Ribozymes Targeted to the Mitochondria Using the 5S Ribosomal Rna

RIBOZYMES TARGETED TO THE MITOCHONDRIA USING THE 5S RIBOSOMAL RNA

JENNIFER ANN BONGORNO

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2005

Jennifer Bongorno

To my grandmother, Hazel Traster Miller, whose interest in genealogy sparked my interest in genetics, and without whose mitochondria I would not be here

ACKNOWLEDGMENTS

I would like to thank all the members of the Lewin lab; especially my mentor, Al

Lewin. Al was always there for me with suggestions and keeping me motivated. He and the other members of the lab were like my second family; I would not have had an enjoyable experience without them. Diana Levinson and Elizabeth Bongorno worked with me on the fourth and third mouse transfections respectively. Joe Hartwich and Al

Lewin tested some of the ribozymes in vitro and cloned some of the constructs I used.

James Thomas also helped with cloning and was an invaluable lab manager. Verline

Justilien worked on a related project and was a productive person with whom to bounce ideas back and forth. Lourdes Andino taught me how to use the new phosphorimager for my SYBR Green-stained gels. Alan White was there through it all, like the older brother

I never had. Mary Ann Checkley was with me even longer than Alan, since we both came to Florida from Ohio Wesleyan, although she did manage to graduate before me.

Jia Liu and Frederic Manfredsson were there when I needed a beer. Marina Gorbatyuk was there when I just had to learn some Russian.

From other labs, Dr. John Guy allowed me to use his equipment and taught me how to assay for ATP synthesis. Xioping Qi helped me section mouse eyes and, although technically part of the Guy lab, was part of the Lewin lab family in my eyes. Dr. Adrian

Timmers skillfully injected my mouse eyes. Ian Elder taught me how to use the ERG machine. Vince Chiodo packaged my ribozymes in AAV. Sue Moyer, Tom Rowe and

Nick Muzyczka gave continued support and valuble advice as my committee. The entire

iv Molecular Genetics and Microbiology department and the IDP program were a pleasure to be a part of. I am sure I will miss everyone.

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... iv

LIST OF TABLES...... viii

LIST OF FIGURES ...... ix

LIST OF ABREVIATIONS ...... xi

ABSTRACT...... xiv

CHAPTER

1 INTRODUCTION TO MITOCHONDRIA ...... 1

Mitochondrial Components ...... 1 Genome...... 1 Replication...... 5 Transcription and Translation...... 7 Protein Import...... 9 RNA Import...... 11 Mitochondrial Functions...... 19 Citric Acid Cycle...... 19 Respiratory Chain...... 20 ATP Synthesis ...... 22 Reactive Oxygen Species ...... 25 Mitochondrial Diseases ...... 25 Mitochondrial DNA Mutations ...... 26 NARP and Leigh Syndrome...... 27 Mitochondrial Manipulations ...... 31 Creating Heteroplasmy in Cells and Mice...... 31 Manipulating the Mitochondrial Genome ...... 33 RNA Import...... 35 Altering Proteins...... 35 Ribozymes ...... 38 Adeno-Associated Virus...... 39

2 RESULTS...... 41

vi Ribozyme Design and In Vitro Analysis ...... 41 Mouse Cell Culture Phenotypes ...... 47 Four Transfection Attempts...... 48 Analysis of Clonal Isolates...... 53 Localization of Ribozymes to the Mitochondria ...... 61 Human Cell Culture Phenotypes ...... 65 HeLa Cells and a Toxic 5S Transcript ...... 65 No Phenotype in 293 Cells...... 67 Injection of Mice...... 69

3 MATERIALS AND METHODS ...... 75

In Vitro Ribozyme Analysis ...... 75 Cloning ...... 76 Cell Culture...... 76 Transfections...... 77 RNA Isolation...... 78 RT-PCR ...... 78 Growth in Galactose ...... 80 Cyanide Resistance Assay ...... 81 ATP Synthesis Assay...... 82 Mitochondrial RNA Isolation...... 83 Mouse Subretinal Injections ...... 84 Electroretinograms...... 85 Sectioning of Mouse Eyes ...... 85

4 DISCUSSION...... 87

In Vitro Ribozyme Assays...... 87 Studies on Total Transfected Mouse Cells ...... 88 Cell Culture Studies on Mouse Clonal Isolates ...... 90 Measurements by RT-PCR...... 90 Mitochondrial RNA Levels and Growth in Galactose ...... 91 ATP Synthesis and Cyanide Resistance...... 92 Human Cell Transfection Studies...... 94 Transfection Toxicity ...... 94 5S-ATP8/6 Toxicity ...... 95 Localization of Ribozymes to the Mitochondria ...... 96 Injection of Mice...... 96 Other Means to an End ...... 97

LIST OF REFERENCES...... 98

BIOGRAPHICAL SKETCH ...... 129

vii

LIST OF TABLES

Table page

2-1. Kinetic parameters for mouse ATP6 ribozymes...... 45

2-2. Rates of succinate-dependent ATP synthesis in total selected cells...... 49

3-1. RNA oligonucleotides used for in vitro ribozyme assays ...... 75

3-2. DNA oligonucleotides used for cloning mouse and human ATP6 ribozymes...... 76

3-3. DNA oligonucleotides used for RT-PCR ...... 79

viii

LIST OF FIGURES

Figure page

1-1. Mitochondrial genome comparson of different species ...... 2

1-2. Genetic map of the human mitochondrial DNA ...... 3

1-3. ATP synthesis pathways...... 23

2-1. Annotated mouse ATP6 mRNA sequence ...... 42

2-2. Depiction of ribozymes annealed to their targets...... 43

2-3. In vitro time course of ribozyme cleavage ...... 44

2-4. Lineweaver-Burke plots of multiple turnover reactions for ribozymes ...... 45

2-5. In vitro ribozyme cleavage of total mitochondrial RNA...... 46

2-6. 5S and UF11 constructs...... 47

2-7. Total G418-selected cells grown in galactose with 0.4 ng/ml oligomycin ...... 50

2-8. Total selected cell growth in 1 mM cyanide ...... 52

2-9. Total selected cell growth in galactose ...... 53

2-10. Ribozyme and reverse transcript levels in clonal isolates by RT-PCR ...... 54

2-11. ATP6 levels from the first set of colonies as measured by RT-PCR ...... 56

2-12. Levels of four mitochondrial mRNAs as measured by RT-PCR ...... 56

2-13. Growth of colonies in glucose and galactose ...... 57

2-14. Growth in galactose of all fourth transfection colonies...... 58

2-15. Growth of colonies in cyanide...... 59

2-16. Relative rates of complex I- and complex II-dependent ATP synthesis ...... 61

2-17. Detection of ribozyme in the mitochondria of NIH3T3 cells...... 63

ix 2-18. Detection of ribozyme in the mitochondria of 293 cells ...... 64

2-19. Absence of the 5S-ATP8/6 transcript in HeLa cells...... 67

2-20. Growth of 293T cells for two days in 20 mM cyanide...... 68

2-21. Growth of HeLa and 293 cells in 20 mM cyanide ...... 69

2-22. Levels of ATP6 and COX2 in transiently transfected 293T cells ...... 70

2-23. Electroretinogram results from mice injected with AAV5-ATP6m252rz...... 71

2-24. Electroretinograms of mouse K at 4 months post injection...... 72

2-25. Sections of retinas from mice J and K...... 73

x LIST OF ABREVIATIONS

3’ is the three prime end of nucleic acid. 5’ is the five prime end of nucleic acid. 5S rRNA is the ribosomal RNA with a sedimentation constant of 5 svedberg units. AAV is Adeno-associated virus. AAV5 is Adeno-associated virus serotype 5. Ala is alanine, an amino acid. ADP is adenosine 5’-diphosphate ANT1 is the adenine nucleotide translocater. Arg is arginine, an amino acid. Asp is aspartic acid, an amino acid. ATP is adenosine 5’-triphosphate. ATP6 is the mitochondrial gene for subunit 6 of ATP synthase. ATP6h114rz is the ribozyme designed to cleave after nucleotide 114 of human ATP6. ATP6h206rz is the ribozyme designed to cleave after nucleotide 206 of human ATP6. ATP6m252rev is the reverse orientation of ATP6m252rz. ATP6m252rz is the ribozyme designed to cleave after nucleotide 252 of mouse ATP6. ATP6m69rev is the reverse orientation of ATP6m69rz. ATP6m69rz is the ribozyme designed to cleave after nucleotide 69 of mouse ATP6. ATP8/6 is the overlapping mouse ATP8 and ATP6 sequence attached to the 5S rRNA. bp is base pairs. BSA is bovine serum albumin. CBA is chicken β-actin enhancer plus the CMV promoter. COX2h24rz is the ribozyme designed to cleave after nucleotide 24 of human COX2. COX2 is the mitochondrial gene for subunit 2 of cytochrome c oxidase. COX3 is the mitochondrial gene for subunit 3 of cytochrome c oxidase. CMV is cytomegalovirus. D-loop is the displacement loop, the mitochondrial major non-coding region. DEPC is diethyl pyrocarbonate. DMEM is Dulbecco’s modified Eagle’s media. DNA is deoxyribonucleic acid. DTT is dithiothreitol. EDTA is ethylenediaminetetraacetic acid. EGTA is ethylene glycol-tetraacetic acid. ES cells are embryonic stem cells. EtBr is ethidium bromide. FAD is flavin-adenine dinucleotide. FBS is fetal bovine serum. F1 is the rotating portion of ATP synthase. FO is the membrane-anchored portion of ATP synthase. G418 is geneticin, a neomycin analog. GFP is green fluorescent protein. Gln is glutamine, an amino acid. GPx1 is glutathione peroxidase. H-strand is the mitochondrial heavy strand. Kb is kilobase pairs.

xi KCN is potassium cyanide. Kcat is the reaction rate with saturating substrate. HIV is the human immunodeficiency virus. Km is the Michaelis-Menten affinity constant . KRS is yeast cytoplasmic lysine amino-acyl tRNA synthetase. L-strand is the mitochondrial light strand. LHON is Leber’s Hereditary Optic Neuropathy. Lys is lysine, an amino acid. LysRS is the human lysine amino-acyl tRNA synthetase. m252rev is the reverse orientation of m252rz. m252rz is the ribozyme designed to cleave after nucleotide 252 of mouse ATP6. m252rz1 is colony number 1 from m252rz cells from the first transfection. m69rev is the reverse orientation of m69rz. m69rz is the ribozyme designed to cleave after nucleotide 69 of mouse ATP6. m69rzI is colony number I from m69rz cells from the fourth transfection. MERRF is myoclonic epilepsy and ragged-red fiber disease. Met is methionine, an amino acid. MgCl2 is magnesium chloride. mRNA is messenger RNA. MRP RNA is mitochondrial RNA processing RNA. MSK is yeast mitochondrial lysine amino-acyl tRNA synthetase. mtDNA is mitochondrial DNA. mtTFA is the same as Tfam, the mitochondrial transcription factor alpha. N-terminal is amino terminal. NADH is reduced nicotinamide adenine dinucleotide. NARP is Neuropathy, Ataxia and Retinitis Pigmentosa. NCS is newborn calf serum. ND4 is NADH dehydrogenase (complex I) subunit 4. PBS is phosphate buffered saline. PCR is polymerase chain reaction. PMSF is phenylmethylsulfonyl fluoride. PolgA is the mitochondrial DNA polymerase-γ. ρ0 cells are cells completely lacking mtDNA. Rb is the retinoblastoma gene. RG6 is the mutagen rhodamine-6-G. RNA is ribonucleic acid. RNase is a ribonuclease. RNase MRP is the ribonuclease for mitochondrial RNA processing. ROS are reactive oxygen species. rRNA is ribosomal RNA. RT is reverse transcription. rz is a ribozyme. SOD is superoxide dismutase. TCA cycle is the tricarboxylic acid cycle or citric acid cycle. Tfam is the same as mtTFA, the mitochondrial transcription factor alpha. TIM is the translocase of the mitochondrial inner membrane.

xii Lys tK1 is yeast tRNA CUU. Lys tK2 is yeast tRNA SUU. Lys tK3 is yeast tRNA UUU. TOM is the translocase of the mitochondrial outer membrane. TR is a terminal repeat, from AAV. tRNA is transfer RNA. UF11 is the plasmid with AAV-TRs, GFP and neomycin resistance. Ucp1 is an uncoupler protein. Vmax is maximum velocity.

xiii

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

RIBOZYMES TARGETED TO THE MITOCHONDRIA USING THE 5S RIBOSOMAL RNA

Jennifer Ann Bongorno

December 2005

Chair: Alfred S. Lewin Major Department: Molecular Genetics and Microbiology

The 5S ribosomal RNA has been shown to be naturally imported into mitochondria.

To reduce the expression of mitochondrial genes, ribozymes were targeted to the mitochondria by attaching them to the 5S ribosomal RNA. Ribozymes were designed to target mouse ATP6, human ATP6 and human COX2. Down regulation of ATP6 could provide a model for the degenerative disease Neuropathy, Ataxia and Retinitis

Pigmentosa.

Ribozymes were tested in vitro on short RNA targets. The active ribozyme sequences were cloned at the 3’ end of the 5S rRNA sequence, and these constructs were transfected into mouse NIH3T3 cells or human 293 cells. Clonal isolates of the NIH3T3 cells expressing high levels of ribozyme were used for most of the mouse experiments, whereas the human cells were analyzed during transient transfections. RT-PCR was used to detect the presence of the ribozyme in RNA isolated from RNase-treated mitochondria.

Target RNA levels were measured by semi-quantitative RT-PCR of total cell RNA.

xiv Phenotypic assays included growth in galactose, resistance to cyanide, and ATP synthesis

in permeabilized cells.

Two ribozymes against the mouse ATP6 sequence were shown to be active in vitro.

The 5S rRNA-ribozyme transcripts were detected in the mitochondria, but in very small amounts. No decrease in target RNA levels was detected, and no phenotype was seen that correlated with the presence of a ribozyme. A phenotype consistent with a mitochondrial defect was seen in some of the mouse clonal isolates, but this was seen in some of the control colonies as well as ribozyme colonies.

Since only about 1% of the 5S ribosomal RNA is normally imported, import of

ribozymes into the mitochondria by this method may not be sufficient to affect the

comparatively high mitochondrial RNA levels. Alternatively, these ribozymes may not

be active within mitochondria.

xv CHAPTER 1 INTRODUCTION TO MITOCHONDRIA

Mitochondria are energy-producing organelles found in most eukaryotic cells.

They are thought to be the result of an endosymbiotic relationship, in which a proteobacterium provided an energy benefit to a host cell (Margulis and Bermudes, 1985;

Gray et al., 1999). The mitochondria still retain a rudimentary genome with similarities to an α-proteobacterium (Yang et al., 1985).

Mitochondrial Components

Today’s mitochondrial DNA (mtDNA) contains the genes for some of the RNAs and less than 1% of the proteins used in the organelle. Therefore, not only is the mitochondrial DNA replicated and inherited in a different manner from nuclear chromosomes, but also over 1,000 proteins and some RNAs must be imported into the mitochondria.

Genome

The size of mitochondrial genomes ranges from less than six kilobase pairs (kb) in the human malaria parasite, Plasmodium falciparum (Gray et al., 1999); to 16 kb in humans (Anderson et al., 1981); to more than 490 kb in rice, Oryza sativa (Notsu et al.,

2002) (Fig. 1-1A). Mitochondrial genomes encode anywhere from three proteins in P. falciparum (Gray et al., 1999); to 13 in humans (Anderson et al., 1981) (Fig. 1-2); to 62 in the flagellated protozoon, Reclinomonas americana (Lang et al., 1997) (Fig. 1-1B).

With such a large number of genes, little non-coding sequence, and a standard genetic code, the mtDNA of R. americana is thought to be similar to the ancestral mitochondrial

1 2

genome (Gray et al., 1999). The bacteria whose genome is most like any mitochondrial

genome is Rickettsia prowazekii, with a genome of 1,112 kb encoding 834 proteins

(Andersson et al., 1998). R. prowazekii, an obligate intracellular parasite, already has a

reduced genome as compared with its free-living bacterial relatives (Andersson et al.,

1998).

Fig. 1-1. Mitochondrial genome comparson of different species. A) Genome size including the bacterial genome of Rickettsia. For the larger genomes, red represents known coding sequence; blue represents unidentified open reading frames, introns and intergenic sequences. B) Gene content of select mitochondrial genomes. Adapted (Gray et al., 1999).

Over 99% of the genes for mitochondrial proteins are found in the nucleus, and

sequences of the mitochondrial genes have also been found in nuclear chromosomes

either as pseudogenes or fragments (Jacobs et al., 1983; Farrelly and Butow, 1983;

Woischnik and Moraes, 2002). It appears that mitochondrial genes have moved to the

nucleus many times over the course of evolution and are still translocating. The size of

the metazoan mitochondrial genome (the common ancestor of all animals) seems to have

stabilized about 800 million years ago (Saccone et al., 2002), which may partly be due to

the acquisition of an altered genetic code. Sequences still seem to move to the nucleus,

but they do not become functional and are not lost from the mtDNA (Woischnik and

Moraes, 2002). Transfer of mitochondrial genes to the nucleus in flowering plants seems

to be an ongoing process (Palmer et al., 2000).

Fig. 1-2. Genetic map of the human mitochondrial DNA. Inner circles represent the DNA; outer lines represent the RNA transcripts. Adapted (Fernandez-Silva et al., 2003).

Mitochondria can exist as individual organelles or as a reticulum; they can fuse and divide and share mitochondrial genomes (Hayashi et al., 1994). When mitochondria are

4 distinct organelles, there are one to 20 mtDNA molecules per mitochondrion (King and

Attardi, 1989; Wiesner et al., 1992) and at least hundreds of mitochondria per animal cell

(Pica-Mattoccia and Attardi, 1971; Posakony et al., 1975; Posakony et al., 1977). In total, there are many thousands of copies of mtDNA per cell. Normally, all of the copies of mtDNA in one cell are identical, and such a cell is termed homoplasmic. If two different types of mtDNA exist in the same cell, it is termed heteroplasmic (Hauswirth and Laipis, 1982). In a situation with both mutant and wild type mtDNA, there is inter-mitochondrial complementation such that all mitochondria within the cell still function alike; either all are normal or all are have the mutant phenotype, because they can fuse and share mitochondrial components (Nakada et al., 2001). A threshold level of mutant genomes (usually greater than 60%) must be exceeded before the mutant phenotype is seen (Zeviani and Antozzi, 1997; Hayashi et al., 1991).

In animals, mitochondria are inherited maternally, so a homoplasmic state usually remains homoplasmic in later generations unless mutations occur. Occasionally, mitochondria can be inherited from both parents (Schwartz and Vissing, 2003).

Normally, any mitochondria from the sperm that enter the egg are eliminated by a ubiquitin-related method (Sutovsky et al., 1999; Sutovsky and Schatten, 2000). Sperm only have about 100 mtDNA molecules (Hecht et al., 1984) as compared to oocytes, which have up to 100,000 copies (Piko and Matsumoto, 1976; Michaels et al., 1982).

These abundant mitochondrial genomes are derived from a small subset of mtDNA during oogenesis, creating a bottleneck that can drastically skew any existing heteroplasmy from one generation to the next (Marchington et al., 1998).

Replication

There are two models of mtDNA replication (Clayton, 1982; Holt et al., 2000).

The original model is strand asymmetric with a different origin of replication for each strand, which can be distinguished as heavy (H) and light (L) strands based on buoyant density (Clayton, 1982). Replication starts at the L-strand transcriptional promoter and uses the L-strand transcripts to prime the synthesis of H-strand DNA (Gillum and

Clayton, 1979; Chang and Clayton, 1985; Fish et al., 2004). This creates the displacement or D-loop and includes the original single-stranded H-strand, the L-strand template and the new H-strand of about 500 to 700 nucleotides. The whole D-loop regulatory region is about 1 kb long (Attardi and Schatz, 1988). When RNase MRP cleaves the L-strand transcript at specific locations between 75 and 165 nucleotides downstream from the transcriptional initiation site, replication continues extending the

D-loop (Chang and Clayton, 1987b; Lee and Clayton, 1997). Replication proceeds using the L-strand as a template. When the replication fork reaches the origin on the H-strand, replication of the L-strand can begin (Hixson et al., 1986; Wong and Clayton, 1985).

Thus the new H-strand is complete well before the new L-strand is (Chang and Clayton,

1987a; Chang and Clayton, 1987b; Clayton, 1982). Finally, the two strands must be decatenated, RNA primer gaps must be filled in and the DNA-binding proteins must be added to create the proper tertiary structure (Lecrenier and Foury, 2000).

Recently, a second mechanism of mtDNA replication was described in mammals and is thought to be the primary mechanism (Holt et al., 2000; Kajander et al., 2001;

Yang et al., 2002). Synthesis of the mtDNA can start anywhere in the genome, although there seem to be preferences for a 4 to 6 kb region 3’ of the D-loop (Bowmaker et al.,

2003). In birds, there is also a preference for initiation 3’ of the D-loop region, but

sometimes synthesis also starts 5’of the D-loop region (Reyes et al., 2005). Replication

is bi-directional and strand-coupled with a leading and lagging strand in each direction,

until it reaches the D-loop region (Bowmaker et al., 2003). At this point, one replication

fork continues away from the D-loop, such that the H-strand is the leading strand, and the

L-strand is the lagging strand (Holt et al., 2000; Yang et al., 2002; Bowmaker et al.,

2003). During synthesis, the L-strand includes large stretches of RNA; some regions

contain more RNA than other regions (Yang et al., 2002). Once replication is complete,

most of the RNA is replaced by DNA, but ribonucleotides still exist randomly throughout

both strands: usually about every 500 nucleotides (Yang et al., 2002; Grossman et al.,

1973). Most of the partially single-stranded replication intermediates described as

evidence for strand asymmetric replication may actually have been artifacts caused by the

degradation of the RNA regions during preparations (Yang et al., 2002).

Replication of mtDNA is stochastic. Some genomes are replicated multiple times

and others may not be replicated at all (Clayton, 1982). Replication generally stops when

the number of genomes has doubled. In the case of cells with a depleted number of

mitochondrial genomes, replication more than doubles the number of genomes per cell

division until the normal number of genomes exists (King and Attardi, 1989). In HeLa

cells, an increase in mtDNA replication has been seen in late S and G2 phases of the cell cycle (Pica-Mattoccia and Attardi, 1972). Segregation into daughter cells is also arbitrary, such that daughters of heteroplasmic cells can be homoplasmic or heteroplasmic; and because of random drift, future daughter cells will eventually reach homoplasmy (Birky, Jr., 2001). Replication is not always random, however. Genomes with a more efficient origin of replication or a large deletion may have a replicative

advantage. Intercellular selection is also possible, but due to inter-mitochondrial complementation; only cells with high percentages of mutant genomes are likely to be phenotypically different.

Transcription and Translation

The mammalian mitochondrial genome is transcribed as two genome-length transcripts originating from the 5’ end of the D-loop (Fernandez-Silva et al., 2003).

Additionally, a second H-strand transcript containing only the two ribosomal RNAs is about 20 times more abundant than the genome-length transcript (Montoya et al., 1983;

Montoya et al., 1982). There are no introns and almost no non-coding sequences among the 13 protein coding and 24 RNA genes in mammalian mtDNA (Montoya et al., 1981;

Ojala et al., 1981; Anderson et al., 1981; Ojala et al., 1980). This is not true of all species; for example, the 366 kb mitochondrial genome of Arabidopsis thaliana contains more than 80% non-coding sequence and still encodes only 32 proteins (Unseld et al.,

1997).

In mammals, excision of the tRNAs (fairly evenly interspersed among the protein-coding genes) separates most of the mRNAs (Ojala et al., 1981; Montoya et al.,

1981; Ojala et al., 1980). A few processing events not mediated by tRNA processing, include the separation of ATP6 from COX3 (Nardelli et al., 1994). The H-strand, containing most of the mRNAs and 14 of the tRNAs, seems to be processed quickly, since full-length transcripts cannot be detected (Attardi et al., 1990). In contrast, full-length L-strand transcripts can be detected, suggesting processing after completion of transcription. The L-strand contains one mRNA (ND6) and eight tRNAs (Attardi and

Schatz, 1988). It is known to be synthesized at a much higher rate (Attardi et al., 1990) and has a much shorter half-life than the H-strand transcripts (Aloni and Attardi, 1971;

Cantatore and Attardi, 1980). Once the tRNAs are processed, the mRNAs are polyadenylated with tails of only about 55 nucleotides: much shorter than nuclear mRNA tails (Ojala and Attardi, 1974; Ojala et al., 1981; Montoya et al., 1981; Hirsch and

Penman, 1974). Ribosomal RNA transcripts have poly-A tails of only one to 10 residues

(Dubin et al., 1982).

Most mitochondria use an imported bacteriophage T7/T3-like RNA polymerase for transcription (Tiranti et al., 1997). The primary transcription factor is Tfam (aka mtTFA), which is able to wrap, bend and unwind DNA in vitro (Fisher et al., 1992; Fisher and

Clayton, 1988; Parisi and Clayton, 1991). Tfam binds both H- and L-strand promoters with a low degree of sequence specificity (Parisi and Clayton, 1991). Tfam (along with

TFB1M or TFB2M) are used for initiation (Falkenberg et al., 2002; McCulloch et al.,

2002). Termination of transcription is mediated by mTERF (Daga et al., 1993;

Fernandez-Silva et al., 1997).

The mammalian mitochondrial genome contains only 22 tRNA genes that are sufficient to recognize all codons because of the slightly altered genetic code used in the mitochondria and the simplified codon-anticodon pairing system (Attardi and Schatz,

1988). The standard stop codon, UGA, codes for tryptophan in the mitochondria, and there are two additional stop codons, AGA and AGG, that normally code for arginine.

There is also one additional methionine codon, AUA, which is an isoleucine codon in the cytoplasm. For half of the codon families, the amino acid is specified by the first two bases alone. The mammalian tRNAs that recognize these codons all contain an unmodified uracil in the wobble position (Fox, 1987). In the cytosol, two tRNAs are necessary for each of these codon families, and often inosine is used to recognize

adenine, cytosine and uracil (Topal and Fresco, 1976). There are two methionine codons,

which can both be used for translation initiation; and in certain species, isoleucine also initiates translation (Fox, 1987). For termination, some human mitochondrial genes do not contain stop codons at the DNA level, but they end in U or UA; such that when poly-adenylated, the RNA has the UAA stop codon (Anderson et al., 1981). The mitochondria of many other species also use non-standard genetic codes, some with different sets of deviations from the standard.

Protein Import

With only 13 proteins expressed in the mitochondria, over 1,000 other proteins must be imported. Proteins synthesized in the cytoplasm and destined for the mitochondria contain import signals of two major varieties that have been reviewed

(Pfanner and Wiedemann, 2002). Proteins targeted to the matrix typically have an amino-terminal (N-terminal) presequence of 25 to 50 amino acids that is then removed once the protein has reached its destination. Some inner membrane proteins (mostly with a single membrane-spanning domain) and intermembrane-space proteins also contain presequences (Schnell and Hebert 2003). These presequences are not identical, but are all positively charged and can form amphiphilic alpha helices (Roise et al., 1986; Roise,

1988; von Heijne, 1986). Not all proteins targeted to the mitochondria have N-terminal

targeting sequences. Many hydrophobic proteins headed for the mitochondrial inner

membrane have multiple internal import signals that are never removed. There are also

other types of proteins with special signals for the intermembrane space and outer

membrane.

Protein import begins with passage through the translocase of the outer membrane

(TOM) and then proceeds through one of two inner membrane complexes (TIM23 or

TIM22)(Wiedemann et al., 2004). The TOM complex consists of at least seven proteins.

Tom20 recognizes cleavable presequences (Abe et al., 2000; Brix et al., 1997; Schleiff et al., 1997), whereas Tom70 recognizes proteins with internal targeting signals

(Wiedemann et al., 2001; Brix et al., 1997; Sollner et al., 1990; Steger et al., 1990). Both interact with Tom22, which is considered the gate; because without it the channel is constitutively open (van Wilpe et al., 1999). Both types of proteins are then passed through channels formed by Tom40, the core of the general insertion pore (Vestweber et al., 1989; Hill et al., 1998). Precursor proteins are threaded through as linear chains, but inner-membrane-destined proteins are folded; such that some internal region of the protein goes in first (Wiedemann et al., 2001). No energy is required for transport through the TOM complex (Pfanner and Wiedemann, 2002). Tom5 is one of three smaller Toms, which is involved in passing precursor proteins from Tom22 to Tom40

(Dietmeier et al., 1997). Tom6 and Tom7 are involved in assembly of the TOM itself

(Dekker et al., 1998; Honlinger et al., 1996; Model et al., 2001).

ATP and an electrochemical gradient are required for import of proteins into the mitochondrial matrix through the Tim23 complex (Schleyer et al., 1982; Martin et al.,

1991; Neupert et al., 1990). Although the majority of Tim23 is in the inner membrane, its N-terminus is anchored in the outer membrane, which could keep it in close proximity to the TOM complex (Donzeau et al., 2000). Tim23 and Tim17 form the core of the

Tim23 complex; both are essential for cell viability (Dekker et al., 1997; Ryan et al.,

1998). Once a protein has entered the matrix, its N-terminal pre-sequence is cleaved off by the heterodimeric mitochondrial processing peptidase (Gavel and von Heijne, 1990).

Transport into the inner mitochondrial membrane via Tim22 still requires the membrane

potential, but does not need ATP (Wachter et al., 1992; Kovermann et al., 2002). Tim22 is also necessary for cell viability (Kovermann et al., 2002).

Most of the proteins imported into the mitochondria from nuclear-encoded genes are not also used in the nucleus or the cytoplasm, although in many cases proteins with the same function are needed in both compartments. Since the proteins targeted to the mitochondria must contain a targeting signal sequence, they must be either encoded on a separate gene or be transcribed or translated from alternative start sites from their nuclear or cytoplasmic counterparts. For example, mitochondrial and nuclear versions of alanyl-tRNA synthetase in Arabidopsis thaliana are transcribed and translated from alternative initiation sites in the same gene (Mireau et al., 1996). Another example is the tRNA-Lys amino-acyl tRNA synthetase gene in humans that codes for the cytoplasmic as well as the mitochondrial protein (Tolkunova et al., 2000).

RNA Import

There are four types of nuclear encoded RNA that are imported into mitochondria: tRNAs, the 5S ribosomal RNA, and the RNA components of RNase P and RNase MRP.

These are not all imported in all species, but in most cases they are either encoded in the mitochondrial DNA or they are imported. The only RNAs that are always found in the mitochondrial genome are the 12S and 16S ribosomal RNAs.

RNase P

RNase P is a site-specific endoribonuclease involved in nuclear and mitochondrial tRNA processing. The 340-nucleotide RNA component of RNase P confers the catalytic activity required to process 5’ tRNA ends, while the protein component plays a structural role (Bartkiewicz et al., 1989; Guerrier-Takada et al., 1986). The RNase P RNA is encoded in the mtDNA of some non-mammalian species (Entelis et al., 2001b) including

yeast (Hollingsworth and Martin, 1986). In mammals this RNA must be imported into

the mitochondria.

