Infectivity of Verticillium Dahliae Isolates on Weedy Hosts

INFECTIVITY OF VERTICILLIUM DAHLIAE ISOLATES ON WEEDY HOSTS,

LITCHI TOMATO, AND TEFF, AND THE EFFECT OF ALFALFA RESIDUE

INCORPORATION ON THE NUMBER OF VERTICILLIUM DAHLIAE

MICROSCLEROTIA, AND SOIL BACTERIAL METAGENOMICS

ZACHARY ANDREW FREDERICK

A dissertation submitted in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

WASHINGTON STATE UNIVERSITY Department of Plant Pathology

MAY 2017

To the Faculty of Washington State University:

The members of the Committee appointed to examine the dissertation of

ZACHARY ANDREW FREDERICK find it satisfactory and recommend that it be accepted.

______Dennis A. Johnson, Ph.D, Chair.

______Mark J. Pavek, Ph.D.

______Debra A. Inglis, Ph.D.

______Weidong Chen, Ph.D.

ii ACKNOWLEDGMENTS

I thank Dr. Dennis A. Johnson for the opportunity to pursue the study of plant pathology, cooperative extension, and potato disease at Washington State University through his program. I also thank Thomas F. Cummings for instruction and support of establishing trials, as well as guidance on statistical analyses. I wish to thank my committee members, Drs. Mark J. Pavek,

Debra A. Inglis, and Weidong Chen for their critiques and guidance. I am grateful for my present and former members of my laboratory workgroup, including David Wheeler and Dr. Lydia

Tymon for direction and toleration of my contributions to entropy, as well as Dr. Jeremiah Dung for his isolates and copious notes left behind. Would you kindly join me in extending special thanks to Dr. Kerik Cox, who continues to serve as an additional adviser. Last, but certainly not least, I give thanks for family and my fiancée for reminding me that there is always a man, always a lighthouse, and always a city.

iii

INFECTIVITY OF VERTICILLIUM DAHLIAE ISOLATES ON WEEDY HOSTS,

LITCHI TOMATO, AND TEFF, AND THE EFFECT OF ALFALFA RESIDUE

INCORPORATION ON THE NUMBER OF VERTICILLIUM DAHLIAE

MICROSCLEROTIA, AND SOIL BACTERIAL METAGENOMICS

Abstract

by Zachary Andrew Frederick, Ph.D. Washington State University May 2017

Chair: Dennis A. Johnson

Verticillium wilt, caused by Verticillium dahliae, is an important disease of many dicotyledonous crops due to a wide host range and the long-term survival of microsclerotia in soil for up to 14 years. Some V. dahliae isolates are aggressive on a specific plant host, such as potato, but can still infect a range of crops. Isolates of V. dahliae that are aggressive on potato are referred to as the potato pathotype. Litchi tomato (Solanum sisymbriifolium) has been grown as a trap crop for the pale cyst nematode in Idaho and teff (Eragrostis tef) could be a short- season rotation crop in the northwestern United States. It is unknown if litchi tomato, teff, or weeds could serve as sources of inoculum for the potato pathotype of V. dahliae. When sixteen weeds were evaluated for V. dahliae, black nightshade (Solanum nigrum) had significantly more microsclerotia of the V. dahliae potato pathotype compared to the other isolates in three of four greenhouse trials (second trial P < 0.0158, third trial P < 0.0264, fourth trial P < 0.0193). There were no differences in numbers of microsclerotia between isolates of V. dahliae in infected teff,

while on litchi tomato the potato pathotype of V. dahliae produced greater numbers of microsclerotia than other isolates in one of six trials (first trial FDR-adjusted P < 0.0149). Soil incorporation of alfalfa residues prior to planting potato could be a Verticillium wilt management strategy by reducing the number of viable microsclerotia in field soil. The impact of incorporating alfalfa residue on soil metagenomics is unknown. The number of V. dahliae microsclerotia in soil where alfalfa was incorporated was greater than when residue was not incorporated (P = 0.0003) when field soils were subject to soil fumigation with chloropicrin. The soil bacterial metagenome in field soils subjected to alfalfa residue incorporation did not differ from those not subject to residue incorporation after one year. Alfalfa residue incorporation alone did not reduce V. dahliae microsclerotia in the soil or impact soil metagenomics; the practice by itself was not an effective strategy to induce a disease-suppressive soil on short rotations.

TABLE OF CONTENTS

Page

ACKNOWLEDGMENTS…………………..…………………………………………………....iii

ABSTRACT ………………………………………………………………………….…….….iv-v

LIST OF TABLES ………….……….…………………………………………...….….…....ix-xii

LIST OF FIGURES …………………..………………….…………………………....………..xiii

CHAPTER ONE: Introduction...... 1

1. Solanaceae and Solanum origin…………………...……………………...... ………….1

2. How is potato production important to Washington State? ………………………...... 3

3. Verticillium – taxonomy, symptoms, and life cycle………………………….………...4

4. Verticillium wilt management…………...……………………...….…………………11

5. Weedy hosts as sources of Verticillium dahliae inoculum……………………………15

6. Black dot – problem, symptoms, and biology…………..………………...... …….16

7. Black dot – management………………………...……………………...... ……...... 18

8. Research Objectives...... 19

9. Literature cited…………………………………...………………..………………...... 23

CHAPTER TWO: Evaluation of Solanum sisymbriifolium as a Potential Inoculum Source of

Verticillium dahliae and Colletotrichum coccodes………………………………………………39

1. ABSTRACT……………….………………...………………………………………...39

2. INTRODUCTION ………………………………....……………………………...... 40

3. MATERIALS AND METHODS……………………………………………………...43

4. RESULTS………………………………………………………………………...... 49

5. DISCUSSION…………………………………………………………………………51

6. ACKNOWLEDGMENTS..…………………………………………………………...55

7. LITERATURE CITED…………………………...……………...... ……………...57

8. TABLES………………………………………………………………………………61

CHAPTER THREE: Susceptibility of Weedy Hosts from Pacific Northwest Potato Production

Systems to Crop-Aggressive Isolates of Verticillium dahliae…………...... ………...………….68

1. ABSTRACT…………………………………………………………………………...68

2. INTRODUCTION.………………………………………………………………...... 69

3. MATERIALS AND METHODS……………………………………………………...72

4. RESULTS…………………………………………………………………………...... 77

5. DISCUSSION…………………………………………………………………………81

6. ACKNOWLEDGEMENTS…………………………………………………………...83

7. LITERATURE CITED……………………………………...... …………...86

8. TABLES……………………………....………………………………………………90

9. FIGURE………………………………….………………………………………...... 99

CHAPTER FOUR: The Effect of Alfalfa Residue Incorporation on Soil Bacterial Communities and the Quantity of Verticillium dahliae Microsclerotia in Potato Fields in the Columbia Basin of

Washington State, USA...... 103

1. ABSTRACT……………………………………………………………………….....103

2. INTRODUCTION ………………………………………………………………...... 104

3. MATERIALS AND METHODS…………………………………………………….108

4. RESULTS……………………………………………………...………………….....116

5. DISCUSSION………………………………………………………………………..120

6. ACKNOWLEDGMENTS..………………………………………………………….122

vii

7. LITERATURE CITED……………………………………...... ………….123

8. TABLES…………………………………………………………………………..…128

CHAPTER FIVE: The Low Potential of Teff (Eragrostis tef) as an Inoculum Source for

Verticillium dahliae...... 142

1. ABSTRACT……………………………………………………………………….....142

2. INTRODUCTION ………………………………………………………………...... 143

3. MATERIALS AND METHODS…………………………………………………….146

4. RESULTS……………………………………………………...………………….....149

5. DISCUSSION………………………………………………………………………..151

6. ACKNOWLEDGMENTS.………………….……………………………………….152

7. LITERATURE CITED……………………………………...... ………….153

8. TABLE……………………………...……………………………………………..…157

9. FIGURES………………………………………………………………..………...... 158

CHAPTER SIX: Conclusions...... 160

1. LITERATURE CITED...... 165

viii

LIST OF TABLES

1. Table 1. Verticillium dahliae and Colletotrichum coccodes isolates used to confirm host status of litchi tomato (Solanum sisymbriifolium)...... ………….……61

2. Table 2. Verticillium dahliae potato pathotype microsclerotia counts (CFU/g) from eggplant, potato, or litchi tomato (Solanum sisymbriifolium) stems at senescence by initial V. dahliae colony forming units (CFU)/g potting medium………………………………………………….62

3. Table 3. Mean number of Verticillium dahliae microsclerotia from stems of three potato cultivars Alturas, Russet Norkotah, and Ranger Russet, and litchi tomato in a greenhouse experiment in 2013………………………………………………………………………………63

4. Table 4. Mean number of Verticillium dahliae CFU from stems and roots of three potato cultivars Alturas, Russet Norkotah Ranger Russet, and litchi tomato (Solanum sisymbriifolium) in a greenhouse in 2014……………………………………...……………………………….64-65

