DOCSLIB.ORG

Brcaallwithlabelsintegrina1b1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Brcaallwithlabelsintegrina1b1 Receptor-type tyrosine-proteinMuscle- skeletal receptor phosphatase tyrosine protein kinase S Dual specificity mitogen-activated protein kinase kinase 1 Plasminogen activator inhibitor-1 Epidermal growth factor receptor erbB1 Beta amyloid A4 protein MAPDual specificity Epidermalkinase mitogen-activated growth factorCasein proteinreceptor ERK2 kinase and ErbB2kinase; II (HER1 alphaMEK1/2 and (prime) HER2) Casein kinase II alpha Integrin alpha-IIb MAPCasein kinase kinase II beta ERK1 Dual specificity mitogen-activated protein kinase kinase 2 Lysyl oxidase Integrin alpha-IIb/beta-3 Furin Mitogen-activatedSerine/threonine-protein kinase RAF and Dual specificityEpidermal protein mitogen-activated growth proteinkinase; factor kinase kinase receptor 1 (Raf/MEK)ERK1/ERK2 Integrin alpha-V/beta-3 Integrin alpha-V/beta-3 and alpha-IIb/beta 3 Casein kinase II Signal transduction by L1 Integrin alpha-V/beta-6 Casein kinase II alpha/beta Vitronectin receptor alpha Bone morphogenetic protein 2 ECM proteoglycans Bone morphogenetic protein 4 VitronectinElastic fibre formation Peripheral plasma membrane protein CASK Neuropilin-1 Integrin alpha-V/beta-5 Protein kinaseProtein kinase C (PKC) alpha Integrin alpha-2/beta-3 Molecules associated with elastic fibres PKC alpha and beta-2 MER intracellular domain/EGFR extracellular domain chimera Fibronectin receptor alpha Protein kinase C- PKC; classical/novel Syndecan interactions Integrin alpha-2 von Willebrand factorIntegrin alpha-10 Laminin interactions Integrin alpha-11 Fibrinogen beta chain Serine/threonine-proteinVascular endothelial growth factor receptor 2 kinase PAK 1 Vascular endothelial growth factor receptorPlatelet Adhesion to exposed collagen Integrin alpha-1 Tyrosine-protein kinase Lyn CD44 antigen Integrin cell surface interactionsCHL1 interactions Ras-related C3 botulinum toxin substrate 1/T-lymphoma invasion and metastasis-inducing protein 1 Tyrosine-protein kinase FYN Integrin alpha-5/beta-1 Integrin alpha-V/beta-1Ras-related C3 botulinum toxin substrate 1 Oxidized low-density lipoprotein receptor 1 T-cell surface antigen CD2 Other semaphorin interactions Thrombin and coagulation factor VII TRAIL receptor-1 Leukocyte common antigen Fibronectin matrixFibronectin formation receptor beta Glycophorin-A Integrin alpha-4/beta-1 Platelet factor 4 HLA-DR antigens-associated invariant chain Transforming growth factor beta-1 Integrin alpha2/beta1 Apolipoprotein B-100 CellP-selectin glycoproteinsurface ligand 1 interactions at theIntegrin vascular alpha-4 wall Macrophage migration inhibitory factor Thrombin and coagulation factor X Fibronectin Vitamin K-dependentP-selectin protein C Integrin alpha-4/beta-7 Localization of the PINCH-ILK-PARVIN complex to focal adhesions Integrin alpha1/beta1Fibronectin receptor (Integrin complexalpha-5/beta-1 and alpha-V/beta-3) MIF/CD74 (Macrophage migrationLymphocyte Proto-oncogeneinhibitory factor and HLA-DR function-associated tyrosine-protein Leukocyteantigens-associated kinaseinvariant chain) MER antigen 3- adhesionCD58 glycoprotein