The import of RNase P into mitochondria in mammals was first proposed by

Doersen et al., when its activity was detected in HeLa cell mitochondria (Doersen et al.,

1985). The mitochondrial RNase P activity was found to be nuclease sensitive, suggesting that an RNA component is imported (Doersen et al., 1985; Puranam and

Attardi, 2001). Looking directly at the presence of the RNase P RNA in the mitochondrial fraction, about 33 to 175 molecules were found per HeLa cell, which corresponds to 0.1 to 0.5% of the nuclear pool (Puranam and Attardi, 2001). This should

be enough RNase P for two or three molecules per transcriptionally active

mitochondrion, sufficient for all the tRNA processing required (Puranam and Attardi,

2001).

RNase MRP

RNase MRP (mitochondrial RNA processing) was first isolated from the

mitochondrial fraction of mouse cells and shown to be a site-specific endoribonuclease

that can cleave the RNA primer involved in mammalian mitochondrial DNA heavy

strand replication (Chang and Clayton, 1987a). This activity is dependent on a region of

complementarity between the MRP and primer RNAs (Bennett and Clayton, 1990). The

MRP RNA is encoded in the nucleus by a single copy gene (Chang and Clayton, 1987a;

Chang and Clayton, 1989; Yuan et al., 1989; Gold et al., 1989). The protein components

of this enzyme are also encoded in the nucleus (Chang and Clayton, 1987b; Clayton,

1994; Kiss et al., 1992). Most of the MRP RNA is actually located in the nucleolus in

ribonucleoprotein particles distinct from RNase MRP and is involved in ribosomal RNA

processing (Chang and Clayton, 1987b; Gold et al., 1989; Kiss et al., 1992; Li et al.,

1994; Lygerou et al., 1996; Topper et al., 1992; Hashimoto and Steitz, 1983; Reddy et al.,

1983; Reimer et al., 1988). The amount of MRP RNA in the mitochondria is close to the limits of detection. Puranam and Attardi (Puranam and Attardi, 2001) detected 6 to 15 molecules per HeLa cell, (which is equivalent to 0.02 to 0.05% of the total cell RNA).

Little is known about how much enzyme is actually needed, but only about 8 primer cleavage events are required per minute in HeLa cells (Puranam and Attardi, 2001).

The mouse, human and yeast RNase MRPs are capable of cleaving an RNA primer with either mouse or human sequences (Bennett and Clayton, 1990; Chang and Clayton,

1987b; Stohl and Clayton, 1992). RNase MRP contains many of the same protein subunits as RNase P (Gold et al., 1989; Chamberlain et al., 1998) and their RNA components also share sequence and structural similarities (Lindahl et al., 2000; Forster and Altman, 1990). By transfecting mutant MRP RNA genes into mouse C2Cl2 myogenic cells it was shown that when nucleotides 118 through 175 were deleted, the

RNA was not imported, whereas the 5’ and 3’ regions were dispensable (Li et al., 1994).

5S rRNA

The majority of the 5S rRNA is incorporated into cytoplasmic ribosomes, but in humans about 1% is imported into the mitochondria (Entelis et al., 2001a). The 5S rRNA is also known to be imported in other mammals. Its presence in the mitochondria was first discovered in cows, rabbits and chickens (Yoshionari et al., 1994). Three small ribosomal RNAs (5S, 9S and 12S) are imported in trypanosomatids (Mahapatra et al.,

1994). The 5S rRNA is not imported in yeast (Entelis et al., 2001a). In other species such as land plants, some types of algae and the flagellate protist Reclinomonas

Americana, the 5S rRNA is transcribed from the mitochondrial genome and its sequence differs from that of the nuclear and chloroplast 5S rRNA (Lang et al., 1996).

In plants the mitochondrial 5S rRNA has been shown to be incorporated into

mitochondrial ribosomes (Lang et al., 1996), whereas it is not thought to be part of

mitochondrial ribosomes in fungi or mammals (Curgy, 1985). Mammalian mitochondrial

ribosomes, while being more similar to bacterial ribosomes than cytoplasmic ribosomes,

differ from both other ribosome types in the number of subunits. The mitochondrial

ribosomes are missing the subunit (O'Brien, 2002) that has been shown to interact with

the 5S rRNA in cytoplasmic ribosomes (Horne and Erdmann, 1972). Interestingly,

Entelis et al. quantitated the number of 5S rRNA molecules in the mitochondrial fraction to be about 3.2 x 104 per cell (Entelis et al., 2001a), which is similar to the number of mitochondrial ribosomes per cell (Ojala and Attardi, 1972; Posakony et al., 1977). Since no function has been shown for the 5S rRNA in mammalian mitochondria, it is likely to be an evolutionary remnant from a time when it was actually imported and incorporated into mitochondrial ribosomes. This would predict the presence of an evolutionary intermediate where the mitochondrial ribosomes still possessed the L5 subunit allowing the incorporation of the 5S rRNA.

Import of the 5S rRNA requires ATP, the mitochondrial membrane potential, and the protein import machinery in isolated human mitochondria (Entelis et al., 2001a). This import is dependent on soluble factors similar to but distinct from those required for tRNA import (Entelis et al., 2001a). The yeast 5S rRNA, which is not thought to be imported naturally in yeast, was imported into human mitochondria when human extracts

were used, but not with yeast extracts (Entelis et al., 2001a). A 5S rRNA transgene

tagged with a point mutation was capable of producing an importable 5S rRNA transcript

(Magalhaes et al., 1998).

Transfer RNA

The import of tRNA into the mitochondria is highly variable between species. In

mammals, a sufficient set of tRNAs is contained in the mtDNA and no import is

necessary (Anderson et al., 1981). In trypanosomatids no tRNAs are present in the

mitochondrial (kinetoplast) genome, and some of the nuclear encoded tRNAs function in

both the cytosol and mitochondria (Hancock and Hajduk, 1990; Lye et al., 1993; Simpson

et al., 1989; Mottram et al., 1991). Another protist, Tetrahymena pyriformis imports 26

of its 36 mitochondrial tRNAs (Chiu et al., 1975; Chiu et al., 1974; Suyama, 1967).

Yeast import only one tRNA (Martin et al., 1979; Martin et al., 1977) in spite of the fact

that they already contain a sufficient number of tRNAs in the mtDNA (Entelis et al.,

2001b). Plant mitochondria have between 14 and 27 tRNAs in their mtDNA and

anywhere between two and 11 are imported (Chiu et al., 1975; Entelis et al., 2001b;

Kumar et al., 1996; Marechal-Drouard et al., 1988; Oda et al., 1992; Suyama, 1986;

Sugiyama et al., 2005). Various plants, fungi and protists known to import some or all of

their tRNAs are listed in Entelis et al. (Entelis et al., 2001b).

RNAs are imported by different mechanisms in different species. Yeast use the

protein import channels (Tarassov et al., 1995a) plus soluble factors to import their

Lys tRNA CUU. Specifically, two amino-acyl tRNA synthetases are required (Tarassov et

al., 1995b) and at least one other factor (Entelis et al., 2001a). Trypanosomatids have

receptors that are used for tRNA and rRNA import that are distinct from those for protein

import (Mahapatra et al., 1994; Nabholz et al., 1999; Bhattacharyya et al., 2000;

Bhattacharyya et al., 2003), and no additional soluble factors are required (Mahapatra et al., 1994). Similarities between yeast and trypanosomatids include the requirement for

ATP (Mahapatra et al., 1994; Tarasov et al., 1993; Tarassov and Entelis, 1992), some sort

of protein receptor (Mahapatra et al., 1994; Tarassov et al., 1995a) and the mitochondrial

membrane potential (Yermovsky-Kammerer and Hajduk, 1999; Adhya et al., 1997;

Tarassov et al., 1995a).

The basic tRNA structure (Hauser and Schneider, 1995; Entelis et al., 1998) and

certain sequences seem to be required for import in both trypanosomatids and yeast. In

trypanosomatids the D-loop and 5’ precursor sequences seem to be most important

(Adhya et al., 1997; Mahapatra et al., 1998; Hancock et al., 1992; Rubio et al., 2000;

Lima and Simpson, 1996), whereas in yeast the anticodon loop and the aminoacceptor

stem determine the selectivity of import, probably because the tRNA must be

aminoacylated before it is imported (Entelis et al., 1998; Kazakova et al., 1999).

Lys In yeast between 2 and 5% of tRNA CUU is imported into the mitochondria

(Entelis et al., 1996; Entelis et al., 1998), and it has been shown to be funtional

Gln (Kolesnikova et al., 2000). In Tetrahymena thermophila 10 to 20% of tRNA UUG is

localized to the mitochondria (Rusconi and Cech, 1996). In trypanosomatids different

tRNAs are imported at different levels (Adhya et al., 1997). In most cases imported

tRNAs have also been shown to function in the cytoplasm (Rusconi and Cech, 1996;

Simpson et al., 1989; Martin et al., 1979).

Import of artificial tRNA has been shown in plants, protists, yeast and humans.

Small et al (Small et al., 1992) have shown the importability of a mutant tRNA carrying extra nucleotides in the anticodon loop as an approach for altering mitochondrial gene expression in potatoes. Plant tRNAs have also been imported into other plant mitochondrion that do not normally import them (Schneider and Marechal-Drouard,

2000). Yeast, tRNAs have been imported into trypanosome mitochondria (Schneider and

Marechal-Drouard, 2000). The addition of extra nucleotides into the D-loop did not

prevent import in Tetrahymena thermophila (Rusconi and Cech, 1996). In Leishmania tRNAs with various unspliced introns can be imported (Sbicego et al., 1998). Also, small

RNAs (17 bases or less) were non-specifically imported in Leishmania tarentolae (Rubio et al., 2000).

In yeast imported exogenous tRNAs were shown to be functional (Kolesnikova et

Lys al., 2000). Yeast have three lysine tRNAs: tK1 (tRNA CUU), which functions in the

Lys cytoplasm and the mitochondria; tK2 (tRNA SUU), which is only cytoplasmic in yeast;

Lys and tK3 (tRNA UUU), which is present in the mitochondrial DNA (Martin et al., 1979).

Changing the anticodon of tK1 from CUU to CAU resulted in the aminoacylation of the

tRNA with methionine instead of lysine. This modified tRNA was imported into isolated

mitochondria and was capable of participating in mitochondrial translation (Kolesnikova

Ala et al., 2000). In whole cells, another mutant tRNA, tK2 CUA was shown to be functional by its ability to suppress a cox2 nonsense mutation (Kolesnikova et al., 2000). This mutant tRNA contains the anticodon base C34 that has been shown to allow tK2 to be imported (Entelis et al., 1998). It also has a mutation in an acceptor stem base pair

(G3:U70) that causes it to be aminoacylated by alanyl-tRNA synthetase (AlaRS) (Hou and Schimmel, 1988). Some artificial tRNAs require aminoacylation for import while others do not (Entelis et al., 1998). In both cases the importable tRNAs retained the ability to bind the mitochondrial lysine amino-acyl tRNA synthetase (pre-MSK) (Entelis et al., 1998). For those that required aminoacylation, the identity of the amino acid did not seem to matter (Kolesnikova et al., 2000).

Although no tRNAs are imported naturally in mammalian cells (Lynch and Attardi,

1976; Amalric et al., 1978), certain exogenous tRNAs are capable of being imported in

Lys Lys Lys cells. Yeast tK1 (tRNA CUU), mutant tK2 (tRNA UUU), tK3 (tRNA UUU), and human

Lys mitochondrially encoded tRNA UUU can all be imported in isolated human mitochondria

Met (Entelis et al., 2001a). The mutant yeast tK1 CAU was also imported into human

mitochondria and was able to participate in mitochondrial translation (Kolesnikova et al.,

2000). Importable versions of yeast tK2 and tK3 were able to partially rescue the human

A8344G MERRF mutation that affects tRNALys (Kolesnikova et al., 2004). This was

shown in two different cybrid cell lines homoplasmic for the MERRF mutation. The

yeast MSK1 gene was transfected along with tK2 or tK3, and a correlation was found

between the amount of tRNA imported and the increased respiration rate (Kolesnikova et

al., 2004).

The import conditions and sequence requirements were shown to be the same for human as for yeast including the human or yeast mitochondrially targeted amino-acyl tRNA synthetases (pre-LysRSmt and pre-MSK1p) (Kolesnikova et al., 2000; Entelis et al., 2001a). The tRNA was imported more efficiently if it was already aminoacylated or if additional yeast or human aminoacyl tRNA synthetases were added (yeast cytoplasmic

= KRS; human cytoplasmic = aaRS), suggesting again that aminoacylation is important for import (Entelis et al., 2001a). Yeast have distinct amino-acyl tRNA synthetase genes for cytoplasmic and mitochondrial tRNA-Lys. Humans have only one, which codes for the cytoplasmic as well as the mitochondrial protein (Tolkunova et al., 2000). Sequence

alignments show that the N-terminal region of LysRS (human) is more similar to

pre-MSK (yeast mitochondrial), and the C-terminal domain is more similar to KRS (yeast

cytoplasmic), which would indicate that the N-terminal region is involved in import

(Entelis et al., 2001a). Interestingly, the N-terminal domain is not required for

aminoacylation (Shiba et al., 1997).

Mitochondrial Functions

All of the proteins synthesized in the mitochondria are involved in the generation of

ATP. The mitochondria can generate up to 95% of the energy in a cell, and they do so mainly by oxidative phosphorylation. Glycolysis takes place in the cytoplasm, but its final product, pyruvate used in the mitochondria for the citric acid cycle. Electrons from citric acid cycle are transported down the respiratory chain to pump protons into the intermembrane space. This electrochemical gradient is used to drive the production of

ATP through ATP synthase. Other functions of the mitochondria include apoptosis, calcium regulation, heat generation, fatty acid oxidation, waste elimination, and amino acid and heme biosynthesis. Mitochondria are also involved in scavenging the free radicals often generated by the respiratory chain and are influential in the aging process.

Citric Acid Cycle

Pyruvate dehydrogenase converts pyruvate from the cytoplasm to acetyl-coenzyme

A and the reduced form of nicotinamide adenine dinucleotide (NADH). This is the first of four reactions that take place in the mitochondria to generate NADH.

Acetyl-coenzyme A enters the citric acid cycle, also know as the Krebs cycle or tricarboxylic acid cycle, where the other three reactions occur. Isocitrate, α-ketoglutarate and malate are the other substrates directly involved in the generation of NADH. NADH is used to carry electrons to the respiratory chain. Additionally, succinate in the citric acid cycle is also a substrate for the reduction of flavin-adenine dinucleotide (FAD) to

FADH2 by succinate dehydrogenase. This enzyme, also known as complex II of the

respiratory chain, passes the electrons from FADH2 to ubiquinone in the electron transport chain.

Respiratory Chain

The electron transport chain consists of three protein complexes that pass electrons from NADH to more than 15 different electron carriers each with an increased affinity for electrons (Fig. 1-3A). The energy generated from passing electrons to carriers with a higher affinity for electrons is used to pump protons from the mitochondrial matrix to the intermembrane space generating an electrochemical gradient (∆Ψ). The final electron acceptor is oxygen, so NADH is oxidized to generate, NAD+, water and ATP. The

complexes involved in this process are NADH dehydrogenase, cytochrome b-c1 complex and cytochrome oxidase. Through an alternative pathway an additional complex, succinate dehydrogenase accepts electrons from FADH2 and bypasses NADH

dehydrogenase in the transport of electrons. Finally, the energy from the proton gradient

is used by ATP synthase to drive the formation of ATP from ADP and inorganic

phosphate (Pi).

Nicotinamide adenine dinucleotide:ubiquinone oxidoreductase or NADH dehydrogenase, also known as complex I, is the first and largest of the complexes in the respiratory chain. This complex of at least 46 subunits contains seven or eight iron-sulfur centers and a flavin that accept and pass electrons releasing the energy to pump protons into the intermembrane space (Hirst et al., 2003; Skehel et al., 1991; Walker, 1992;

Skehel et al., 1998; Brandt, 1997). The complex is L-shaped, composed of a matrix arm and a membrane arm separated by a thin collar (Grigorieff, 1998; Guenebaut et al., 1998).

The matrix domain contains all but one of the electron acceptors as well as the binding

site for NADH (Finel et al., 1992). Seven of its 14 core subunits are encoded in the

metazoan mitochondrial genome (Hirst et al., 2003; Anderson et al., 1981). NADH

dehydrogenase can be inhibited with rotenone (Davey and Clark, 1996).

Succinate dehydrogenase, also known as complex II of the respiratory chain, is also one of the enzymes involved in the citric acid cycle. It converts FAD to FADH2 and passes two electrons to the electron transport chain. This complex contains 3 iron-sulfur centers and one flavoprotein covalently bound to FAD (Robinson et al., 1994), but here the transfer of electrons is not coupled to the pumping of protons (Hagerhall, 1997). All four the subunits of succinate dehydrogenase are encoded in the nucleus in metazoans

(Anderson et al., 1981).

Both NADH dehydrogenase and succinate dehydrogenase pass their electrons to ubiquinone, also called coenzyme Q (CoQ). Ubiquinone is a small hydrophobic molecule that can reside in the lipid bilayer, and pass electrons to complex III. It consists of a benzoquinone headgroup and a polyisoprenyl tail (Nohl et al., 2003; von Jagow et al., 1986). It can carry up to two electrons at the same time, now called ubisemiquinone

(CoQH) or ubiquinol (CoQH2), and pass them to complex III.

Cytochrome b-c1 complex, ubiquinol:cytochrome c oxidoreductase, or complex III contains eleven (Wallace, 2001) different proteins and acts as a dimer. It contains one iron-sulfur center and three hemes with iron atoms that carry electrons (van Loon et al.,

1983). Cytochrome b contains two of the hemes, and cytochrome c1 contains the third.

Two protons are pumped for each electron that passes through this complex (Saraste,

1999). Cytochrome b-c1 complex passes its electrons to cytochrome c, a water-soluble

hemoprotein in the intermembrane space. Cytochrome c transports the electrons to

cytochrome oxidase. Its crystal structure helped determine its proton pumping activity

(Iwata, 1998; Xia et al., 1997; Zhang et al., 1998). Only one of its subunits is encoded in

mammalian mitochondria DNA (Anderson et al., 1981). Complex III can be inhibited by

myxothiazol or antimycin A (Villani and Attardi, 1997; Taylor et al., 1994).

Cytochrome oxidase or complex IV is composed of 13 different proteins

(Yoshikawa et al., 1998; Tsukihara et al., 1996) and also functions as a dimer. The three

major subunits are encoded in the mitochondrial DNA (Anderson et al., 1981). Subunit I

contains one copper atom and two cytochromes each with one heme. Subunit II contains

a copper center, which acts as the first electron acceptor (Malmstrom and Aasa, 1993;

Lappalainen et al., 1993). The copper atom in subunit I works together with the iron

atom from one of the hemes to pass electrons to the final acceptor, oxygen. Oxygen

needs a total of four electrons to produce two water molecules. Since copper and iron

can only carry one electron each, oxygen stays bound to the bimetallic center after

receiving the first two electrons. Once a third electron is passed, one water molecule can

be released. The fourth electron completes the cycle (Babcock and Wikstrom, 1992). Its

mechanisms of proton pumping have been partially described through crystallographic

studies (Yoshikawa et al., 1998; Ostermeier et al., 1997; Tsukihara et al., 1996; Tsukihara

et al., 1995; Iwata et al., 1995). The activity of cytochrome oxidase can be inhibited with

cyanide (Letellier et al., 1994).

ATP Synthesis

ATP synthase, F1FO ATPase or complex V contains 15 subunits in mammals

(Devenish et al., 2000; Lutter et al., 1993), some of which are present in more than one copy per complex. It is composed of an anchored membrane portion, FO of up to twelve subunits depending on the species (Boyer, 1997; Devenish et al., 2000), and a rotating

portion, F1 of five different subunits (Karrasch and Walker, 1999; Wilkens and Capaldi,

1998; von Meyenburg et al., 1982) (Fig. 1-3B). The two mitochondrially encoded

subunits, ATP6 and ATP8, are part of the FO portion.

Fig. 1-3. ATP synthesis pathways. A) Tricarboxylic acid (TCA) cycle and oxidative phosphorylation; adapted (Maechler and Wollheim, 2001). B) Bacterial ATP synthase; adapted (Schon et al., 2001).

F1FO-ATPase couples the flow of protons down the electrochemical gradient to the

production of ATP from ADP and inorganic phosphate (Pi) (Elston et al., 1998; Noji and

Yoshida, 2001). Protons flow through a channel in the ATP6 subunit of FO and cause the

neighboring ring of ATP9 subunits to rotate (Rastogi and Girvin, 1999; Hutcheon et al.,

2001). This rotates the F1 portion, which catalyzes the phosphorylation of ADP (Duncan

et al., 1995; Fillingame, 1997; Duncan et al., 1995; Noji et al., 1997). The “stator”

portion of the structure consists primarily of subunit 6, two copies of subunit b that create

a stalk and δ of F1; the “rotator” consists of the 12 copies of subunit 9 and the rest of the

F1 portion, α3β3γε (Elston et al., 1998).

The FO portion in Escherichia coli is composed of subunits a (analogous to the mitochondrial subunit 6), b (two copies per complex), and c (12 copies per complex, analogous to mitochondrial subunit 9) (Jones and Fillingame, 1998). All are required for proton translocation (Schneider and Altendorf, 1985). Subunit a, a very hydrophobic

(probably five-transmembrane helix) protein, has been shown to interact closely with subunit c suggesting a joint catalytic role in proton translocation (Jiang and Fillingame,

1998). Specifically, Arg210 (mitochondrial Arg159) in helix-4 of subunit a interacts with Asp61 (mitochondrial Glu58) in subunit c (Jiang and Fillingame, 1998; Cox et al.,

1986; Cain and Simoni, 1989; Cain and Simoni, 1988). The antibiotic oligomycin inhibits ATP synthase through interaction with the FO portion (Breen et al., 1986; John

and Nagley, 1986).

The F1 sector is the catalytic component (Boyer et al., 1975). It is composed of five subunits (α3β3γδε). Although the α and β subunits are similar, only β has catalytic

activity. Energy is required for binding of ADP and release of ATP, but not for the

synthesis of ATP (Boyer, 1993; Boyer, 1997). The F1 portion not only has ATP synthesis activity when coupled with the FO sector, but it has ATP hydrolysis activity on its own

whether tethered to a membrane or free-floating (Jiang and Fillingame, 1998). Its crystal

structure (Abrahams et al., 1994) confirmed the idea that the α and β subunits rotate

(Boyer, 1993).

Reactive Oxygen Species

Mitochondria are the primary endogenous source of reactive oxygen species

(Harman, 1972). When the electron transport chain is inhibited, electrons accumulate at

.- complex I and CoQ and can easily be transferred to oxygen to create superoxide (O2 ).

.- O2 can be converted to hydrogen peroxide (H2O2) by magnesium superoxide dismutase

(MnSOD) in the mitochondria or copper/zinc superoxide dismutase (Cu/ZuSOD) in the

cytosol. H2O2 can be converted to H2O by glutathione peroxidase (GPx1) in the

mitochondria or the cytoplasm and by catalase in the cytoplasm. Reactive oxygen

.- . species such as O2 , H2O2 and the hydroxyl radical (OH ), formed from the interaction of

2+ H2O2 with Fe , can damage DNA, proteins and lipid membranes (Snyder, 1990). ROS are an important source of mitochondrial DNA mutations, up to ten times more than nuclear DNA mutations (Richter, 1988; Ames et al., 1993). They can also further inhibit

ATP synthesis by inactivating iron-sulfur electron carriers in the respiratory chain and aconitase in the citric acid cycle (Wallace, 1997; Brazzolotto et al., 1999; Hentze, 1996).

Mitochondrial Diseases

Mitochondria are involved in many degenerative diseases, aging and cancer. Each

mitochondrial disease occurs in only about 1 in 10,000 people (Larsson and Clayton,

1995; Wallace, 2001; Man et al., 2003), which can be considered rare, but when all

mitochondiral diseases are considered together, their numbers are much more impressive

(Schaefer et al., 2004). Most of these are due to defects in nuclear genes associated with

mitochondrial functions (Orth and Schapira, 2001; Triepels et al., 2001) and some are due

to mutations in the mitochondrial DNA itself (Holt et al., 1988; Wallace et al., 1988;

Shoffner et al., 1990; Goto et al., 1990). In some cases, mutations in nuclear genes lead

to mtDNA damage (Suomalainen and Kaukonen, 2001). They can be maternally

inherited or sporadic meaning that the mutations can be inherited or can accumulate over

time (DiMauro and Schon, 2001).

Mitochondrial DNA Mutations

Over 50 point mutations and hundreds of rearrangements in mitochondrial DNA

have been associated with disease (Kogelnik et al., 1998). Some mtDNA mutations

involve tRNA (Enriquez et al., 1995; Flierl et al., 1997; Hao and Moraes, 1996) or rRNA

genes (Entelis et al., 2001b; Moraes et al., 1991) and thus affect all mitochondrially

encoded proteins. About one-third of point mutations affect only a single protein-coding

gene (Manfredi et al., 2002). Mutations that affect all mitochondrially synthesized

proteins are usually heteroplasmic, such that there are enough good copies of mtDNA to

provide some function. However, some tRNA point mutations have a milder effect and

can be homoplasmic (Wallace, 1999). Likewise, there are some point mutations in

protein-coding genes that are only found in the heteroplasmic state implying lethality if

homoplasmic and other point mutations that do not result in a disease phenotype unless

homoplasmic. Mutations associated with Leber’s Hereditary Optic Neuropathy do not

always result in disease even when homoplasmic suggesting the presence of modifier

genes or a role for environmental factors (Carelli et al., 2003). In all cases, at least 60%

of mitochondrial genomes must have the mutation in order for the disease to manifest

itself (Hayashi et al., 1991; Zeviani and Antozzi, 1997; Moraes et al., 1993; Tatuch et al.,

1992; Larsson et al., 1995).

Since all of the genes in the mitochondrial DNA are involved in energy production, tissues having high energy requirements are likely to be affected. Mitochondrial diseases commonly affect the brain, central nervous system, skeletal muscle, eye, heart, and renal and endocrine systems (Wallace, 1999). Diseases associated with mutations in

mitochondrial DNA typically have variable onset and symptoms even within the same

family. This may be due to the amount of the mutant DNA relative to wild type within a

given tissue or individual cells (Schon et al., 1997; Petruzzella et al., 1994; Sciacco et al.,

1994). Additionally, most mitochondrial diseases are progressive, which is probably due

to the accumulation of mtDNA mutations over time (Zhang et al., 1992; Linnane et al.,

1990; Corral-Debrinski et al., 1991; Cortopassi and Arnheim, 1990; Simonetti et al.,

1992; Cooper et al., 1992).

Leber’s Hereditary Optic Neuropathy (LHON), the first disease associated with a mutation in mtDNA (Wallace et al., 1988), has a very noticeable variation in penetrance.

It is caused by point mutations in genes for subunits of NADH dehydrogenase. It causes sudden midlife blindness associated with degeneration of the optic nerve (Carelli et al.,

2002; Kerrison, 2005). The most common mutations are usually homoplasmic including

ND4:G11778A, ND1:G3460A, and ND6:T14484C (Carelli et al., 2003). LHON is more

prevalent in males within a homoplasmic family (Carelli et al., 2002; Qu et al., 2005;

Howell and Mackey, 1998). An X-linked recessive locus may contribute to LHON (Bu

and Rotter, 1991). This could explain the general variability in penetrance as well as the

increased incidence in males, but no gene has yet been identified (Carelli et al., 2003).

Environmental factors including tobacco and alcohol have been shown to increase the

penetrance of LHON, which may also contribute to the increased occurrence in males, if

they are more likely to smoke and drink (Carelli et al., 2002).

NARP and Leigh Syndrome

The original goal of this dissertation was to create a mouse model of a disease

caused by mutations in the mitochondrial gene ATP6 that codes one of the subunits of

ATP synthase. Mutations in this gene can lead to two different diseases, Neuropathy,

Ataxia, and Retinitis Pigmentosa (NARP) or Leigh Syndrome. The percent of the

mitochondrial DNA that carries the mutation roughly determines whether the individual

will be healthy or develop one of the two diseases (Holt et al., 1990; Santorelli et al.,

1993; Tatuch et al., 1992). NARP is associated with 70 to 90% mutant mtDNA (White et

al., 1999), while Leigh Syndrome is associated with 90 to 95% mutant mtDNA (Shoffner

and Wallace, 1992; Ortiz et al., 1993; Tatuch et al., 1992).

NARP affects the brain, central nervous system, peripheral nervous system and eye. Symptoms include developmental delay, dementia, seizures, ataxia, corticospinal tract atrophy, muscle weakness, sensory neuropathy, salt and pepper retinopathy, retinitis pigmentosa, sluggish pupils, lazy eye and blindness (Hamosh et al., 2002). Onset often occurs in childhood and usually coincides with an infection. Symptoms at onset are

highly variable and tend to be progressive (Sciacco et al., 2003). Affected individuals

tend to live into their thirties (White et al., 1999). In mild cases, symptoms may not

appear until later in life. Leigh Syndrome is characterized clinically by ataxia, hypotonia,

spasticity, developmental delay, optic atrophy, ophthalmoplegia (paralysis of the

extra-ocular eye muscles), degeneration of the basal ganglia and vascular proliferation

(Shoffner et al., 1995). Onset is during infancy, not at birth, and affected individuals

usually die within a few years.

A thymine to guanine transversion at nucleotide 8993 of the mitochondrial genome

results in an arginine instead of a leucine at amino acid 156 of the ATP6 protein. This

T8993G mutation has been associated with both NARP and Leigh syndrome depending

on state of heteroplasmy, and is the most common mutation associated with NARP (Holt

et al., 1990; Santorelli et al., 1993; Tatuch et al., 1992). Other mutations in ATP6 have

also been correlated with both diseases including T8993C (Hamosh et al., 2005;

Santorelli et al., 1996), T9176G (Carrozzo et al., 2004), T9176C (Thyagarajan et al.,

1995) and A8527G (Dubot et al., 2004). The TJG transversions are more severe than

the TJC transitions for both the 8993 and 9176 mutation sites (Schon et al., 2001).

Leigh syndrome can also be caused by mutations in nuclear encoded subunits of the

respiratory chain and pyruvate dehydrogenase. It can be X-linked or autosomal recessive

in addition to being maternally inherited. The maternally inherited Leigh syndrome

(MILS) mutations account for 18% of all Leigh syndrome percentages (Dahl, 1998), of

which the T8993G mutation in ATP6 is the most common (Schon et al., 1997).