5. Table 5: Mean number of Colletotrichum coccodes CFU from stems and roots of three potato cultivars Alturas, Russet Norkotah Ranger Russet, and litchi tomato (Solanum sisymbriifolium) in a greenhouse in 2013 and 2014……………………………………………….…...... ……….66

6. Table 6: Mean number of Verticillium dahliae or Colletotrichum coccodes CFU from stems of potato and litchi tomato (Solanum sisymbriifolium) in the 2014 field trial in Othello, WA and the

2015 field trials in Prosser, WA and Powell Butte, OR………………………………………….67

7. Table 1. Weed plants and crop hosts, number of trials, and isolate characteristics of

Verticillium dahliae used to determine microsclerotia production when potential host plants were inoculated with V. dahliae host-adapted isolates in four greenhouse trials in 2014-2016...…90-91

8. Table 2. Mean and standard error for the number of microsclerotia from eight isolates obtained from 13 weedy hosts in the greenhouse when inoculated with Verticillium dahliae in the first trial...... 92-94

9. Table 3. Mean and standard error for the number of microsclerotia from eight isolates obtained from 12 weedy hosts and one crop in the greenhouse when inoculated with Verticillium dahliae in the second trial...... 95-97

10. Table 4. Mean and standard error for the number of microsclerotia from eight isolates obtained from seven weedy hosts and two crop in the greenhouse when inoculated with

Verticillium dahliae in the third trial...... 98-99

11. Table 5. Mean and standard error for the number of microsclerotia from eight isolates obtained from 12 weedy hosts and one crop in the greenhouse when inoculated with Verticillium dahliae in the fourth trial...... 100-101

12. Table 1: Fields and treatment structure employed to determine if soil inoculum density of

Verticillium dahliae in field soils where alfalfa residue from previous crops was incorporated into soil were different than field soils where alfalfa residues were not incorporated in 2014 and

2015...... 128-129

13. Table 2. Primers employed to amplify an approximately 250 bp amplicon from bacterial 16S rRNA for bacterial taxa classification from soil samples collected in 2014 and 2015...... 130

14. Table 3: Pairwise comparisons between fields where alfalfa crop residue was or was not incorporated. Mean Verticillium dahliae microsclerotia/g for both soil and potato plant samples are presented...... 131

15. Table 4: Pairwise comparisons between chloropicrin-fumigated fields and fields with no fumigation for mean Verticillium dahliae microsclerotia/g for both soil and potato plant samples...... 132

16. Table 5: Percentage carbon and nitrogen, as well as potato yield data from fields where alfalfa residue was and was not incorporated in 2015...... 133

17. Table 6: The number of bacterial genera sequences recovered and Inverse Simpson measure of diversity from soil samples where alfalfa residue was or was not incorporated. The soil samples were collected in 2014...... 134-135

18. Table 7: Bacterial genera that contributed to the top 33% dissimilarity between soil samples where alfalfa residue was or was not incorporated. The soil samples were collected in

2015...... 136-139

19. Table 8: The number of bacterial genera1 and diversity measures2 (Shannon’s H and Inverse

Simpson) where alfalfa residue had or had not been incorporated. These soil samples were collected in 2015...... 140-141

20. Table 1: The isolates of Verticllium dahliae used in in two greenhouse trials in 2014 and

2016 to evaluate if teff (Eragrostis tef) is susceptible to V. dahliae infection, and if teff is susceptible to potato or mint pathotypes of V. dahliae...... 157

xii

LIST OF FIGURES

Fig. 1. Summary of the number of trials where a V. dahliae pathotype or isolate was more aggressive than the other isolates. Aggressiveness (Differential effect of pathotype) was determined by a greater number of microsclerotia were produced from one isolate than the other isolates for a specific weedy host. The host of origin or the pathotype of the V. dahliae isolate is written within or above each bar, and the weedy host evaluated is along the horizontal axis....102

Fig. 1: The mean number of Verticllium dahliae microsclerotia observed in the stems and roots of teff and eggplant for each V. dahliae isolate in 2014. No one V. dahliae pathotype produced significantly greater numbers of microsclerotia than any other isolate in stems (false discovery rate corrected P < 0.006) or roots (false discovery rate corrected P < 0.007). The control plants for both teff and eggplant were noninoculated...... 158

Fig. 2: The mean number of Verticllium dahliae microsclerotia observed in the stems and roots of teff and eggplant for each V. dahliae isolate in 2016. No one V. dahliae pathotype produced significantly greater numbers of microsclerotia than any other isolate in stems (false discovery rate corrected P < 0.006) or roots (false discovery rate corrected P < 0.007). The control plants for both teff and eggplant were noninoculated...... 159

xiii

CHAPTER ONE

Introduction

Solanaceae and Solanum origin

The nightshade family (Solanaceae) is a medium-sized family of flowering plants that consists of approximately 90 genera and 3000 to 4000 plant species. The members of Solanaceae are currently found on all continents except Antarctica and are diverse in terms of habit, morphology, and ecology. Members of Solanaceae include annual herbs, epiphytes, lianas, shrubs, trees, and vines. Central and South America have long been considered the center of diversity for Solanaceae, although other centers of diversity for species within Solanaceae include Australia and Africa (Planetary Biodiversity Inventories (PBI) Solanum Project). South

America, particularly along the Andes mountains, is where the greatest diversity of plants from

Solanaceae have been recorded (PBI Solanum Project). Plants from the Solanaceae are often found as secondary vegetation in disturbed areas in different ecosystems, but species from this family can occupy habitats ranging from deserts to tropical rainforests (Heywood 1978).

An important genus in Solanaceae is Solanum. Members of this genus are classified as herbs, shrubs, trees, or vines that may be with or without spines or glandular hairs. Prickles

(often called spines) are key to the identification of certain species with Solanum (D’Arcy 1972;

1973). These prickles are found on the stems, leaves, and calyx and can be straight or recurved, and thin and needle-like to very broad. Leaves of plants in Solanum vary greatly and may be alternate or paired, often unequal in size, simple or compound, petiolate or sessile. The inflorescence is always cymose, although the inflorescence may be branched or unbranched.

Flowers of the genus Solanum are actinomorphic or zygomorphic symmetry. Stamens from flowers in the genus are equal or unequal, the filaments are short and inserted at the corolla base, with the anthers basifixed, blunt or tapered toward apex. Ovaries of genus Solanum contain many ovules housed in a slender style with articulated base and capitate stigma. The fruit is classified as a fleshy berry, usually green, with many flattened seeds (D’Arcy 1972; 1973).

The potato (Solanum tuberosum) has attracted the attention of humans for approximately the last 7,000 years. The inhabitants of the Andes Mountains in South America are attributed as those who first took interest in the starchy underground tubers. These tubers were nutrient-rich and could be stored and transported easily, which was of importance to the nomadic hunter- gatherers. The plant also proved useful to human society as populations settled and began domesticating animals and growing plants for food (Brown and Henfling 2015 ).

Spanish explorers and missionaries who arrived in South America in the 16th century witnessed highly organized societies that were coupled with agricultural cropping systems. These systems included hundreds of types of potatoes and related plants. The potato proved suitable for long distance transport and storage, and the potato was first introduced to Europe via the Canary

Islands and then into Spain (approximately 1567 C.E.). The potato was noted in these islands as a health food that replenished the strength of those it was fed to. It wasn’t until the potato was introduced to Piedmont in northern Italy that it began to be cultivated as food for the poor. The potato became the foodstuff of Protestant groups that fled north to escape religious persecution.

For these groups of people, the potato proved useful again because of it could be transported and stored for many months (Brown and Henfling 2015 ), provided nourishment in the form of

carbohydrates, fiber, and minerals (Brown and Henfling 2015 ; Kon et al. 1928), and escaped taxation at the mill (Brown and Henfling 2015 ).

The introduction of potato in North America took place through two routes: the migration of people bringing potatoes from South to North America (via Central America), and by people moving potatoes from Europe to North America. The earliest surviving records indicate the potato was brought to Jamestown, Virginia sometime between 1620-1629 (Zhang et al. 2010).

There is much conjecture that obscures the true reasons for this movement, which implies that many factors contributed to this outcome. Movement of the potato, and mass potato cultivation, from South to North America (via Central America) was facilitated by Spanish forts built to establish dominance over these regions. The gradual movement from south-to-north has been assumed to be done by troops and mariners over the course of the 16th to 18th centuries (Zhang et al. 2010). The potato also moved from Jamestown westward through modern-day Canada by the

Hudson Bay Company (Suttles 1951).

How is potato production important to Washington State?