LFA-1 alpha Serine/threonine-protein kinase ILK-1 Selectin E MET interacts with TNS proteins Tumor necrosis factorThrombin receptor superfamily member 10B MET activates PTK2 signaling Integrin alpha-3 Leukocyte adhesion molecule-1 Smooth Muscle Contraction Hepatocyte growth factor receptor Triggering receptor expressed on myeloid cells 1 Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell Focal adhesion kinase 1/vascular endothelial growth factor receptor 3 Paxillin Cell division control protein 42 homolog Tyrosine-proteinFocal adhesion kinase SRC kinase 1 Serine/threonine protein phosphataseAurora 2A- kinase B/Inner 56 centromere kDa protein regulatory subunit- alpha isoform Serine/threonine-proteinMyosin light chain kinasekinase- smoothPAK 2 muscle RHO GTPases Activate Formins CD22 40S ribosomal protein S27 Antigen-presenting glycoprotein CD1d Calmodulin Serine/threonine protein phosphatase 2A- catalytic subunit- alpha isoform IntercellularCD81 antigen adhesion molecule (ICAM-1)- Integrin alpha-L/beta-2 Annexin A2 Integrin alpha-M/beta-2 Centromere-associated protein E Annexin A2/S100-A10 Serine/threonine-protein kinase PLK1 Pulmonary surfactant-associatedComplement protein C3D Tubulin beta-1 chain High affinity immunoglobulin gamma Fc receptor IIntegrin alpha M Integrin alpha-L/beta-2 (LFA-1) Basigin interactions Mitotic checkpoint serine/threonine-protein kinase BUB1 Hemagglutinin Segment polarity proteinSerine/threonine dishevelled protein phosphatase homolog PP1-gamma catalytic subunitDVL-2 HLASH2 class domain-containing I histocompatibility protein 1A antigen A-3 Serine/threonine-proteinTubulin kinase TAO1 beta-2 chain Basic fibroblast growth factor Tubulin beta-3 chainTransformingKinetochore protein RhoA protein NDC80 homolog Segment polarity protein dishevelled homolog DVL-1 Intercellular adhesion molecule-1 Exportin-1 Serine/threonine-protein kinase Aurora-B Vascular cell adhesion protein 1 Segment polarity protein dishevelled homolog DVL-3 Actin- cytoplasmic 1 Myelin-associated glycoprotein Rho-related GTP-binding protein RhoB Heat shock cognate 71 kDa protein Sodium/potassium-transporting ATPase Kinesin-likeTubulin protein KIF2C Hepatocyte growth factor Monocarboxylate transporter 1 Cystine/glutamate transporter Monocarboxylate transporter 4 L-type amino acid transporter 1 Cyclophilin A Collagenase Matrix metalloproteinase-1Baculoviral IAP repeat-containing protein 5 Hypoxia-inducible factor 1 alpha Opioid receptors; delta & kappa Serine/threonine-protein kinase AKT Induced myeloid leukemia cell differentiation protein Mcl-1 Delta opioidSerine/threonine-protein receptor kinase PIM1 Heme oxygenase 1 Tumour suppressor p53/oncoprotein Mdm2 PI3-kinase p85-alpha subunit Signal transducer and activator of transcription 1-alpha/beta PI3-kinase class I Interleukin-4 and 13 signalingEotaxin Forkhead box protein O3 CCR5/mu opioid receptor complex Mu opioid receptorInterleukin-6 Opioid receptors; mu & delta Platelet glycoprotein 4 Opioid receptors; mu & kappa Interleukin-8 JAK3/JAK1 Monoamine oxidase CyclooxygenaseCellular tumor antigen p53 JAK2/TYK2 Homeobox protein NANOG Bcl-xL/BAK 5-lipoxygenase/FLAP Tumour suppressor