells. Biochimica et biophysica acta 1770: 820-825. 46. Wang Y, Medvid R, Melton C, Jaenisch R, Blelloch R (2007) DGCR8 is essential for microRNA biogenesis and silencing of embryonic stem cell self-renewal. Nature genetics 39: 380-385. 47. Suh N, Baehner L, Moltzahn F, Melton C, Shenoy A, et al. (2010) MicroRNA function is globally suppressed in mouse oocytes and early embryos. Current biology : CB 20: 271-277. 48. Ma J, Flemr M, Stein P, Berninger P, Malik R, et al. (2010) MicroRNA activity is suppressed in mouse oocytes. Current biology : CB 20: 265-270. 49. Korhonen HM, Meikar O, Yadav RP, Papaioannou MD, Romero Y, et al. (2011) Dicer is required for haploid male germ cell differentiation in mice. PloS one 6: e24821.
158
50. Romero Y, Meikar O, Papaioannou MD, Conne B, Grey C, et al. (2011) Dicer1 depletion in male germ cells leads to infertility due to cumulative meiotic and spermiogenic defects. PloS one 6: e25241. 51. Huang CC, Yao HH (2010) Inactivation of Dicer1 in Steroidogenic factor 1-positive cells reveals tissue-specific requirement for Dicer1 in adrenal, testis, and ovary. BMC developmental biology 10: 66. 52. Maatouk DM, Loveland KL, McManus MT, Moore K, Harfe BD (2008) Dicer1 is required for differentiation of the mouse male germline. Biology of reproduction 79: 696-703. 53. Hayashi K, Chuva de Sousa Lopes SM, Kaneda M, Tang F, Hajkova P, et al. (2008) MicroRNA biogenesis is required for mouse primordial germ cell development and spermatogenesis. PloS one 3: e1738. 54. Song R, Hennig GW, Wu Q, Jose C, Zheng H, et al. (2011) Male germ cells express abundant endogenous siRNAs. Proceedings of the National Academy of Sciences of the United States of America 108: 13159-13164. 55. Aoki K, Taketo MM (2008) Tissue-specific transgenic, conditional knockout and knock-in mice of genes in the canonical Wnt signaling pathway. Methods in molecular biology 468: 307-331. 56. Wang X (2009) Cre transgenic mouse lines. Methods in molecular biology 561: 265- 273. 57. Yu Y, Zuo J (2009) The practical use of Cre and loxP technologies in mouse auditory research. Methods in molecular biology 493: 87-102. 58. Chong MM, Rasmussen JP, Rudensky AY, Littman DR (2008) The RNAseIII enzyme Drosha is critical in T cells for preventing lethal inflammatory disease. The Journal of experimental medicine 205: 2005-2017. 59. Sadate-Ngatchou PI, Payne CJ, Dearth AT, Braun RE (2008) Cre recombinase activity specific to postnatal, premeiotic male germ cells in transgenic mice. Genesis 46: 738-742. 60. Muzumdar MD, Tasic B, Miyamichi K, Li L, Luo L (2007) A global double- fluorescent Cre reporter mouse. Genesis 45: 593-605. 61. Bellve AR (1993) Purification, culture, and fractionation of spermatogenic cells. Methods in enzymology 225: 84-113. 62. Song R, Ro S, Michaels JD, Park C, McCarrey JR, et al. (2009) Many X-linked microRNAs escape meiotic sex chromosome inactivation. Nature genetics 41: 488-493. 63. Hogarth CA, Mitchell D, Evanoff R, Small C, Griswold M (2011) Identification and expression of potential regulators of the mammalian mitotic-to-meiotic transition. Biology of reproduction 84: 34-42. 64. Royo H, Polikiewicz G, Mahadevaiah SK, Prosser H, Mitchell M, et al. (2010) Evidence that meiotic sex chromosome inactivation is essential for male fertility. Current biology : CB 20: 2117-2123. 65. Turner JM, Mahadevaiah SK, Ellis PJ, Mitchell MJ, Burgoyne PS (2006) Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental cell 10: 521-529.