Potato production in Washington State occurs primarily in the Columbia Basin and the

Skagit Valley. Volcanic soils, readily available water from precipitation or irrigation districts, cool nights, and the long growing season contribute to the success of Washington potato production (WSDA 2015). Potato production is important to Washington State agriculture, as its dollar value ranks third after aquaculture and tree fruit. Approximately 170,000 acres of processing potatoes were planted in Washington State in 2015 with an average yield of 590

CWT/acre, which is the highest known yield per acre in the United States and presumably for the

world. Washington potato production was highest in Grant County in 2008 and Franklin County in 2009, with 20,606,000 and 20,798,000 CWT harvested in 2008 and 2009 respectively. There were 238 farms in Washington State growing 123,768 acres of processing potatoes in 2012, compared to 1,015 farms growing 40,157 acres of fresh market potatoes in the same year (NASS

2016). There were fewer farms growing potatoes for processing in Washington State, but these processing farms generally plant greater acreage than fresh market potatoes in 2012. For example, there were 28 farms with over 1000 acres of processing potatoes, whereas there were only 14 farms with over 1000 acres of fresh market potatoes (NASS 2016). Washington State is a lead producer in the United States of potatoes destined for the processing market (WSDA

2015).

Verticillium – taxonomy, symptoms, and life cycle

Verticillium wilt, caused by the soil-borne fungus Verticillium dahliae Kleb., is one of the most important diseases of dicotyledonous crop plants in North America (Agrios 2005; Bhat and Subbarao 1999; Malik and Milton 1980), including potato (Johnson and Miliczky 1993;

Omer et al. 2008). V. dahliae has been also reported as a pathogen of barley (Hordeum vulgare), a monocotyledonous crop (Mathre 1989). Mathre (1989) noticed symptoms associated with

Cephalosporium stripe (caused by Cephalosporium gramineum) on spring-sown barley noted it was unusual “because this pathogen [C. gramineum] primarily attacks fall-sown [barley] crops whose roots experience wounding during winter”. Mathre (1989) isolated and identified the pathogen in spring-sown barley as V. dahliae by morphological features in culture, although

Mathre stated that Verticillium wilt was unlikely to become a major pathogen of cereal crops.

Some of the earliest reports of Verticillium wilt on potato are from Germany in 1879

(Reinke and Berthold 1879, by Isaac and Harrison 1968), indicating that the disease has been associated with potatoes for over a century. Verticillium wilt was identified as a major limiting factor to potato production about 70 years later (Isaac and Harrison 1968). One possibility for this delay is that symptoms associated with Verticillium wilt were confused with poor nutrition or poor water management, leading to many cases being incorrectly identified and the problem largely understated (Isaac and Harrison 1968).

The Verticillium genus was established in 1817 by Nees von Esenbeck (1817) in

Germany upon the description of Verticillium tenerum isolated from hollyhock (Alcea rosea L.)

(Saccardo 1886). Until recently, V. dahliae was classified with phylum Deuteromycota with the

Fungi Imperfecti, as no sexual phase has been discovered (Klosterman et al. 2009). Verticillium still has no known sexual form (Inderbitzen et al. 2011; Klosterman et al. 2009), but is now classified within phylum Ascomycota and to the family Plectosphaerellaceae (Inderbitzen et al.

2011). Verticillium now contains approximately 11 species that are pathogenic on plants

(Inderbitzen and Subbarao 2014). DNA sequence data have provided insight that distantly related species once categorized as Verticillium now belong to other genera, causing the genus to be redefined with V. dahliae as the type species (Inderbitzen and Subbarao 2014).

V. dahliae has been characterized by the following morphological features: hyaline and septate hyphae, verticillate conidiophores, slimy terminal amerospores, irregularly-shaped and melanized microsclerotia, and the absence of the yellow pigment called flavexudan (Inderbitzin and Subbarao 2014; Inderbitzen et al. 2011). Verticillium dahliae mycelium is septate and

multinucleate, but not distinctive. Conidia are oval in shape and produced on long phialides that are whorled around the conidiophores; this whorled appearance is called ‘verticillate’, and this is the basis upon which the genus was named (Fradin and Thomma 2006). The presence of flavexudan (yellow pigment in culture), microsclerotia, specific host ranges, Vegetative

Compatibility Groups (VCGs), and mating types have been used in differentiating Verticillium species (Inderbitzen et al. 2011; Inderbitzen and Subbarao 2014). PCR tests based on the internal transcribed spacer region (ITS) between the small and large ribosomal subunits have been proposed and vetted for comparing sequences of individual isolates for correct species identification, as morphological techniques alone have not differentiated all species of

Verticillium, such as the difference between V. dahliae and V. longisporum (Inderbitzin and

Subbarao 2014; Inderbitzen et al. 2011).

The symptoms of Verticillium wilt in dicotyledonous hosts can include stunting, wilting, chlorosis, anthocyanescence, and premature senescence (Agrios 1997; 2005), and are often most apparent on mature plants (Krikun and Orion 1979). Verticillium wilt symptoms vary among hosts, limiting the number of characteristic symptoms that can enable correct disease identification based on symptoms alone. Typical wilting symptoms display in the oldest shoots as V. dahliae compromises the functionality of the vascular system, and are more striking during the summer when plants are water stressed (Fradin and Thomma 2006). The only characteristic symptom of Verticillium wilt of potato is unilateral chlorosis and necrosis (Bowden et al. 1990;

Johnson and Dung 2010; Isaac and Harrison 1968; Powelson and Rowe 1993). Unilateral chlorosis is defined as “chlorosis [yellowing] of one or more leaves towards the stem apex, and the chlorotic leaves curve towards the [a]ffected side of the plant” (Mace et al. 1981). Isaac and

Harrison (1968) added that unilateral chlorosis is only a diagnostic symptom of V. dahliae infection if the symptom occurs only on part of the potato leaflet, but not the entirety of the leaflet, and is distinguishable from natural senescence in that the chlorosis develops prior to the rest of the plant senescing. As disease develops, the chlorosis spreads throughout the remainder of the plant, leaves wilt, and tissue necrosis begins (Mace et al. 1981). The widespread chlorosis symptom at advanced stages of disease is not diagnostic of V. dahliae infection (Isaac and

Harrison 1968).

Colonization of potato roots by V. dahliae microsclerotia and invasion of the plant vasculature by conidia occurs throughout the growing season, however symptoms are most apparent later in the season when tuber are increasing in weight (tuber bulking) (Johnson and

Miliczky 1993; Rowe and Powelson 1993). Symptoms on potato plants include interveinal chlorosis, wilting, and tissue necrosis from the crowns to the apexes of diseased plants (Johnson and Dung 2010; Powelson and Rowe 1993). Stems of infected plants may remain erect after senescence. Microsclerotia form upon and within stems of senescing plants and are incorporated throughout the soil profile by cultivation and decomposition (Pegg and Brady 2002).

Microsclerotia are thought to be formed when V. dahliae is not actively parasitizing host tissue, but when V. dahliae is functioning as a saprotroph on dead tissue or cultural media (Mace et al.

1981).

Microsclerotia function as the primary source of inoculum of V. dahliae (Schnathorst,

1981). Mycelium and clusters of hyaline cells can survive in field soil, but do not remain viable after drying (DeVay et al. 1974; Schnathorst and Vogle 1974). Microsclerotia densities in soil

are generally greatest in the top 10 to 30 cm of soil (Jordon 1971; Taylor et al. 2005), and are generally distributed near the place where an infected plant decomposed (Mace et al. 1981).

Viable microsclerotia persist in soil for 14 years or more (Wilhelm 1955) and may be found embedded in host tissue or freely existing in soil (Mace et al. 1981). Multiple resources (Brown and Wyllie 1970; Mace et al. 1981; Schnathorst 1981) noted heterogeneity in cell morphology of the melanized cells that compose a microsclerotium and have hypothesized that this mechanism ensures that every cell does not germinate when conditions are optimal. Mace, Bell, and

Beckman (1981) stated that each cell in a microsclerotium is in a different state of dormancy, hence microsclerotia can remain viable for many years. Conidia are not considered to be part of

V. dahliae long-term survival, as they are rendered non-viable after minutes of drying or exposure to high temperatures (Mace et al. 1981; Schnathrost 1981).

Root exudates from host and non-host plants stimulate microsclerotia to germinate (Mol et al. 1995; Pegg and Brady 2002). Successful infections of host plants generally occur near root tips and root hairs (Nelson 1950; Pegg and Brady 2002; Klosterman et al. 2009). Root penetration can occur quickly in some hosts in as fast as six hours post inoculation in peppermint

(Nelson 1950). Colonization of vascular tissues occurs after host plant infection via conidia in the xylem (Beckmann 1987; Pegg and Brady 2002; Klosterman et al. 2009). Symptom expression occurs after the upward movement of conidia causes them to lodge in xylem perforations or pitted walls and the conidia germinate. Conidia can be formed in as few as three days after infection, and are produced on simple conidiophores within plant vasculature instead of on the verticillate conidiophores observed in culture (Mace et al. 1981). Once germinated conidia begin to colonize the vasculature and surrounding cortical tissues, the host responds by

producing tyloses. The combination of conidia and hyphae, as well as the host responses, blocks xylem vessels and leads to symptom expression in a susceptible host (Beckmann 1987; Pegg and

Brady 2002; Klosterman et al. 2009). Yield loss from V. dahliae infection of potato has been shown, in part, to be due to a decrease in photosynthesis caused by stomatal closure in response to drops in turgor pressure, which was initially caused by xylem blockage with V. dahliae conidia (Bowden et al. 1990). The difference between a V. dahliae susceptible cultivar and tolerant cultivar (as defined by Mace et al. 1981) is the number of xylem vessels colonized, not the degree of mycelial development. It is now understood that what was meant by a tolerant cultivar by Mace, Bell, and Beckman (1981) was a resistant cultivar. Caldwell et al. (1966) states

“tolerance enables a susceptible plant to endure severe attack…without sustaining severe losses in yield or quality”. Verticillium dahliae infection and mycelial development occurs in both resistant and tolerant hosts, but a tolerant host shows no impact on yield or quality despite severe infection and colonization of many xylem vessels. The absence of yield data, as well as the plant resisting infection through decreased xylem colonization, leads to the conclusion that resistance was the observed phenomenon from Mace, Bell, and Beckman (1981).