protein p53/Mdm4 TNF-alpha Sphingosine 1-phosphate receptor Edg-1 Nuclear receptor ROR-alpha Matrix metalloproteinase 9 JAK2/JAK1Myc proto-oncogene protein PI3KCDK-interacting p110 protein beta/p85 1 alpha Apoptosisc-Myc/Max regulator Bcl-X Tyrosine-protein kinase JAK2 VascularArachidonate endothelial growth factor A 15-lipoxygenase JAK1/JAK2/TYK2 HeatCoagulation shock factor XIIINitric oxide protein sythases;PI3-kinase iNOS p110-alpha/p85-alpha HSP90 & nNOS Cyclin-dependentPI3-kinase p110-delta/p85-alpha kinaseCDK6/cyclin 4/cyclin D1 D1 Interleukin-1Heat shock protein beta HSP 90-alpha Cyclooxygenase-2 Opioid receptors; mu/kappa/delta ImmunoglobulinSignal epsilon transducer Fc receptor and activator of transcription 6 Forkhead box protein O1 JAK1/TYK2 Endoplasmin ApoptosisTyrosine-protein regulator Bcl-2 Nuclear receptor ROR-gamma kinase TYK2 G1/S-specific cyclin D1 C-C motif chemokine 2 Matrix metalloproteinase-2 Cyclin-dependentSignalPOU domain- transducer class 2- transcription factor 1 and kinase activatorHypoxia inducible of4/cyclin factors; transcription HIF-1-alpha- HIF-2-alpha D 3 AKT/p21CIP1 Tyrosine-protein kinase JAK3 Matrix metalloproteinase 3 Tyrosine-proteinArachidonate 5-lipoxygenase kinase JAK1 Monoamine IL6Ralpha/GP130oxidase A Nitric oxideCREB-binding protein/p53 synthase- inducible.
Load more

Recommended publications
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Paxillin Binding to the Cytoplasmic Domain of CD103 Promotes Cell Adhesion and Effector
    Author Manuscript Published OnlineFirst on October 11, 2017; DOI: 10.1158/0008-5472.CAN-17-1487 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Paxillin binding to the cytoplasmic domain of CD103 promotes cell adhesion and effector functions for CD8+ resident memory T cells in tumors Ludiane Gauthier1, Stéphanie Corgnac1, Marie Boutet1, Gwendoline Gros1, Pierre Validire2, Georges Bismuth3 and Fathia Mami-Chouaib1 1 INSERM UMR 1186, Integrative Tumor Immunology and Genetic Oncology, Gustave Roussy, EPHE, Fac. de médecine - Univ. Paris-Sud, Université Paris-Saclay, 94805, Villejuif, France 2 Institut Mutualiste Montsouris, Service d’Anatomie pathologique, 75014 Paris, France. 3 INSERM U1016, CNRS UMR8104, Université Paris Descartes, Institut Cochin, 75014 Paris. S Corgnac, M Boutet and G Gros contributed equally to this work. M Boutet current address: Department of Microbiology and Immunology Albert Einstein College of Medecine, NY 10461 USA. Corresponding author: Fathia Mami-Chouaib, INSERM UMR 1186, Gustave Roussy. 39, rue Camille Desmoulins, F-94805 Villejuif. Phone: +33 1 42 11 49 65, Fax: +33 1 42 11 52 88, e-mail: [email protected] and [email protected] Running title: CD103 signaling in human TRM cells Key words: TRM cells, CD103 integrin, T-cell function and signaling, paxillin. Abbreviations: IS: immune synapse; LFA: leukocyte function-associated antigen; FI: fluorescence intensity; mAb: monoclonal antibody; phospho: phosphorylated; Pyk2: proline- rich tyrosine kinase-2; NSCLC: non-small-cell lung carcinoma; r: recombinant; sh-pxn: shorthairpin RNA-paxillin; TCR: T-cell receptor; TIL: tumor-infiltrating lymphocyte; TRM: tissue-resident memory T.