159
66. Namekawa SH, Lee JT (2011) Detection of nascent RNA, single-copy DNA and protein localization by immunoFISH in mouse germ cells and preimplantation embryos. Nature protocols 6: 270-284. 67. McCarrey JR, Berg WM, Paragioudakis SJ, Zhang PL, Dilworth DD, et al. (1992) Differential transcription of Pgk genes during spermatogenesis in the mouse. Developmental biology 154: 160-168. 68. Ro S, Park C, Sanders KM, McCarrey JR, Yan W (2007) Cloning and expression profiling of testis-expressed microRNAs. Developmental biology 311: 592-602. 69. Kim VN, Han J, Siomi MC (2009) Biogenesis of small RNAs in animals. Nature reviews Molecular cell biology 10: 126-139. 70. Wu H, Xu H, Miraglia LJ, Crooke ST (2000) Human RNase III is a 160-kDa protein involved in preribosomal RNA processing. The Journal of biological chemistry 275: 36957-36965. 71. Denli AM, Tops BB, Plasterk RH, Ketting RF, Hannon GJ (2004) Processing of primary microRNAs by the Microprocessor complex. Nature 432: 231-235. 72. Gregory RI, Yan KP, Amuthan G, Chendrimada T, Doratotaj B, et al. (2004) The Microprocessor complex mediates the genesis of microRNAs. Nature 432: 235- 240. 73. Shukla KK, Mahdi AA, Rajender S (2012) Apoptosis, spermatogenesis and male infertility. Frontiers in bioscience 4: 746-754. 74. Print CG, Loveland KL (2000) Germ cell suicide: new insights into apoptosis during spermatogenesis. BioEssays : news and reviews in molecular, cellular and developmental biology 22: 423-430. 75. Yang J, Medvedev S, Yu J, Tang LC, Agno JE, et al. (2005) Absence of the DNA- /RNA-binding protein MSY2 results in male and female infertility. Proceedings of the National Academy of Sciences of the United States of America 102: 5755- 5760. 76. Guo H, Ingolia NT, Weissman JS, Bartel DP (2010) Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466: 835-840. 77. Namekawa SH, Park PJ, Zhang LF, Shima JE, McCarrey JR, et al. (2006) Postmeiotic sex chromatin in the male germline of mice. Current biology : CB 16: 660-667. 78. Turner JM (2007) Meiotic sex chromosome inactivation. Development 134: 1823- 1831. 79. Namekawa SH, VandeBerg JL, McCarrey JR, Lee JT (2007) Sex chromosome silencing in the marsupial male germ line. Proceedings of the National Academy of Sciences of the United States of America 104: 9730-9735. 80. Kaneko H, Dridi S, Tarallo V, Gelfand BD, Fowler BJ, et al. (2011) DICER1 deficit induces Alu RNA toxicity in age-related macular degeneration. Nature 471: 325- 330. 81. Murchison EP, Stein P, Xuan Z, Pan H, Zhang MQ, et al. (2007) Critical roles for Dicer in the female germline. Genes & development 21: 682-693. 82. Lomeli H, Ramos-Mejia V, Gertsenstein M, Lobe CG, Nagy A (2000) Targeted insertion of Cre recombinase into the TNAP gene: excision in primordial germ cells. Genesis 26: 116-117.
160
83. Nakahara K, Carthew RW (2004) Expanding roles for miRNAs and siRNAs in cell regulation. Current opinion in cell biology 16: 127-133. 84. Vasudevan S, Tong Y, Steitz JA (2007) Switching from repression to activation: microRNAs can up-regulate translation. Science 318: 1931-1934. 85. Suh N, Blelloch R (2011) Small RNAs in early mammalian development: from gametes to gastrulation. Development 138: 1653-1661. 86. Tam OH, Aravin AA, Stein P, Girard A, Murchison EP, et al. (2008) Pseudogene- derived small interfering RNAs regulate gene expression in mouse oocytes. Nature 453: 534-538.
161
Chapter 6
Summary
To better understand fertility in humans, mouse models have provided us invaluable information in reproductive biology. Using knockout (KO) mouse models, our study showed that both protein-coding genes and small non-coding RNAs are essential for normal spermatogenesis and male fertility.
During spermiogenesis, the rate of ubiquitination is high due to the enhanced protein turnover rate and the rearrangement/elimination of unnecessary organelles [1,2].
Our study identified that CUL3-KLHL10 is a novel spermatid-specific E3 ligase responsible for protein turnover during late spermiogenesis. A spermatid-specific protein,
SPATA3, was identified to be a substrate of CUL3-KLHL10 E3 ligase complex. In addition, the disruption of this E3 ligase by inactivating Klhl10 causes accumulation of mitochondrial proteins in spermatids, suggesting CUL3-KLHL10 E3 ligase functions in the regulation of mitochondria proteostasis. To confirm KLHL10 function in mitochondrial protein turnover, western blot need to be performed using antibodies against mitochondrial proteins identified in 2D/MS. Co-immunoprecipitation and ubiquitination assays will be helpful to determine which mitochondrial proteins are true substrates for CUL3-KLHL10 E3 ligase.