Several structural barriers to V. dahliae conidia germination and colonization within plant host xylem have been described, and have possible ramifications as part of a host resistance response (Klosterman et al. 2009). “Dark gum” prevented hyphae from entering the root cortex of cotton (Garber 1973), while lignified and thickened cell walls surrounded V. dahliae hyphae in resistant potatoes (Mace et al. 1981; Perry 1983a; 1983b). In tomato (Solanum lycopersicum), an R gene (Ve gene) confers resistance to V. dahliae race 1 (Diwan 1999; Kawchuck et al. 2001).

The Ve gene encodes for an R gene with structures that resemble cell-surface glycoproteins that

signal receptor-mediated endocytosis, which is followed by ubiquitinization and degradation of proteins (Kawchuck et al. 2001). All forms of characterized resistance center on limiting continued xylem colonization cell-to-cell by V. dahliae.

Infection of potato by V. dahliae can occur whenever microsclerotia are present, but moderate to severe epidemics of Verticillium wilt typically arise when a minimum of 5 to 30 of

V. dahliae microsclerotia per gram of soil are present in soil where a susceptible crop is planted

(Powelson and Rowe 1993). Soils from fields where Verticillium wilt has been considered a problem for potato, cauliflower, or other dicot crops can have 75 microsclerotia per gram of soil

(Mace et al. 1981; Schnathrost 1981), and studies where soil was artificially infested considered

10 microsclerotia per cubic centimeter of soil to be a low level of inoculation (Dung et al.

2012b). Differences in severity of Verticillium wilt and V. dahliae microsclerotia counts were initially suspected to be due to differences in sampling methods, however a study by Devay et al.

(1973) demonstrated the similarity in final microsclerotia counts using several competing methods simultaneously. Since the 1980’s, the disparity in Verticllium wilt severity and soil microsclerotia count has been attributed to V. dahliae host adaptation (Mace et al. 1981;

Schnathrost 1981).

Individual V. dahliae isolates can have greater or lesser host specificity (Bhat and

Subbarao 1999), despite retaining a wide host range (Bhat and Subbarao 1999; Subbarao et al.

1995). These isolates are called host-adapted pathotypes (Dung et al. 2013, 2012a, 2010; Pegg and Brady 2002). Additional evidence shows this host adaptation can occur over a relatively short period of time for both annual and perennial cropping systems such as pepper and mint

(Bhat et al. 2003; Fordyce and Green 1960). In wild mint (Mentha arvensis), the difference in disease severity between mint pathotype and potato pathotype was evident three to four weeks after root dip inoculation in V. dahliae conidial suspension. Inoculations of M. arvensis conducted with the V. dahliae mint pathotype resulted in complete wilt and necrosis, whereas inoculations with the potato pathotype did not (Dung et al. 2010). Certain V. dahliae host- adapted pathotypes have been associated with Vegetative compatibility groups (VCGs) (Katan

2000), although this observation is not true for all isolates scored to a VCG (Bhat and Subbarao

1999; Dung et al. 2012a).

Verticillium dahliae VCGs are scored by complementation of nitrate-nonutilizing (nit) mutants that are generated in culture on 1% potassium chlorate-amended medium (Joaquim and

Rowe 1990, 1991). V. dahliae isolates from potato and mint are often characterized as VCG 4A and 2B, respectively (Douhan and Johnson 2001; Dung et al. 2012a). Dung et al. (2012a) concluded that V. dahliae generally reproduces clonally, and the chance of sexual reproduction was very low based on this evidence.

Verticillium wilt - management

Verticillium wilt of potato limits potato production worldwide. Development of

Verticillium wilt epidemics depends on the presence of microsclerotia in field soil prior to planting (Schnathorst 1981). Reducing of the number of V. dahliae microsclerotia, or limiting their ability to germinate, is an important consideration in potato fields prior to planting (Mace et al. 1981). Aggressiveness of V. dahliae host-adapted pathotypes may also be important to the development of Verticillium wilt epidemics, although the role of these pathotypes has not been

fully determined. No fungicides are currently available to manage Verticillium wilts (Fradin and

Thomma 2006). Successful Verticillium wilt management hinges on the combined effects of chemical treatments (soil fumigants), suppressive soils, resistant cultivars (when available), and irrigation management (Johnson and Dung 2010; Pegg and Brady 2002).

Soil fumigation with metam sodium, especially in combination with 1,3-dichloropropene, has been effective in reducing V. dahliae soil population densities, thereby increasing potato yields (Hamm et al. 2003). Historically, soil fumigation with methyl bromide (Mace et al. 1981) and chloropicrin (Wilhelm et al. 1956) has increased potato yield by suppressing soil populations of nematodes, weed seeds, and disease-causing organisms such as V. dahliae, until regulations concerning the use of methyl bromide rendered it largely unavailable after 2006 (Zasada et al.

2010). The fumigant concentration available in soil is also an important disease management consideration in addition to which fumigant is selected. For example, the soil concentration of methyl bromide necessary to kill 90% of V. dahliae microsclerotia within 30 hours of exposure was three times greater than what is required for oomycete pathogens like Phytophthora parasitica and P. cinnamomi (Munnecke et al. 1978).

Cultural practices such as soil cultivation (Taylor et al. 2005) and irrigation (Cappaert et al. 1992) can be effective at reducing V. dahliae soil populations, especially in combination with soil fumigation (Taylor et al. 2005). Soil fumigation using certain chemistries is also effective as a standalone treatment as well (Hamm et al, 2003). Tillage techniques can alter the distribution of V. dahliae in soil profiles (Taylor et al. 2005) thereby altering the inoculum density in the 10 to 30 cm depths at which V. dahliae microsclerotia are normally found (Taylor et al. 2005;

Jordon 1971). Tillage in combination with fumigation can reduce V. dahliae population densities in the uppermost soil horizons (Taylor et al. 2005). Verticillium wilt severity can increase with early season irrigation in potato, especially as water is introduced earlier in the growing season

(Cappaert et al. 1992).

Disease-suppressive soils could potentially reduce the number of viable V. dahliae microsclerotia, or at least suppress their growth. The specific mechanisms responsible for disease-suppressive soil are currently the focus of intense study, and all aspects have not been fully characterized. Two possible hypotheses have been put forwards as hypothetical mechanisms of Verticillium-suppressive soil: the volatile (Mayton et al. 1996) and lignin- melanin hypotheses (Butler and Day, 1998). The volatile hypothesis focuses on the breakdown of crucifer residues and the release of different volatile agents, such as allyl isothiocyanate, through decomposition and the toxic properties of these volatiles to V. dahliae (Mayton et al.

1996). The lignin-melanin hypothesis focuses on the similarities between enzymatic pathways that degrade lignin in buried crucifer residues that also have the potential of degrading melanin, which is a key constituent of V. dahliae microsclerotia (Butler and Day 1998). In both cases, the disease-suppressive soil can be promoted by incorporating relatively large amounts of either green manures or plant residues of specific crops into greenhouse and field soils (Larkin and

Halloran 2014; Harrison 1976).

Research linking practices of residue incorporation and disease-suppressive soil has taken place over decades and has yet to fully explore how best to implement these changes in actual cropping systems in different types of environments. The “magnitude” in reduction of V. dahliae

viable microsclerotia through residue incorporation varies with soil type, crop residue type, and how much biomass is returned to the soil (DeBode et al. 2005). For example, incorporation of ryegrass residues reduced V. dahliae microsclerotia counts only in soils of fine sandy texture with a pH of 7.0 and 3.6% organic matter (DeBode et al. 2005). Many have noted that specific methods must be employed in the process of incorporating crop residues in order to reduce V. dahliae microsclerotia counts in soil. These methods include which crop is incorporated, how the soil is covered, and when the crop residues are incorporated. Davis et al. (1996) determined that incorporating sudangrass and corn residues increased potato yields in fields infested with V. dahliae. Debode et al. (2005) noted that crucifer residue incorporation was not as successful at eliminating viable V. dahliae in the soil when the soil was not covered post-incorporation, which lessened the escape of volatile, toxic agents. Timing of residue incorporation is also important, as

Ioannou et al. (1977) suggested that burial prior to microsclerotia formation deprives the fungus of the oxygen needed to form microsclerotia.