Studies on the cellular defects associated with specific mutations in ATP6 have used E. coli, patient cells and human cytoplasmic hybrids (cybrids). Cybrids are cells

containing the nuclear DNA from one cell type, usually an established cell line, and the

mitochondria from another cell type, in this case the mitochondria from patients with the

disease (Ziegler and Davidson, 1981). In this way, the mitochondrial mutations can be

studied with the same nuclear genetic background to ensure that the effects are due to the

mitochondrial mutations.

Theoretically, mutations in the ATP6 subunit could prevent assembly of the FO portion of ATP synthase (Houstek et al., 1995), inhibit proton flow through the subunit

(Hartzog and Cain, 1993), or prevent the proper coupling of proton flow with the rotation of the c subunits. (Garcia et al., 2000b) have shown proper assembly of ATP synthase in patient cells with high levels of the T8993G mutation. In NARP mutant cybrids, however, some cells were able to assemble only one-third of the F1FO-ATPase with the

ATP6 subunit and others had no defect in assembly (Nijtmans et al., 2001). Cells devoid

30 of mitochondrial DNA, and therefore having no ATP6 or ATP8, were able to assemble half of the F1 with the c subunits (Nijtmans et al., 2001). In E. coli the mutation analogous to the human T9176G mutation showed defects in proton pumping and ATP synthesis (Hartzog and Cain, 1993; Carrozzo et al., 2004).

Many studies have shown a defect in ATP synthesis in cybrid cells and patient fibroblasts containing the most common NARP mutation, T8993G. Studies on homoplasmic T8993G mutant cells show 50 to 80% reduction in ATP synthesis (Tatuch and Robinson, 1993; Uziel et al., 1997; Manfredi et al., 1999; Mattiazzi et al., 2004;

Nijtmans et al., 2001; Vazquez-Memije et al., 1996; Baracca et al., 2000; Garcia et al.,

2000a). Platelets from unaffected family members with ~35% T8993G mutant mtDNA showed a 65% decrease in ATP synthesis (Carelli et al., 2002). Complex I- and complex

II-dependent ATP synthesis was detectably decreased even in clones having only 10% mutant mtDNA (Mattiazzi et al., 2004).

Two studies showed a decrease in respiration even in an uncoupled state (Mattiazzi et al., 2004; Trounce et al., 1994). Oxygen consumption in uncoupled cells is independent of ATP synthase, so these data suggest a defect in other complexes of the respiratory chain. Direct assays on complexes I, II and IV confirmed a defect in the activities of each of these three complexes that correlated with the amount of mutant mtDNA (Mattiazzi et al., 2004). Additionally, the activity of aconitase in the citric acid cycle was reduced in mutant cybrids (Mattiazzi et al., 2004). Aconitase contains iron-sulfur centers similar to complexes I, II and III. This implicates reactive oxygen species (ROS) as the causative agent of the decrease in activity of these complexes, since

ROS act on iron-sulfur centers. Consistent with this implication, the activity of MnSOD

was increased (Mattiazzi et al., 2004; Geromel et al., 2001) and levels of H2O2 were increased (Mattiazzi et al., 2004). Although respiration rates were decreased, there was a slight increase in membrane potential (∆Ψ) in the mutant cybrids, and the pH of the matrix in 100% mutant cybrids was increased relative to wild type (Mattiazzi et al.,

2004). This increase in matrix pH is consistent with reduced flow through the proton channel of ATP synthase as seen in E. coli studies (Hartzog and Cain, 1993; Ogilvie and

Capaldi, 1999; Carrozzo et al., 2000) and human studies (Schon et al., 2001). This increase is also consistent with studies correlating ROS with a high membrane potential

(Mattiazzi et al., 2004; Korshunov et al., 1997). Mattiazzi et al. also showed a galactose growth defect in cybrids with 30 to 100% mutant mitochondrial DNA (Mattiazzi et al.,

2004). Treatment with antioxidants partially rescued the defect seen in NARP mutant cybrids (Mattiazzi et al., 2004).

Mitochondrial Manipulations

The ability to alter the components of the mitochondria is useful for creating animal models of mitochondrial defects as well as for treating mitochondrial disease patients.

Unfortunately, the techniques used for creating or correcting nuclear DNA mutations cannot be directly applied to mammalian mitochondria, and new methods had to be developed to manipulate the mitochondria.

Creating Heteroplasmy in Cells and Mice

As mentioned above with respect to NARP, cybrids or cytoplasmic hybrids are cells that contain foreign mitochondria. If the recipient cell mitochondrial DNA was removed before introducing the other mitochondria, the resulting cybrid will contain the nuclear DNA from the recipient cell and the mitochondria from the donor cell. The mitochondria from the parental cell line are removed by growing the cells in the presence

of a mutagen such as ethidium bromide or rhodamine-6-G (RG6), which select against

the mitochondrial DNA. Cells lacking mitochondrial DNA, also called ρ0 cells, can be

grown in media containing pyruvate and uridine. The cells containing the donor

mitochondria are enucleated with cytochalasin B and then the two cell types are then

fused (King and Attardi, 1989; Trounce and Wallace, 1996; Ziegler and Davidson, 1981).

Cybrids can be used to study mutations from non-dividing cells by putting them in a cell

line that can be easily manipulated. It requires the existence of the mutation in the

species of interest.

The first heteroplasmic mice were created by fusing oocytes from different mouse strains (Jenuth et al., 1996; Jenuth et al., 1997; Meirelles and Smith, 1997; Meirelles and

Smith, 1998). While not harboring deleterious mutations, these mice showed skewed heteroplasmy in blood, spleen, liver and kidney (Jenuth et al., 1997). The first mutant heteroplasmic mouse was generated by fusing embryonic stem (ES) cells (Marchington et al., 1999). Levy et al. (Levy et al., 1999) used ES cells previously treated with R6G to

remove wild type mtDNA and fused them with enucleated cells containing mutant

mitochondrial DNA. Resultant mice were nearly homoplasmic for the mutant (Levy et

al., 1999). The first heteroplasmic mouse with germline transmission was created by

fusion of zygotes with enucleated cybrids bearing mtDNA with large deletions (Inoue et

al., 2000). Although the wild-type mtDNA was not removed from the zygotes, and the

first generation had less than 20% mutant mtDNA, the third generation had up to 80%

mutant mtDNA (Inoue et al., 2000). Another heteroplasmic mutant mouse with germ line

transmission was produced by fusion of RG6-treated ES cells with enucleated cell

cytoplast containing mtDNA with point mutations (Sligh et al., 2000).

Manipulating the Mitochondrial Genome

Altering existing mitochondrial DNA

Restriction enzymes can be targeted to the mitochondria by adding a mitochondrial signal sequence to their amino-termini. In a heteroplasmic state where a difference between the two haplotypes includes a unique restriction site, the corresponding restriction enzyme can eliminate one of the haplotypes. Mitochondrially targeted PstI has been shown to shift the heteroplasmic state of rodent cells where only one haplotype contained PstI sites (Srivastava and Moraes, 2001). The T8399G mutation that causes

NARP and MILS creates a SmaI restriction site that is not found in wild type mitochondrial genomes. Restriction enzymes could be therapeutic for diseases with such mutations.

Different ways of introducing small segments of DNA have been explored.

Polynucleotides cross-linked to a protein with a mitochondrial-targeting signal can be imported into isolated mitochondria (Vestweber and Schatz, 1989; Seibel et al., 1995).

Peptide nucleic acids were designed to be complementary to point mutations and deletion breakpoints and were able to selectively inhibit replication of the mutant mtDNA in isolated mitochondria (Taylor et al., 1997). They have been imported into mitochondria in cultured cells by fusion to a mitochondrial targeting signal (Taylor et al., 1997;

Muratovska et al., 2001), but have not been shown to be functional in intact cells (Taylor et al., 2000; Muratovska et al., 2001).

Even if DNA can be delivered to the mitochondria, there is no reason for it to stay there. It is believed that homologous recombination does not occur in mammalian mitochondria. Crossover products and excision repair activity have not been found in mammalian mitochondria (Clayton et al., 1975). Zuckerman et al. (Zuckerman et al.,

1984) were not able to detect recombination of mitochondrial DNA in somatic cell hybrids. On the other hand, there is some evidence for homologous recombination in the mitochondria. A RecA-like activity necessary for homologous recombination has been found in the mitochondria (Thyagarajan et al., 1996). Two population studies claim sequence comparisons contain evidence for homologous recombination in humans (Eyre-

Walker et al., 1999; Awadalla et al., 1999). High frequency homologous recombination occurs in mussels, plants and fungi (Ladoukakis and Zouros, 2001). It seems likely that recombination occurs in mammalian mitochondria, but not frequently enough to facilitate targeted alterations of the mitochondrial genome (Eyre-Walker, 2000).

Introduction of entire mitochondrial genomes

If the entire mitochondrial genome is introduced into mitochondria, it should be able to replicate and remain there. One group cloned the entire mitochondrial genome in

E. coli and was able to electroporate the mtDNA into isolated mitohcondria (Yoon and

Koob, 2003). RNA was detected that had been synthesized from the new mtDNA template in these isolated mitochondria from both wild type and ρ0 cells (Yoon and

Koob, 2003).

Another group cloned the mitochondrial genome in E. coli and complexed it with the mitochondrial transcription factor, Tfam, before introducing it into cells (Khan and

Bennett, Jr., 2004). The Tfam they used was modified with a protein transduction domain for import into cells as well as a mitochondrial localization signal. The protein transduction domain used to allow Tfam to efficiently cross cell membranes was from the

Tat protein from the human immunodeficiency virus (HIV) (Vives et al., 1997). About one thousand molecules of Tfam are bound to each endogenous mtDNA molecule (Alam

et al., 2003), so the exogenous mtDNA bound the modified Tfam will resemble the

endogenous one. After entry into the mitochondria, the mitochondrial localization

presequence should be cleaved from Tfam, which will also remove the protein

transduction domain at the amino terminus. This technique, termed protofection, proved

to be an efficient means of introducing DNA into the mitochondria (Khan and Bennett,

Jr., 2004).

RNA Import

There are more than 70 different pathogenic tRNA mutations and most are heteroplasmic (Turnbull and Lightowlers, 2002; Wallace, 1999). It may be possible to treat these diseases by importation of different tRNAs (Entelis et al., 2001b) as has been shown for tRNALys discussed above (Kolesnikova et al., 2004). Additionally, tRNA suppressor mutants may be able to ameliorate the effects of point mutations in protein coding genes of which more that 30 mutations are known (Entelis et al., 2001b). More molecules of the 5S rRNA are imported than tRNAs (Kolesnikova et al., 2004), but a smaller percentage (Entelis et al., 2001a). Either the 5S rRNA or tRNAs could be used as vectors to deliver RNAs with therapeutic activity, such as interfering with replication of mutant mtDNA (Kolesnikova et al., 2004).

Altering Proteins

Nuclear-encoded mitochondrial proteins

The vast majority of mitochondrial proteins is encoded in the nucleus and is imported into mitochondria following translation on cytoplasmic ribosomes. The genes for these proteins can be mutated or knocked out by transgenic methods. Knockouts have been made for many nuclear-encoded mitochondrial proteins including MnSOD

(Lebovitz et al., 1996; Li et al., 1995; Melov et al., 1999), GPx1 (Esposito et al., 2000),

uncoupler protein (Ucp1) (Enerback et al., 1997), and the adenine nucleotide translocater

(ANT1) (Graham et al., 1997). Of particular interest to the study of mitochondrial DNA

mutations are the Tfam knockout and PolgA knock-in.

Tfam is the major mitochondrial transcription factor and is also involved in generating the primer for mitochondrial DNA replication. The mouse knockout of Tfam is lethal between embryonic day 8.5 and 10.5 (Larsson et al., 1998). Little to no mtDNA is detectable at this stage. The heterozygote is viable and has 34% fewer copies of mtDNA (Larsson et al., 1998).

PolgA is the mitochondrial DNA polymerase-γ. A mouse with a mutation in

PolgA, affecting its proof-reading function, was shown to have an increase in mtDNA mutations and showed many signs of early ageing, supporting the notion that mtDNA mutations are a cause of ageing and not just another symptom (Trifunovic et al., 2004).

This mouse could be a model for progressive external ophthalmoplegia, caused by a mutation in human PolgA, although the symptoms are not identical (Agostino et al.,

2003).

Allotopic protein import

Allotopic protein import refers to the import of proteins into the mitochondria that are normally synthesized there. In order to manipulate mitochondrially-encoded proteins, they can be made in the cytoplasm with a mitochondrial import signal sequence. In order to do this, the gene sequence must be altered to account for the differences in the mitochondrial genetic code. At least the four codons must be changed that code for different amino acids or stop codons. Most important is UGA that codes for trypophan in the mitochondria and would create a truncated protein in the cytoplasm. Additionally,

37 codon usage frequencies differ between the mitochondria and the cytoplasm and could affect the efficiency of translation. Although import of a wild type protein does not involve the removal of the mutant protein, mitochondrial diseases do not typically affect individuals with less than 70% mutant mitochondrial DNA, so the presence of the mutant protein does not seem to be a problem (Zeviani and Antozzi, 1997; Hayashi et al., 1991).

Import of allotopic proteins is not always successful due to the hydrophobicity of the proteins. Allotopic protein expression was first studied in yeast (Farrell et al., 1988;

Law et al., 1988; Gearing and Nagley, 1986). The S. cerevisiae ATPase 8 protein was imported and restored respiration in a mutant strain (Farrell et al., 1988). ATPase 9 could only be imported when modified with amino acids from the N. crassa sequence that reduced its hydrophobicity and did not restore respiration (Law et al., 1988). Since only

COX1 and apocytochrome b (cyt b) are encoded in the mitochondrial genomes of all species, importable versions of most of the mitochondrial proteins exist in nature (Oca-

Cossio et al., 2003). The problem still remains that the importable version from one species may not be functional in another species (Law et al., 1988).

In human cells ATP6, ATP8 and ND4 have been imported allotopically (Manfredi et al., 2002; Guy et al., 2002; Oca-Cossio et al., 2003). Import of ATP6 resulted in incorporation of the allotopic protein into ATP synthase (Manfredi et al., 2002). The allotopic ATP6 was able to rescue defects in galactose growth with oligomycin and ATP synthesis in NARP cybrid cells (Manfredi et al., 2002). Import of ND4 was able to rescue complex I-dependent ATP synthesis in LHON cybrid cells (Guy et al., 2002).

Another group was unable to see import of ND4 or cyt b, but did achieve import of ATP6 and ATP8 (Oca-Cossio et al., 2003).

Ribozymes

Ribozymes are useful tools for reducing the levels of a specific RNA, for example, the RNA for one of the nuclear-encoded subunits of complex I (Qi et al., 2003b).

Hammerhead ribozymes are the most common type used for this purpose (Lewin and

Hauswirth, 2001; Gorbatyuk et al., 2005; Ruffner et al., 1990; Birikh et al., 1997). They were first described as cleaving in cis as part of a plant viroid’s replication cycle (Forster and Symons, 1987). They can be manipulated to cleave in trans by dividing the ribozyme into two parts (Uhlenbeck, 1987). Hammerhead ribozymes are composed of three helices and a core of 13 nucleotides that impart the catalytic activity (Symons,

1992). Helix I and helix III can be used as target arms by altering the nucleotide sequence of one strand to be complementary to the RNA that should be cleaved. The target RNA becomes the other strand of helix I and helix III.

The cleavage substrate of the hammerhead ribozyme must contain a UX, where X

is any nucleotide besides G (Shimayama et al., 1995; Ruffner et al., 1990). Hammerhead

ribozymes are capable of cleaving any site with a UX, but GUC is cleaved most

efficiently (Shimayama et al., 1995). Ribozymes are generally designed to base pair with

five to seven nucleotides on each side of the UX (Fritz et al., 2002b). Ribozymes with

UA following the GUC seem to have better activity, but not all combinations have been

tested, and this enrichment may not applicable to cleavage triplets other than GUC

(Clouet-d'Orval and Uhlenbeck, 1997).

Ribozymes are usually designed to target 11 to 14 nucleotides, a sequence short

enough to allow the ribozyme to dissociate after cleavage, so that it can cleave multiple

targets (Fritz et al., 2002a). Assuming random nucleotide sequences, a 13-nucleotide

sequence would statistically be found in the human or mouse genome about 200 times.

Fortunately, most genomic DNA is not transcribed, so it is likely that a specific target

sequence will only be present in one other transcript, if at all. Even if there are other

matches, those mRNAs may not be expressed in the cells being used. It is advisable to

check for other potential targets using BLAST (Gaeta, 2000).

Adeno-Associated Virus

Adeno-associated virus (AAV) is a non-pathogenic virus that has been used to

deliver a wide variety of genes into animals including an allotopic protein and a ribozyme

both mentioned above (Guy et al., 2002; Qi et al., 2003b). It has also been used to

deliver the Sod2 gene and a ribozyme targeting the Sod2 RNA (Qi et al., 2003a; Qi et al.,

2004), as well as GFP with a mitochondrial localization signal (Owen, IV et al., 2000).

AAV is a single-stranded DNA parvovirus of about 4.6 kb containing only two

genes, Rep and Cap, that encode four rep proteins and three capsid proteins. AAV can

efficiently transduce many cell types including non-dividing cells (Flotte and Ferkol,

1997). However, AAV requires coinfection with a helper virus, typically Adenovirus, for a productive infection. Therefore, a recombinant virus, lacking the AAV genes, requires both wild type AAV and a helper virus in order to replicate. This and its preferential integration into human chromosome 19 (Balague et al., 1997) make AAV attractive for gene therapy.

To package recombinant AAV, the only cis requirements are the two terminal repeats (TRs) between which the genes to be packaged can be cloned. The wild type

AAV genes and necessary Adenoviral genes can be supplied in trans without TRs, so that

only the genes of interests are packaged (Zolotukhin et al., 2002). Many serotypes of

AAV have been discovered in humans and other primate species (Gao et al., 2004; Gao et

al., 2005). The most widely studied serotype is AAV2, though other serotypes such as

AAV1 and AAV5 have been found to be superior to AAV2 in transducing specific tissues. DNA with the AAV2 TRs can be packaged in the capsid proteins of other serotypes (Rabinowitz et al., 2002). This practice is termed “pseudotyping.” AAV2

DNA packaged in AAV5 capsids has been shown to more efficiently transduce photoreceptors and other cells of the retina than with AAV2 or AAV1 capsids (Auricchio et al., 2001; Surace et al., 2003).

CHAPTER 2 RESULTS

Ribozymes were designed to target the mitochondrial ATP6 messenger RNA. The ribozymes were shown to be capable of cleaving their target RNA in vitro. When tested in cell culture, a phenotype resembling a mitochondrial defect was seen, but it did not correlate with the presence of the ribozyme. Ribozymes were shown to be imported into the mitochondria in cultured mouse and human cells, but the amount of import achieved does not appear to be sufficient to noticeably affect the target mRNA levels. Sub-retinal injection of mice with one of the ribozymes in Adeno-associated virus was not capable of inducing detectable damage.

Ribozyme Design and In Vitro Analysis

Two ribozymes were designed to cleave the mouse mitochondrial ATP6 messenger

RNA. The first 43 nucleotides of ATP6 overlap the ATP8 gene, so ribozyme target sites were sought following this region. The most common mutation in the ATP6 gene associated with human disease is T8993G, which results in an arginine instead of a leucine at amino acid 156 (Holt et al., 1990; Santorelli et al., 1993). This is the second highlighted codon in Fig. 2-1. Ribozymes were designed to target upstream of this codon. If the 5’ end of the cleaved mRNA were still translated, the truncated protein would not contain this apparently important region. Hammerhead ribozymes are known to cleave more efficiently after certain triplet sequences (Shimayama et al., 1995), so

GUC, CUC, AUC, AUA and GUA sites were examined. Possible ribozyme targets were eliminated if they or their ribozymes were predicted to have inhibitory secondary

41 42

structure according to M-fold (Zuker, 2003) or if more than 12 nucleotides were an exact match to genes other than ATP6 as determined by BLAST (McGinnis and Madden,

2004) searching. Three ribozymes target sites were chosen, and the ribozymes were named for the nucleotide of the coding sequence after which they should cleave:

ATP6m69rz, ATP6m171rz and ATP6m252rz, where “m” indicates the mouse gene.

Ribozymes were designed similarly for the human ATP6 gene including ATP6h206rz

(designed by Alfred Lewin), ATP6h208rz and ATP6h114rz, where “h” indicates the human gene. A ribozyme was also designed by Alfred Lewin to target human COX2,

COX2h24rz.

Fig. 2-1. Annotated mouse ATP6 mRNA sequence. The longer capitalized sequences are the targets of ribozymes m69, m171 and m252 respectively. Single capitalized codons are the sites of mutations associated with mitochondrial diseases.

Ribozymes were tested for their ability to cleave their short target RNA molecules in vitro. These targets were 13- or 14-nucleotide ribonucleotides that were purchased from Dharmacon, Inc. Ribozymes and radioactively end-labeled targets were incubated

with magnesium for various lengths of time. The reactions were run on acrylamide gels

and visualized with a phosphorimager. The uncut target and 5’ cleavage products were quantitated to determine the percent cleavage at each time point.

Fig. 2-2. Depiction of ribozymes annealed to their targets. Arrows indicate the cleavage site.

At 20 mM MgCl2, ribozymes m69 and m252 cleaved 25% of their targets in one and three minutes respectively, and both reached 70% cleavage in only 30 minutes (Fig.

2-3 A and C). Ribozyme m171 could only cleave 12% of its target in twelve hours, so this ribozyme was discarded (Fig. 2-3B). Time courses for m69 and m252 ribozymes were repeated at 5 mM MgCl2 to slow the reaction and find an ideal time point for

saturation kinetics. At 5 mM MgCl2 ribozyme m252 cleaved slightly faster than

ribozyme m69. They were able to cleave 20% of their targets in about 25 and 30 minutes

respectively (Fig. 2-3 D and E). The time courses of these two ribozymes are comparable

to other ribozymes that have been shown to work in vivo (Drenser et al., 1998).

Multiple turnover reactions were performed to calculate the kinetics of each ribozyme (Fig. 2-4). Ribozyme m69 reactions were stopped at 25 minutes, and m252 reactions were stopped after 15 minutes. These intervals were chosen so that less than

15% of the substrate had been cleaved, and therefore the observed reaction rate could be

Fig. 2-3. In vitro time course of ribozyme cleavage. A) ATP6m69rz at 20 mM MgCl2 with a target-to-ribozyme ratio of 9:1. B) ATP6m171rz at 20 mM MgCl2 with a target-to-ribozyme ratio of 10:1. C) ATP6m252rz at 20 mM MgCl2 with a target-to-ribozyme ratio of 10.5:1. D) ATP6m69rz at 5mM MgCl2 with a target-to-ribozyme ratio of 10:1. E) ATP6m252rz at 5mM MgCl2 with a target-to-ribozyme ratio of 10:1. used to estimate the initial velocity. Each reaction had 15 mM ribozyme with an increasing concentration of target. Maximum velocity (Vmax), the Michaelis-Menten constant for affinity (Km), and a reaction rate under saturating substrate concentrations

(kcat) were calculated for both ribozymes (Table 1). Although these parameters were

measured at 5 mM MgCl2, the kcat of both of these ribozymes is above the minimal

-1 acceptable value of 0.1 min at 20 mM MgCl2 (Fritz et al., 2002a) and similar to the kcat

of a published ribozyme that worked in vivo in a rat model of retinitis pigmentosa

(Drenser et al., 1998). The kcat of ribozymes m69 and m252 would be even higher if

measured at 20 mM MgCl2, because the observed initial rates were higher (Fig. 2-3).

Human ribozymes ATP6h208, ATP6h114 and COX2h24rz were tested in vitro on

short target RNA molecules (Alfred Lewin and Joe Hartwich, unpublished). ATP6h114

and COX2h24rz were able to cleave their short RNA targets efficiently, but ATP6h208

was not effective. ATP6h206rz was not tested in vitro.

Fig 2-4. Lineweaver-Burke plots of multiple turnover reactions for ribozymes. A) ATP6m69rz. B) ATP6m252rz.

Table 2-1. Kinetic parameters for mouse ATP6 ribozymes measured at 5 mM MgCl2 -1 -1 -1 Vmax (nM/min) kcat (min ) Km (nM) kcat/Km (min µΜ ) ATP6m69rz 9.2 0.62 1700 0.37 ATP6m252rz 8.3 0.55 1300 0.42

The mouse ATP6m69 and ATP6m252 ribozymes were also tested in vitro on total mitochondrial RNA. Mitochondrial RNA was isolated from NIH3T3 cells as described for detecting the localization of the ribozyme (below and Materials and Methods). Each ribozyme was incubated with an equal amount of mitochondrial RNA and 20 mM MgCl2 for either 27 or 91 minutes at 37oC. Reverse transcription and polymerase chain reaction

(RT-PCR) was performed to compare the remaining ATP6 mRNA to reactions incubated

without ribozyme (Fig. 2-5). The RNA incubated with the m252rz had less remaining

ATP6 mRNA than RNA incubated without ribozyme. The m69rz reactions had less

ATP6 than the ATP6m252rz reactions at each time point. Interestingly, the reactions

incubated for 27 minutes had less remaining ATP6 than those incubated for 91 minutes.

The m69rz reactions had 40% and 20% reductions in ATP6 compared with the no

ribozyme reactions at 27 and 91 minutes respectively. The m252rz reactions had 20%

and 10% reductions in ATP6 compared with the no ribozyme reactions at 27 and 91

minutes respectively. If maximum cleavage was reached by 27 minutes, as was seen with

the short targets, the difference in the time points could be simply the variation between

duplicate samples due to pipetting error; the difference may not be dependent on the

incubation time. Although this experiment was not repeated, and no internal control was

used, it appears as though at least the m69rz is capable of cleaving its full-length target in

vitro.

Fig. 2-5. In vitro ribozyme cleavage of total mitochondrial RNA. The ATP6 mRNA was amplified by RT-PCR.

The in vitro experiments above used ribozyme molecules without the upstream 5S rRNA sequence. To test whether the ribozyme is active when attached to the 5S rRNA, the 5S-ribozyme was synthesized by in vitro transcription and tested on its short target at

various time points (Alfred Lewin, unpublished). The 5S-ATP6m69rz and

5S-COX2h24rz were able to cleave their respective target RNAs in vitro.

Mouse Cell Culture Phenotypes

Both ATP6m69rz and ATP6m252rz were cloned into the HindIII site at the end of the 5S rRNA in forward and reverse orientation (Fig. 2-6 and Materials and Methods).

The reverse orientation constructs, ATP6m69rev and ATP6m252rev were used as negative controls along with the 5S rRNA with no ribozyme. UF11 contains the green fluorescent protein (GFP) gene driven by the cytomegalovirus (CMV) promoter and chicken β-actin enhancer (CBA). GFP expression was used for visualizing transfection efficiencies and as a control that did not contain the 5S rRNA. All of these constructs include a neomycin resistance cassette for selection purposes and adeno-associated virus

(AAV) terminal repeats (TRs) for packaging into AAV. The AAV packaged ribozymes were only used for injection into mice, because they do not infect mouse cells in culture very efficiently (Hansen et al., 2000).

Fig. 2-6. 5S and UF11 constructs. Ribozymes were cloned in both orientations into the HindIII site at the end of the 5S rRNA.

Mouse NIH3T3 cells were transfected with both ATP6 ribozymes four separate times. No reproducible phenotype was seen that could be correlated with the levels of ribozyme or target mRNA. A phenotype was seen in some of the clonal isolates that seemed to reflect a mitochondrial defect, but did not correlate with levels of ribozyme or

ATP6 mRNA. Each of the four transfections was analyzed at different stages and by different assays. First the four transfection attempts will be reviewed, and then the two sets of clonal isolates with the sporadic phenotype will be discussed.

Four Transfection Attempts

The first transfection included ATP6m69rz, ATP6m69rev, ATP6m252rz,

ATP6m252rev, UF11 (GFP) and mock transfection with Lipofectamine and the Plus reagent. Cells were plated two hours before transfection and only 3 µg DNA was used, resulting in about 5% transfection efficiency for UF11. UF11 cells were not allowed to grow, but cells transfected with m69rz, m69rev, m252rz and m252rev were selected with

G418 while the mock-transfected cells were grown without G418.

After 12 days under selection and 2 days without G418, an ATP synthesis assay was done on permeabilized cells using succinate as a substrate (Table 2-2). Using succinate as a substrate measures complex II-dependent ATP synthesis; complex

I-dependent ATP synthesis was not measured in these cells. Cells were trypsinized and permeabilized with digitonin so that the substrates could enter. ADP and succinate were used as substrates. Luciferin and luciferase were added in order to detect the production of ATP. The flash of light produced by the luciferase reaction was detected with a luminometer immediately after adding the substrates. Three reactions were performed from each plate of cells. There was some decrease in activity between the first and third

49 reactions, which could account for some of the variation within samples. A gradual decrease in luciferase activity over the course of the assay has also been seen, which could account for some of the variation between samples. The order of the samples was as listed in Table 2-2, so the mock-transfected cells may have had the lowest rate of ATP synthesis. None of the transfected cells had a decreased rate of ATP synthesis compared to the mock-transfected cells.

Table 2-2. Rates of succinate-dependent ATP synthesis in total selected mouse cells. The average rate for three consecutive reactions is given with the standard deviation in parentheses. Mock m69rz m69rev m252rz m252rev nmolATP/min/µg protein 2.7 (1.6) 4.3 (2.0) 5.1 (3.3) 2.8 (1.2) 2.3 (0.9)

After at least 2 weeks under G418 selection, the growth of these cells was compared in glucose, galactose, galactose with 0.4 ng/ml oligomycin (Fig. 2-6) and galactose with 0.8 ng/ml oligomycin. When grown in glucose, cultured cells rely on glycolysis for their energy source (Reitzer et al., 1979), but in galactose media they are more dependent on mitochondrial oxidative phosphorylation (Robinson, 1996).

Therefore, cells with a defect in the oxidative phosphorylation pathway should not be able to grow in galactose. Oligomycin is an inhibitor of ATP synthase, so addition of small amounts of this reagent to the galactose media should make this assay more sensitive by inhibiting some of the ATP synthesis (Breen et al., 1986; John and Nagley,

1986; Manfredi et al., 1999).

For the transiently transfected cells tested here, there was no difference between ribozyme, reverse or mock-transfected cells in their ability to grow in galactose. They all grew about half as fast in galactose as in glucose. When grown in galactose and the lower amount of oligomycin, all of the cells grew even slower for the first four days, but

then the ribozyme and reverse transfected cells started to grow faster while the

mock-transfected cells continued to grow at the same slow rate (Fig. 2-7). This could

possibly be explained by the fact that the mock-transfected cells did not go through the

stress of being selected with G418 and were therefore more sensitive. Alternatively,

transfection with any of the vectors could have made the cells less sensitive to

oligomycin or more respiratory competent. When the cells were grown in galactose with

the larger amount of oligomycin, they were only grown for 4 days with galactose and 0.8

ng/ml oligomycin and then were allowed to recover in glucose media. None of the cells

grew while the oligomycin was present, and they all recovered equally well in glucose,

including the mock-transfected cells. This suggests that the ribozyme and reverse

constructs had no effect on oxidative phosphorylation or oligomycin resistance. Since no

phenotype was detectable in these total selected cells, clonal isolates were derived to

Fig. 2-7. Total G418-selected cells grown in galactose with 0.4 ng/ml oligomycin. Mock-transfected cells were not pre-selected with G418.