    [Show full text]
  • Human Integrin Alpha L Gene Cdna Clone Plasmid
    Human Integrin alpha L Gene cDNA clone plasmid Catalog Number: HG10812-M General Information Plasmid Resuspension protocol Gene : integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; 1.Centrifuge at 5,000×g for 5 min. alpha polypeptide) 2.Carefully open the tube and add 100 l of sterile water to dissolve the DNA. Official Symbol : ITGAL 3.Close the tube and incubate for 10 minutes at room temperature. 4.Briefly vortex the tube and then do a quick spin to concentrate Synonym : CD11A, LFA-1, LFA1A, ITGAL the liquid at the bottom. Speed is less than 5000×g. 5.Store the plasmid at -20 ℃. Source : Human The plasmid is ready for: cDNA Size: 3513bp • Restriction enzyme digestion • PCR amplification RefSeq : NM_002209.2 • E. coli transformation • DNA sequencing Plasmid: pMD-ITGAL E.coli strains for transformation (recommended Description but not limited) Lot : Please refer to the label on the tube Most commercially available competent cells are appropriate for Sequence Description : the plasmid, e.g. TOP10, DH5α and TOP10F´. Identical with the Gene Bank Ref. ID sequence except for the point mutation 2928 A/G not causing the amino acid variation. Vector : pMD18-T Simple Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. Storage : The lyophilized plasmid can be stored at ambient temperature for three months. Quality control : The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. Sequencing primer list : M13-47 ： 5’ GCCAGGGTTTTCCCAGTCACGAC 3’ RV-M ： 5’ GAGCGGATAACAATTTCACACAGG 3’ Other M13 primers can also be used as sequencing primers.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • APC Anti-Human Cd11b (ICRF44) Catalog Number: 20-0118
    TECHNICAL DATA SHEET APC Anti-Human CD11b (ICRF44) Catalog Number: 20-0118 PRODUCT INFORMATION Count Contents: APC Anti-Human CD11b (ICRF44) Isotype: Mouse IgG1, kappa 0 0 1 2 3 4 10 10 10 10 10 Human CD11b (ICRF44) APC Concentration: 5 uL (1 ug)/test Clone: ICRF44 Human peripheral blood monocytes were stained with 5 uL (1 ug) APC Anti-Human CD11b (20-0118) (solid line) or 1 ug APC Mouse Reactivity: Human IgG1 isotype control (dashed line). Formulation: 10 mM NaH2PO4, 150 mM NaCl, 0.09% NaN3, 0.1% gelatin, pH7.2 DESCRIPTION The ICRF44 antibody reacts with human CD11b, also known as integrin alpha M. This 165-170 kDa cell surface glycoprotein is part of a family of integrin receptors that mediate adhesion between cells (cell-cell) and components of the extracellular matrix, e.g. fibrinogen (cell-matrix). In addition, integrins are active signaling receptors which recruit leukocytes to inflammatory sites and promote cell activa- tion. Complete, functional integrin receptors consist of distinct combinations of integrin chains which are differentially expressed. Integrin alpha M (CD11b) assembles with Integrin beta-2 (CD18) into a receptor known as Macrophage Antigen-1 (Mac-1) or complement receptor type 3 (CR3). This receptor binds and induces intracellular signaling through ICAM-1, ICAM-2, ICAM-3 and ICAM-4 on endothelial cells and can also facilitate removal of iC3b bearing foreign cells.The ICRF44 antibody is widely used as a marker for CD11b expression on macrophages, granulocytes, and subsets of NK cells. It is reported to be cross-reactive with a number of non-human species including Baboon, Chimpanzee, Cynomolgus, Rhesus and Swine.