Residue incorporation as a means of killing or suppressing V. dahliae microsclerotia in soil has long focused on crucifers and the mechanism has been characterized (Bending and

Lincoln 1999). In general, the mechanism relies on microsclerotia proximity to the release of toxic isothiocyanates (ITC) and a mixture of other volatile compounds during crucifer decomposition in soil. However, another possible mechanism that explains how a broader array of non-crucifer crops can be incorporated into soil to suppress V. dahliae in soil and is referred to as the lignin-melanin hypothesis (Debode et al. 2005). More specifically, in certain soil types, ryegrass and corn incorporation can reduce viable V. dahliae microsclerotia in soil. Debode et al.

(2005) interpreted these results as indicators that a non-specific plant compound, such as lignin,

was responsible for this effect given the similar reduction in viable V. dahliae microsclerotia with several lignin extracts. Residues of other crops could have similar effects, but have not been experimentally validated.

Weeds as sources of V. dahliae inoculum

Weeds present in the field are competitors for water, nutrients, sunlight, and space (Baker

1974). Hairy nightshade (Solanum physalifolium) at a density of one or three plants per 3-ft row of potato can reduce U.S. No. 1 yield of potato cultivars Russet Norkotah and Russet Burbank by up to 27% and 10%, respectively (Hutchinson et al. 2011). One barnyard grass (Echinochloa crus-galli (L). P. Beauv.) plant per m2 of potato reduced marketable tuber yield by 19% if the barnyard grass emerged prior to potato emergence and then remained throughout the season

(Vangessel and Renner 1990).

Weeds in the field also can pose a second problem in addition to yield loss in that they can be infected by V. dahliae, and return V. dahliae inoculum to the soil when they decompose at the end of the season (Woolliams, 1966). Busch et al. (1978) emphasized the importance of weed seedlings as hosts and inoculum sources for V. dahliae when distinctive Verticillium conidiophores were found on 3 week old weedy seedlings and confounded the results of a study intended to study crop rotation as a control for V. dahliae. The fact that seed germination of many weedy hosts has been observed to occur throughout the production season, and that berry- producing weeds such as hairy nightshade can produce viable seeds within 4 to 5 weeks, means weedy seedlings can be present throughout the potato growing season (Hutchinson et al. 2011).

Black dot – problem, symptoms, and biology

A second fungus, Colletotrichum coccodes (Wallr.) S. J. Hughes, is an increasingly important pathogen of potato. The complete host range of C. coccodes is not fully understood

(Lees and Hilton 2003), but solanaceous crops such as potato (Johnson and Miliczky, 1993) and tomato (Alkan et al. 2012; Lees and Hilton 2003), and weeds from Cucurbitaceae, Fabaceae, and

Solanaceae (Chesters and Hornby 1965) are known hosts. One of the earliest reports of black dot of potato was in 1926 when Dickson (1926) observed weakened potato stems with poor growth and premature senescence that were determined to have originated from planting infected potato seed. Damage to potato caused by C. coccodes infection was considered to be a minor or sporadic problem until the 1990’s, when increased yield losses were observed (Johnson and

Miliczky 1993, Tsror et al. 1999).

Colletotrichum coccodes colonizes all underground potato parts (underground stems, daughter tubers, stolons, and roots) and foliage (Johnson 1994, Johnson and Miliczky 1993).

Tuber infection results in the development of silver colored lesions on the tuber surface and black microsclerotia that resemble dots and gave the disease its name: black dot (Dillard 1992).

Total yield losses can be high and were observed to be between 22 to 30% for potato cultivars such as ‘Alpha’, ‘Cara’, ‘Nicola’, ‘Agria’, and ‘Desiree’ (Tsror and Hazanovsky 1999). Black dot symptoms are more evident on tubers of thin-skinned than thick-skinned, or russet type potato cultivars (Lees and Hilton 2003). However, Nitzan et al. (2009) has assigned the foliage as susceptible based on field trials with russet potato cultivars Ranger Russet, Russet Burbank, and Umatilla Russet.

Early season detection of black dot in potato is difficult due to latent infection and asymptomatic plants (Ingram and Johnson 2010). One key early symptom is the sloughing of the root cortex (Stevenson 2001), where it can be easily slid off and removed by hand. Black dot symptoms are more prominent later when the production season, especially as potatoes senesce and the microsclerotia form on plant tissues and brown lesions form on the roots. Postharvest symptoms are clear on tubers in the form brown lesions, blemishes, and microsclerotia (Ingram and Johnson 2010).

Potato plants in the field become infected from microsclerotia found in the soil or from infected seed-tubers (Johnson et al. 1997; Tsror et al. 1999). Soilborne inoculum is considered more aggressive than tuber borne inoculum (Nitzan et al. 2008; 2005). Infected seed tubers promote colonization of roots, however Dung et al. (2012a) suggested that internal seed tuber infection by C. coccodes is “not a reliable predictor of final disease.” Potato foliage can also become infected by inoculum that is splash and wind dispersed in the form of conidia from above ground lesions or microsclerotia are blown into wounds (Ingram and Johnson, 2010;

Johnson and Miliczky 1993). Infections can progress throughout much of the growing season without symptoms appearing. Healthy tissue, especially roots, can be infected as readily as weakened tissue (Ingram and Johnson, 2010). Co-infection by both C. coccodes and V. dahliae has been reported in Washington and Israel, and susceptible plants infected with both pathogens showed enhanced disease symptoms compared to when either pathogen was inoculated alone

(Tsror and Hazanovsky 2001), possibly increasing yield loss.

Black dot – management

Disease management of black dot hinges on reducing soilborne inoculum and limiting the rate of plant colonization. Management tactics should be deployed whenever soilborne inoculum is present (Lees and Hilton 2003). Management strategies rely on chemical applications, crop rotation, irrigation management, and methods that reduce plant stress. Chemical management of black dot includes seed treatments and foliar fungicide applications. Combining several strategies is important as “no single management tactic will sufficiently reduce the effects of black dot on potato growth” (Johnson and Cummings 2015).

The fungicides fenpiclonil (Read and Hide 1995) and prochloraz (Denner et al. 1997) have served as a successful potato seed treatment that reduces the severity of black dot.

However, these treatments must be made 25 to 30 days before planting to be effective, and are not as effective if microsclerotia are present in soil prior to planting. Quinone outside Inhibitor

(QoI) fungicides have been employed more recently with the intent of reducting black dot severity on stems and progeny when applied to foliage (Ingram et al. 2011; Nitzan et al. 2005).

The timing of the fungicide application is of critical importance, as azoxystrobin (QoI fungicide) treatments 40 to 62 days after planting provided the most consistent black dot control (Johnson and Cummings 2015; Cummings and Johnson 2008; Nitzan et al. 2005). Other QoI fungicides such as fluoxastrobin and pyraclostrobin are also effective management tools. Mandipropamid combined with difenoconazole is effective at reducing C. coccodes infection of potato if applied prior to introduction of C. coccodes to the plant (Ingram et al. 2011). Delivery of these materials directly to susceptible, below-ground tissues is difficult, necessitating the use of chemigation to apply most of these fungicides (Ingram et al. 2011).

Crop rotation is also important for management of black dot. Johnson and Cummings

(2015) determined that rotations of potatoes at a minimum of every five years are needed to reduce the effects of the disease from C. coccodes inoculum present in the soil. Fields where potatoes were on shorter, one to three year rotations had a greater incidence of black dot

(Johnson and Cummings 2015).

Severity of black dot has been associated with plant stress (Stevenson et al. 1976), making plant stress reduction an important part of black dot management. Proper nutrient management also is important to avoid stressing plants, as an imbalance of nutrients such as potassium leads to more severe loss from black dot (Geary et al. 2009). Water management to avoid plant stress is also critical because the severity of black dot can be greater when plants are excessively irrigated (Cummings and Johnson 2015; Denner 1998), especially at the end of the production season during plant senescence (T.F Cummings, personal communication). Water- saturated soil and splashing by too much irrigation favors the spread of C. coccodes conidia and colonization of host tissue, but also renders the soil unable to replenish oxygen that is used by cellular respiration (Cummings and Johnson 2015).

Research objectives

Objective 1:

Litchi tomato has been grown as a trap crop for the pale cyst nematode (Globodera pallida). In order to avoid increasing pathogenic fungal populations that could infect future potato crops, an understanding of any increase of C. coccodes or V. dahliae microsclerotia within

litchi tomato is important to potato production if litchi tomato is going to continue to be used as a trap crop. The objectives of this study were to (i) quantify inoculum production of two pathotypes of V. dahliae and an isolate of C. coccodes in stems and roots of greenhouse-grown litchi tomato plants and compare to potato cultivars that differ in susceptibility to V. dahliae, and

(ii) evaluate litchi tomato grown in tandem with potato in field soils infested with endemic C. coccodes and V. dahliae populations to determine if microsclerotia form within litchi tomato stems and roots.