51 analyze homogenous populations of cells with various levels of ribozyme expression

(section below on clonal isolates). These colonies were designated with Arabic numerals.

The second transfection attempt included ATP6m69rz, ATP6m252rz,

ATP6m252rev and UF11 (GFP) each transfected in duplicate. Although about 20% of the cells were green on the UF11 transfected plates, the transfection efficiencies of the others may have been much lower, since selection with G418 resulted in distinct colonies for both m69rz and m252rev. The efficiency of m252rz transfection was apparently better, as it did not lead to distinct colonies. The total selected m252rz cells, m69rz colonies, and m252rev colonies were tested for their ability to grow in galactose. They all appeared to grow equally well in glucose and galactose. In conclusion, none of the cells had an obvious defect in oxidative phosphorylation as indicated by their ability to grow in galactose, but this could be attributed to the low transfection efficiencies.

The third transfection was done in duplicate with ATP6m69rz, ATP6m252rz,

ATP6m252rev and UF11 (GFP). The transfection parameters were slightly different for each of the duplicates (see materials and methods) such that one resulted in 15% and the other in 30% of the cells transfected as determined by the number of green cells from the

UF11-transfected cells. UF11 cells were not grown further. Two days post-transfection, cells were selected with G418 for either two or three days before splitting them into either continued G418 selection or 0.5mM potassium cyanide (KCN).

Cyanide kills cells through a cytochrome oxidase (complex IV) dependent pathway, so cells with a decrease in cytochrome oxidase are more resistant to cyanide

(Villani and Attardi, 2000). The cyanide resistance assay was done in response to a phenotype seen in one of the first transfection colonies discussed below, although it is not

the primary phenotype expected. By visual inspection after four days in cyanide, the

ribozyme-transfected cells were surviving better than the m252rev-transfected cells in

both transfection sets. After five days, the m252rz cells looked more resistant to

cyanide-induced cell death than the m69rz cells for one of the sets, based on cells per

field, while they appeared the same for the other set. Based on their growth in G418, the

m69rz cells were more efficiently transfected, so they may be less resistant to cyanide

than ribozyme m252 in both cases.

Cells that were fully selected with G418 were grown in 1mM cyanide and counted in triplicate every two days (Fig. 2-8). Neither of the ribozymes was more resistant to cyanide than m252rev. The mock-transfected cells (not selected with G418) were more resistant to cyanide than any of the transfected cells. When this assay was repeated with only 250 µM cyanide, no significant difference was seen for any of the samples. Upon visual inspection, no difference in growth in galactose was seen compared to glucose in these total selected cells. No colonies were isolated from the third transfection.

Fig. 2-8. Total selected cell growth in 1 mM cyanide. Mock-transfected cells were not pre-selected with G418. Error bars are the standard deviation of three replicates.

The fourth transfection included ATP6m252rz, ATP6m69rz, ATP6m69rev, 5S (no ribozyme), UF11 (GFP) and a mock transfection. Only 1% of UF11-transfected cells were green one day post transfection. Mock-transfected cells were not allowed to grow further. The transfected cells were split into regular glucose media, galactose media and media with G418 one day post transfection. No difference was visually detectable in galactose compared to glucose media. Total G418-selected cells were tested for their ability to grow in galactose (Fig. 2-9). The m69rz-transfected cells grew slower in galactose than in glucose, but not significantly slower than the 5S and UF11 controls in galactose. Colonies were isolated from the selected cells and were designated with

Roman numerals.

Fig. 2-9. Total selected cell growth in galactose. Values are the average doublings per day between Days 1 and 3 in galactose and glucose. Error bars are the standard deviation for three replicates in glucose and four replicates in galactose.

Analysis of Clonal Isolates

Ribozyme and target mRNA levels

The clonal isolates from the first transfection, designated with Arabic numerals, were first screened for their levels of ribozyme expression by semi-quantitative RT-PCR

(Fig. 2-10). Total cell RNA was reverse transcribed, and products were amplified by

PCR at different numbers of cycles to ensure measurements were in the linear range of

amplification. Products were run on agarose gels and detected with ethidium bromide

(Materials and Methods). Of the ATP6m252rz colonies, m252rz1 and m252rz6 had more

than ten-fold the levels of ribozyme expression than the average selected cell (T).

Colony m252rev3 had the highest 5S-reverse transcript levels of the nine reverse colonies

tested (only two shown), but it was still less than half of the levels of the two high

expressing ribozyme colonies. None of the ATP6m69 ribozyme colonies had higher

levels of ribozyme than the total selected cell average (data not shown), so they were not

pursued further. Only three ribozyme colonies (1, 3 and 6) and two reverse colonies (3

and 10) were further analyzed along with two mock-transfected colonies.

Fig. 2-10. Ribozyme and reverse transcript levels in clonal isolates by RT-PCR. The first sample, T, was the total selected ATP6m252rz cells before isolation of the first set colonies. Arabic numerals were used to refer to the first set of colonies, while Roman numerals were used for the last set of colonies. These two sets of colonies were assayed separately.

The clonal isolates from the fourth transfection, designated by Roman numerals, were first screened for their ability to grow in galactose (Fig. 2-14). Then the ribozyme expression levels from most of the clones were measured as was done for the colonies from the earlier transfection (Fig. 2-10). None of the five m252rz colonies tested had high levels of ribozyme expression compared to each other. Only one of the m69rz colonies, m69rzI, had significantly higher levels of ribozyme expression than the other six tested. Four of the five m69rev colonies had higher levels of reverse transcript than the average ribozyme level, and one of those colonies, m69revII, had very high levels.

The levels of target ATP6 mRNA were measured by semi-quantitative RT-PCR for some of the colonies from both sets. Ribozyme colony m252rz1 was the only one with significantly lower levels of ATP6 (Fig. 2-11). This was one of the two colonies with the highest levels of ribozyme expression. The other colony with high levels of ribozyme, m252rz6, did not have a reduction in ATP6 mRNA. The m252rz1 colony not only had a decrease in ATP6, it also had reduced levels of all other mitochondrial mRNAs tested including ND6, the only mRNA encoded on the L-strand of mitochondrial DNA (Fig.

2-12). The mRNA levels of ATP6 and COX3 in colonies m252rz1, m252rev3 and

Mock5 were also analyzed by northern blot (data not shown). The relative mRNA levels among the colonies were the same by northern as by RT-PCR. The mitochondria DNA copy number was also measured by semi-quantitative PCR and did not correlate with mRNA levels. Both m252rz1 and Mock5 had fewer copies of mtDNA than m252rev3

(data not shown). None of the colonies from the fourth transfection had reduced levels of

ATP6 mRNA (data not shown), so other mRNA and mtDNA levels were not measured.

Fig. 2-11. ATP6 levels from the first set of colonies as measured by RT-PCR. Error bars are the standard deviation of two to five replicates.

Fig. 2-12. Levels of four mitochondrial mRNAs as measured by RT-PCR. A) COX3. B) ND4. C) ND6. D) ND2.

Growth in galactose

To determine if the ATP6m252rz1 or other colonies had a defect in oxidative phosphorylation, their rate of growth in galactose was measured. An equal number of

cells were plated on multiple dishes. Each day a subset of these dishes were counted.

For the first transfection (Fig. 2-13), the mock-transfected colonies, m252rz3 and

m252rev3 grew just as well in galactose as in glucose. Those were four colonies with no

decrease in ATP6 mRNA levels. For the colony with the most reduction in ATP6 levels,

m252rz1, more than half of the cells died after two days in galactose. Those cells that

survived grew such that there was more cell growth and division than death between Day

2 and Day 3. Colony m252rev10, that may have had a slight reduction in ATP6 levels,

had an intermediate galactose growth phenotype. On average, the cells from this colony

grew slower. Their growth slowed even more between Day 2 and Day 3 than between

Day 1 and Day 2. This could be due to slower growth of all the cells or some growth and

some death. The growth of colony m252rz6 in galactose was not quantitated, but no

difference was seen when compared visually with growth in glucose for three days. This

Fig. 2-13. Growth of colonies in glucose and galactose shown as population doublings per day.

colony had high levels of ribozyme expression (Fig. 2-10), but no decrease in ATP6

mRNA (Fig. 2-11).

For the Roman numeral colonies, the galactose growth assay was the first used to

screen the colonies (Fig. 2-14). This initial screen was a comparison of three days of

growth in galactose to glucose and was not done in duplicate. The assay was repeated up

to three more times on nine of the colonies, which are indicated by error bars (Fig. 2-14).

Three of the m69rz colonies, two of the m69rev, one of the 5S (empty vector) and two of

the UF11 (GFP) colonies did not grow as well in galactose as they did in glucose. All of

the m252rz colonies grew well in glucose and galactose. The colonies with the highest

levels of ribozyme and reverse transcript, m69rzI and m69revII (Fig. 2-10) were

Fig. 2-14. Growth in galactose of all fourth transfection colonies. First all colonies were screened; only those with error bars were repeated. The error bars are the standard deviation for two to four replicates.

two of the colonies with the galactose growth defect, but the other defective colonies had

very low levels of transcript. The existence of 5S and UF11 colonies with a galactose

growth defect further supports the idea that this phenotype is not caused by the ribozyme

or 5S-reverse transcript.

Cyanide resistance

Since the levels of COX3 mRNA were reduced in the m252rz1 colony, its

sensitivity to cyanide was measured (Fig. 2-15). Cyanide is an inhibitor of cytochrome

oxidase (complex IV) (Letellier et al., 1994). When cells are grown in glucose, the

integrity of the respiratory chain is not important, but cyanide can also induce apoptosis

or necrosis (Villani and Attardi, 2000). Therefore, cells with decreased levels of complex

IV may have increased resistance to cyanide-induced cell death.

Fig. 2-15. Growth of colonies in cyanide. The plaid bars represent cells grown in 250 µM KCN. The solid bars represent cells grown in 1 mM KCN.

The growth of the cells in cyanide was measured as was done for galactose growth.

Multiple plates were set up on Day 0 with two different concentrations of cyanide, and a

60 subset of these plates was counted for each time point. The m252rz1 colony that showed a decrease in COX3 and other mitochondrial mRNAs was more resistant to cyanide.

These cells eventually showed susceptibility to the higher concentration of cyanide by

Day 6 (Fig. 2-15) and the lower concentration by Day 8 (data not shown). The m252rev3 and Mock5 colonies were starting to die as early as Day 2 at both concentrations of cyanide. About 50 to 80% of the cells had died by Day 4. By Day 6, in the lower concentration of cyanide, there was more growth than death. At the higher concentration of cyanide, the cells from colonies m252rev and Mock5 cells were still dying at Day 6.

ATP synthesis

The ribozymes are targeted to ATP6, a subunit of ATP synthase. To more directly measure the activity of this complex, the rate of ATP synthesis was measured in permeabilized cells (Fig. 2-16). Cultured cells were trypsinized and given ADP and either succinate or pyruvate and malate as substrates. Succinate is the substrate for complex II-dependent ATP synthesis; malate and pyruvate are substrates for complex

I-dependent ATP synthesis (Fig. 1-3). The production of ATP was monitored with luciferase, which uses luciferin and ATP to produce a flash of light that can be detected with a luminometer. Cells were permeabilized with digitonin to start the reaction.

Luminometer readings were taken at 20 sec intervals, and the rate of ATP synthesis was calculated.

No difference was seen in the rate of ATP synthesis for any samples when succinate was used as a substrate. When pyruvate and malate were used as substrates, however, all of the colonies that died in galactose were unable to synthesize ATP (Fig.

2-16). This included colonies from both sets of stably transfected cells, and the nature of the DNA with which the cells were originally transfected did not make a difference.

Fig. 2-16. Relative rates of complex I- and complex II-dependent ATP synthesis. Complex II-dependent rates were the same for all, so this is a comparison of the complex I-dependent rates while correcting for loss of luciferase activity over the course of the assay.

Since pyruvate and malate are substrates for complex I, these results suggests that the affected colonies have a complex I defect. The ability of the cells to synthesize ATP with the complex II substrate, succinate, suggests there is no defect in ATP synthase or any other respiratory chain complexes. The presence of control colonies with the defect and the fact that it resembles a complex I defect both imply that the ribozyme did not cause this phenotype.

Localization of Ribozymes to the Mitochondria

To determine if the 5S rRNA is effective at transporting the ribozyme into the mitochondria, RT-PCR was done on RNA extracted from purified mitochondria from colonies ATP6m69rzI and UF11I (Fig. 2-17). Cells were homogenized, and the mitochondria were collected by differential centrifugation. The mitochondria were treated with RNase to remove any cytoplasmic RNA stuck to the outside of the mitochondria. As a control, some of the mitochondria were not treated with RNase.

Some mitochondria were also treated with digitonin before the RNase step. Digitonin permeabilizes the outer mitochondrial membrane, but not the inner mitochondrial membrane, so RNA in the matrix should still be protected. As a final control, some of the mitochondria were lysed with Triton X-100 before RNase treatment to ensure that all unprotected RNA was degraded with the amount of RNase used. The treated mitochondria were washed three times and DEPC-treated to remove the RNase before extracting RNA.

The RNA extractions were treated with DNase before performing RT-PCR. The 5’ primer was identical to a portion of the 5S rRNA and the 3’ primer was complementary to the ribozyme (see Materials and Methods). In addition to the ribozyme, RT-PCR reactions were carried out for β-actin and ND4 to monitor the presence of cytoplasmic

RNA and mitochondrial RNA respectively. The RNA extracted from the mitochondria was not enough to quantitate by spectrophotometric means, so the samples may have had different amounts of RNA.

The two RNase-treated ribozyme samples (R and d) were devoid of any detectable cytoplasmic RNA, but did contain detectable ribozyme. No ribozyme was seen in cells that were not transfected with ribozyme expressing plasmid (UF11I) or in the lysed mitochondria sample (X). This shows that the 5S rRNA with the ribozyme attached was capable of being imported into the mitochondria. The endogenous mitochondrial RNA was detected in these samples with only 22 amplification cycles, whereas the ribozyme required 35 cycles. Although not very precise, this is an indication of how little of the ribozyme is present in the mitochondria. When compared with the limits of detection in total cell RNA, the percent of the ribozyme imported could be similar to the 0.9% of 5S

Fig. 2-17. Detection of ribozyme in the mitochondria of NIH3T3 cells. T, total RNA; n, mitochondria with no RNase; R, RNased mitochondria; d, digitonin-treated and RNased mitochondria; X, Triton X-100-lysed and RNased mitochondria. rRNA naturally imported (Entelis et al., 2001a). Again, this is not a very quantitative method, and the estimated range is between 0.3% and 30% of the ribozyme being imported.

The presence of the ribozyme in the mitochondria of human cells was also analyzed

(Fig. 2-18). The ribozyme used here was one designed to cleave the human COX2 mRNA. As this is an assay for the localization of the ribozyme and not for function, the identity of the ribozyme is not significant, and an earlier experiment by Dr. John Guy suggested that this ribozyme might be imported into mitochondria using the 5S import sequence (personal communication). Transfections of human 293 cells were more

efficient than transfections of mouse NIH3T3 cells. About 85% of the cells were

transfected as visualized by GFP fluorescence in the UF11-transfected cells, so the cells

were analyzed during transient transfection, six days post-transfection. The isolation of

mitochondrial RNA was the same as for the mouse cells described above. Unlike the

mouse cells, enough RNA was extracted for spectrophotometric measurement, and about

0.5 µg RNA was used for each RT reaction. As seen in the mouse cells, the ribozyme

was detectable in the mitochondrial RNA fractions R (total mitochondrial RNA) and d

(mitochondrial matrix RNA) (Fig. 2-18). Thirty-three PCR cycles were required to

visualize the ribozyme, and only 19 cycles were required to detect ATP6 in the

mitochondrial RNA fractions. Again, this is a rough indication of how little of the

Fig. 2-18. Detection of ribozyme in the mitochondria of 293 cells. T, total RNA; n, mitochondria with no RNase; R, RNased mitochondria; d, digitonin-treated and RNased mitochondria; X, Triton X-100-lysed and RNased mitochondria.

65 ribozyme is imported. This is consistent with the amount seen in mouse cells and for the endogenous 5S rRNA.

Human Cell Culture Phenotypes

HeLa Cells and a Toxic 5S Transcript

Two human ATP6 ribozymes (h206rz and h114rz) and the COX2h24 ribozyme were tested in HeLa and 293 cells for their ability to alter the phenotype of the cells.

Another construct that was tested contained the 5S rRNA followed by the entire overlapping mouse ATP8 and ATP6 genes cloned by Alfred Lewin (see Materials and

Methods). By testing this mouse sequence in human cells, it can be distinguished from the endogenous ATP6. Controls included the mouse ATP6m69 ribozyme, the empty 5S construct, UF11 (GPF), mock transfection and untransfected cells.

HeLa cells were transfected three times. The first transfection resulted in 50%

GFP-positive cells of those transfected with UF11. The growth of these transiently transfected cells in galactose medium was compared to their growth in glucose between one and four days post-transfection, and no difference was apparent based on cell density.

The levels of ATP6 and COX2 were measured by RT-PCR on RNA extracted four days post-transfection, and no difference was detected. Meanwhile, some of the cells were selected with G418, and noticeably fewer of the cells transfected with the ATP8/6 construct survived the selection process. When the second HeLa cell transfection was selected with G418, the ATP8/6-transfected cells again survived very poorly compared with the cells transfected with the other five constructs.

The third HeLa cell transfection was done to test whether the ATP8/6 construct was toxic to cells. Each transfection was done in duplicate with two different preparations of

DNA to determine if transfection efficiency was the cause of the lack of resistance to

G418. The COX2 ribozyme, the empty 5S construct, UF11 and mock transfection were

used as controls. The two UF11 transfections resulted in 1% and 25% GFP-positive

cells. When selected with G418, almost no cells remained from one of the ATP8/6

transfections. The DNA for this transfection was made at the same time as the UF11 that

resulted in only 1% green cells. The other ATP8/6 transfection still had fewer remaining

cells than both the 1%- and the 25%-green UF11 cells. Although transfection efficiency

may have played a role, the ATP8/6 construct appeared to be toxic to HeLa cells. This

could be at the RNA level due to the 5S-ATP8/6 transcripts. Alternatively, if the RNA is

imported into the mitochondria and is translated, the mouse protein may not be

compatible with human cells.

To address this question further, RNA from the ATP8/6-transfected cells was analyzed for the presence of the 5S-ATP8/6 transcripts (Fig. 2-19). No mouse ATP8/6

RNA was detectable one day post-transfection in HeLa cells, but it was detectable in

293T cells five days post transfection. Although the RNA had been DNased, the no RT controls were still positive. This shows that the transfected DNA was indeed in the cells.

Since only one-fifth of the RT reaction was used for the PCR, the DNA was apparently below the levels of detection for the ATP8/6 RT-PCR. The greater intensity of the

COXh24rz band in the first RT-PCR compared to the no RT control showed that transcripts could be detected one day post transfection. Interestingly no COX2h24rz was detected in the second sample. The ATP8/6 RNA was also undetectable in the first HeLa cell transfection four days post transfection (data not shown). When regular 293 cells were transfected and selected with G418, the ATP8/6-transfected cells survived the selection process as well as the other transfected cells. This is further evidence that the

lack of G418-resistant cells was not due to the transfection efficiency, but rather a

HeLa-cell specific toxicity.

Fig. 2-19. Absence of the 5S-ATP8/6 transcript in HeLa cells. Duplicate HeLa cell samples are from duplicate transfections. No RT controls were done for the first of the duplicates.

No Phenotype in 293 Cells

Human 293T cells were transfected twice. This cell line is already resistant to

G418, so the transfected cells could not be selected for. The first transfection tested the three human ribozymes; ATP6h206, ATP6h114 and COX2h24; compared to UF11- and mock-transfected controls. UF11-transfected cells were more than 50% green one day post transfection. No difference was seen between growth in galactose and glucose between two and five days after transfection.

The second 293T cell transfection included all nine of the ribozymes and controls mentioned above, and each was done in duplicate with two different preparations of

DNA. The two UF11 transfections resulted in 40% and 70% GFP-positive cells. Three days post transfection, the growth of the cells was compared with and without cyanide

(Fig, 2-20). The COX2 ribozyme could lead to cyanide resistance, if it reduces the levels of cytochrome oxidase. One of the COX2h24rz transfections was more resistant to

cyanide than control cells, but both of the ATP8/6-transfected cells were more resistant.

The ATP8/6 gene was not expected to cause cyanide resistance.

Fig. 2-20. Growth of 293T cells for two days in 20 mM cyanide. Error bars are the range of the duplicate transfections.

The cyanide resistance assay was repeated with HeLa and 293 cells transfected with all combinations of COX2h24rz, UF11 or mock transfection using Lipofectamine

2000 or Mirus LT1 (Fig. 2-21). No difference was seen between COX2h24rz and UF11, but there was a difference between cell types, transfection reagents and mock-transfected cells. There was a correlation between the transfection efficiency and sensitivity to cyanide. The 293 cells transfected with Lipofectamine 2000 resulted in 20%

GFP-positive UF11-transfected cells and had the most cell death after two days in cyanide. The 293 cells transfected with Mirus LT1 resulted in only 1% green cells, and both HeLa cell transfections were less than 1% green. Mock-transfected cells, by definition, have the lowest transfection efficiency and were the most resistant to cyanide in each set. This was the same trend seen when cells were grown without cyanide for the first day of this experiment, so the differences between cells is apparently due to

transfection toxicity, which correlates with transfection efficiency. Although the

previous cyanide resistance assay was done three days post transfection as opposed to the

one day done here, it could be an explanation for the perceived resistance of the

ATP8/6-transfected cells to cyanide.

Fig. 2-21. Growth of HeLa and 293 cells in 20 mM cyanide. Cells were assayed one day post transfection for two days in cyanide.

The levels of both ATP6 and COX2 mRNA were measured in RNA extracted five days post transfection from 293T cells not grown in cyanide. There was no significant difference in ATP6 or COX2 levels (Fig. 2-22). All of the transfected cells may have less

ATP6 and COX2 than the untransfected cells, but the untransfected-cell values were

highly variable. Again, compared to the other transfected cells, ATP8/6 more closely

resembled the untransfected cells possibly due to low transfection efficiency.

Injection of Mice

If the ribozyme were capable of creating the disease phenotype, it would cause a

loss of photoreceptors and a loss of vision (Chapter 1, Mitochondrial Disease section).

Fig. 2-22. Levels of ATP6 and COX2 in transiently transfected 293T cells. Error bars are the standard deviation of 7-10 PCR reactions from two or three RT reactions.

Although the levels of ribozymes delivered to cultured cells may have been insufficient, it was possible that viral mediated delivery to mouse photoreceptors could result in higher levels of ribozyme expression. Ribozyme ATP6m252 and its reverse were

packaged in Adeno-associated virus pseudotype 5 (AAV5). Pseudotype AAV5 has

AAV2 terminal repeats (TRs) and AAV5 capsid proteins. AAV5 has been shown to

more efficiently transduce photoreceptors than other AAV serotypes (Auricchio et al.,

2001; Surace et al., 2003). Two sets of mice were injected subretinally with 2 x 1011

AAV genome copies of the ATP6m252rz in the right eye and the m252rev control in the left eye.

The ability of the mice to see was monitored by electroretinogram (ERG) every month for about four months (Fig. 2-23). The ERG measures the electrical response of the eye to flashes of light. The response includes a negative a-wave and a positive

Fig. 2-23. Electroretinogram results from mice injected with AAV5-ATP6m252rz. Values are the ratios of the right to left eye A waves at 5 Candela/mm2.

Fig. 2-24. Electroretinograms of mouse K at 4 months post injection. A) Left eye injected with ATP6m252rev. B) Right eye injected with ATP6m252rz. b-wave (Fig. 2-24). The a-wave represents the response of the photoreceptors (Hood and

Birch, 1990). The b-wave represents the response of the bipolar and Müller cells that are post-synaptic to the photoreceptors (Witkovsky et al., 1975). If the ribozyme caused loss of photoreceptors, a decrease in the amplitudes of the a-wave and the b-wave would be seen.

Of the 12 mice (6 in each set), eight retained vision in both eyes (A, D, E, I, N, U, V and W). Two of these had slightly reduced vision in the left eye compared to the right eye (N and U), but U was not consistently different. One mouse had reduced vision in both eyes (M). One mouse completely lost vision in the right eye by one month (J), andthis was likely due to injection damage. Three mice had reduced vision in the right eye (K, Q and W). Two of these had a decrease in the right eye by one month and no change after that (Q and W), which could have been due to injection damage. The decrease in W was small and only detectable in the a-wave (b-wave not shown). Only

one mouse had a gradual loss of vision in the right eye (K), which is what was expected.

Its ERG wave forms are shown for four months post injection (Fig. 2-24)

After four and one half months, the first set of animals was sacrificed, and eyes

were removed and sectioned. While dissecting the eyes, it was noted that the right eye of

mouse K had a cataract. Although cataracts do not always interfere with the ERG

response, this could be the reason for the decreased vision seen in this eye. Hematoxylin

and Eosin staining of sections revealed multiple areas of this retina with a loss of

photoreceptors (Fig. 2-25) that could also have caused the decrease in ERG response.

The right eye of mouse J that had no ERG response had a total loss of photoreceptors.

Fig. 2-25. Sections of retinas from mice J and K. The left eye was injected with AAV5-ATP6m252rev. The right eye was injected with AAV5-ATP6m252rz. The photoreceptors can be seen in three layers, the outer segments (OS), inner segments (IS), and outer nuclear layer (ON). The inner nuclear layer (IN) is made up of other retinal cells.

The second set of mice was sacrificed after five months for sectioning of their eyes. No significant thinning of the retina was seen in any of these animals.

CHAPTER 3 MATERIALS AND METHODS

In Vitro Ribozyme Analysis

Synthetic RNA oligonucleotides were ordered for both ribozymes and targets from

Dharmacon, Inc. (Lafayette, CO) and de-protected as described by the manufacturer.

These were used for time courses and multiple-turnover kinetic reactions as described

(Fritz et al., 2002a).

Table 3-1. RNA oligonucleotides used for in vitro ribozyme assays ATP6m69rz uauaaucugaugagcgcuucggcgcgaaauggcua ATP6m69t uagccaucauuaua ATP6m171rz agcaucugaugagcgcuucggcgcgaaauuuguu ATP6m171t aacaaauaaugcu ATP6m252rz ccuagcugaugagcgcuucggcgcgaaagauuug ATP6m252t caaaucuccuagg

Time course reactions included 50 to 300 nM ribozyme (denatured at 70oC for

2 min), 500 nM to 3 µM target spiked with γ-32P (ICN; Costa Mesa, CA) end-labeled target (such that the target to ribozyme ratio is about 10:1), 40 mM Tris HCl pH 7.5,

20 mM or 5 mM MgCl2 as indicated, 9 mM DTT and 1% RNasin from Promega

(Madison, WI). One 100-µl reaction was set up at 37oC and 10 µl was removed at each time point (3n min, where n = 0-6), and the reaction was stopped with an equal volume

formamide dye mix (90% formamide, 50 mM EDTA, 0.05% bromophenol blue and

0.05% xylene cyanol). A separate reaction was set up without ribozyme for negative

controls at the shortest and longest time points.

A time point at which about 15% of the target was cleaved was used for saturation

kinetics. Reactions included 15 nM ribozyme, 300 nM to 1.92 µM cold target plus 0.12

75 76

32 µCi γ- P end-labeled target, 40 mM Tris HCl pH 7.5, 5 mM MgCl2, 4.5 mM DTT and

0.5% Promega (Madison, WI) RNasin. Each reaction was run in a separate tube and done in duplicate. Again, each reaction was stopped with an equal volume of formamide dye containing 50 mM EDTA.

Cloning

The 5S ribosomal RNA with a point mutation creating a SmaI site at nucleotide

105 of the RNA sequence was a gift from the laboratory of Dr. Eric Schon at Columbia

University (Magalhaes et al., 1998). The 648 bp EcoRI fragment containing 272 bp upstream and 250 bp downstream of the 121 bp 5S rRNA sequence was cloned into the

EcoRI and MfeI sites of an AAV2-TR vector. (EcoRI and MfeI have compatible overhanging ends.) A neomycin resistance cassette was cloned into the SalI site 54 bp downstream of the EcoRI/MfeI site. The ribozymes were cloned in forward and reverse orientation into the HindIII site at the very end of the 5S rRNA sequence. The ribozymes were constructed with overlapping DNA oligonucleotides that have HindIII-compatible ends when annealed.

Table 3-2. DNA oligonucleotides used for cloning mouse and human ATP6 ribozymes ATP6m69sense AGCTTATAATCTGATGAGCGCTTCGGCGCGAAATGGCTA ATP6m69antisense AGCTTAGCCATTTCGCGCCGAAGCGCTCATCAGATTATA ATP6m252sense AGCTTCCTAGCTGATGAGCGCTTCGGCGCGAAAGATTTGA ATP6m252antisense AGCTTCAAATCTTTCGCGCCGAAGCGCTCATCAGCTAGGA ATP6h114rzsense AGCTTGTTGTTCTGATGAGCGCTTCGGCGCGAAATGAGA ATP6h114rzantisense AGCTTCTCATTTCGCGCCGAAGCGCTCATCAGAACAACA ATP6b (h206rzsense) AGCTTATAAGACTGATGAGCCGTTCGCGGCGAAATCAGGA ATP6brev (h206rzanti) AGCTTCCTGATTTCGCCGCGAACGGCTCATCAGTCTTATA

Cell Culture

Mouse NIH3T3 cells were grown in Dulbecco’s Modified Eagle’s Media (DMEM)

from Mediatech, Inc (Herndon, VA). with 4.5 g/L glucose; 10% Newborn Calf Serum

(NCS); 1X antibiotic/antimycotic from Mediatech, Inc (Herndon, VA); 1 mM pyruvate,

unless otherwise stated, and, in later experiments, 50 mg/L uridine. For glucose-free

media DMEM base from Sigma (St. Louis, MO) was used with 3.7 g/L sodium

bicarbonate, 2 mM L-glutamine, either 4.5 g/L glucose or 5 mM galactose, 10% NCS,

antibiotic/antimycotic, pyruvate and sometimes 50 mg/L uridine. To detach cells, they

were treated with 0.5% trypsin EDTA from Mediatech, Inc. (Herndon, VA) in phosphate

buffered saline (PBS). PBS is 130 mM NaCl and 10 mM sodium phosphate, monobasic

and dibasic mixed to pH 7.3. Human cells included 293, 293T and HeLa cells. They

were grown in DMEM media as described for mouse cells except 10% Fetal Bovine

Serum (FBS) was substituted in place of NCS.