    [Show full text]
  • CD Markers Are Routinely Used for the Immunophenotyping of Cells
    ptglab.com 1 CD MARKER ANTIBODIES www.ptglab.com Introduction The cluster of differentiation (abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules. So-called CD markers are routinely used for the immunophenotyping of cells. Despite this use, they are not limited to roles in the immune system and perform a variety of roles in cell differentiation, adhesion, migration, blood clotting, gamete fertilization, amino acid transport and apoptosis, among many others. As such, Proteintech’s mini catalog featuring its antibodies targeting CD markers is applicable to a wide range of research disciplines. PRODUCT FOCUS PECAM1 Platelet endothelial cell adhesion of blood vessels – making up a large portion molecule-1 (PECAM1), also known as cluster of its intracellular junctions. PECAM-1 is also CD Number of differentiation 31 (CD31), is a member of present on the surface of hematopoietic the immunoglobulin gene superfamily of cell cells and immune cells including platelets, CD31 adhesion molecules. It is highly expressed monocytes, neutrophils, natural killer cells, on the surface of the endothelium – the thin megakaryocytes and some types of T-cell. Catalog Number layer of endothelial cells lining the interior 11256-1-AP Type Rabbit Polyclonal Applications ELISA, FC, IF, IHC, IP, WB 16 Publications Immunohistochemical of paraffin-embedded Figure 1: Immunofluorescence staining human hepatocirrhosis using PECAM1, CD31 of PECAM1 (11256-1-AP), Alexa 488 goat antibody (11265-1-AP) at a dilution of 1:50 anti-rabbit (green), and smooth muscle KD/KO Validated (40x objective). alpha-actin (red), courtesy of Nicola Smart. PECAM1: Customer Testimonial Nicola Smart, a cardiovascular researcher “As you can see [the immunostaining] is and a group leader at the University of extremely clean and specific [and] displays Oxford, has said of the PECAM1 antibody strong intercellular junction expression, (11265-1-AP) that it “worked beautifully as expected for a cell adhesion molecule.” on every occasion I’ve tried it.” Proteintech thanks Dr.
    [Show full text]
  • Human ITGAL Peptide (DAG-P0325) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Human ITGAL peptide (DAG-P0325) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Antigen Description ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Specificity Leukocytes. Nature Synthetic Expression System N/A Purity 70 - 90% by HPLC. Conjugate Unconjugated Sequence Similarities Belongs to the integrin alpha chain family.Contains 7 FG-GAP repeats.Contains 1 VWFA domain. Cellular Localization Membrane. Procedure None Format Liquid Preservative None Storage Shipped at 4°C. Upon delivery aliquot and store at -20°C or -80°C. Avoid repeated freeze / thaw cycles. Information available upon request. ANTIGEN GENE INFORMATION Gene Name ITGAL integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide) [ Homo sapiens (human) ] 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative
    [Show full text]
  • High Constitutive Cytokine Release by Primary Human Acute Myeloid Leukemia Cells Is Associated with a Specific Intercellular Communication Phenotype
    Supplementary Information High Constitutive Cytokine Release by Primary Human Acute Myeloid Leukemia Cells Is Associated with a Specific Intercellular Communication Phenotype Håkon Reikvam 1,2,*, Elise Aasebø 1, Annette K. Brenner 2, Sushma Bartaula-Brevik 1, Ida Sofie Grønningsæter 2, Rakel Brendsdal Forthun 2, Randi Hovland 3,4 and Øystein Bruserud 1,2 1 Department of Clinical Science, University of Bergen, 5020, Bergen, Norway 2 Department of Medicine, Haukeland University Hospital, 5021, Bergen, Norway 3 Department of Medical Genetics, Haukeland University Hospital, 5021, Bergen, Norway 4 Institute of Biomedicine, University of Bergen, 5020, Bergen, Norway * Correspondence: [email protected]; Tel.: +55-97-50-00 J. Clin. Med. 2019, 8, x 2 of 36 Figure S1. Mutational studies in a cohort of 71 AML patients. The figure shows the number of patients with the various mutations (upper), the number of mutations in for each patient (middle) and the number of main classes with mutation(s) in each patient (lower). 2 J. Clin. Med. 2019, 8, x; doi: www.mdpi.com/journal/jcm J. Clin. Med. 2019, 8, x 3 of 36 Figure S2. The immunophenotype of primary human AML cells derived from 62 unselected patients. The expression of the eight differentiation markers CD13, CD14, CD15, CD33, CD34, CD45, CD117 and HLA-DR was investigated for 62 of the 71 patients included in our present study. We performed an unsupervised hierarchical cluster analysis and identified four patient main clusters/patient subsets. The mutational profile for each f the 62 patients is also given (middle), no individual mutation of main class of mutations showed any significant association with any of the for differentiation marker clusters (middle).