Objective 2:

Many weedy hosts, such as black nightshade and hairy nightshade are important to potato production in Washington State’s Columbia Basin because of their ability to directly compete for resources and serve as a host for potato pathogens. The interaction of V. dahliae host-adapted pathotypes with weedy hosts has not been explored, despite the importance of aggressive isolates of V. dahliae to Verticillium wilt epidemics on potato. Complete understanding of the interaction of aggressive isolates of V. dahliae with weedy hosts is important to successful long-term management of Verticillium wilt of potato because locations where Verticillium-susceptible weedy hosts are prevalent in the potato field could present greater inoculum pressure from V. dahliae aggressive to potato in subsequent years. The objective of this study was to: (i) identify the susceptibility of 16 weeds from the Columbia basin to eight V. dahliae isolates, and (ii) identify weedy hosts where the potato or mint pathotype produce greater numbers of microsclerotia compared to other V. dahliae isolates.

Objective 3:

Disease-suppressive soils may potentially reduce the number of viable V. dahliae microsclerotia, or suppress their germination. Disease-suppressive soils can be promoted by incorporating relatively large amounts of either green manures or plant residues of specific crops

(Harrison 1976; Larkin and Halloran 2014). Larkin and Halloran (2014) noted that crop residue incorporation has not been investigated as an effective disease management tactic in every different cropping system. This statement implies that crop residue incorporation in specific regions, such as alfalfa residue incorporation and its effect on Verticillium wilt of potato in the

Columbia Basin of Washington State has yet to be fully explored. The goal of this research was to determine if alfalfa residue incorporation facilitates the formation of soils that suppress or kill

V. dahliae microsclerotia during crop rotations with potato. Verticillium dahliae microsclerotia were quantified in field soils where organic material from alfalfa was incorporated, and numbers of microsclerotia were compared to fields where alfalfa residue was not incorporated. In addition, bacterial metagenomics were characterized for soils where organic material from alfalfa was or was not incorporated.

Objective 4:

Teff (Eragrostis tef) is a fine stemmed annual grass and Ethiopian small grain that is of interest as a rotation crop for potato. Little is known about the susceptibility of teff to most soilborne diseases, althought teff is susceptible to head smudge, rust, and damping off in

Ethiopia (Ketema 1997; 1987). Teff could be grown in rotation with potato in the Columbia

Basin as both a forage crop and a rotation crop provided that teff does not increase soil populations of Verticillium dahliae. The objective was to determine the susceptibility of teff to

Verticillium wilt by (i) identifying the susceptibility of teff to eight V. dahliae isolates and (ii)

determining if teff is susceptible to potato or mint pathotypes of V. dahliae and whether aggressiveness of the isolate is maintained on teff through the production of microsclerotia.

Literature cited:

Agrios G.N. 2005. Plant pathology. 5th ed. Elsevier Academic Press, San Diego.

Agrios G.N. 1997. Plant pathology. 4th ed. Elsevier Academic Press, San Diego.

Alkan, N., Fluhr, R., and Prusky, D. 2012. Ammonium secretion during Colletotrichum coccodes infection modulates salicylic and jasmonic acid pathways of ripe and unripe tomato fruit.

Molecular Plant-Microbe Interactions 25: 85-96.

Allen, T. C. and J. R. Davis. 1982. Distribution of tobacco rattle virus and potato virus X in leaves, roots and fruits and/or seeds of naturally infected weeds. Am. Potato J. 59:149–153.

Atallah, Z.K., Maruthachalam, K., du Toit, L., Koike, S.T., Davis, R.M., Klosterman, S.J.,

Hayes, R.J., and Subbarao, K.V. 2010. Population analyses of the vascular plant pathogen

Verticillium dahliae detect recombination and transcontinental gene flow. Fungal Genetics and

Biology. 47: 416 -422.

Bending, G.D., Lincoln, S.D., 1999. Characterization of volatile Sulphur containing compounds produced during decomposition of Brassica juncea tissues in soil. Soil Biology and

Biochemistry 31: 695–703.

Bhat, R. G., Smith, R. F., Koike, S. T., Wu, B. M., and Subbarao, K. V. 2003. Characterization of Verticillium dahliae isolates and wilt epidemics of pepper. Plant Dis.87:789-797.

Bhat, R.G. and Subbarao, K.V. 1999. Host range specificity in Verticillium dahliae.

Phytopathology: 89 1218–1225.

Butler, M.J., Day, A.W., 1998. Destruction of fungal melanins by ligninases of Phanerochaete chrysosporium and other white rot fungi. International Journal of Plant Sciences 159 989–995.

Beckmann, C.H. 1987. The nature of wilt diseases of plants. APS Press, St. Paul

Bletsos, F., Thanassoulopoulos, C., and Roupakias, D. 2003. Effect of grafting on growth, yield, and Verticillium wilt of eggplant. HortScience 38: 183-186.

Bowden, R. L., Rouse, D. I., and Sharkey, T. D. 1990. Mechanism of photosynthesis decrease by

Verticillium dahliae in potato. Plant Physiology 94: 1048-1055.

Brown, C.R. and JW Henfling. 2015. A History of Potato. In: Navarre, R. and Pavek, M. (eds)

The Potato: Botany, Production, and Uses. CAB International, Oxfordshire, UK, pp 1-11.

Caldwell. R. M., Schafer, F., Compton, L. E., Patterson. F. L. 1958. Tolerance to cereal leaf rusts. Science 128: 714-15.

Cappaert, M.R. Powelson, M.L. Christensen, N.W., and Crowe, G.J. 1992. Influence of irrigation on severity of potato early dying and associated yield loss. Phytopathology 86: 1448-1453.

Chesters CGC, Hornby D, 1965. Studies on Colletotrichum coccodes 2. Alternative host tests and tomato fruit inoculations using a typical tomato root isolate. Transactions of the British

Mycological Society 48: 583–94.

Cummings, T. F., and Johnson, D. A. 2008. Effectiveness of early-season, single applications of azoxystrobin for the control of potato black dot as evaluated by three assessment methods. Am.

J. Potato Res. 85: 422-431.

Davis JR, Huisman OC, Westermann DT, Hafez SL, Everson DO, et al. 1996. Effects of green manures on Verticillium wilt of potato. Phytopathology 86: 444–53

D’Arcy, W.G. 1972. Solanaceae studies II: typification of subdivisions of Solanum. Ann.

Missouri Bot. Gard. 59: 262-278. Retrieved from < http://solanaceaesource.org/content/solanum- genus-solanaceae>

D’Arcy, W.G. 1973. Solanaceae. Pp. 573-780 in R. E. Woodson & R. W. Schery (eds.), Flora of

Panama. Ann. Missouri Botanical Gard. Vol. 60. Retrieved from < http://solanaceaesource.org/content/solanum-genus-solanaceae>

Debode, J., Clewes, E., De Backer, G., and Höfte, M. 2005. Lignin is involved in the reduction of Verticillium dahliae var. longisporum inoculum in soil by crop residue incorporation. Soil

Biology and Biochemistry 37: 301-309.

Denner, F. D. N., Millard, C. P., and Wehner, F. C. 1998. The effect of seed and soilborne inoculum of Colletotrichum coccodes on the incidence of black dot on potato. Potato Res. 41:

51-65.

Denner, F. D. N., Millard, C., Geldenhuys, A., and Wehner, F. C. 1997. Treatment of seed potatoes with prochloraz for simultaneous control of silver scurf and black dot on progeny tubers. Potato Res. 40: 221-227.

DeVay, J. E., Forrester, L. L., Garber, R. H., and Butterfield, E. J. 1974. Characteristics and concentration of propagules of Verticillium dahliae in air-dried field soils in relation to the prevalence of Verticillium wilt in cotton. Phytopathology 64: 22-29.

Dickson B.T. 1926. The black dot disease of potato. Phytopathology 16: 23–40

Dillard HR, 1992. Colletotrichum coccodes: the pathogen and its hosts. In: Bailey JA, Jeger MJ, eds. Colletotrichum: Biology, Pathology and Control. Wallingford, UK: CAB International 225–

36.

Diwan, N., Fluhr, R., Eshed, Y., Zamir, D. & Tanksley, S. D. (1999) Theor. Appl. Genet. 98:

315–319.

Douhan, L. I., and Johnson, D. A. 2001. Vegetative compatibility and pathogenicity of

Verticillium dahliae from spearmint and peppermint. Plant Dis. 85: 297-302.

Dung, J. K., Peever, T. L., and Johnson, D. A. 2013. Verticillium dahliae populations from mint and potato are genetically divergent with predominant haplotypes. Phytopathology 103: 445-459.

Dung, J. K., Ingram, J. T., Cummings, T. F., and Johnson, D. A. 2012a. Impact of seed lot infection on the development of black dot and Verticillium wilt of potato in Washington. Plant

Dis. 96: 1179-1184.