Transfections

All transfections of NIH3T3 cells were on 6-well plates and used serum-free media.

The first transfection used 4 x 105 cells, 3 µg DNA, 14 µl Lipofectamine, 6 µl PLUS reagent from Invitrogen (Carlsbad, CA). The second transfection was done in two sets and used 2 x 105 or 3 x 105 cells, 10 or 16 µl Lipofectamine respectively, 15 µg DNA and

6µl PLUS reagent. The third transfection consisted of two different sets. One set used

2 x 105 cells, 12 µg DNA, 10 µl Lipofectamine and 3 µl PLUS reagent and was carried out by Elizabeth Bongorno resulting in 30% GFP-positive cells the next day. The other set used 2.5 x 105 cells, 15 µg DNA, 11 µl Lipofectamine and 2 µl PLUS reagent and resulted in 15% GFP-positive cells the next day. The fourth transfection used 2 x 105 cells, 9 µg DNA, 14 µl Lipofectamine and 4 µl PLUS reagent and was carried out by

Diana Levinson. Uridine was added to the media after transfection and for all experiments on these cells.

Human cell transfections on 6-well plates used 8µl Lipofectamine 2000 from

Invitrogen (Carlsbad, CA) and serum-free media. The three transfections of HeLa cells

used 5 x 105, 6 x 105 and 4 x 105 cells with 8 µg, 5 µg and 5 µg DNA respectively.

Transfections of 293 cells on 6-well plates used 6 x 105 cells and 5 µg DNA.

Transfections of 293 cells to look for the presence of the ribozyme in the mitochondria were done on 6cm dishes with 1 x 106 cells, 10 µg DNA and 16 µl Lipofectamine 2000.

RNA Isolation

RNA was isolated either by TRIzol extraction from Invitrogen (Carlsbad, CA) or

with the Sigma (St. Louis, MO) GenElute Mammalian Total RNA Miniprep Kit. The

Sigma kit was used for all of the assays for the first set (Arabic numerals) of colonies,

except for the measurements of ND2 and ND6 mRNA levels. RNA was extracted from a

10 cm dish of cells and eluted in 90 µl of water. RT-PCR of ND2 and ND6, all assays on

the Roman numeral colonies and assays on human cells used TRIzol extracted RNA. For

TRIzol extraction, a 10 cm dish of cells was trypsinized as described above and cells

were resuspended in 100 µl PBS before adding 1 ml TRIzol as Invitrogen recommends.

The remainder of the Invitrogen protocol was followed except that no second

precipitation step was done. If less than a 10 cm dish of cells was harvested, the amount

of TRIzol was usually decreased to 500 µl or 250 µl and the other reagents were

decreased accordingly.

RT-PCR

Reverse transcription (RT) reactions for detecting 5S transcripts from the first set

of clonal isolates were performed using the Ambion (Austin, TX) Retroscript kit in 20 µl

reaction volumes, and all other RT reactions used the Amersham (Piscataway, NJ)

First-Strand cDNA Synthesis Kit in 10 µl reaction volumes (2.5 µl bulk mix and 0.5 µl

200 mM DTT). Before adding the RT reaction mix, 50 pmol of a random decamer and

1pmol of the appropriate antisense primer for the ribozyme were annealed to the RNA

(usually 1 to 2 µg) at 70oC for 5 min.

Polymerase chain reactions (PCR) contained 3 pmol each of the appropriate

primers, 0.2 mM dNTPs, 1X Promega Buffer, 2.5 mM MgCl2, 2U Promega Taq

Polymerase and usually 2 µl of the RT reaction in a 25 µl volume. Cycles consist of 30 s each at 95, 50 and 72oC in most cases. Duplicate PCR reactions were carried out for different numbers of cycles to insure they were still within the linear range.

Table 3-3. DNA oligonucleotides used for RT-PCR Random 10mer NNNNNNNNNN 5Ssense21 GTCTACGGCCATACCACCCTG 5Santisense18 AAGCTTACAGCACCCGGG HH antisense 04 TTTCGCCGCGAACGGCTCATCAG ATP6m69sense AGCTTATAATCTGATGAGCGCTTCGGCGCGAAATGGCTA ATP6m69antisense AGCTTAGCCATTTCGCGCCGAAGCGCTCATCAGATTATA ATP6m252sense AGCTTCCTAGCTGATGAGCGCTTCGGCGCGAAAGATTTGA ATP6m252antisense AGCTTCAAATCTTTCGCGCCGAAGCGCTCATCAGCTAGGA ATP6h114rzsense AGCTTGTTGTTCTGATGAGCGCTTCGGCGCGAAATGAGA ATP6h114rzantisense AGCTTCTCATTTCGCGCCGAAGCGCTCATCAGAACAACA ATP6b (h206rzsense) AGCTTATAAGACTGATGAGCCGTTCGCGGCGAAATCAGGA ATP6brev (h206rzanti) AGCTTCCTGATTTCGCCGCGAACGGCTCATCAGTCTTATA ATP6mtMouseSense ATGAACGAAAATCTATTTGCCTCAT ATP6MouseAntisense GTAATGGTAGCTGTTGGTGGGC COX3MSENSE TCCATGACCATTAACTGGAGCC COX3MANTISENSE CTCATGTAATTGAAACACCTGATGC ND4MSENSE CTCAATCTGCTTACGCCAAACAG ND4MANTI CGTGTGTGTGAGGGTTGGAGG ND2mouseSense GTAATCACAATATCCAGCACCAACC ND2mouseAnti GGGGTAGGGTTATTGTGCTTATGATAG ND6mouseSense CATTATTTTTGGTTGGTTGTCTTGG ND6mouseAnti CGATAATAATAAAAATACCCGCAAAC COX2humanSense CGCAAGTAGGTCTACAAGACGCTAC COX2humanAntisense GTCGTGTAGCGGTGAAAGTGG ATP6humanSense CCCAACAATGACTAATCAAACTAACC ATP6humanAntisense TGGTTGATATTGCTAGGGTGGC mouse beta-actin 5’ GTTTGAGACCTTCAACACCCC mouse beta-actin 3’ ACTCCTGCTTGCTGATCCAC

The ribozyme transcript levels for the first (Arabic) clonal isolates were detected at

20 to 26 cycles with an annealing temperature of 52oC. The ribozyme levels in the

Roman numeral colonies were assayed at 24 and 26 cycles with an annealing temperature

of 50oC. For ATP6 mRNA measurements, 12 to 16 cycles were used with an annealing

temperature of 48oC. For COX3 and ND4, 14 to 16 cycles and an annealing temperature of 48oC were used. ND2 and ND6 were assayed with 14 to 18 cycles and an annealing

temperature of 50oC. Bands were detected on agarose gels stained with ethidum bromide

(EtBr) in most cases. A comparison with radioactively labeled PCR produced ribozyme

to Rb (retinoblastoma) ratios that were half that of EtBr-detected bands, but samples were

consistent relative to each other.

Growth in Galactose

Total selected cells from the first transfection were plated at 3 x 105 cells per 6 cm

dish. Five plates each were set up in 5 mM galactose and 0.4 ng/ml oligomycin. One

plate was trypsinized as described above and counted on a hemacytometer counted every

two days, and the media was replaced on the remaining plates.

Total selected cells from the fourth transfection were plated at 1 x 105 cells per

6 cm dish in two separate experiments. In the first experiment, two galactose and one glucose plate were counted one day after plating, and another two galactose and one glucose plates were counted three days after plating. In the second experiment, two galactose and one glucose plate were counted one day after plating, and two galactose and two glucose plates were counted three days after plating. Standard deviations were calculated for the doubling rates between one and three days of growth for both experiments combined, four replicates in galactose and three in glucose.

The first set of clonal isolates grown in galactose (6 colonies designated with

Arabic numerals) was plated at 2 x 105 cells per 6 cm dish. Each colony was plated on 12 dishes in 5 mM galactose. Each day three plates were counted for each colony. Medium was replaced every two days. After three days, increased confluence caused a significant decrease in growth rate, so the numbers for Day four are not shown. Standard deviations were calculated for the three replicates.

The colonies designated with Roman numerals from the fourth transfection were screened for their ability to grow in galactose. Once colonies had grown enough, they were split in half to two wells of a 12-well plate. One well was grown in glucose and one in galactose for three days. Both wells were counted on the third day and the number in galactose was compared to the number in glucose.

Galactose growth measurements were repeated for those Roman numeral colonies that appeared to have a defect in galactose growth. They were plated at 1 x 105 cells per

6 cm dish. Each colony was plated on five dishes in 5 mM galactose and three in glucose. On Day one, two galactose plates and one glucose plate were counted for each colony. On Day three, the remaining three galactose plates and two glucose plates were counted. For some of the colonies, the cells were only counted on Day three, two in galactose and two in glucose. Error bars are the standard deviation of two to four replicates.

Cyanide Resistance Assay

The assay for cyanide (KCN) resistance is essentially the same as the galactose growth assay, except for the contents of the media and the expected outcome. Cells with a decrease in cytochrome oxidase should grow better in cyanide. Cells were plated at

1 x 105 cells per 6 cm dish with 250 µM or 1 mM KCN. For the third transfection cells,

12 plates were set up for each sample. For the first transfection colonies, 18 plates were

set up for each colony, 9 at each cyanide concentration. Three plates were counted every

two days, and the medium was replaced on the remaining plates.

ATP Synthesis Assay

The rate of ATP synthesis was measured in permeabilized cells as described

(Manfredi et al., 2001). A 15 cm dish of cells were trypsinized as described above and

resuspended at 1 x 107 cells/ml in buffer A. Buffer A is composed of 150 mM KCl, 25 mM Tris HCl, 2 mM EDTA, 0.1% BSA, 10 mM K-phosphate, 0.1 mM MgCl2, pH 7.4.

Each reaction consisted of 1.6 x 106 cells, 1 mM ADP, 1.5 mM adenosine pyrophosphate,

10 mM pyruvate, 10 mM malate, 5% buffer B (containing luciferin and luciferase), and

100 µg/ml digitonin. Buffer B is 800 µM luciferin from Promega Life Science (Madison,

WI) and 20 µg/ml luciferase from Roche Applied Sciences (Indianapolis, IN) in 500 mM

Tris Acetate, pH 7.75. Digitonin was added last to start the reaction, and the other

components were added to the cells immediately before the digitonin. Using luciferin

and ATP, luciferase catalyses a reaction that produces a flash of yellow-green light

(DeLuca et al., 1979). The ATP-dependent production of light was detected immediately

in a luminometer reading every 15 to 20 s for 3 to 5 min. Pyruvate and malate are

substrates for complex I. Succinate (50 mM) was used instead of pyruvate and malate to

measure complex II-dependent ATP synthesis. As a negative control, oligomycin was

added to the reactions at 2 µg/ml. Relative light units detected with the luminometer

were converted to moles of ATP by reading luciferase activity with ATP standards.

Succinate-dependent rates were approximately the same for all, but there was variability due to the loss of luciferase activity over time. Since the reactions with the different

substrates were done immediately after one another for each sample, using the ratio of the

two rates was able to correct for this difference in luciferase activity.

Mitochondrial RNA Isolation

Mitochondria were isolated from four 15 cm dishes of NIH3T3 cells or one 15 cm dish of 293 cells as described (Gaines, III, 1996). Briefly, cells were harvested and washed twice with six pellet volumes (about 600 µl) of cell wash solution (1 mM Tris pH

7.0, 130 mM NaCl, 5 mM KCl and 7.5 mM MgCl2). Cells were centrifuged for 5 min at

1500 gav. Washed cells were resuspended in 50 µl 10X spin solution (35 mM Tris pH

7.7, 20 mM NaCl, 5 mM MgCl2, and 1 mM phenylmethylsulfonyl fluoride, PMSF).

Cells were homogenized with 15 strokes of a Teflon coated pestle. The homogenate was transferred to a 1.5ml Eppendorf tube with 800 µl 1X spin solution with EDTA (3.5 mM

Tris pH 7.7, 2 mM NaCl, 0.5 mM MgCl2, 0.5% BSA, 20 mM EDTA and 1 mM PMSF).

A low speed spin, 1500 gav for 10 min, was used to pellet unbroken cells, nuclei and other

debris. The supernatant was transferred to a new tube and spun at 1500 gav for 5 min two

more times.

The supernatant containing the mitochondria and other cytoplasmic components

was divided in order to subject the mitochondria to different treatments. One fraction,

“n” or no RNase, was spun at 18,000 gav for 5 min to pellet mitochondria and washed

with final wash solution (10 mM Tris pH 7.5, 1 mM EDTA, 6 mM CaCl2, 320 mM

sucrose and 1mM PMSF) multiple times. The “R” (RNased), “d” (digitonin), and “X”

(Triton X-100) fractions were incubated for 15 min at room temperature with 32.5 µg

RNase A before pelleting mitochondria. The R mitochondrial pellet was resuspended in

50 µl final wash solution and treated with 65 µg RNase A and 20 units of micrococcal

nuclease for 15 min more at room temperature. The micrococcal nuclease was

inactivated by adding 20 mM EGTA to chelate the calcium. The “d” or digitonin fraction

was resuspended in 30 µl final wash solution with 1 mg/ml digitonin and left to shake at four degrees Celsius for 15 min. The mitochondria were pelleted for 10 min at 18,000 gav and then treated with nuclease as described for the R fraction. The two RNase-treated mitochondria fractions were washed three times with final wash solution containing 20 mM EDTA. The X fraction mitochondrial pellet was resuspended in 50 µl final wash solution with 1% Triton X-100. The sample was mixed for a few seconds and then

RNase and micrococcal nuclease were added and incubated for 15 min at room temperature. EGTA, 0.05% diethylpyrocarbonate (DEPC) and TRIzol were added directly to extract RNA. (The mitochondria could not be pelleted again, because they should have been lysed.) All other fractions (n, R and d) were resuspended in 20 µl final wash solution with 20 mM EDTA, 0.05% DEPC and 0.1 M sodium acetate, and RNA was extracted with 250 µl TRIzol (Invitrogen, Inc.)

The RNA was treated with DNase before performing RT-PCR. To determine if any cytoplasmic RNA remained, beta-actin primers were used in the RT-PCR mix.

Mouse ND4 primers or human ATP6 primers were used to monitor mitochondrial transcripts. RT-PCR products were separated on 5% acrylamide, 6 M urea gels. The gels were stained with 0.01% SYBR® Green I from Invitrogen (Carlsbad, CA) and visualized

with a Storm Phosphorimager (GE Healthcare).

Mouse Subretinal Injections

For sub-retinal injections, mouse eyes were dilated with atropine (Bausch & Lomb

Pharmaceuticals, Inc, Tampa, FL) about one hour before and then phenylephrine

(AK-DILATE from Akorn; Buffalo Grove, IL) a few minutes before injection. Injections

were done by Adrian Timmers. The mice in the first set were 36 days old, and those in

the second set were 21 days old. Mice were anesthetized with a 1.2:0.3:3.5 ratio of

ketamine:xylazine:PBS (100 mg/ml ketamine, Fort Dodge Animal Health, Fort Dodge,

IA; 100 mg/ml xylazine from Phoenix Pharmaceutical, Inc., St. Joseph, MO; 1X PBS

see tissue culture section above). Both eyes were injected with 0.5 µl full AAV particles at 4 x 1011 genomes per µl. The right eye received ATP6m252rz and the left eye got

ATP6m252rev.

Electroretinograms

For electroretinograms (ERGs)(Timmers et al., 2001) mice were dark-adapted overnight and anesthetized with a 1:1:5 ratio of ketamine:xylazine:PBS. Eyes were dilated with phenylephrine and given a topical anesthetic, proparacaine (Akorn; Buffalo

Grove, IL). Mice were positioned in a dome with a ground electrode in their hind thigh, reference electrode in the back of the neck and contact electrodes kept in contact with each eye with hydroxypropyl methylcellulose (Gonak from Eye Supply USA, Inc.;

Tampa, FL). Flashes of light were given with increasing intensity from 0.01 up to 10,000 mCandela/mm2 (TONNIES). The electrical responses were averaged from ten flashes for

each intensity of light. After removing electrodes, mouse eyes were moistened with the

antibacterial, vetropolycin (Pharmaderm, Melville, NY).

Sectioning of Mouse Eyes

For sectioning of eyes, mice were euthenized with an overdose of carbon dioxide or

ketamine and xylazine followed by cervical dislocation. Eyes were removed from the

mice and fixed with 4% glutaraldehyde. The corneas and lenses were removed. The

eyes were dehydrated with increasing percentages of ethanol and then immersed in

increasing percentages of polyester wax from Electron Microscopy Sciences (Fort

Washington, PA). Wax was cooled and eyes were sectioned every 8 to 10 µm. Sections were stained with hematoxylin (1.5 min) and eosin (1 sec).

CHAPTER 4 DISCUSSION

In Vitro Ribozyme Assays

Both ATP6m252 and ATP6m69 ribozymes were shown to cleave short RNA molecules consisting solely of the corresponding target sequence (Fig. 2-3). Preliminary results indicate that the ribozymes were also capable of cleaving the full length ATP6 mRNA in the presence of other mitochondrial RNA (Fig. 2-5). Both of these experiments used ribozyme molecules without the upstream 5S rRNA sequence or any extra nucleotides at the 3’ end. When the ribozyme was transcribed with the upstream 5S rRNA sequence, it was still active on its short target in vitro (Alfred Lewin, unpublished).

Whether the ribozyme is active in the environment of the mitochondria still remains to be seen. Although evidence for the functionality of the ribozymes in cultured cells is lacking, the amount of ribozyme delivered to the mitochondria could be insufficient. Another way the ribozyme activity could be tested would be in isolated mitochondria. The 5S-ribozyme could be transcribed in vitro, and the amount added to the mitochondria could be controlled better than is possible in cultured cells. ATP and the soluble factors required for 5S rRNA import (Entelis et al., 2001a) would have to be added in addition to the magnesium required for ribozyme folding (Curtis and Bartel,

2001; Murray and Scott, 2000). Only 1% of the 5S-ribozyme would be expected to get into the mitochondria, but adding more 5S-ribozyme could easily increase the number of molecules imported. Isolated mitochondria have been shown to be functional with respect to oxidative phosphorylation, so they should provide an environment similar

87 88 though not identical to that of intact cell mitochondria (Villani et al., 1998). Even though mitochondria concentrate divalent cations, the mitochondrial membranes are permeable to small molecules and they contain an adenine nucleotide exchange protein, so molecules such as ATP and magnesium may not be retained in isolated mitochondria

(Pauptit et al., 1991). With respect to these small molecules, the isolated mitochondria would not resemble the in vivo environment.

Studies on Total Transfected Mouse Cells

No significant reproducible defect was seen due to the ribozymes in transiently transfected or total G418-selected cells. This could be due, in part, to low transfection efficiencies. If higher levels of ribozyme expression could be achieved, the more copies of the ribozyme would be imported into the mitochondria and could be more effective. It is also possible that the 5S rRNA ribozyme or reverse transcript is toxic to cells, and the few cells that get higher levels of ribozyme expression are never seen. The reduction in

ATP6 alone should not be toxic to cells, because cells completely lacking mitochondrial

DNA can survive when pyruvate and uridine are present in the media (Ziegler and

Davidson, 1981). It is possible that the ribozymes also target a nuclear gene, although no exact matches were found when searched with BLAST (McGinnis and Madden, 2004).

The 5S rRNA with extra sequence itself could be toxic if it is incorporated into cytoplasmic ribosomes, however no evidence for this was detected.

A difference between transfected and mock-transfected cells was seen three times.

Mock-transfected cells from the first transfection had reduced ATP synthesis activity

(Table 2-2) and were not able to grow in galactose with oligomycin as well as the transfected cells (Fig. 2-7). In the third transfection, the mock-transfected cells were more resistant to cyanide-induced cell death (Fig. 2-8). Cyanide induced death is

89 believed to be related to the generation of reactive oxygen species by the mitochondrial electron transport chain (ATP Synthesis and Cyanide Resistance section below), so that increased sensitivity may indicated increased respiratory activity. In all three cases the transfected cells had been selected with G418 and the mock-transfected cells had not been selected. It appears that either the transfection or selection process caused an up regulation of oxidative phosphorylation complexes resulting in resistance to oligomycin when grown in galactose and sensitivity to cyanide when grown in glucose. G418 acts by inhibiting protein synthesis (Eustice and Wilhelm, 1984; Hayashi et al., 1982) and causing misreading of codons (Cavallo and Martinetto, 1981) in both prokaryotes and eukaryotes. It is possible that the cells initially responded by up regulating gene expression and some of the surviving cells maintained these levels. Again, this is not due to the ribozyme itself, because the cells transfected with m252rev had the same phenotype.

When total G418-selected transfected cells were assayed in galactose without oligomycin (Fig. 2-9), mock-transfected cells were not tested, but the

ATP6m69rz-transfected cells may have grown slower than the ATP6m252rz- or three control-transfected cells. The cells grew significantly slower in galactose than glucose, but not significantly slower than the other cells in galactose. The experiment was repeated in duplicate with the first experiment showing more of a difference than the second experiment. This experiment could be repeated again to be sure, but it was done previously on cells from the first transfection, and no difference was seen.

The only ATP synthesis assay done on total selected cells used succinate for a substrate. Complex I-dependent ATP synthesis, using pyruvate and malate as substrates,

was not measured. Although some of the clonal isolates had a complex I defect, this was

not the phenotype expected. If the ribozyme were successful in down regulating ATP6

levels sufficiently, a decrease in both complex I- and complex II-dependent ATP

synthesis would be expected. Therefore, measuring the rate of ATP synthesis using

pyruvate and malate would not help in identifying the phenotype of interest, when succinate-dependent rates of ATP synthesis have already been measured. It should be

noted, however, that cells harboring a mutation in ATP6 were better able to synthesize

ATP using succinate as a substrate than using pyruvate and malate, although both rates

were reduced compared to wild type cells (Manfredi et al., 2002). Therefore, it may be

easier to detect a difference using malate and pyruvate. The results of Manfredi et al.

suggest that defects in complex V, the ATP synthase, may affect the activity of complex I

either directly, through the assembly membrane protein complexes, or indirectly, through

the proton electrochemical gradient across the mitochondrial inner membrane. Manfredi

et al. favor the latter interpretation.

Cell Culture Studies on Mouse Clonal Isolates

Measurements by RT-PCR

Concerning the levels of ribozyme and mRNA expression, all values are ratios

compared to an internal standard. No conclusions can be drawn about the absolute

amount of these transcripts. Even when comparing to the standard, the efficiency of the

primers and size of the PCR product must be taken into account. The ratios calculated can be used only to compare the levels of a certain transcript between clonal isolates.

Additionally, RT-PCR performed at different times may not be comparable due to degradation of RNA and primers. Attempts were made to assay all relevant samples side

by side with fresh RNA, but this was not always possible. For example, the two sets of

colonies from transfections one and four were analyzed separately.

In order to quantitate the absolute numbers of ribozyme molecules, the ribozyme

PCR products would have to be compared to a known standard. In vitro-transcribed and

radio-labeled ribozyme could be used as the RT-PCR template for calibration. The

number of cells from which the RNA was extracted or the amount of another RNA would

also have to be calculated accurately to express the number as molecules of ribozyme per

cell or per molecule target RNA. The number of ribozyme molecules could be compared

to the amount of endogenous 5S rRNA for which the number of molecules per cell has

been quantitated (Entelis et al., 2001a).

Mitochondrial RNA Levels and Growth in Galactose

Only one of the colonies tested had a decrease in mitochondrial RNA levels.

Colony ATP6m252rz1 had a decrease in ATP6 as well as four other mitochondrial

mRNAs. The apparent global down regulation of mitochondrial RNAs in and of itself

does not point to the specific cleavage of ATP6 by the ribozyme, although it could be an

indirect effect. None of the other colonies with galactose growth and ATP synthesis

defects had detectable reduction of any mRNA levels, further refuting the ribozyme as

the cause of the reduced levels of mitochondrial RNAs in m252rz1.

The m252rz1 colony could have a different defect leading to the same galactose

and ATP synthesis phenotypes as the other colonies, or it could have two defects. The

unique defect is likely a random mutation and not a direct result of transfection, selection

or colony isolation. However, these processes do place stress on the cells and could lead

to a general increased mutation rate. Cloning and expansion could also have isolated

cells that already had a mutation. Considering the frequency with which the galactose

growth defect was seen, it should have been detectable in total selected cells if it were

caused by the selection process. Since it was not seen in total selected cells, this suggests

that the isolation of colonies may have selected for cells with this phenotype. Not all

cultured cells are able to form colonies. Although NIH3T3 cells can normally form

colonies, if a variable population exists, this process could provide selective pressure

against cells that have lost this ability or those that expand more slowly. How the defect

in galactose growth could be associated with a selective advantage for clonal expansion

in glucose is not understood.

There was also another colony, m252rz6, with high ribozyme expression equal to

that of m252rz1 and no decrease in ATP6 or death in galactose. Another colony,

m252rev10, with an intermediate galactose growth phenotype and slightly reduced levels

of ATP6 contained the reversed ribozyme sequence. One could speculate that the 5S

transcript is toxic to mitochondria, but this colony had low levels of this transcript. Many

other colonies with higher levels of ribozyme or reverse transcripts had no phenotype.

Unlike ATP6m252rz1 and m252rev10 from the first set of colonies, the cells that died in

galactose from the colonies designated with Roman numerals had no decrease in ATP6

levels. Whatever defect caused the inability to grow in galactose must not have affected

ATP6 mRNA levels.

ATP Synthesis and Cyanide Resistance

Although one of the subunits of complex IV and ATP6 of complex V were shown to be reduced in colony m252rz1 by RT-PCR, this did not lead to a detectable decrease in complex II-dependent ATP synthesis. This could be due to an excess of cytochrome oxidase and ATP synthase activity present in normal cells, although the excess of cytochrome oxidase has been shown to be small in intact cells (Villani and Attardi,

1997). Complex I has been shown to be the rate-limiting complex for ATP synthesis

(Villani and Attardi, 1997). Therefore, it would be possible for a moderate decrease in all mitochondrial RNA to only result in a defect in complex I activity.

The defect in complex I-dependent ATP synthesis correlated with the defect in galactose growth for all of the colonies tested. This implies that the defect that led to this phenotype could be the same in all cases. Unfortunately, the phenotype did not correlate with ribozyme expression, so the ribozyme was not the cause. Although the galactose growth defect is consistent with the phenotype of ATP synthase-defective cells, they should also have a defect in complex II and not just complex I if it were caused by the ribozyme. Since screening by growth in galactose resulted in all false positives, it may not be the best assay to use for screening. A small decrease in ATP synthesis may not necessarily produce a detectable galactose growth defect (Mattiazzi et al., 2004).

Unfortunately, the ATP synthesis assay is not conducive to screening large numbers of samples due to the large numbers of cells required and the variability in luciferase activity over time. Initial screening by measuring ATP6 mRNA or ribozyme levels is reasonable for large numbers of samples. Measuring ATP6 protein levels may be more relevant, but there is no commercially available antibody.

Colony ATP6m252rz1 was shown to be resistant to cyanide-induced cell death when grown in glucose medium (Fig. 2-15). Cyanide has been shown to cause apoptosis by inhibiting cytochrome oxidase, which causes a backup of electrons in the respiratory chain and generation of oxygen radicals primarily from complex I (Chen et al., 2003;

Bhattacharya and Lakshmana Rao, 2001). The reactive oxygen species contribute to the loss of membrane potential resulting in release of cytochrome c and initiation of

apoptosis (Shou et al., 2003). Since cells were grown in glucose, the loss of ATP

production due to cyanide would not affect cell viability. It is possible that the levels of

all of the respiratory chain complexes were reduced in this stable cells line, which is

supported by the reduced RNA levels seen (Fig. 2-11 and 2-12). If there was less

electron transport to be blocked by the addition of cyanide, fewer reactive oxygen species

may have been produced. Additionally or alternatively, the mutation that caused the

complex I-dependent ATP synthesis defect could also have prevented the generation of

reactive oxygen species from complex I. Reduced production of oxygen radicals could

explain why the m252rz1 cells took longer to die that the other cells. The oxidative

damage would still accumulate, but at a slower rate.

Human Cell Transfection Studies

Transfection Toxicity

In transiently transfected human cells no difference was visible between growth in

galactose and glucose. When grown in cyanide, however, the cells that were transfected

more efficiently were more sensitive to cyanide. This was especially noticeable when the

cells were assayed one day post transfection (Fig. 2-21), and is therefore likely due to

toxicity from the transfection. When the cells were allowed to recover for two extra

days, less cell death was seen (Fig. 2-20). When the ATP6 and COX2 mRNA levels

were measured five days post transfection, the transfected cells had lower levels of

mitochondrial RNA than the untransfected cells (Fig. 2-21). A decrease in mitochondrial

RNA levels as seen in mouse colony ATP6m252rz1 would lead to increased resistance to cyanide. Since this is not what was seen, the sensitivity to cyanide is more likely due to a general sensitivity to stress. This cyanide sensitivity is the opposite of what was seen in the total selected mouse cells. The mouse cells had a chance to recover from the

transfection and were also subjected to selection with G418. The G418 selection could

have selected not only for cells that were transfected, but for those more resistant to

stress.

The third transfection mouse cells provide and interesting intermediate. They were

selected with G418 for only two or three days starting Day 2 post transfection. They

were grown in cyanide beginning on Day 4 or Day 5 post transfection. They were not

compared to untransfected cells due to the days spent in G418, but their relative

transfection efficiencies were estimated by continued growth of some of the cells in

G418. No correlation was seen between the transfection efficiencies and cyanide

resistance, but rather both of the ribozymes were more resistant to cyanide than the

reverse control. Based on the G418 selection, the ribozyme transfection efficiencies were either greater or equal to those of the reverse, and the ribozyme with the greater transfection efficiency was less resistant to cyanide. Unfortunately, cyanide resistance was not the phenotype expected from ribozymes targeted to ATP6, and in the absence of other phenotypes this does not suggest that the ribozymes are functional.

5S-ATP8/6 Toxicity

One concern with using the 5S ribosomal RNA to deliver ribozymes is that the extra sequence attached to the 5S rRNA could be toxic to cells. There was no evidence suggesting that the ribozyme attached to the 5S rRNA in either orientation was detrimental to cells. When the entire mouse ATP8 and ATP6 mRNA sequence was attached to the 5S rRNA, however, some evidence for a toxic effect was seen in human cells. This could be due to the RNA or the protein, considering that it is a mouse protein in human cells. Considering the amount of ribozyme detectable in the mitochondria, it is unlikely that enough protein could be made to be toxic.