Upon nuclear condensation initiating in spermatids, histones are sequentially replaced by transition nuclear proteins and protamines [3]. Hils1-/-Tnp1-/- double KO mice we generated displayed severe defects in sperm, including highly reduced sperm number, less condensed sperm nuclei, increased sperm DNA damage and elevated premature P2.
Our data showed that majority of Hils1-/-Tnp1-/- sperm were not capable of developing
162 beyond 2-cell stage after ICSI. Two major functions, maternal mRNA degradation and embryonic gene activation, were not normally executed during maternal to zygotic transition in mutant 2PN zygotes and 2-cell embryos. To reveal how defective sperm can cause pre-implantation embryonic arrest, it would be useful to investigate the paternal chromatin or histone modification changes at genome-wide level in mutant sperm.
It has been shown that mouse spermatogenic cells express abundant miRNAs and endo-siRNAs [4-6]. To address the function of miRNAs and endo-siRNAs during spermatogenesis, we conditionally inactivated Drosha or Dicer in spermatogenic cells starting at postnatal day 3 using a germ cell-specific iCre. Although no significant differences were observed between Drosha and Dicer KO testes at morphologic level, microarray analyses revealed that the altered transcript profiles caused by deletion of
Drosha and Dicer did not fully overlap, suggesting that DROSHA and DICER indeed are involved in different small RNA pathways. Further investigation is needed for uncovering the molecular mechanism underlying the phenotypes of mutant mice.
Overall, we show that both spermiogenesis associated genes and small non- coding RNAs are crucial for male germ cell development. The detailed information about genes we studied using knockout strategy is summarized in Table 1. Our study will benefit the understanding of fundamentals of reproductive biology.
163
Knockout genes Expression pattern Phenotypes Functions of protein Klhl10 Cytoplasm of step 9– Depletion of germ A component of 16 spermatids cells; no sperm CUL3-based ubiquitin production; infertile. E3 ligase complex; serves as a substrate adaptor Hils1 Nuclei of step 9-15 Abnormal chromatin Chromatin spermatids condensation; remodeling? incomplete P2 processing; fertile. Tnp1 Nuclei of step 10-14 Abnormal chromatin Chromatin spermatids condensation; remodeling? incomplete P2 processing; reduced sperm motility; reduced fertility. Drosha Nucleus Germ cell depletion; A RNase III for (Conditional knockout reduced sperm cleaving pri-miRNAs in postnatal germ number; infertile. to pre-miRNAs. cells) Dicer Cytoplasm Germ cell depletion; A RNase III for (Conditional knockout reduced sperm cleaving pre-miRNAs in postnatal germ number; infertile. to cells) mature miRNAs; process double stranded RNAs to generate endo-siRNAs.
Table 1. Summary of genes involved in spermatogenesis in our study.
164
References:
1. Rajapurohitam V, Morales CR, El-Alfy M, Lefrancois S, Bedard N, et al. (1999) Activation of a UBC4-dependent pathway of ubiquitin conjugation during postnatal development of the rat testis. Dev Biol 212: 217-228. 2. Rajapurohitam V, Bedard N, Wing SS (2002) Control of ubiquitination of proteins in rat tissues by ubiquitin conjugating enzymes and isopeptidases. Am J Physiol Endocrinol Metab 282: E739-745. 3. Oliva R, Dixon GH (1991) Vertebrate protamine genes and the histone-to-protamine replacement reaction. Prog Nucleic Acid Res Mol Biol 40: 25-94. 4. Barad O, Meiri E, Avniel A, Aharonov R, Barzilai A, et al. (2004) MicroRNA expression detected by oligonucleotide microarrays: system establishment and expression profiling in human tissues. Genome Res 14: 2486-2494. 5. Liu CG, Calin GA, Meloon B, Gamliel N, Sevignani C, et al. (2004) An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc Natl Acad Sci U S A 101: 9740-9744. 6. Song R, Hennig GW, Wu Q, Jose C, Zheng H, et al. (2011) Male germ cells express abundant endogenous siRNAs. Proc Natl Acad Sci U S A 108: 13159-13164.