    [Show full text]
  • ICAM-1 (Phospho Tyr512) Polyclonal Antibody
    ICAM-1 Monoclonal Antibody Catalog No : YM1051 Reactivity : Human Applications : WB,IF/ICC Gene Name : ICAM1 Protein Name : Intercellular adhesion molecule 1 Human Gene Id : 3383 Human Swiss Prot P05362 No : Mouse Swiss Prot P13597 No : Immunogen : Purified recombinant human ICAM-1 (N-terminus) protein fragments expressed in E.coli. Specificity : ICAM-1 Monoclonal Antibody detects endogenous levels of ICAM-1 protein. Formulation : Purified mouse monoclonal in buffer containing 0.1M Tris-Glycine (pH 7.4, 150 mM NaCl) with 0.2% sodium azide, 50% glycerol. Source : Mouse Dilution : Western Blot: 1/1000 - 1/2000. Immunofluorescence: 1/100 - 1/500. Not yet tested in other applications. Purification : Affinity purification Concentration : 1 mg/ml Storage Stability : -20°C/1 year Cell Pathway : Cell adhesion molecules (CAMs),Natural killer cell mediated cytotoxicity,Leukocyte transendothelial migration,Viral myocarditis, 1 / 2 Background : intercellular adhesion molecule 1(ICAM1) Homo sapiens This gene encodes a cell surface glycoprotein which is typically expressed on endothelial cells and cells of the immune system. It binds to integrins of type CD11a / CD18, or CD11b / CD18 and is also exploited by Rhinovirus as a receptor. [provided by RefSeq, Jul 2008], Function : function:ICAM proteins are ligands for the leukocyte adhesion protein LFA-1 (integrin alpha-L/beta-2). During leukocyte trans-endothelial migration, ICAM1 engagement promotes the assembly of endothelial apical cups through SGEF and RHOG activation. In case of rhinovirus infection acts as a cellular receptor for the virus.,online information:ICAM-1,online information:Icosahedral capsid structure,online information:Intercellular adhesion molecule entry,polymorphism:Homozygotes with ICAM1-Kalifi Met-56 seem to have an increased risk for cerebral malaria.,PTM:Monoubiquitinated, which is promoted by MARCH9 and leads to endocytosis.,similarity:Belongs to the immunoglobulin superfamily.
    [Show full text]
  • Structural Insight on the Recognition of Surface-Bound Opsonins by the Integrin I Domain of Complement Receptor 3
    Structural insight on the recognition of surface-bound opsonins by the integrin I domain of complement receptor 3 Goran Bajica, Laure Yatimea, Robert B. Simb, Thomas Vorup-Jensenc,1, and Gregers R. Andersena,1 Departments of aMolecular Biology and Genetics and cBiomedicine, Aarhus University, DK-8000 Aarhus, Denmark; and bDepartment of Pharmacology, University of Oxford, Oxford OX1 3QT, United Kingdom Edited by Douglas T. Fearon, University of Cambridge School of Clinical Medicine, Cambridge, United Kingdom, and approved August 28, 2013 (received for review June 13, 2013) Complement receptors (CRs), expressed notably on myeloid and degranulation, and changes in leukocyte cytokine production (2, lymphoid cells, play an essential function in the elimination of 5–7). CR3, and to a lesser degree CR4, are essential for the complement-opsonized pathogens and apoptotic/necrotic cells. In phagocytosis of complement-opsonized particles or complexes addition, these receptors are crucial for the cross-talk between the (6, 8, 9). Complement-opsonized immune complexes are cap- innate andadaptive branches ofthe immune system. CR3 (also known tured in the lymph nodes by CR3-positive subcapsular sinus as Mac-1, integrin α β , or CD11b/CD18) is expressed on all macro- macrophages (SSMs) and conveyed directly to naïve B cells or M 2 γ phages and recognizes iC3b on complement-opsonized objects, en- through follicular dendritic cells (10) using CR1, CR2, and Fc abling their phagocytosis. We demonstrate that the C3d moiety of receptors for antigen capture (11, 12). Hence, antigen-presenting iC3b harbors the binding site for the CR3 αI domain, and our structure cells such as SSMs may act as antigen storage and provide B of the C3d:αI domain complex rationalizes the CR3 selectivity for iC3b.