Interestingly, the 5S-ATP8/6 toxicity was specific to HeLa cells. RNA extracted from HeLa cells one or four days post transfection was devoid of detectable 5S-ATP8/6 transcripts, whereas its presence was detected in 293 cells. Although the ATP8/6 RNA was undetectable in HeLa cells, the DNA was present suggesting the cells transfected with the construct may not all have died, but only shut down expression of the

5S-ATP8/6 from the plasmid. If the neomycin-resistance gene was also not expressed, it would still be consistent with the paucity of surviving cells after G418 selection in HeLa cells. The ATP8/6-transfected 293 cells survived selection with G418. There is no apparent reason why the 5S-ATP8/6 should react differently with these two cells lines.

Localization of Ribozymes to the Mitochondria

The 5S-m69rz RNA was shown to be present in the mitochondria. Detecting its presence proved difficult, apparently due to its low levels in the mitochondria. The endogenous 5S rRNA is more abundant, with tens of thousands of copies in the mitochondria of one cell (Entelis et al., 2001a), but it is difficult to deliver enough ribozyme by transfection to match these levels. The levels achieved may not be sufficient to affect the comparatively high mitochondrial RNA levels. Alternatively, these ribozymes may not be active within mitochondria. The ribozymes were shown to be active in vitro, but they may not work in cells. Ribozyme activity could be tested in the cytoplasm by cotransfection of the target with the ribozyme, but this still would not prove that the ribozyme would work in the mitochondria.

Injection of Mice

At a time when the cell culture results looked promising, mice were injected subretinally with one of the ribozymes. Even if the ribozymes did not work in tissue culture, they could still work in vivo. It may be possible to get more copies of the

97 ribozyme into retinal cells. Photoreceptors are non-dividing, so the ribozyme would not be diluted out through cell division. On the other hand, because of their large energy requirement, they have more mitochondria than cultured cells, so even more ribozyme may be required to cause a phenotype. Since no consistent effect was seen, either not enough ribozyme could be delivered or the ribozyme is not effective in vivo.

Other Means to an End

Since this project was started, other techniques have been developed for manipulating mitochondrial gene expression. Of interest to this project, DNA has been successfully introduced into the mitochondria of cells by a method termed protofection

(Khan and Bennett, Jr., 2004). Entire mitochondrial genomes were complexed with a modified mitochondrial transcription factor, TFAM, and introduced into cells. The

TFAM contained a protein transduction domain from the TAT protein from HIV (Vives et al., 1997), that allows it to efficiently cross cell membranes. It also contained a signal sequence for mitochondrial import, and was capable of carrying the mtDNA across both membranes (Khan and Bennett, Jr., 2004).

To more accurately model mitochondrial diseases, introduction of mtDNA containing the associated mutation would be ideal. As protofection now appears to make this feasible, it would be a better way to attempt to model NARP than with a ribozyme method. Alternatively, protofection could be used to deliver the ribozymes to the mitochondria. The question of whether ribozymes could work in the mitochondria might be answered this way, but introduction of the mutant DNA would still be a better way to model NARP.

LIST OF REFERENCES

Abe,Y., Shodai,T., Muto,T., Mihara,K., Torii,H., Nishikawa,S., Endo,T., and Kohda,D. (2000). Structural basis of presequence recognition by the mitochondrial protein import receptor Tom20. Cell 100, 551-560.

Abrahams,J.P., Leslie,A.G., Lutter,R., and Walker,J.E. (1994). Structure at 2.8 A resolution of F1-ATPase from bovine heart mitochondria. Nature 370, 621-628.

Adhya,S., Ghosh,T., Das,A., Bera,S.K., and Mahapatra,S. (1997). Role of an RNA- binding protein in import of tRNA into Leishmania mitochondria. J. Biol. Chem. 272, 21396-21402.

Agostino,A., Valletta,L., Chinnery,P.F., Ferrari,G., Carrara,F., Taylor,R.W., Schaefer,A.M., Turnbull,D.M., Tiranti,V., and Zeviani,M. (2003). Mutations of ANT1, Twinkle, and POLG1 in sporadic progressive external ophthalmoplegia (PEO). Neurology 60, 1354-1356.

Alam,T.I., Kanki,T., Muta,T., Ukaji,K., Abe,Y., Nakayama,H., Takio,K., Hamasaki,N., and Kang,D. (2003). Human mitochondrial DNA is packaged with TFAM. Nucleic Acids Res. 31, 1640-1645.

Aloni,Y. and Attardi,G. (1971). Expression of the mitochondrial genome in HeLa cells. II. Evidence for complete transcription of mitochondrial DNA. J. Mol. Biol. 55, 251-267.

Amalric,F., Merkel,C., Gelfand,R., and Attardi,G. (1978). Fractionation of mitochondrial RNA from HeLa cells by high-resolution electrophoresis under strongly denaturing conditions. J. Mol. Biol. 118, 1-25.

Ames,B.N., Shigenaga,M.K., and Gold,L.S. (1993). DNA lesions, inducible DNA repair, and cell division: three key factors in mutagenesis and carcinogenesis. Environ. Health Perspect. 101 Suppl 5, 35-44.

Anderson,S., Bankier,A.T., Barrell,B.G., de Bruijn,M.H., Coulson,A.R., Drouin,J., Eperon,I.C., Nierlich,D.P., Roe,B.A., Sanger,F., Schreier,P.H., Smith,A.J., Staden,R., and Young,I.G. (1981). Sequence and organization of the human mitochondrial genome. Nature 290, 457-465.

Andersson,S.G., Zomorodipour,A., Andersson,J.O., Sicheritz-Ponten,T., Alsmark,U.C., Podowski,R.M., Naslund,A.K., Eriksson,A.S., Winkler,H.H., and Kurland,C.G. (1998). The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 396, 133-140.

98 99

Attardi,G., Chomyn,A., King,M.P., Kruse,B., Polosa,P.L., and Murdter,N.N. (1990). Regulation of mitochondrial gene expression in mammalian cells. Biochem. Soc. Trans. 18, 509-513.

Attardi,G. and Schatz,G. (1988). Biogenesis of mitochondria. Annu. Rev. Cell Biol. 4, 289-333.

Auricchio,A., Kobinger,G., Anand,V., Hildinger,M., O'Connor,E., Maguire,A.M., Wilson,J.M., and Bennett,J. (2001). Exchange of surface proteins impacts on viral vector cellular specificity and transduction characteristics: the retina as a model. Hum. Mol. Genet. 10, 3075-3081.

Awadalla,P., Eyre-Walker,A., and Smith,J.M. (1999). Linkage disequilibrium and recombination in hominid mitochondrial DNA. Science 286, 2524-2525.

Babcock,G.T. and Wikstrom,M. (1992). Oxygen activation and the conservation of energy in cell respiration. Nature 356, 301-309.

Balague,C., Kalla,M., and Zhang,W.W. (1997). Adeno-associated virus Rep78 protein and terminal repeats enhance integration of DNA sequences into the cellular genome. J. Virol. 71, 3299-3306.

Baracca,A., Barogi,S., Carelli,V., Lenaz,G., and Solaini,G. (2000). Catalytic activities of mitochondrial ATP synthase in patients with mitochondrial DNA T8993G mutation in the ATPase 6 gene encoding subunit a. J. Biol. Chem. 275, 4177-4182.

Bartkiewicz,M., Gold,H., and Altman,S. (1989). Identification and characterization of an RNA molecule that copurifies with RNase P activity from HeLa cells. Genes Dev. 3, 488-499.

Bennett,J.L. and Clayton,D.A. (1990). Efficient site-specific cleavage by RNase MRP requires interaction with two evolutionarily conserved mitochondrial RNA sequences. Mol. Cell Biol. 10, 2191-2201.

Bhattacharya,R. and Lakshmana Rao,P.V. (2001). Pharmacological interventions of cyanide-induced cytotoxicity and DNA damage in isolated rat thymocytes and their protective efficacy in vivo. Toxicol. Lett. 119, 59-70.

Bhattacharyya,S.N., Chatterjee,S., Goswami,S., Tripathi,G., Dey,S.N., and Adhya,S. (2003). "Ping-pong" interactions between mitochondrial tRNA import receptors within a multiprotein complex. Mol. Cell Biol. 23, 5217-5224.

Bhattacharyya,S.N., Mukherjee,S., and Adhya,S. (2000). Mutations in a tRNA import signal define distinct receptors at the two membranes of Leishmania mitochondria. Mol. Cell Biol. 20, 7410-7417.

Birikh,K.R., Heaton,P.A., and Eckstein,F. (1997). The structure, function and application of the hammerhead ribozyme. Eur. J. Biochem. 245, 1-16.

100

Birky,C.W., Jr. (2001). The inheritance of genes in mitochondria and chloroplasts: laws, mechanisms, and models. Annu. Rev. Genet. 35, 125-148.

Bowmaker,M., Yang,M.Y., Yasukawa,T., Reyes,A., Jacobs,H.T., Huberman,J.A., and Holt,I.J. (2003). Mammalian mitochondrial DNA replicates bidirectionally from an initiation zone. J. Biol. Chem. 278, 50961-50969.

Boyer,P.D. (1993). The binding change mechanism for ATP synthase--some probabilities and possibilities. Biochim. Biophys. Acta 1140, 215-250.

Boyer,P.D. (1997). The ATP synthase--a splendid molecular machine. Annu. Rev. Biochem. 66, 717-749.

Boyer,P.D., Stokes,B.O., Wolcott,R.G., and Degani,C. (1975). Coupling of "high- energy" phosphate bonds to energy transductions. Fed. Proc. 34, 1711-1717.

Brandt,U. (1997). Proton-translocation by membrane-bound NADH:ubiquinone- oxidoreductase (complex I) through redox-gated ligand conduction. Biochim. Biophys. Acta 1318, 79-91.

Brazzolotto,X., Gaillard,J., Pantopoulos,K., Hentze,M.W., and Moulis,J.M. (1999). Human cytoplasmic aconitase (Iron regulatory protein 1) is converted into its [3Fe-4S] form by hydrogen peroxide in vitro but is not activated for iron-responsive element binding. J. Biol. Chem. 274, 21625-21630.

Breen,G.A., Miller,D.L., Holmans,P.L., and Welch,G. (1986). Mitochondrial DNA of two independent oligomycin-resistant Chinese hamster ovary cell lines contains a single nucleotide change in the ATPase 6 gene. J. Biol. Chem. 261, 11680-11685.

Brix,J., Dietmeier,K., and Pfanner,N. (1997). Differential recognition of preproteins by the purified cytosolic domains of the mitochondrial import receptors Tom20, Tom22, and Tom70. J. Biol. Chem. 272, 20730-20735.

Bu,X.D. and Rotter,J.I. (1991). X chromosome-linked and mitochondrial gene control of Leber hereditary optic neuropathy: evidence from segregation analysis for dependence on X chromosome inactivation. Proc. Natl. Acad. Sci. U. S. A 88, 8198-8202.

Cain,B.D. and Simoni,R.D. (1988). Interaction between Glu-219 and His-245 within the a subunit of F1F0-ATPase in Escherichia coli. J. Biol. Chem. 263, 6606-6612.

Cain,B.D. and Simoni,R.D. (1989). Proton translocation by the F1F0ATPase of Escherichia coli. Mutagenic analysis of the a subunit. J. Biol. Chem. 264, 3292-3300.

Cantatore,P. and Attardi,G. (1980). Mapping of nascent light and heavy strand transcripts on the physical map of HeLa cell mitochondrial DNA. Nucleic Acids Res. 8, 2605-2625.

101

Carelli,V., Giordano,C., and d'Amati,G. (2003). Pathogenic expression of homoplasmic mtDNA mutations needs a complex nuclear-mitochondrial interaction. Trends Genet. 19, 257-262.

Carelli,V., Ross-Cisneros,F.N., and Sadun,A.A. (2002). Optic nerve degeneration and mitochondrial dysfunction: genetic and acquired optic neuropathies. Neurochem. Int. 40, 573-584.

Carrozzo,R., Murray,J., Santorelli,F.M., and Capaldi,R.A. (2000). The T9176G mutation of human mtDNA gives a fully assembled but inactive ATP synthase when modeled in Escherichia coli. FEBS Lett. 486, 297-299.

Carrozzo,R., Rizza,T., Lucioli,S., Pierini,R., Bertini,E., and Santorelli,F.M. (2004). A mitochondrial ATPase 6 mutation is associated with Leigh syndrome in a family and affects proton flow and adenosine triphosphate output when modeled in Escherichia coli. Acta Paediatr. Suppl. 93, 65-67.

Cavallo,G. and Martinetto,P. (1981). The mechanism of action of aminoglycosides. G. Batteriol. Virol. Immunol. 74, 335-346.

Chamberlain,J.R., Lee,Y., Lane,W.S., and Engelke,D.R. (1998). Purification and characterization of the nuclear RNase P holoenzyme complex reveals extensive subunit overlap with RNase MRP. Genes Dev. 12, 1678-1690.

Chang,D.D. and Clayton,D.A. (1985). Priming of human mitochondrial DNA replication occurs at the light-strand promoter. Proc. Natl. Acad. Sci. U. S. A 82, 351-355.

Chang,D.D. and Clayton,D.A. (1987a). A mammalian mitochondrial RNA processing activity contains nucleus-encoded RNA. Science 235, 1178-1184.

Chang,D.D. and Clayton,D.A. (1987b). A novel endoribonuclease cleaves at a priming site of mouse mitochondrial DNA replication. EMBO J. 6, 409-417.

Chang,D.D. and Clayton,D.A. (1989). Mouse RNAase MRP RNA is encoded by a nuclear gene and contains a decamer sequence complementary to a conserved region of mitochondrial RNA substrate. Cell 56, 131-139.

Chen,Q., Vazquez,E.J., Moghaddas,S., Hoppel,C.L., and Lesnefsky,E.J. (2003). Production of reactive oxygen species by mitochondria: central role of complex III CHEN2003. J. Biol. Chem. 278, 36027-36031.

Chiu,N., Chiu,A., and Suyama,Y. (1974). Three isoaccepting forms of leucyl transfer RNA in mitochondria. J. Mol. Biol. 82, 441-457.

Chiu,N., Chiu,A., and Suyama,Y. (1975). Native and imported transfer RNA in mitochondria. J. Mol. Biol. 99, 37-50.

Clayton,D.A. (1982). Replication of animal mitochondrial DNA. Cell 28, 693-705.

102

Clayton,D.A. (1994). A nuclear function for RNase MRP. Proc. Natl. Acad. Sci. U. S. A 91, 4615-4617.

Clayton,D.A., Doda,J.N., and Friedberg,E.C. (1975). Absence of a pyrimidine dimer repair mechanism for mitochondrial DNA in mouse and human cells. Basic Life Sci. 5B, 589-591.

Clouet-d'Orval,B. and Uhlenbeck,O.C. (1997). Hammerhead ribozymes with a faster cleavage rate. Biochemistry 36, 9087-9092.

Cooper,J.M., Mann,V.M., and Schapira,A.H. (1992). Analyses of mitochondrial respiratory chain function and mitochondrial DNA deletion in human skeletal muscle: effect of ageing. J. Neurol. Sci. 113, 91-98.

Corral-Debrinski,M., Stepien,G., Shoffner,J.M., Lott,M.T., Kanter,K., and Wallace,D.C. (1991). Hypoxemia is associated with mitochondrial DNA damage and gene induction. Implications for cardiac disease. JAMA 266, 1812-1816.

Cortopassi,G.A. and Arnheim,N. (1990). Detection of a specific mitochondrial DNA deletion in tissues of older humans. Nucleic Acids Res. 18, 6927-6933.

Cox,G.B., Fimmel,A.L., Gibson,F., and Hatch,L. (1986). The mechanism of ATP synthase: a reassessment of the functions of the b and a subunits. Biochim. Biophys. Acta 849, 62-69.

Curgy,J.J. (1985). The mitoribosomes. Biol. Cell 54, 1-38.

Curtis,E.A. and Bartel,D.P. (2001). The hammerhead cleavage reaction in monovalent cations. RNA. 7, 546-552.

Daga,A., Micol,V., Hess,D., Aebersold,R., and Attardi,G. (1993). Molecular characterization of the transcription termination factor from human mitochondria. J. Biol. Chem. 268, 8123-8130.

Dahl,H.H. (1998). Getting to the nucleus of mitochondrial disorders: identification of respiratory chain-enzyme genes causing Leigh syndrome. Am. J. Hum. Genet. 63, 1594- 1597.

Davey,G.P. and Clark,J.B. (1996). Threshold effects and control of oxidative phosphorylation in nonsynaptic rat brain mitochondria. J. Neurochem. 66, 1617-1624.

Dekker,P.J., Martin,F., Maarse,A.C., Bomer,U., Muller,H., Guiard,B., Meijer,M., Rassow,J., and Pfanner,N. (1997). The Tim core complex defines the number of mitochondrial translocation contact sites and can hold arrested preproteins in the absence of matrix Hsp70-Tim44. EMBO J. 16, 5408-5419.

103

Dekker,P.J., Ryan,M.T., Brix,J., Muller,H., Honlinger,A., and Pfanner,N. (1998). Preprotein translocase of the outer mitochondrial membrane: molecular dissection and assembly of the general import pore complex. Mol. Cell Biol. 18, 6515-6524.

DeLuca,M., Wannlund,J., and McElroy,W.D. (1979). Factors affecting the kinetics of light emission from crude and purified firefly luciferase. Anal. Biochem. 95, 194-198.

Devenish,R.J., Prescott,M., Roucou,X., and Nagley,P. (2000). Insights into ATP synthase assembly and function through the molecular genetic manipulation of subunits of the yeast mitochondrial enzyme complex. Biochim. Biophys. Acta 1458, 428-442.

Dietmeier,K., Honlinger,A., Bomer,U., Dekker,P.J., Eckerskorn,C., Lottspeich,F., Kubrich,M., and Pfanner,N. (1997). Tom5 functionally links mitochondrial preprotein receptors to the general import pore. Nature 388, 195-200.

DiMauro,S. and Schon,E.A. (2001). Mitochondrial DNA mutations in human disease. Am. J. Med. Genet. 106, 18-26.

Doersen,C.J., Guerrier-Takada,C., Altman,S., and Attardi,G. (1985). Characterization of an RNase P activity from HeLa cell mitochondria. Comparison with the cytosol RNase P activity. J. Biol. Chem. 260, 5942-5949.

Donzeau,M., Kaldi,K., Adam,A., Paschen,S., Wanner,G., Guiard,B., Bauer,M.F., Neupert,W., and Brunner,M. (2000). Tim23 links the inner and outer mitochondrial membranes. Cell 101, 401-412.

Drenser,K.A., Timmers,A.M., Hauswirth,W.W., and Lewin,A.S. (1998). Ribozyme- targeted destruction of RNA associated with autosomal-dominant retinitis pigmentosa. Invest Ophthalmol. Vis. Sci. 39, 681-689.

Dubin,D.T., Montoya,J., Timko,K.D., and Attardi,G. (1982). Sequence analysis and precise mapping of the 3' ends of HeLa cell mitochondrial ribosomal RNAs. J. Mol. Biol. 157, 1-19.

Dubot,A., Godinot,C., Dumur,V., Sablonniere,B., Stojkovic,T., Cuisset,J.M., Vojtiskova,A., Pecina,P., Jesina,P., and Houstek,J. (2004). GUG is an efficient initiation codon to translate the human mitochondrial ATP6 gene. Biochem. Biophys. Res. Commun. 313, 687-693.

Duncan,T.M., Zhou,Y., Bulygin,V.V., Hutcheon,M.L., and Cross,R.L. (1995). Probing interactions of the Escherichia coli F0F1 ATP synthase beta and gamma subunits with disulphide cross-links. Biochem. Soc. Trans. 23, 736-741.

Elston,T., Wang,H., and Oster,G. (1998). Energy transduction in ATP synthase. Nature 391, 510-513.

104

Enerback,S., Jacobsson,A., Simpson,E.M., Guerra,C., Yamashita,H., Harper,M.E., and Kozak,L.P. (1997). Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387, 90-94.

Enriquez,J.A., Chomyn,A., and Attardi,G. (1995). MtDNA mutation in MERRF syndrome causes defective aminoacylation of tRNA(Lys) and premature translation termination. Nat. Genet. 10, 47-55.

Entelis,N.S., Kieffer,S., Kolesnikova,O.A., Martin,R.P., and Tarassov,I.A. (1998). Structural requirements of tRNALys for its import into yeast mitochondria. Proc. Natl. Acad. Sci. U. S. A 95, 2838-2843.

Entelis,N.S., Kolesnikova,O.A., Dogan,S., Martin,R.P., and Tarassov,I.A. (2001a). 5 S rRNA and tRNA import into human mitochondria - Comparison of in vitro requirements. J. Biol. Chem. 276, 45642-45653.

Entelis,N.S., Kolesnikova,O.A., Martin,R.P., and Tarassov,I.A. (2001b). RNA delivery into mitochondria. Adv. Drug Deliv. Rev. 49, 199-215.

Entelis,N.S., Krasheninnikov,I.A., Martin,R.P., and Tarassov,I.A. (1996). Mitochondrial import of a yeast cytoplasmic tRNA (Lys): possible roles of aminoacylation and modified nucleosides in subcellular partitioning. FEBS Lett. 384, 38-42.

Esposito,L.A., Kokoszka,J.E., Waymire,K.G., Cottrell,B., MacGregor,G.R., and Wallace,D.C. (2000). Mitochondrial oxidative stress in mice lacking the glutathione peroxidase-1 gene. Free Radic. Biol. Med. 28, 754-766.

Eustice,D.C. and Wilhelm,J.M. (1984). Mechanisms of action of aminoglycoside antibiotics in eucaryotic protein synthesis. Antimicrob. Agents Chemother. 26, 53-60.

Eyre-Walker,A. (2000). Do mitochondria recombine in humans? Philos. Trans. R. Soc. Lond B Biol. Sci. 355, 1573-1580.

Eyre-Walker,A., Smith,N.H., and Smith,J.M. (1999). How clonal are human mitochondria? Proc. Biol. Sci. 266, 477-483.

Falkenberg,M., Gaspari,M., Rantanen,A., Trifunovic,A., Larsson,N.G., and Gustafsson,C.M. (2002). Mitochondrial transcription factors B1 and B2 activate transcription of human mtDNA. Nat. Genet. 31, 289-294.

Farrell,L.B., Gearing,D.P., and Nagley,P. (1988). Reprogrammed expression of subunit 9 of the mitochondrial ATPase complex of Saccharomyces cerevisiae. Expression in vitro from a chemically synthesized gene and import into isolated mitochondria. Eur. J. Biochem. 173, 131-137.

Farrelly,F. and Butow,R.A. (1983). Rearranged mitochondrial genes in the yeast nuclear genome. Nature 301, 296-301.

105

Fernandez-Silva,P., Enriquez,J.A., and Montoya,J. (2003). Replication and transcription of mammalian mitochondrial DNA. Exp. Physiol 88, 41-56.

Fernandez-Silva,P., Martinez-Azorin,F., Micol,V., and Attardi,G. (1997). The human mitochondrial transcription termination factor (mTERF) is a multizipper protein but binds to DNA as a monomer, with evidence pointing to intramolecular leucine zipper interactions. EMBO J. 16, 1066-1079.

Fillingame,R.H. (1997). Coupling H+ transport and ATP synthesis in F1F0-ATP synthases: glimpses of interacting parts in a dynamic molecular machine. J. Exp. Biol. 200, 217-224.

Finel,M., Skehel,J.M., Albracht,S.P., Fearnley,I.M., and Walker,J.E. (1992). Resolution of NADH:ubiquinone oxidoreductase from bovine heart mitochondria into two subcomplexes, one of which contains the redox centers of the enzyme. Biochemistry 31, 11425-11434.

Fish,J., Raule,N., and Attardi,G. (2004). Discovery of a major D-loop replication origin reveals two modes of human mtDNA synthesis. Science 306, 2098-2101.

Fisher,R.P. and Clayton,D.A. (1988). Purification and characterization of human mitochondrial transcription factor 1. Mol. Cell Biol. 8, 3496-3509.

Fisher,R.P., Lisowsky,T., Parisi,M.A., and Clayton,D.A. (1992). DNA wrapping and bending by a mitochondrial high mobility group-like transcriptional activator protein. J. Biol. Chem. 267, 3358-3367.

Flierl,A., Reichmann,H., and Seibel,P. (1997). Pathophysiology of the MELAS 3243 transition mutation. J. Biol. Chem. 272, 27189-27196.

Flotte,T.R. and Ferkol,T.W. (1997). Genetic therapy. Past, present, and future. Pediatr. Clin. North Am. 44, 153-178.

Forster,A.C. and Altman,S. (1990). Similar cage-shaped structures for the RNA components of all ribonuclease P and ribonuclease MRP enzymes. Cell 62, 407-409.

Forster,A.C. and Symons,R.H. (1987). Self-cleavage of virusoid RNA is performed by the proposed 55-nucleotide active site. Cell 50, 9-16.

Fox,T.D. (1987). Natural variation in the genetic code. Annu. Rev. Genet. 21, 67-91.

Fritz,J.J., Lewin,A., Hauswirth,W., Agarwal,A., Grant,M., and Shaw,L. (2002a). Development of hammerhead ribozymes to modulate endogenous gene expression for functional studies. Methods 28, 276-285.

Fritz,J.J., White,D.A., Lewin,A.S., and Hauswirth,W.W. (2002b). Designing and characterizing hammerhead ribozymes for use in AAV vector-mediated retinal gene therapies. Methods Enzymol. 346, 358-377.

106

Gaeta,B.A. (2000). BLAST on the Web. Biotechniques 28, 436, 438, 440.

Gaines,G.L., III (1996). In organello RNA synthesis system from HeLa cells. Methods Enzymol. 264, 43-49.

Gao,G., Vandenberghe,L.H., Alvira,M.R., Lu,Y., Calcedo,R., Zhou,X., and Wilson,J.M. (2004). Clades of Adeno-associated viruses are widely disseminated in human tissues. J. Virol. 78, 6381-6388.

Gao,G., Vandenberghe,L.H., and Wilson,J.M. (2005). New recombinant serotypes of AAV vectors. Curr. Gene Ther. 5, 285-297.

Garcia,J.J., Ogilvie,I., Robinson,B.H., and Capaldi,R.A. (2000b). Structure, functioning, and assembly of the ATP synthase in cells from patients with the T8993G mitochondrial DNA mutation. Comparison with the enzyme in Rho(0) cells completely lacking mtdna. J. Biol. Chem. 275, 11075-11081.

Garcia,J.J., Ogilvie,I., Robinson,B.H., and Capaldi,R.A. (2000a). Structure, functioning, and assembly of the ATP synthase in cells from patients with the T8993G mitochondrial DNA mutation. Comparison with the enzyme in Rho(0) cells completely lacking mtdna. J. Biol. Chem. 275, 11075-11081.

Gavel,Y. and von Heijne,G. (1990). Cleavage-site motifs in mitochondrial targeting peptides. Protein Eng. 4, 33-37.

Gearing,D.P. and Nagley,P. (1986). Yeast mitochondrial ATPase subunit 8, normally a mitochondrial gene product, expressed in vitro and imported back into the organelle. EMBO J. 5, 3651-3655.

Geromel,V., Kadhom,N., Cebalos-Picot,I., Ouari,O., Polidori,A., Munnich,A., Rotig,A., and Rustin,P. (2001). Superoxide-induced massive apoptosis in cultured skin fibroblasts harboring the neurogenic ataxia retinitis pigmentosa (NARP) mutation in the ATPase-6 gene of the mitochondrial DNA. Hum. Mol. Genet. 10, 1221-1228.

Gillum,A.M. and Clayton,D.A. (1979). Mechanism of mitochondrial DNA replication in mouse L-cells: RNA priming during the initiation of heavy-strand synthesis. J. Mol. Biol. 135, 353-368.

Gold,H.A., Topper,J.N., Clayton,D.A., and Craft,J. (1989). The RNA processing enzyme RNase MRP is identical to the Th RNP and related to RNase P. Science 245, 1377-1380.

Gorbatyuk,M.S., Pang,J.J., Thomas,J., Jr., Hauswirth,W.W., and Lewin,A.S. (2005). Knockdown of wild-type mouse rhodopsin using an AAV vectored ribozyme as part of an RNA replacement approach. Mol. Vis. 11, 648-656.

Goto,Y., Nonaka,I., and Horai,S. (1990). A mutation in the tRNA(Leu)(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature 348, 651-653.

107

Graham,B.H., Waymire,K.G., Cottrell,B., Trounce,I.A., MacGregor,G.R., and Wallace,D.C. (1997). A mouse model for mitochondrial myopathy and cardiomyopathy resulting from a deficiency in the heart/muscle isoform of the adenine nucleotide translocator. Nat. Genet. 16, 226-234.

Gray,M.W., Burger,G., and Lang,B.F. (1999). Mitochondrial evolution. Science 283, 1476-1481.

Grigorieff,N. (1998). Three-dimensional structure of bovine NADH:ubiquinone oxidoreductase (complex I) at 22 A in ice. J. Mol. Biol. 277, 1033-1046.

Grossman,L.I., Watson,R., and Vinograd,J. (1973). The presence of ribonucleotides in mature closed-circular mitochondrial DNA. Proc. Natl. Acad. Sci. U. S. A 70, 3339- 3343.

Guenebaut,V., Schlitt,A., Weiss,H., Leonard,K., and Friedrich,T. (1998). Consistent structure between bacterial and mitochondrial NADH:ubiquinone oxidoreductase (complex I). J. Mol. Biol. 276, 105-112.

Guerrier-Takada,C., Haydock,K., Allen,L., and Altman,S. (1986). Metal ion requirements and other aspects of the reaction catalyzed by M1 RNA, the RNA subunit of ribonuclease P from Escherichia coli. Biochemistry 25, 1509-1515.

Guy,J., Qi,X., Pallotti,F., Schon,E.A., Manfredi,G., Carelli,V., Martinuzzi,A., Hauswirth,W.W., and Lewin,A.S. (2002). Rescue of a mitochondrial deficiency causing Leber Hereditary Optic Neuropathy. Ann. Neurol. 52, 534-542.

Hagerhall,C. (1997). Succinate: quinone oxidoreductases. Variations on a conserved theme. Biochim. Biophys. Acta 1320, 107-141.

Hamosh,A., Scott,A.F., Amberger,J., Bocchini,C., Valle,D., and McKusick,V.A. (2002). Online Mendelian Inheritance in Man (OMIM), a knowledgebase of human genes and genetic disorders. Nucleic Acids Res. 30, 52-55.

Hamosh,A., Scott,A.F., Amberger,J.S., Bocchini,C.A., and McKusick,V.A. (2005). Online Mendelian Inheritance in Man (OMIM), a knowledgebase of human genes and genetic disorders. Nucleic Acids Res. 33, D514-D517.

Hancock,K. and Hajduk,S.L. (1990). The mitochondrial tRNAs of Trypanosoma brucei are nuclear encoded. J. Biol. Chem. 265, 19208-19215.

Hancock,K., Leblanc,A.J., Donze,D., and Hajduk,S.L. (1992). Identification of Nuclear Encoded Precursor Transfer-Rnas Within the Mitochondrion of Trypanosoma-Brucei. J. Biol. Chem. 267, 23963-23971.