Dung, J. K., and Johnson, D. A. 2012b. Roles of infected seed tubers and soilborne inoculum on

Verticillium wilt of 'Russet Burbank' potato. Plant Dis. 96: 379-383.

Dung, J. K., Schroeder, B. K., and Johnson, D. A. 2010. Evaluation of Verticillium wilt resistance in Mentha arvensis and M. longifolia genotypes. Plant Dis. 94: 1255-1260.

Fordyce, C., and Green, K.J. 1960. Studies of host specificity of Verticillium albo-atrum var. menthae. Phytopathology 50: 635.

Fradin, E. F., and Thomma, B. P. H. J. 2006. Physiology and molecular aspects of Verticillium wilt diseases caused by V. dahliae and V. albo-atrum. Molecular Plant Pathology 7: 71-86.

Garber RH. 1973. Fungus penetration and development. In Verticillium Wilt of Cotton

, pp. 69–77. College Station, Texas: United States Department of Agriculture Publication

Geary, B., Kearns, M. J., Song, E., Blaisedel, B., Johnson, D. A., Hopkins, B. G., and Jolly, V.

D. 2009. Infection severity of Colletotrichum coccodes in Russet Burbank potatoes with respect to environmental potassium. Phytopathology 99: S41.

Hafez, S. L., Sundararaj, P., Handoo, Z. A., Skantar, A. M., Carta, L. K., and Chitwood, D. J.

2007. First report of the pale cyst nematode, Globodera pallida, in the United States. Plant Dis.

91: 325-325.

Hamm, P. B., Ingham, R. E., Jaeger, J. R., Swanson, W. H., and Volker, K. C. 2003. Soil fumigant effects on three genera of potential soilborne pathogenic fungi and their effect on potato yield in the Columbia Basin of Oregon. Plant Dis. 87: 1449-1456.

Harrison, M. D. 1976. The effect of barley straw on the survival of Verticillium albo-atrum in naturally infested field soil. Am Potato J. 53: 385-394.

Heywood, V. H. 1978. Flowering plants of the world. OUP, Oxford.

Hutchinson, P. J. S., Beutler, B. R., and Farr, J. 2011. Hairy nightshade (Solanum sarrachoides) competition with two potato varieties. Weed Science 59: 37-42.

Ingram, J., Cummings, T. F., and Johnson, D. A. 2011. Response of Colletotrichum coccodes to selected fungicides using a plant inoculation assay and efficacy of azoxystrobin applied by chemigation. American journal of potato research 88: 309-317.

Ingram, J., and Johnson, D. A. 2010. Colonization of potato roots and stolons by Colletotrichum coccodes from tuberborne inoculum. American journal of potato research 87: 382-389.

Isaac, I., and Harrison, J.A.C. 1968. The symptoms and causal agents of early-dying disease

(Verticillium wilt) of potatoes. Ann. appl. Biol. 61: pp. 231-244.

Inderbitzin, P., and Subbarao, K. V. 2014. Verticillium systematics and evolution: How confusion impedes Verticillium wilt management and how to resolve it. Phytopathology 104:

564-574.

Inderbitzin, P., Bostock, R.M. Davis M.R., Usami T., Platt, H.W. and Subbararo, K.V. 2011.

Phylogenetics and Taxonomy of the Fungal Vascular Wilt Pathogen Verticillium, with the

Descriptions of Five New Species. PloS ONE 6(12):e28341

Ioannou, N., Schneider, R. W., Grogan, R. G., and Duniway, J. M. 1977.Effect of water potential and temperature on growth, sporulation, and production of microsclerotia by

Verticillium dahliae. Phytopathology 67: 637-644.

Joaquim, T. R., and Rowe, R. C. 1991. Vegetative compatibility and virulence of strains of

Verticillium dahliae from soil and potato plants. Phytopathology 81: 552-558.

Joaquim, T. R., and Rowe, R. C. 1990. Reassessment of vegetative compatibility relationships among strains of Verticillium dahliae using nitrate-nonutilizing mutants. Phytopathology 80:

1160-1166.

Johnson, D. A., and Cummings, T. F. 2015. Effect of Extended Crop Rotations on Incidence of

Black Dot, Silver Scurf, and Verticillium Wilt of Potato. Plant Dis. 99: 257-262.

Johnson, D.A., and Dung, J.K.S. 2010. Verticillium wilt of potato-the pathogen, disease and management. Can. J. Plant Pathol. 32:58-67.

Johnson, D.A., R.C. Rowe, and T.F. Cummings. 1997. Incidence of Colletotrichum coccodes in certified potato seed tubers planted in Washington State. Plant Dis. 81: 1199–1202.

Johnson DA, 1994. Effect of foliar infection caused by Colletotrichum coccodes on yield of

Russett Burbank potato. Plant Dis. 78, 1075–8.

Johnson DA, and Miliczky ER, 1993. Effects of wounding and wetting duration on infection of potato foliage by Colletotrichum coccodes. Plant Dis. 77, 13–7.

Jordon, V.W. 1971. Estimation of the distribution of Verticillium populations in infected strawberry plants and soil. Plant Pathology 20: 21-24.

Kawchuk, L. M., Hachey, J., Lynch, D. R., Kulcsar, F., van Rooijen, G., Waterer, D. R., and

Fischer, R. 2001. Tomato Ve disease resistance genes encode cell surface-like receptors.

Proceedings of the National Academy of Sciences 98: 6511-6515.

Katan, T. 2000. Vegetative compatibility in populations of Verticillium—an overview. Pages 69-

86 in: Advances in Verticillium: Research and Disease Management. E. C. Tjamos, R. C. Rowe,

J. B. Heale, and D. R. Fravel, eds. American Phytopathological Society Press, St. Paul, MN.

Ketema, S. 1997. Tef-Eragrostis Tef (Zucc.) (Vol. 12). Bioversity International.

Ketema, S. 1987. Research recommendations for production and brief outline of strategy for the improvment of tef [Eragrostis tef (Zucc.) Trotter]. In: Proc. 19th Natl. Crop. Imp. Conf. IAR.

Addis Ababa, Ethiopia.

Klosterman, S. J., Atallah, Z. K., Vallad, G. E., and Subbarao, K. V. 2009. Diversity, pathogenicity, and management of Verticillium species. Annual review of phytopathology 47,

39-62.

Kon, S. K., and Klein, A. 1928. The value of whole potato in human nutrition. Biochemical

Journal 22: 258.

Krikun, J., and Orion, D. 1979. Verticillium wilt of potato: importance and control.

Phytoparasitica 7: 107-116.

Larkin, R.P., and Halloran, J.M. 2014. Management effects of disease-suppressive rotation crops on potato yield and soilborne diseases. Am J. Potato Research 91:429-439.

Lees, A. K., and Hilton, A. J. 2003. Black dot (Colletotrichum coccodes): an increasingly important disease of potato. Plant Pathology 52: 3-12.

Mace, M; Bell, A; and Beckman, C. 1981. Fungal Wilt Diseases of Plants. New York, Academic

Press, Inc. Page 65.

Malik, N.K., Milton, J.M. 1980. Survival of Verticillium in Monocotyledonous host plants.

Trans. Br. Mycol. Soc.75: 496-497.

Mathre, D. E. 1989. Pathogenicity of an isolate of Verticillium dahliae from barley. Plant Dis.

73: 164-167.

Mayton, H.S., Olivier, C., Vaughn, S.F., Loria, R., 1996. Correlation of fungicidal activity of

Brassica species with allyl isothiocyanate production in macerated leaf tissue. Phytopathology

86: 267–271.

Munnecke, D. E., Bricker, J. L., and Kolbezen, M. J. 1978. Comparative toxicity of gaseous methyl bromide to ten soilborne phytopathogenic fungi. Phytopathology 68: 1210-1216.

National Agricultural Statistics Service. Quick Stats (NASS). 2013-2016. United States

Department of Agriculture, Washington D.C. Resources employed include:

; ;

Nelson, R. 1950. Verticillium wilt of peppermint. Technical Bulletin. Michigan Agricultural

Experiment Station, (221).

Nitzan, N., Evans, M. A., Cummings, T. F., Johnson, D. A., Batchelor, D. L., Olsen, C., and

Brown, C. R. 2009. Field resistance to potato stem colonization by the black dot pathogen

Colletotrichum coccodes. Plant Dis. 93: 1116-1122.

Nitzan, N., T.F. Cummings, and D.A. Johnson. 2008. Disease potential of soil- and tuberborne inocula of Colletotrichum coccodes and black dot severity on potato. Plant Dis. 92: 1497–1502.

Nitzan, N., Cummings, T. F., and Johnson, D. A. 2005. Effect of seed-tuber generation, soilborne inoculum, and azoxystrobin application on development of potato black dot caused by

Colletotrichum coccodes. Plant Dis. 89: 1181-1185.