    [Show full text]
  • CD11/CD18 (24) FITC FITC Labeled Mouse Monoclonal Antibody
    Product Data Sheet IMQ-84601_2015.09-v1 CD11/CD18 (24) FITC FITC Labeled Mouse Monoclonal Antibody Catalog Number: IMQ-84601 Size: 50 µl (1 mg/ml) Class: Monoclonal Type: Antibody Clone: 24 Host / Isotype: Mouse / IgG1 Immunogen: Fibronectin-purified human monocytes Myeloma / fusion Cells from immunized Balb/c mice were fused with the Sp2/0-Ag.14 myeloma partners: cell line Species Reactivity: Human Specificity: This antibody recognises integrin alpha L,M,X/Beta 2 (CD11/CD18). Integrins are heterodimeric cell surface receptors composed of alpha and beta subunits which mediate cell-cell and cell-extracellular matrix attachments. Integrin beta2 (CD18) associates with integrin alpha L (CD11a) to form the leukocyte function- associated antigen-1 (LFA-1) with integrin alpha M (CD11b) to form Complement Receptor 3 (CR3) and with integrin alpha X (CD11c) to form Complement Receptor 4 (CR4). Each integrin receptor can bind various Intercellular adhesion molecules (ICAMs). Aberrant integrin expression has been found in many epithelial tumours. Changes in integrin expression have been shown to be important for the growth and early metastatic capacity of melanoma cells. Purification: Purified on protein A from tissue culture supernatant. Format: Purified IgG conjugated to Fluoroscein using Innova Biosciences Lightning- Link®, supplied in Phosphate buffered saline (PBS) containing 0.09% Sodium azide Applications: Flow Cytometry, Immunocytochemistry, Immunofluorescence Dilutions: Optimal antibody dilution should be determined by titration Storage: Store stock solution of the antibody at 2-8 °C in the dark. Do not freeze. References: Hogg N, et al. An anti-human monocyte/macrophage monoclonal antibody, reacting most strongly with macrophages in lymphoid tissue.
    [Show full text]
  • PDF Download
    Integrin β2 Polyclonal Antibody Catalog No : YT2369 Reactivity : Human,Mouse,Rat Applications : IF/ICC,ELISA Gene Name : ITGB2 Protein Name : Integrin beta-2 Human Gene Id : 3689 Human Swiss Prot P05107 No : Mouse Gene Id : 16414 Mouse Swiss Prot P11835 No : Immunogen : The antiserum was produced against synthesized peptide derived from human CD18/ITGB2. AA range:720-769 Specificity : Integrin β2 Polyclonal Antibody detects endogenous levels of Integrin β2 protein. Formulation : Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. Source : Rabbit Dilution : Immunofluorescence: 1/200 - 1/1000. ELISA: 1/5000. Not yet tested in other applications. Purification : The antibody was affinity-purified from rabbit antiserum by affinity- chromatography using epitope-specific immunogen. Concentration : 1 mg/ml Storage Stability : -20°C/1 year Molecularweight : 84782 1 / 2 Cell Pathway : Cell adhesion molecules (CAMs),Natural killer cell mediated cytotoxicity,Leukocyte transendothelial migration,Regulates Actin and Cytoskeleton,Viral myocarditis, Background : integrin subunit beta 2(ITGB2) Homo sapiens This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014], Function : disease:Defects in ITGB2 are the cause of leukocyte adhesion deficiency type I (LAD1) [MIM:116920]. LAD1 patients have recurrent bacterial infections and their leukocytes are deficient in a wide range of adhesion-dependent functions.,function:Integrin alpha-L/beta-2 is a receptor for ICAM1, ICAM2, ICAM3 and ICAM4.
    [Show full text]