Hansen,J., Qing,K., Kwon,H.J., Mah,C., and Srivastava,A. (2000). Impaired intracellular trafficking of adeno-associated virus type 2 vectors limits efficient transduction of murine fibroblasts. J. Virol. 74, 992-996.

108

Hao,H. and Moraes,C.T. (1996). Functional and molecular mitochondrial abnormalities associated with a C --> T transition at position 3256 of the human mitochondrial genome. The effects of a pathogenic mitochondrial tRNA point mutation in organelle translation and RNA processing. J. Biol. Chem. 271, 2347-2352.

Harman,D. (1972). The biologic clock: the mitochondria? J. Am. Geriatr. Soc. 20, 145- 147.

Hartzog,P.E. and Cain,B.D. (1993). The aleu207-->arg mutation in F1F0-ATP synthase from Escherichia coli. A model for human mitochondrial disease. J. Biol. Chem. 268, 12250-12252.

Hashimoto,C. and Steitz,J.A. (1983). Sequential association of nucleolar 7-2 RNA with two different autoantigens. J. Biol. Chem. 258, 1379-1382.

Hauser,R. and Schneider,A. (1995). tRNAs are imported into mitochondria of Trypanosoma brucei independently of their genomic context and genetic origin. EMBO J. 14, 4212-4220.

Hauswirth,W.W. and Laipis,P.J. (1982). Mitochondrial DNA polymorphism in a maternal lineage of Holstein cows. Proc. Natl. Acad. Sci. U. S. A 79, 4686-4690.

Hayashi,H., Kunii,O., Komatsu,T., and Nishiya,H. (1982). The mechanisms of synergistic effect of antibiotics. A mechanism of synergism, cephaloridine with gentamicin on cephaloridine resistant gram negative bacilli. Jpn. J. Antibiot. 35, 1708- 1715.

Hayashi,J., Ohta,S., Kikuchi,A., Takemitsu,M., Goto,Y., and Nonaka,I. (1991). Introduction of disease-related mitochondrial DNA deletions into HeLa cells lacking mitochondrial DNA results in mitochondrial dysfunction. Proc. Natl. Acad. Sci. U. S. A 88, 10614-10618.

Hayashi,J., Takemitsu,M., Goto,Y., and Nonaka,I. (1994). Human mitochondria and mitochondrial genome function as a single dynamic cellular unit. J. Cell Biol. 125, 43-50.

Hecht,N.B., Liem,H., Kleene,K.C., Distel,R.J., and Ho,S.M. (1984). Maternal inheritance of the mouse mitochondrial genome is not mediated by a loss or gross alteration of the paternal mitochondrial DNA or by methylation of the oocyte mitochondrial DNA. Dev. Biol. 102, 452-461.

Hentze,M.W. (1996). Iron-sulfur clusters and oxidant stress responses. Trends Biochem. Sci. 21, 282-283.

Hill,K., Model,K., Ryan,M.T., Dietmeier,K., Martin,F., Wagner,R., and Pfanner,N. (1998). Tom40 forms the hydrophilic channel of the mitochondrial import pore for preproteins [see comment]. Nature 395, 516-521.

109

Hirsch,M. and Penman,S. (1974). The messenger-like properties of the poly(A)plus RNA in mammalian mitochondria. Cell 3, 335-339.

Hirst,J., Carroll,J., Fearnley,I.M., Shannon,R.J., and Walker,J.E. (2003). The nuclear encoded subunits of complex I from bovine heart mitochondria. Biochim. Biophys. Acta 1604, 135-150.

Hixson,J.E., Wong,T.W., and Clayton,D.A. (1986). Both the conserved stem-loop and divergent 5'-flanking sequences are required for initiation at the human mitochondrial origin of light-strand DNA replication. J. Biol. Chem. 261, 2384-2390.

Hollingsworth,M.J. and Martin,N.C. (1986). Rnase P-Activity in the Mitochondria of Saccharomyces-Cerevisiae Depends on Both Mitochondrion and Nucleus-Encoded Components. Mol. Cell Biol. 6, 1058-1064.

Holt,I.J., Harding,A.E., and Morgan-Hughes,J.A. (1988). Mitochondrial DNA polymorphism in mitochondrial myopathy. Hum. Genet. 79, 53-57.

Holt,I.J., Harding,A.E., Petty,R.K., and Morgan-Hughes,J.A. (1990). A new mitochondrial disease associated with mitochondrial DNA heteroplasmy. Am. J. Hum. Genet. 46, 428-433.

Holt,I.J., Lorimer,H.E., and Jacobs,H.T. (2000). Coupled leading- and lagging-strand synthesis of mammalian mitochondrial DNA. Cell 100, 515-524.

Honlinger,A., Bomer,U., Alconada,A., Eckerskorn,C., Lottspeich,F., Dietmeier,K., and Pfanner,N. (1996). Tom7 modulates the dynamics of the mitochondrial outer membrane translocase and plays a pathway-related role in protein import. EMBO J. 15, 2125-2137.

Hood,D.C. and Birch,D.G. (1990). The A-wave of the human electroretinogram and rod receptor function. Invest Ophthalmol. Vis. Sci. 31, 2070-2081.

Horne,J.R. and Erdmann,V.A. (1972). Isolation and characterization of 5S RNA-protein complexes from Bacillus stearothermophilus and Escherichia coli ribosomes. Mol. Gen. Genet. 119, 337-344.

Hou,Y.M. and Schimmel,P. (1988). A simple structural feature is a major determinant of the identity of a transfer RNA. Nature 333, 140-145.

Houstek,J., Klement,P., Hermanska,J., Houstkova,H., Hansikova,H., van den,B.C., and Zeman,J. (1995). Altered properties of mitochondrial ATP-synthase in patients with a T-- >G mutation in the ATPase 6 (subunit a) gene at position 8993 of mtDNA. Biochim. Biophys. Acta 1271, 349-357.

Howell,N. and Mackey,D.A. (1998). Low-penetrance branches in matrilineal pedigrees with Leber hereditary optic neuropathy. Am. J. Hum. Genet. 63, 1220-1224.

110

Hutcheon,M.L., Duncan,T.M., Ngai,H., and Cross,R.L. (2001). Energy-driven subunit rotation at the interface between subunit a and the c oligomer in the F(O) sector of Escherichia coli ATP synthase. Proc. Natl. Acad. Sci. U. S. A 98, 8519-8524.

Inoue,K., Nakada,K., Ogura,A., Isobe,K., Goto,Y., Nonaka,I., and Hayashi,J.I. (2000). Generation of mice with mitochondrial dysfunction by introducing mouse mtDNA carrying a deletion into zygotes. Nat. Genet. 26, 176-181.

Iwata,S. (1998). Structure and function of bacterial cytochrome c oxidase. J. Biochem. (Tokyo) 123, 369-375.

Iwata,S., Ostermeier,C., Ludwig,B., and Michel,H. (1995). Structure at 2.8 A resolution of cytochrome c oxidase from Paracoccus denitrificans. Nature 376, 660-669.

Jacobs,H.T., Posakony,J.W., Grula,J.W., Roberts,J.W., Xin,J.H., Britten,R.J., and Davidson,E.H. (1983). Mitochondrial DNA sequences in the nuclear genome of Strongylocentrotus purpuratus. J. Mol. Biol. 165, 609-632.

Jenuth,J.P., Peterson,A.C., Fu,K., and Shoubridge,E.A. (1996). Random genetic drift in the female germline explains the rapid segregation of mammalian mitochondrial DNA. Nat. Genet. 14, 146-151.

Jenuth,J.P., Peterson,A.C., and Shoubridge,E.A. (1997). Tissue-specific selection for different mtDNA genotypes in heteroplasmic mice. Nat. Genet. 16, 93-95.

Jiang,W. and Fillingame,R.H. (1998). Interacting helical faces of subunits a and c in the F1Fo ATP synthase of Escherichia coli defined by disulfide cross-linking. Proc. Natl. Acad. Sci. U. S. A 95, 6607-6612.

John,U.P. and Nagley,P. (1986). Amino acid substitutions in mitochondrial ATPase subunit 6 of Saccharomyces cerevisiae leading to oligomycin resistance. FEBS Lett. 207, 79-83.

Jones,P.C. and Fillingame,R.H. (1998). Genetic fusions of subunit c in the F0 sector of H+-transporting ATP synthase. Functional dimers and trimers and determination of stoichiometry by cross-linking analysis. J. Biol. Chem. 273, 29701-29705.

Kajander,O.A., Karhunen,P.J., Holt,I.J., and Jacobs,H.T. (2001). Prominent mitochondrial DNA recombination intermediates in human heart muscle. EMBO Rep. 2, 1007-1012.

Karrasch,S. and Walker,J.E. (1999). Novel features in the structure of bovine ATP synthase. J. Mol. Biol. 290, 379-384.

Kazakova,H.A., Entelis,N.S., Martin,R.P., and Tarassov,I.A. (1999). The aminoacceptor stem of the yeast tRNA(Lys) contains determinants of mitochondrial import selectivity. Febs Letters 442, 193-197.

111

Kerrison,J.B. (2005). Latent, acute, and chronic Leber's hereditary optic neuropathy. Ophthalmology 112, 1-2.

Khan,S.M. and Bennett,J.P., Jr. (2004). Development of mitochondrial gene replacement therapy. J. Bioenerg. Biomembr. 36, 387-393.

King,M.P. and Attardi,G. (1989). Human cells lacking mtDNA: repopulation with exogenous mitochondria by complementation. Science 246, 500-503.

Kiss,T., Marshallsay,C., and Filipowicz,W. (1992). 7-2/MRP RNAs in plant and mammalian cells: association with higher order structures in the nucleolus. EMBO J. 11, 3737-3746.

Kogelnik,A.M., Lott,M.T., Brown,M.D., Navathe,S.B., and Wallace,D.C. (1998). MITOMAP: a human mitochondrial genome database--1998 update. Nucleic Acids Res. 26, 112-115.

Kolesnikova,O.A., Entelis,N.S., Jacquin-Becker,C., Goltzene,F., Chrzanowska- Lightowlers,Z.M., Lightowlers,R.N., Martin,R.P., and Tarassov,I. (2004). Nuclear DNA- encoded tRNAs targeted into mitochondria can rescue a mitochondrial DNA mutation associated with the MERRF syndrome in cultured human cells. Hum. Mol. Genet. 13, 2519-2534.

Kolesnikova,O.A., Entelis,N.S., Mireau,H., Fox,T.D., Martin,R.P., and Tarassov,I.A. (2000). Suppression of mutations in mitochondrial DNA by tRNAs imported from the cytoplasm. Science 289, 1931-1933.

Korshunov,S.S., Skulachev,V.P., and Starkov,A.A. (1997). High protonic potential actuates a mechanism of production of reactive oxygen species in mitochondria. FEBS Lett. 416, 15-18.

Kovermann,P., Truscott,K.N., Guiard,B., Rehling,P., Sepuri,N.B., Muller,H., Jensen,R.E., Wagner,R., and Pfanner,N. (2002). Tim22, the essential core of the mitochondrial protein insertion complex, forms a voltage-activated and signal-gated channel. Mol. Cell 9, 363-373.

Kumar,R., MarechalDrouard,L., Akama,K., and Small,I. (1996). Striking differences in mitochondrial tRNA import between different plant species. Molecular & General Genetics 252, 404-411.

Ladoukakis,E.D. and Zouros,E. (2001). Direct evidence for homologous recombination in mussel (Mytilus galloprovincialis) mitochondrial DNA. Mol. Biol. Evol. 18, 1168- 1175.

Lang,B.F., Burger,G., O'Kelly,C.J., Cedergren,R., Golding,G.B., Lemieux,C., Sankoff,D., Turmel,M., and Gray,M.W. (1997). An ancestral mitochondrial DNA resembling a eubacterial genome in miniature. Nature 387, 493-497.

112

Lang,B.F., Goff,L.J., and Gray,M.W. (1996). A 5 S rRNA gene is present in the mitochondrial genome of the protist Reclinomonas americana but is absent from red algal mitochondrial DNA. J. Mol. Biol. 261, 407-413.

Lappalainen,P., Aasa,R., Malmstrom,B.G., and Saraste,M. (1993). Soluble CuA-binding domain from the Paracoccus cytochrome c oxidase. J. Biol. Chem. 268, 26416-26421.

Larsson,N.G. and Clayton,D.A. (1995). Molecular genetic aspects of human mitochondrial disorders. Annu. Rev. Genet. 29, 151-178.

Larsson,N.G., Tulinius,M.H., Holme,E., and Oldfors,A. (1995). Pathogenetic aspects of the A8344G mutation of mitochondrial DNA associated with MERRF syndrome and multiple symmetric lipomas. Muscle Nerve 3, S102-S106.

Larsson,N.G., Wang,J., Wilhelmsson,H., Oldfors,A., Rustin,P., Lewandoski,M., Barsh,G.S., and Clayton,D.A. (1998). Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice. Nat. Genet. 18, 231-236.

Law,R.H., Farrell,L.B., Nero,D., Devenish,R.J., and Nagley,P. (1988). Studies on the import into mitochondria of yeast ATP synthase subunits 8 and 9 encoded by artificial nuclear genes. FEBS Lett. 236, 501-505.

Lebovitz,R.M., Zhang,H., Vogel,H., Cartwright,J., Jr., Dionne,L., Lu,N., Huang,S., and Matzuk,M.M. (1996). Neurodegeneration, myocardial injury, and perinatal death in mitochondrial superoxide dismutase-deficient mice. Proc. Natl. Acad. Sci. U. S. A 93, 9782-9787.

Lecrenier,N. and Foury,F. (2000). New features of mitochondrial DNA replication system in yeast and man. Gene 246, 37-48.

Lee,D.Y. and Clayton,D.A. (1997). RNase mitochondrial RNA processing correctly cleaves a novel R loop at the mitochondrial DNA leading-strand origin of replication LEE1997. Genes Dev. 11, 582-592.

Letellier,T., Heinrich,R., Malgat,M., and Mazat,J.P. (1994). The kinetic basis of threshold effects observed in mitochondrial diseases: a systemic approach. Biochem. J. 302 ( Pt 1), 171-174.

Levy,S.E., Waymire,K.G., Kim,Y.L., MacGregor,G.R., and Wallace,D.C. (1999). Transfer of chloramphenicol-resistant mitochondrial DNA into the chimeric mouse. Transgenic Res. 8, 137-145.

Lewin,A.S. and Hauswirth,W.W. (2001). Ribozyme gene therapy: applications for molecular medicine. Trends Mol. Med. 7, 221-228.

Li,K., Smagula,C.S., Parsons,W.J., Richardson,J.A., Gonzalez,M., Hagler,H.K., and Williams,R.S. (1994). Subcellular partitioning of MRP RNA assessed by ultrastructural and biochemical analysis. J. Cell Biol. 124, 871-882.

113

Li,Y., Huang,T.T., Carlson,E.J., Melov,S., Ursell,P.C., Olson,J.L., Noble,L.J., Yoshimura,M.P., Berger,C., Chan,P.H., Wallace,D.C., and Epstein,C.J. (1995). Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase. Nat. Genet. 11, 376-381.

Lima,B.D. and Simpson,L. (1996). Sequence-dependent in vivo importation of tRNAs into the mitochondrion of Leishmania tarentolae. RNA. 2, 429-440.

Lindahl,L., Fretz,S., Epps,N., and Zengel,J.M. (2000). Functional equivalence of hairpins in the RNA subunits of RNase MRP and RNase P in Saccharomyces cerevisiae. RNA. 6, 653-658.

Linnane,A.W., Baumer,A., Maxwell,R.J., Preston,H., Zhang,C.F., and Marzuki,S. (1990). Mitochondrial gene mutation: the ageing process and degenerative diseases. Biochem. Int. 22, 1067-1076.

Lutter,R., Abrahams,J.P., van Raaij,M.J., Todd,R.J., Lundqvist,T., Buchanan,S.K., Leslie,A.G., and Walker,J.E. (1993). Crystallization of F1-ATPase from bovine heart mitochondria. J. Mol. Biol. 229, 787-790.

Lye,L.F., Chen,D.H., and Suyama,Y. (1993). Selective import of nuclear-encoded tRNAs into mitochondria of the protozoan Leishmania tarentolae. Mol. Biochem. Parasitol. 58, 233-245.

Lygerou,Z., Allmang,C., Tollervey,D., and Seraphin,B. (1996). Accurate processing of a eukaryotic precursor ribosomal RNA by ribonuclease MRP in vitro. Science 272, 268- 270.

Lynch,D.C. and Attardi,G. (1976). Amino acid specificity of the transfer RNA species coded for by HeLa cell mitochondrial DNA. J. Mol. Biol. 102, 125-141.

Maechler,P. and Wollheim,C.B. (2001). Mitochondrial function in normal and diabetic beta-cells. Nature 414, 807-812.

Magalhaes,P.J., Andreu,A.L., and Schon,E.A. (1998). Evidence for the presence of 5S rRNA in mammalian mitochondria. Mol. Biol. Cell 9, 2375-2382.

Mahapatra,S., Ghosh,S., Bera,S.K., Ghosh,T., Das,A., and Adhya,S. (1998). The D arm of tRNATyr is necessary and sufficient for import into Leishmania mitochondria in vitro. Nucleic Acids Res. 26, 2037-2041.

Mahapatra,S., Ghosh,T., and Adhya,S. (1994). Import of small RNAs into Leishmania mitochondria in vitro. Nucleic Acids Res. 22, 3381-3386.

Malmstrom,B.G. and Aasa,R. (1993). The nature of the CuA center in cytochrome c oxidase. FEBS Lett. 325, 49-52.

114

Man,P.Y., Griffiths,P.G., Brown,D.T., Howell,N., Turnbull,D.M., and Chinnery,P.F. (2003). The epidemiology of Leber hereditary optic neuropathy in the North East of England. Am. J. Hum. Genet. 72, 333-339.

Manfredi,G., Fu,J., Ojaimi,J., Sadlock,J.E., Kwong,J.Q., Guy,J., and Schon,E.A. (2002). Rescue of a deficiency in ATP synthesis by transfer of MTATP6, a mitochondrial DNA- encoded gene, to the nucleus. Nat. Genet. 30, 394-399.

Manfredi,G., Gupta,N., Vazquez-Memije,M.E., Sadlock,J.E., Spinazzola,A., De Vivo,D.C., and Schon,E.A. (1999). Oligomycin induces a decrease in the cellular content of a pathogenic mutation in the human mitochondrial ATPase 6 gene. J. Biol. Chem. 274, 9386-9391.

Manfredi,G., Spinazzola,A., Checcarelli,N., and Naini,A. (2001). Assay of mitochondrial ATP synthesis in animal cells. Methods Cell Biol. 65, 133-145.

Marchington,D.R., Barlow,D., and Poulton,J. (1999). Transmitochondrial mice carrying resistance to chloramphenicol on mitochondrial DNA: developing the first mouse model of mitochondrial DNA disease. Nat. Med. 5, 957-960.

Marchington,D.R., Macaulay,V., Hartshorne,G.M., Barlow,D., and Poulton,J. (1998). Evidence from human oocytes for a genetic bottleneck in an mtDNA disease. Am. J. Hum. Genet. 63, 769-775.

Marechal-Drouard,L., Weil,J.H., and Guillemaut,P. (1988). Import of several tRNAs from the cytoplasm into the mitochondria in bean Phaseolus vulgaris. Nucleic Acids Res. 16, 4777-4788.

Margulis,L. and Bermudes,D. (1985). Symbiosis as a mechanism of evolution: status of cell symbiosis theory. Symbiosis 1, 101-124.

Martin,J., Mahlke,K., and Pfanner,N. (1991). Role of an energized inner membrane in mitochondrial protein import. Delta psi drives the movement of presequences. J. Biol. Chem. 266, 18051-18057.

Martin,R.P., Schneller,J.M., Stahl,A.J., and Dirheimer,G. (1977). Study of yeast mitochondrial tRNAs by two-dimensional polyacrylamide gel electrophoresis: characterization of isoaccepting species and search for imported cytoplasmic tRNAs. Nucleic Acids Res. 4, 3497-3510.

Martin,R.P., Schneller,J.M., Stahl,A.J., and Dirheimer,G. (1979). Import of nuclear deoxyribonucleic acid coded lysine-accepting transfer ribonucleic acid (anticodon C-U- U) into yeast mitochondria. Biochemistry 18, 4600-4605.

Mattiazzi,M., Vijayvergiya,C., Gajewski,C.D., DeVivo,D.C., Lenaz,G., Wiedmann,M., and Manfredi,G. (2004). The mtDNA T8993G (NARP) mutation results in an impairment of oxidative phosphorylation that can be improved by antioxidants. Hum. Mol. Genet. 13, 869-879.

115

McCulloch,V., Seidel-Rogol,B.L., and Shadel,G.S. (2002). A human mitochondrial transcription factor is related to RNA adenine methyltransferases and binds S- adenosylmethionine. Mol. Cell Biol. 22, 1116-1125.

McGinnis,S. and Madden,T.L. (2004). BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res. 32, W20-W25.

Meirelles,F.V. and Smith,L.C. (1997). Mitochondrial genotype segregation in a mouse heteroplasmic lineage produced by embryonic karyoplast transplantation. Genetics 145, 445-451.

Meirelles,F.V. and Smith,L.C. (1998). Mitochondrial genotype segregation during preimplantation development in mouse heteroplasmic embryos. Genetics 148, 877-883.

Melov,S., Coskun,P., Patel,M., Tuinstra,R., Cottrell,B., Jun,A.S., Zastawny,T.H., Dizdaroglu,M., Goodman,S.I., Huang,T.T., Miziorko,H., Epstein,C.J., and Wallace,D.C. (1999). Mitochondrial disease in superoxide dismutase 2 mutant mice. Proc. Natl. Acad. Sci. U. S. A 96, 846-851.

Michaels,G.S., Hauswirth,W.W., and Laipis,P.J. (1982). Mitochondrial DNA copy number in bovine oocytes and somatic cells. Dev. Biol. 94, 246-251.

Mireau,H., Lancelin,D., and Small,I.D. (1996). The same Arabidopsis gene encodes both cytosolic and mitochondrial alanyl-tRNA synthetases. Plant Cell 8, 1027-1039.

Model,K., Meisinger,C., Prinz,T., Wiedemann,N., Truscott,K.N., Pfanner,N., and Ryan,M.T. (2001). Multistep assembly of the protein import channel of the mitochondrial outer membrane. Nat. Struct. Biol. 8, 361-370.

Montoya,J., Christianson,T., Levens,D., Rabinowitz,M., and Attardi,G. (1982). Identification of initiation sites for heavy-strand and light-strand transcription in human mitochondrial DNA. Proc. Natl. Acad. Sci. U. S. A 79, 7195-7199.

Montoya,J., Gaines,G.L., and Attardi,G. (1983). The pattern of transcription of the human mitochondrial rRNA genes reveals two overlapping transcription units. Cell 34, 151-159.

Montoya,J., Ojala,D., and Attardi,G. (1981). Distinctive features of the 5'-terminal sequences of the human mitochondrial mRNAs. Nature 290, 465-470.

Moraes,C.T., Andreetta,F., Bonilla,E., Shanske,S., DiMauro,S., and Schon,E.A. (1991). Replication-competent human mitochondrial DNA lacking the heavy-strand promoter region. Mol. Cell Biol. 11, 1631-1637.

Moraes,C.T., Ciacci,F., Silvestri,G., Shanske,S., Sciacco,M., Hirano,M., Schon,E.A., Bonilla,E., and DiMauro,S. (1993). Atypical clinical presentations associated with the MELAS mutation at position 3243 of human mitochondrial DNA MORAES1993A. Neuromuscul. Disord. 3, 43-50.

116

Mottram,J.C., Bell,S.D., Nelson,R.G., and Barry,J.D. (1991). tRNAs of Trypanosoma brucei. Unusual gene organization and mitochondrial importation. J. Biol. Chem. 266, 18313-18317.

Muratovska,A., Lightowlers,R.N., Taylor,R.W., Turnbull,D.M., Smith,R.A., Wilce,J.A., Martin,S.W., and Murphy,M.P. (2001). Targeting peptide nucleic acid (PNA) oligomers to mitochondria within cells by conjugation to lipophilic cations: implications for mitochondrial DNA replication, expression and disease. Nucleic Acids Res. 29, 1852- 1863.

Murray,J.B. and Scott,W.G. (2000). Does a single metal ion bridge the A-9 and scissile phosphate groups in the catalytically active hammerhead ribozyme structure? J. Mol. Biol. 296, 33-41.

Nabholz,C.E., Horn,E.K., and Schneider,A. (1999). tRNAs and proteins are imported into mitochondria of Trypanosoma brucei by two distinct mechanisms. Mol. Biol. Cell 10, 2547-2557.

Nakada,K., Inoue,K., Ono,T., Isobe,K., Ogura,A., Goto,Y.I., Nonaka,I., and Hayashi,J.I. (2001). Inter-mitochondrial complementation: Mitochondria-specific system preventing mice from expression of disease phenotypes by mutant mtDNA. Nat. Med. 7, 934-940.

Nardelli,M., Tommasi,S., D'Erchia,A.M., Tanzariello,F., Tullo,A., Primavera,A.T., De Lena,M., Sbisa,E., and Saccone,C. (1994). Detection of novel transcripts in the human mitochondrial DNA region coding for ATPase8-ATPase6 subunits. FEBS Lett. 344, 10- 14.

Neupert,W., Hartl,F.U., Craig,E.A., and Pfanner,N. (1990). How do polypeptides cross the mitochondrial membranes? Cell 63, 447-450.

Nijtmans,L.G., Henderson,N.S., Attardi,G., and Holt,I.J. (2001). Impaired ATP synthase assembly associated with a mutation in the human ATP synthase subunit 6 gene. J. Biol. Chem. 276, 6755-6762.

Nohl,H., Staniek,K., Kozlov,A.V., and Gille,L. (2003). The biomolecule ubiquinone exerts a variety of biological functions. Biofactors 18, 23-31.

Noji,H., Yasuda,R., Yoshida,M., and Kinosita,K., Jr. (1997). Direct observation of the rotation of F1-ATPase. Nature 386, 299-302.

Noji,H. and Yoshida,M. (2001). The rotary machine in the cell, ATP synthase. J. Biol. Chem. 276, 1665-1668.

Notsu,Y., Masood,S., Nishikawa,T., Kubo,N., Akiduki,G., Nakazono,M., Hirai,A., and Kadowaki,K. (2002). The complete sequence of the rice (Oryza sativa L.) mitochondrial genome: frequent DNA sequence acquisition and loss during the evolution of flowering plants. Mol. Genet. Genomics 268, 434-445.

117

O'Brien,T.W. (2002). Evolution of a protein-rich mitochondrial ribosome: implications for human genetic disease. Gene 286, 73-79.

Oca-Cossio,J., Kenyon,L., Hao,H., and Moraes,C.T. (2003). Limitations of allotopic expression of mitochondrial genes in mammalian cells. Genetics 165, 707-720.

Oda,K., Yamato,K., Ohta,E., Nakamura,Y., Takemura,M., Nozato,N., Akashi,K., and Ohyama,K. (1992). Transfer RNA genes in the mitochondrial genome from a liverwort, Marchantia polymorpha: the absence of chloroplast-like tRNAs. Nucleic Acids Res. 20, 3773-3777.

Ogilvie,I. and Capaldi,R.A. (1999). Mutation of the mitochrondrially encoded ATPase 6 gene modeled in the ATP synthase of Escherichia coli. FEBS Lett. 453, 179-182.

Ojala,D. and Attardi,G. (1972). Expression of the mitochondrial genome in HeLa cells. X. Properties of mitochondrial polysomes. J. Mol. Biol. 65, 273-289.

Ojala,D. and Attardi,G. (1974). Expression of the mitochondrial genome in HeLa cells. XIX. Occurrence in mitochondria of polyadenylic acid sequences, "free" and covalently linked to mitochondrial DNA-coded RNA. J. Mol. Biol. 82, 151-174.

Ojala,D., Merkel,C., Gelfand,R., and Attardi,G. (1980). The tRNA genes punctuate the reading of genetic information in human mitochondrial DNA. Cell 22, 393-403.

Ojala,D., Montoya,J., and Attardi,G. (1981). tRNA punctuation model of RNA processing in human mitochondria. Nature 290, 470-474.

Orth,M. and Schapira,A.H. (2001). Mitochondria and degenerative disorders. Am. J. Med. Genet. 106, 27-36.

Ortiz,R.G., Newman,N.J., Shoffner,J.M., Kaufman,A.E., Koontz,D.A., and Wallace,D.C. (1993). Variable retinal and neurologic manifestations in patients harboring the mitochondrial DNA 8993 mutation. Arch. Ophthalmol. 111, 1525-1530.

Ostermeier,C., Harrenga,A., Ermler,U., and Michel,H. (1997). Structure at 2.7 A resolution of the Paracoccus denitrificans two-subunit cytochrome c oxidase complexed with an antibody FV fragment. Proc. Natl. Acad. Sci. U. S. A 94, 10547-10553.

Owen,R., IV, Lewin,A.P., Peel,A., Wang,J., Guy,J., Hauswirth,W.W., Stacpoole,P.W., and Flotte,T.R. (2000). Recombinant adeno-associated virus vector-based gene transfer for defects in oxidative metabolism. Hum. Gene Ther. 11, 2067-2078.

Palmer,J.D., Adams,K.L., Cho,Y., Parkinson,C.L., Qiu,Y.L., and Song,K. (2000). Dynamic evolution of plant mitochondrial genomes: mobile genes and introns and highly variable mutation rates. Proc. Natl. Acad. Sci. U. S. A 97, 6960-6966.

Parisi,M.A. and Clayton,D.A. (1991). Similarity of human mitochondrial transcription factor 1 to high mobility group proteins. Science 252, 965-969.

118

Pauptit,R.A., Zhang,H., Rummel,G., Schirmer,T., Jansonius,J.N., and Rosenbusch,J.P. (1991). Trigonal crystals of porin from Escherichia coli. J. Mol. Biol. 218, 505-507.

Petruzzella,V., Moraes,C.T., Sano,M.C., Bonilla,E., DiMauro,S., and Schon,E.A. (1994). Extremely high levels of mutant mtDNAs co-localize with cytochrome c oxidase- negative ragged-red fibers in patients harboring a point mutation at nt 3243. Hum. Mol. Genet. 3, 449-454.

Pfanner,N. and Wiedemann,N. (2002). Mitochondrial protein import: two membranes, three translocases. Curr. Opin. Cell Biol. 14, 400-411.

Pica-Mattoccia,L. and Attardi,G. (1971). Expression of the mitochondrial genome in HeLa cells. V. Transcription of mitochondrial DNA in relationship to the cell cycle. J. Mol. Biol. 57, 615-621.

Pica-Mattoccia,L. and Attardi,G. (1972). Expression of the mitochondrial genome in HeLa cells. IX. Replication of mitochondrial DNA in relationship to cell cycle in HeLa cells. J. Mol. Biol. 64, 465-484.

Piko,L. and Matsumoto,L. (1976). Number of mitochondria and some properties of mitochondrial DNA in the mouse egg. Dev. Biol. 49, 1-10.

Posakony,J.W., England,J.M., and Attardi,G. (1975). Morphological heterogeneity of HeLa cell mitochondria visualized by a modified diaminobenzidine staining technique. J. Cell Sci. 19, 315-329.

Posakony,J.W., England,J.M., and Attardi,G. (1977). Mitochondrial growth and division during the cell cycle in HeLa cells. J. Cell Biol. 74, 468-491.

Puranam,R.S. and Attardi,G. (2001). The RNase P associated with HeLa cell mitochondria contains an essential RNA component identical in sequence to that of the nuclear RNase P. Mol. Cell Biol. 21, 548-561.

Qi,X., Lewin,A.S., Hauswirth,W.W., and Guy,J. (2003a). Optic neuropathy induced by reductions in mitochondrial superoxide dismutase. Invest Ophthalmol. Vis. Sci. 44, 1088- 1096.

Qi,X., Lewin,A.S., Hauswirth,W.W., and Guy,J. (2003b). Suppression of complex I gene expression induces optic neuropathy. Ann. Neurol. 53, 198-205.

Qi,X., Lewin,A.S., Sun,L., Hauswirth,W.W., and Guy,J. (2004). SOD2 gene transfer protects against optic neuropathy induced by deficiency of complex I. Ann. Neurol. 56, 182-191.

Qu,J., Li,R., Tong,Y., Hu,Y., Zhou,X., Qian,Y., Lu,F., and Guan,M.X. (2005). Only male matrilineal relatives with Leber's hereditary optic neuropathy in a large Chinese family carrying the mitochondrial DNA G11778A mutation. Biochem. Biophys. Res. Commun. 328, 1139-1145.

119

Rabinowitz,J.E., Rolling,F., Li,C., Conrath,H., Xiao,W., Xiao,X., and Samulski,R.J. (2002). Cross-packaging of a single adeno-associated virus (AAV) type 2 vector genome into multiple AAV serotypes enables transduction with broad specificity. J. Virol. 76, 791-801.

Rastogi,V.K. and Girvin,M.E. (1999). Structural changes linked to proton translocation by subunit c of the ATP synthase. Nature 402, 263-268.

Reddy,R., Tan,E.M., Henning,D., Nohga,K., and Busch,H. (1983). Detection of a nucleolar 7-2 ribonucleoprotein and a cytoplasmic 8-2 ribonucleoprotein with autoantibodies from patients with scleroderma. J. Biol. Chem. 258, 1383-1386.

Reimer,G., Raska,I., Scheer,U., and Tan,E.M. (1988). Immunolocalization of 7-2- ribonucleoprotein in the granular component of the nucleolus. Exp. Cell Res. 176, 117- 128.

Reitzer,L.J., Wice,B.M., and Kennell,D. (1979). Evidence that glutamine, not sugar, is the major energy source for cultured HeLa cells. J. Biol. Chem. 254, 2669-2676.

Reyes,A., Yang,M.Y., Bowmaker,M., and Holt,I.J. (2005). Bidirectional replication initiates at sites throughout the mitochondrial genome of birds. J. Biol. Chem. 280, 3242- 3250.

Richter,C. (1988). Do mitochondrial DNA fragments promote cancer and aging? FEBS Lett. 241, 1-5.

Robinson,B.H. (1996). Use of fibroblast and lymphoblast cultures for detection of respiratory chain defects. Methods Enzymol. 264, 454-464.

Robinson,K.M., Rothery,R.A., Weiner,J.H., and Lemire,B.D. (1994). The covalent attachment of FAD to the flavoprotein of Saccharomyces cerevisiae succinate dehydrogenase is not necessary for import and assembly into mitochondria. Eur. J. Biochem. 222, 983-990.

Roise,D. (1988). Import of proteins into mitochondria. Prog. Clin. Biol. Res. 282, 43-53.

Roise,D., Horvath,S.J., Tomich,J.M., Richards,J.H., and Schatz,G. (1986). A chemically synthesized pre-sequence of an imported mitochondrial protein can form an amphiphilic helix and perturb natural and artificial phospholipid bilayers. EMBO J. 5, 1327-1334.

Rubio,M.A., Liu,X., Yuzawa,H., Alfonzo,J.D., and Simpson,L. (2000). Selective importation of RNA into isolated mitochondria from Leishmania tarentolae. RNA. 6, 988-1003.

Ruffner,D.E., Stormo,G.D., and Uhlenbeck,O.C. (1990). Sequence requirements of the hammerhead RNA self-cleavage reaction. Biochemistry 29, 10695-10702.

120

Rusconi,C.P. and Cech,T.R. (1996). Mitochondrial import of only one of three nuclear- encoded glutamine tRNAs in Tetrahymena thermophila. EMBO J. 15, 3286-3295.

Ryan,K.R., Leung,R.S., and Jensen,R.E. (1998). Characterization of the mitochondrial inner membrane translocase complex: the Tim23p hydrophobic domain interacts with Tim17p but not with other Tim23p molecules. Mol. Cell Biol. 18, 178-187.

Saccone,C., Gissi,C., Reyes,A., Larizza,A., Sbisa,E., and Pesole,G. (2002). Mitochondrial DNA in metazoa: degree of freedom in a frozen event. Gene 286, 3-12.

Santorelli,F.M., Mak,S.C., Vazquez-Memije,E., Shanske,S., Kranz-Eble,P., Jain,K.D., Bluestone,D.L., De Vivo,D.C., and DiMauro,S. (1996). Clinical heterogeneity associated with the mitochondrial DNA T8993C point mutation. Pediatr. Res. 39, 914-917.

Santorelli,F.M., Shanske,S., Macaya,A., DeVivo,D.C., and DiMauro,S. (1993). The mutation at nt 8993 of mitochondrial DNA is a common cause of Leigh's syndrome. Ann. Neurol. 34, 827-834.

Saraste,M. (1999). Oxidative phosphorylation at the fin de siecle. Science 283, 1488- 1493.

Sbicego,S., Nabholz,C.E., Hauser,R., Blum,B., and Schneider,A. (1998). In vivo import of unspliced tRNATyr containing synthetic introns of variable length into mitochondria of Leishmania tarentolae. Nucleic Acids Res. 26, 5251-5255.

Schaefer,A.M., Taylor,R.W., Turnbull,D.M., and Chinnery,P.F. (2004). The epidemiology of mitochondrial disorders--past, present and future. Biochim. Biophys. Acta 1659, 115-120.

Schleiff,E., Shore,G.C., and Goping,I.S. (1997). Interactions of the human mitochondrial protein import receptor, hTom20, with precursor proteins in vitro reveal pleiotropic specificities and different receptor domain requirements. J. Biol. Chem. 272, 17784- 17789.

Schleyer,M., Schmidt,B., and Neupert,W. (1982). Requirement of a membrane potential for the posttranslational transfer of proteins into mitochondria. Eur. J. Biochem. 125, 109-116.

Schneider,A. and Marechal-Drouard,L. (2000). Mitochondrial tRNA import: are there distinct mechanisms? Trends Cell Biol. 10, 509-513.

Schneider,E. and Altendorf,K. (1985). All three subunits are required for the reconstitution of an active proton channel (F0) of Escherichia coli ATP synthase (F1F0). EMBO J. 4, 515-518.

Schon,E.A., Bonilla,E., and DiMauro,S. (1997). Mitochondrial DNA mutations and pathogenesis. J. Bioenerg. Biomembr. 29, 131-149.

121

Schon,E.A., Santra,S., Pallotti,F., and Girvin,M.E. (2001). Pathogenesis of primary defects in mitochondrial ATP synthesis. Semin. Cell Dev. Biol. 12, 441-448.

Schwartz,M. and Vissing,J. (2003). New patterns of inheritance in mitochondrial disease. Biochem. Biophys. Res. Commun. 310, 247-251.

Sciacco,M., Bonilla,E., Schon,E.A., DiMauro,S., and Moraes,C.T. (1994). Distribution of wild-type and common deletion forms of mtDNA in normal and respiration-deficient muscle fibers from patients with mitochondrial myopathy. Hum. Mol. Genet. 3, 13-19.

Sciacco,M., Prelle,A., D'Adda,E., Lamperti,C., Bordoni,A., Rango,M., Crimi,M., Comi,G.P., Bresolin,N., and Moggio,M. (2003). Familial mtDNA T8993C transition causing both the NARP and the MILS phenotype in the same generation. A morphological, genetic and spectroscopic study. J. Neurol. 250, 1498-1500.

Seibel,P., Trappe,J., Villani,G., Klopstock,T., Papa,S., and Reichmann,H. (1995). Transfection of mitochondria: strategy towards a gene therapy of mitochondrial DNA diseases. Nucleic Acids Res. 23, 10-17.

Shiba,K., Stello,T., Motegi,H., Noda,T., Musier-Forsyth,K., and Schimmel,P. (1997). Human lysyl-tRNA synthetase accepts nucleotide 73 variants and rescues Escherichia coli double-defective mutant. J. Biol. Chem. 272, 22809-22816.

Shimayama,T., Nishikawa,S., and Taira,K. (1995). Generality of the NUX rule: kinetic analysis of the results of systematic mutations in the trinucleotide at the cleavage site of hammerhead ribozymes. Biochemistry 34, 3649-3654.

Shoffner,J.M., Kaufman,A., Koontz,D., Krawiecki,N., Smith,E., Topp,M., and Wallace,D.C. (1995). Oxidative phosphorylation diseases and cerebellar ataxia. Clin. Neurosci. 3, 43-53.

Shoffner,J.M., Lott,M.T., Lezza,A.M., Seibel,P., Ballinger,S.W., and Wallace,D.C. (1990). Myoclonic epilepsy and ragged-red fiber disease (MERRF) is associated with a mitochondrial DNA tRNA(Lys) mutation. Cell 61, 931-937.

Shoffner,J.M. and Wallace,D.C. (1992). Mitochondrial genetics: principles and practice. Am. J. Hum. Genet. 51, 1179-1186.

Shou,Y., Li,L., Prabhakaran,K., Borowitz,J.L., and Isom,G.E. (2003). p38 Mitogen- activated protein kinase regulates Bax translocation in cyanide-induced apoptosis. Toxicol. Sci. 75, 99-107.

Simonetti,S., Chen,X., DiMauro,S., and Schon,E.A. (1992). Accumulation of deletions in human mitochondrial DNA during normal aging: analysis by quantitative PCR. Biochim. Biophys. Acta 1180, 113-122.

Simpson,A.M., Suyama,Y., Dewes,H., Campbell,D.A., and Simpson,L. (1989). Kinetoplastid mitochondria contain functional tRNAs which are encoded in nuclear DNA

122 and also contain small minicircle and maxicircle transcripts of unknown function. Nucleic Acids Res. 17, 5427-5445.

Skehel,J.M., Fearnley,I.M., and Walker,J.E. (1998). NADH:ubiquinone oxidoreductase from bovine heart mitochondria: sequence of a novel 17.2-kDa subunit. FEBS Lett. 438, 301-305.

Skehel,J.M., Pilkington,S.J., Runswick,M.J., Fearnley,I.M., and Walker,J.E. (1991). NADH:ubiquinone oxidoreductase from bovine heart mitochondria. Complementary DNA sequence of the import precursor of the 10 kDa subunit of the flavoprotein fragment. FEBS Lett. 282, 135-138.

Sligh,J.E., Levy,S.E., Waymire,K.G., Allard,P., Dillehay,D.L., Nusinowitz,S., Heckenlively,J.R., MacGregor,G.R., and Wallace,D.C. (2000). Maternal germ-line transmission of mutant mtDNAs from embryonic stem cell-derived chimeric mice. Proc. Natl. Acad. Sci. U. S. A 97, 14461-14466.

Small,I., MarechalDrouard,L., Masson,J., Pelletier,G., Cosset,A., Weil,J.H., and Dietrich,A. (1992). Invivo Import of A Normal Or Mutagenized Heterologous Transfer- Rna Into the Mitochondria of Transgenic Plants - Towards Novel Ways of Influencing Mitochondrial Gene-Expression. EMBO J. 11, 1291-1296.

Snyder,J.W. (1990). Mechanisms of toxic cell injury. Clin. Lab Med. 10, 311-321.

Sollner,T., Pfaller,R., Griffiths,G., Pfanner,N., and Neupert,W. (1990). A mitochondrial import receptor for the ADP/ATP carrier. Cell 62, 107-115.

Srivastava,S. and Moraes,C.T. (2001). Manipulating mitochondrial DNA heteroplasmy by a mitochondrially targeted restriction endonuclease. Hum. Mol. Genet. 10, 3093-3099.

Steger,H.F., Sollner,T., Kiebler,M., Dietmeier,K.A., Pfaller,R., Trulzsch,K.S., Tropschug,M., Neupert,W., and Pfanner,N. (1990). Import of ADP/ATP carrier into mitochondria: two receptors act in parallel. J. Cell Biol. 111, 2353-2363.

Stohl,L.L. and Clayton,D.A. (1992). Saccharomyces cerevisiae contains an RNase MRP that cleaves at a conserved mitochondrial RNA sequence implicated in replication priming. Mol. Cell Biol. 12, 2561-2569.

Sugiyama,Y., Watase,Y., Nagase,M., Makita,N., Yagura,S., Hirai,A., and Sugiura,M. (2005). The complete nucleotide sequence and multipartite organization of the tobacco mitochondrial genome: comparative analysis of mitochondrial genomes in higher plants. Mol. Genet. Genomics 272, 603-615.

Suomalainen,A. and Kaukonen,J. (2001). Diseases caused by nuclear genes affecting mtDNA stability. Am. J. Med. Genet. 106, 53-61.

Surace,E.M., Auricchio,A., Reich,S.J., Rex,T., Glover,E., Pineles,S., Tang,W., O'Connor,E., Lyubarsky,A., Savchenko,A., Pugh,E.N., Jr., Maguire,A.M., Wilson,J.M.,

123

and Bennett,J. (2003). Delivery of adeno-associated virus vectors to the fetal retina: impact of viral capsid proteins on retinal neuronal progenitor transduction. J. Virol. 77, 7957-7963.

Sutovsky,P., Moreno,R.D., Ramalho-Santos,J., Dominko,T., Simerly,C., and Schatten,G. (1999). Ubiquitin tag for sperm mitochondria. Nature 402, 371-372.

Sutovsky,P. and Schatten,G. (2000). Paternal contributions to the mammalian zygote: fertilization after sperm-egg fusion. Int. Rev. Cytol. 195, 1-65.

Suyama,Y. (1967). The origins of mitochondrial ribonucleic acids in Tetrahymena pyriformis. Biochemistry 6, 2829-2839.

Suyama,Y. (1986). Two dimensional polyacrylamide gel electrophoresis analysis of Tetrahymena mitochondrial tRNA. Curr. Genet. 10, 411-420.

Symons,R.H. (1992). Small catalytic RNAs. Annu. Rev. Biochem. 61, 641-671.

Tarassov,I.A. and Entelis,N.S. (1992). Mitochondrially-imported cytoplasmic tRNA(Lys)(CUU) of Saccharomyces cerevisiae: in vivo and in vitro targetting systems. Nucleic Acids Res. 20, 1277-1281.

Tarasov,I.A., Entelis,N.S., and Krasheninnikov,I.A. (1993). Import of Cytoplasmic Lysine Transfer-Rna Into Bakers-Yeast Mitochondria - In-Vivo and In-Vitro Test Systems. Biochemistry-Moscow 58, 1089-1096.

Tarassov,I.A., Entelis,N.S., and Martin,R.P. (1995a). An intact protein translocating machinery is required for mitochondrial import of a yeast cytoplasmic tRNA. J. Mol. Biol. 245, 315-323.

Tarassov,I.A., Entelis,N.S., and Martin,R.P. (1995b). Mitochondrial import of a cytoplasmic lysine-tRNA in yeast is mediated by cooperation of cytoplasmic and mitochondrial lysyl-tRNA synthetases. EMBO J. 14, 3461-3471.

Tatuch,Y., Christodoulou,J., Feigenbaum,A., Clarke,J.T., Wherret,J., Smith,C., Rudd,N., Petrova-Benedict,R., and Robinson,B.H. (1992). Heteroplasmic mtDNA mutation (T---- G) at 8993 can cause Leigh disease when the percentage of abnormal mtDNA is high. Am. J. Hum. Genet. 50, 852-858.

Tatuch,Y. and Robinson,B.H. (1993). The mitochondrial DNA mutation at 8993 associated with NARP slows the rate of ATP synthesis in isolated lymphoblast mitochondria. Biochem. Biophys. Res. Commun. 192, 124-128.

Taylor,R.W., Birch-Machin,M.A., Bartlett,K., Lowerson,S.A., and Turnbull,D.M. (1994). The control of mitochondrial oxidations by complex III in rat muscle and liver mitochondria. Implications for our understanding of mitochondrial cytopathies in man. J. Biol. Chem. 269, 3523-3528.

124

Taylor,R.W., Chinnery,P.F., Turnbull,D.M., and Lightowlers,R.N. (1997). Selective inhibition of mutant human mitochondrial DNA replication in vitro by peptide nucleic acids. Nat. Genet. 15, 212-215.

Taylor,R.W., Chinnery,P.F., Turnbull,D.M., and Lightowlers,R.N. (2000). In-vitro genetic modification of mitochondrial function. Hum. Reprod. 15 Suppl 2, 79-85.

Thyagarajan,B., Padua,R.A., and Campbell,C. (1996). Mammalian mitochondria possess homologous DNA recombination activity. J. Biol. Chem. 271, 27536-27543.

Thyagarajan,D., Shanske,S., Vazquez-Memije,M., De Vivo,D., and DiMauro,S. (1995). A novel mitochondrial ATPase 6 point mutation in familial bilateral striatal necrosis. Ann. Neurol. 38, 468-472.

Timmers,A.M., Zhang,H., Squitieri,A., and Gonzalez-Pola,C. (2001). Subretinal injections in rodent eyes: effects on electrophysiology and histology of rat retina. Mol. Vis. 7, 131-137.

Tiranti,V., Savoia,A., Forti,F., D'Apolito,M.F., Centra,M., Rocchi,M., and Zeviani,M. (1997). Identification of the gene encoding the human mitochondrial RNA polymerase (h-mtRPOL) by cyberscreening of the Expressed Sequence Tags database. Hum. Mol. Genet. 6, 615-625.

Tolkunova,E., Park,H., Xia,J., King,M.P., and Davidson,E. (2000). The human lysyl- tRNA synthetase gene encodes both the cytoplasmic and mitochondrial enzymes by means of an unusual alternative splicing of the primary transcript. J. Biol. Chem. 275, 35063-35069.

Topal,M.D. and Fresco,J.R. (1976). Base pairing and fidelity in codon-anticodon interaction. Nature 263, 289-293.

Topper,J.N., Bennett,J.L., and Clayton,D.A. (1992). A role for RNAase MRP in mitochondrial RNA processing. Cell 70, 16-20.

Triepels,R.H., van den Heuvel,L.P., Trijbels,J.M., and Smeitink,J.A. (2001). Respiratory chain complex I deficiency. Am. J. Med. Genet. 106, 37-45.

Trifunovic,A., Wredenberg,A., Falkenberg,M., Spelbrink,J.N., Rovio,A.T., Bruder,C.E., Bohlooly,Y., Gidlof,S., Oldfors,A., Wibom,R., Tornell,J., Jacobs,H.T., and Larsson,N.G. (2004). Premature ageing in mice expressing defective mitochondrial DNA polymerase. Nature 429, 417-423.

Trounce,I., Neill,S., and Wallace,D.C. (1994). Cytoplasmic transfer of the mtDNA nt 8993 T-->G (ATP6) point mutation associated with Leigh syndrome into mtDNA-less cells demonstrates cosegregation with a decrease in state III respiration and ADP/O ratio. Proc. Natl. Acad. Sci. U. S. A 91, 8334-8338.

125

Trounce,I. and Wallace,D.C. (1996). Production of transmitochondrial mouse cell lines by cybrid rescue of rhodamine-6G pre-treated L-cells. Somat. Cell Mol. Genet. 22, 81-85.

Tsukihara,T., Aoyama,H., Yamashita,E., Tomizaki,T., Yamaguchi,H., Shinzawa-Itoh,K., Nakashima,R., Yaono,R., and Yoshikawa,S. (1995). Structures of metal sites of oxidized bovine heart cytochrome c oxidase at 2.8 A. Science 269, 1069-1074.

Tsukihara,T., Aoyama,H., Yamashita,E., Tomizaki,T., Yamaguchi,H., Shinzawa-Itoh,K., Nakashima,R., Yaono,R., and Yoshikawa,S. (1996). The whole structure of the 13- subunit oxidized cytochrome c oxidase at 2.8 A. Science 272, 1136-1144.

Turnbull,D.M. and Lightowlers,R.N. (2002). A roundabout route to gene therapy. Nat. Genet. 30, 345-346.

Uhlenbeck,O.C. (1987). A small catalytic oligoribonucleotide. Nature 328, 596-600.

Unseld,M., Marienfeld,J.R., Brandt,P., and Brennicke,A. (1997). The mitochondrial genome of Arabidopsis thaliana contains 57 genes in 366,924 nucleotides. Nat. Genet. 15, 57-61.

Uziel,G., Moroni,I., Lamantea,E., Fratta,G.M., Ciceri,E., Carrara,F., and Zeviani,M. (1997). Mitochondrial disease associated with the T8993G mutation of the mitochondrial ATPase 6 gene: a clinical, biochemical, and molecular study in six families. J. Neurol. Neurosurg. Psychiatry 63, 16-22. van Loon,A.P., Maarse,A.C., Riezman,H., and Grivell,L.A. (1983). Isolation, characterization and regulation of expression of the nuclear genes for the core II and Rieske iron-sulphur proteins of the yeast ubiquinol-cytochrome c reductase. Gene 26, 261-272. van Wilpe,S., Ryan,M.T., Hill,K., Maarse,A.C., Meisinger,C., Brix,J., Dekker,P.J., Moczko,M., Wagner,R., Meijer,M., Guiard,B., Honlinger,A., and Pfanner,N. (1999). Tom22 is a multifunctional organizer of the mitochondrial preprotein translocase. Nature 401, 485-489.

Vazquez-Memije,M.E., Shanske,S., Santorelli,F.M., Kranz-Eble,P., Davidson,E., DeVivo,D.C., and DiMauro,S. (1996). Comparative biochemical studies in fibroblasts from patients with different forms of Leigh syndrome. J. Inherit. Metab Dis. 19, 43-50.

Vestweber,D., Brunner,J., Baker,A., and Schatz,G. (1989). A 42K outer-membrane protein is a component of the yeast mitochondrial protein import site. Nature 341, 205- 209.

Vestweber,D. and Schatz,G. (1989). DNA-protein conjugates can enter mitochondria via the protein import pathway. Nature 338, 170-172.

126

Villani,G. and Attardi,G. (1997). In vivo control of respiration by cytochrome c oxidase in wild-type and mitochondrial DNA mutation-carrying human cells. Proc. Natl. Acad. Sci. U. S. A 94, 1166-1171.

Villani,G. and Attardi,G. (2000). In vivo control of respiration by cytochrome c oxidase in human cells. Free Radic. Biol. Med. 29, 202-210.

Villani,G., Greco,M., Papa,S., and Attardi,G. (1998). Low reserve of cytochrome c oxidase capacity in vivo in the respiratory chain of a variety of human cell types. J. Biol. Chem. 273, 31829-31836.

Vives,E., Brodin,P., and Lebleu,B. (1997). A truncated HIV-1 Tat protein basic domain rapidly translocates through the plasma membrane and accumulates in the cell nucleus. J. Biol. Chem. 272, 16010-16017. von Heijne,G. (1986). Mitochondrial targeting sequences may form amphiphilic helices EMBO J. 5, 1335-1342. von Jagow,G., Link,T.A., and Ohnishi,T. (1986). Organization and function of cytochrome b and ubiquinone in the cristae membrane of beef heart mitochondria. J. Bioenerg. Biomembr. 18, 157-179. von Meyenburg,K., Jorgensen,B.B., Nielsen,J., Hansen,F.G., and Michelsen,O. (1982). The membrane bound ATP synthase of Escherichia coli: a review of structural and functional analyses of the atp operon. Tokai J. Exp. Clin. Med. 7 Suppl, 23-31.

Wachter,C., Schatz,G., and Glick,B.S. (1992). Role of ATP in the intramitochondrial sorting of cytochrome c1 and the adenine nucleotide translocator. EMBO J. 11, 4787- 4794.

Walker,J.E. (1992). The NADH:ubiquinone oxidoreductase (complex I) of respiratory chains. Q. Rev. Biophys. 25, 253-324.

Wallace,D.C. (1997). Mitochondrial DNA in aging and disease. Sci. Am. 277, 40-47.

Wallace,D.C. (1999). Mitochondrial diseases in man and mouse 15. Science 283, 1482-1488.

Wallace,D.C. (2001). Mitochondrial defects in neurodegenerative disease. Ment. Retard. Dev. Disabil. Res. Rev. 7, 158-166.

Wallace,D.C., Singh,G., Lott,M.T., Hodge,J.A., Schurr,T.G., Lezza,A.M., Elsas,L.J., and Nikoskelainen,E.K. (1988). Mitochondrial DNA mutation associated with Leber's hereditary optic neuropathy. Science 242, 1427-1430.

White,S.L., Shanske,S., McGill,J.J., Mountain,H., Geraghty,M.T., DiMauro,S., Dahl,H.H., and Thorburn,D.R. (1999). Mitochondrial DNA mutations at nucleotide 8993 show a lack of tissue- or age-related variation. J. Inherit. Metab Dis. 22, 899-914.

127

Wiedemann,N., Frazier,A.E., and Pfanner,N. (2004). The protein import machinery of mitochondria. J. Biol. Chem. 279, 14473-14476.

Wiedemann,N., Pfanner,N., and Ryan,M.T. (2001). The three modules of ADP/ATP carrier cooperate in receptor recruitment and translocation into mitochondria. EMBO J. 20, 951-960.

Wiesner,R.J., Ruegg,J.C., and Morano,I. (1992). Counting target molecules by exponential polymerase chain reaction: copy number of mitochondrial DNA in rat tissues. Biochem. Biophys. Res. Commun. 183, 553-559.

Wilkens,S. and Capaldi,R.A. (1998). Electron microscopic evidence of two stalks linking the F1 and F0 parts of the Escherichia coli ATP synthase. Biochim. Biophys. Acta 1365, 93-97.

Witkovsky,P., Dudek,F.E., and Ripps,H. (1975). Slow PIII component of the carp electroretinogram. J. Gen. Physiol 65, 119-134.

Woischnik,M. and Moraes,C.T. (2002). Pattern of organization of human mitochondrial pseudogenes in the nuclear genome. Genome Res. 12, 885-893.

Wong,T.W. and Clayton,D.A. (1985). Isolation and characterization of a DNA primase from human mitochondria. J. Biol. Chem. 260, 11530-11535.

Xia,D., Yu,C.A., Kim,H., Xia,J.Z., Kachurin,A.M., Zhang,L., Yu,L., and Deisenhofer,J. (1997). Crystal structure of the cytochrome bc1 complex from bovine heart mitochondria. Science 277, 60-66.

Yang,D., Oyaizu,Y., Oyaizu,H., Olsen,G.J., and Woese,C.R. (1985). Mitochondrial origins. Proc. Natl. Acad. Sci. U. S. A 82, 4443-4447.

Yang,M.Y., Bowmaker,M., Reyes,A., Vergani,L., Angeli,P., Gringeri,E., Jacobs,H.T., and Holt,I.J. (2002). Biased incorporation of ribonucleotides on the mitochondrial L- strand accounts for apparent strand-asymmetric DNA replication. Cell 111, 495-505.

Yermovsky-Kammerer,A.E. and Hajduk,S.L. (1999). In vitro import of a nuclearly encoded tRNA into the mitochondrion of Trypanosoma brucei. Mol. Cell Biol. 19, 6253- 6259.

Yoon,Y.G. and Koob,M.D. (2003). Efficient cloning and engineering of entire mitochondrial genomes in Escherichia coli and transfer into transcriptionally active mitochondria. Nucleic Acids Res. 31, 1407-1415.

Yoshikawa,S., Shinzawa-Itoh,K., and Tsukihara,T. (1998). Crystal structure of bovine heart cytochrome c oxidase at 2.8 A resolution. J. Bioenerg. Biomembr. 30, 7-14.

128

Yoshionari,S., Koike,T., Yokogawa,T., Nishikawa,K., Ueda,T., Miura,K., and Watanabe,K. (1994). Existence of nuclear-encoded 5S-rRNA in bovine mitochondria. FEBS Lett. 338, 137-142.

Yuan,Y., Singh,R., and Reddy,R. (1989). Rat nucleolar 7-2 RNA is homologous to mouse mitochondrial RNase mitochondrial RNA-processing RNA. J. Biol. Chem. 264, 14835-14839.

Zeviani,M. and Antozzi,C. (1997). Mitochondrial disorders. Mol. Hum. Reprod. 3, 133- 148.

Zhang,C., Baumer,A., Maxwell,R.J., Linnane,A.W., and Nagley,P. (1992). Multiple mitochondrial DNA deletions in an elderly human individual. FEBS Lett. 297, 34-38.

Zhang,Z., Huang,L., Shulmeister,V.M., Chi,Y.I., Kim,K.K., Hung,L.W., Crofts,A.R., Berry,E.A., and Kim,S.H. (1998). Electron transfer by domain movement in cytochrome bc1. Nature 392, 677-684.

Ziegler,M.L. and Davidson,R.L. (1981). Elimination of mitochondrial elements and improved viability in hybrid cells. Somatic. Cell Genet. 7, 73-88.

Zolotukhin,S., Potter,M., Zolotukhin,I., Sakai,Y., Loiler,S., Fraites,T.J., Jr., Chiodo,V.A., Phillipsberg,T., Muzyczka,N., Hauswirth,W.W., Flotte,T.R., Byrne,B.J., and Snyder,R.O. (2002). Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28, 158-167.

Zuckerman,S.H., Solus,J.F., Gillespie,F.P., and Eisenstadt,J.M. (1984). Retention of both parental mitochondrial DNA species in mouse-Chinese hamster somatic cell hybrids. Somat. Cell Mol. Genet. 10, 85-91.

Zuker,M. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406-3415.

BIOGRAPHICAL SKETCH

I was born and raised in a suburb of Cleveland, Ohio. During high school, I spent one semester in a small town in northern Germany. In college, I continued my German studies and spent a semester in Graz, Austria. The rest of my college years were spent at

Ohio Wesleyan University in Delaware, Ohio, where I majored in genetics and German.

Immediately after college, I moved to Gainesville, Florida, where I have been pursuing my doctorate for seven and a half years.

129