Omer, M. A., Johnson, D. A., Douhan, L. I., Hamm, P. B., and Rowe, R. C. 2008. Detection, quantification, and vegetative compatibility of Verticillium dahliae in potato and mint production soils in the Columbia Basin of Oregon and Washington. Plant Dis. 92: 1127-1131.

Pavek, M. 2014. Potato Field Preparation, Crop Rotations, and Green Manures. [PowerPoint slides]. Retrieved from http://web.cals.uidaho.edu/potatoscience/files/2014/01/2014-Potato-Sci-

Lect-3-Field-Prep-Rotations.pptx+&cd=3&hl=en&ct=clnk&gl=us

PBI Solanum Project. Current year. Solanaceae Source. Date downloaded. URL (address) of web site (http://www.solanaceaesource.org/).

Pegg, G.F. and Brady, B.L. 2002.Verticillium Wilts. Wallingford, UK: CABI Publishing.

Perry JW, Evert RF. 1983a. Histopathology of Verticillium dahliae within mature roots of Russet

Burbank potatoes. Can. J. Bot. 61:3405–21

Perry JW, Evert RF. 1983b. The effect of colonization by Verticillium dahliae on the root tips of

Russet Burbank potatoes. Can. J. Bot. 61:3422–29

Powelson, M.L., and Rowe, R.C. 1993. Biology and Management of Early Dying of Potatoes.

Ann. Rev. Phytopathol. 31:111-126.

Reinke, J. and Berthold, G. 1879. Die Zersetzung der Kartoffel durch Pilze. Untersuch. Bot. Lab.

Univ. Gottingen 1: pp. 1-100.

Read, P. J., and Hide, G. A. 1995. Effects of fungicides on the growth and conidial germination of Colletotrichum coccodes and on the development of black dot disease of potatoes. Ann. Appl.

Biol. 126:437-447.

Saccardo, P. A. 1886. Verticillium tenerum. Sylloge Fungorum 4:158. Cited by Inderbitzin, P., and Subbarao, K. V. 2014. Verticillium systematics and evolution: how confusion impedes

Verticillium wilt management and how to resolve it. Phytopathology 104: 564-574.

Schnathorst, W.C. 1981. Life cycle and epidemiology of Verticillium. In Fungal Wilt Diseases of

Plants (Mace, M.E., Bell, A.A. and Beckman, C.H., eds), pp. 81–111. New York: Academic

Press.

Schnathorst, W. C., and Fogle, D. 1973. Survival structures of Verticillium dahliae in naturally infested field soils. In Proceedings of the Beltwide Cotton Production Research Conference,

Phoenix, Arizona (pp. 9-10).

Stevenson, W.R., R.J. Green, and G.B. Bergeson. 1976. Occurrence and control of potato black dot root rot in Indiana. Plant Disease Reporter 60: 248–251.

Subbarao, K.V., Chassot, A., Gordon, R.R., Hubbard, J.C., Bonello, P., Mullin, R., Okamoto, D.,

Davis, R.M. and Koike, S.T. 1995. Genetic relationships and cross pathogenicities of

Verticillium dahliae isolates from cauliflower and other crops. Phytopathology, 85, 1105–1112.

Suttles, W. 1951. The early diffusion of the potato among the Coast Salish. Southwestern Journal of Anthropology: 272-288.

Taylor, R.J., Pasche, J.S., and Gudmestad, N.C. 2005. Influence of tillage and methods of metam sodium application on distribution and survival of Verticillium dahliae in the soil and the development of potato early dying disease. Amer J of Potato Res. 82: 450-461.

Tsror, L. and Hazanovsky, M. 2001. Effect of coinoculation by Verticillium dahliae and

Colletotrichum coccodes on disease symptoms and fungal colonization in four potato cultivars.

Plant pathology 50: 483-488.

Tsror, L., O. Erlich, and M. Hazanovsky. 1999. Effect of Colletotrichum coccodes on potato yield, tuber quality, and stem colonization during spring and autumn. Plant Dis. 83: 561– 565.

Vallad, G.E., Bhat, R.G., Koike, S.T., Ryder, E.J. and Subbarao, K.V. 2005. Weedborne reservoirs and seed transmission of Verticillium dahliae in lettuce. Plant Dis. 89, 317–324.

Vangessel, M. J., and Renner, K. A. 1990. Redroot pigweed (Amaranthus retroflexus) and barnyardgrass (Echinochloa crus-galli) interference in potatoes (Solanum tuberosum). Weed

Science: 338-343.

Wilhelm, S., Koch, E. C., Condit, I. J., Warner, R. M., Neubauer, L. W., Hoyle, B. J., ... &

Middleton, J. T. 1956). Verticillium wilt controlled: Chloropicrin achieves effective control of

Verticillium wilt in strawberry plantings if properly applied as soil fumigant. California

Agriculture 10: 3-14.

Wilhelm, S. 1955. Longevity of Verticillium wilt fungus in the laboratory and field.

Phytopathology 45: 180-81.

WSDA. 2015. Agriculture – A Cornerstone of Washington’s Economy. AGRI-PUB 103-127

(R/2/15). Retrieved from

Woolliams, G. E. 1966. Host range and symptomatology of Verticillium dahliae in economic, weed, and native plants in interior British Columbia. Canadian Journal of Plant Science, 46: 661-

669.

Zasada, I. A., Walters, T. W., and Pinkerton, J. N. 2010. Post-plant nematicides for the control of root lesion nematode in red raspberry. HortTechnology, 20: 856-862.

Zhang, L., Brown, C. R., Culley, D., Baker, B., Kunibe, E., Denney, H., and Dauenhauer, R.

2010. Inferred origin of several Native American potatoes from the Pacific Northwest and

Southeast Alaska using SSR markers. Euphytica, 174: 15-29.

CHAPTER TWO

Evaluation of Solanum sisymbriifolium as a Potential Inoculum Source of Verticillium

dahliae and Colletotrichum coccodes.

ABSTRACT

Solanum sisymbriifolium, the litchi tomato, is a perennial herbaceous plant from South

America that is used as a trap crop to reduce soilborne populations of the pale cyst nematode

Globodera pallida, an important potato pathogen. Possible interactions of soilborne potato pathogens Verticillium dahliae and Colletotrichum coccodes with litchi tomato are unknown, yet important in potato production if litchi tomato is to be planted as a trap crop. The goal of this research was to quantitatively assess if litchi tomato is a potential inoculum source for C. coccodes and V. dahliae by comparing colony forming units (CFU) observed in inoculated plants of litchi tomato to susceptible and resistant potato cultivars (cvs.) such as Russet Norkotah and

Alturas, respectively. The potato cvs. Alturas (P = 0.0003), Ranger Russet (P = 0.0193) and

Russet Norkotah (P = 0.0022) produced more CFUs of the potato pathotype of V. dahliae than litchi tomato the first of two years of greenhouse trials. Significantly more CFUs of the potato pathotype of V. dahliae were quantified from stems and roots of cv. Russet Norkotah when only compared to litchi tomato (P = 0.0001) in the second year. The CFUs for C. coccodes varied between litchi tomato and the potato cultivars, perhaps due to varying levels of resistance since litchi tomato is from a selected intermated seed source. Based on these data, the effect of litchi tomato in rotation with potato on the proliferation of V. dahliae or C. coccodes populations in the soil when compared to a susceptible potato cultivar is likely to be limited. Although both

pathogens are likely to persist in field soils where S. sisymbriifolium is used as a trap crop, neither fungus will facilitate increased incoculum level in the soils by growth of litchi tomato.

INTRODUCTION

Two important diseases of potato in the Northwestern United States are Verticillium wilt and black dot, caused by the soilborne fungi Verticillium dahliae Kleb. and Colletotrichum coccodes Wallr., respectively. Verticillium dahliae infects a wide range of plants, making it one of the most important pathogens of dicotyledonous crop plants in North America (Agrios 2005;

Bhat and Subbarao 1999; Dung et al. 2013). Despite the wide host range of V. dahliae, individual isolates vary in aggressiveness when introduced to different plant hosts under controlled conditions, a situation which has been also noted from field isolations (Bhat and Subbarao 1999;

Dung et al. 2013; Pegg and Brady 2002). Host adaptation of V. dahliae may occur over a relatively short period of time within both annual and perennial crop hosts such as pepper and mint, respectively (Bhat et al. 2003; Fordyce and Green 1960). Individual V. dahliae isolates that are aggressive to a particular host have been called host-adapted pathotypes (Dung et al. 2013;

Pegg and Brady 2002). Certain V. dahliae isolates that are grouped into host-adapted pathotypes often fall into certain vegetative compatibility groups (VCGs, Katan, 2000), although this pattern is not true for all isolates (Bhat and Subbarao 1999; Dung et al. 2013). The VCGs of V. dahliae are scored by complementation of nitrate-nonutilizing (nit) mutants generated in culture on 1% potassium chlorate-amended medium and they are able to fuse and grow on media with defined nitrogen sources (Joaquim and Rowe 1990, 1991).

The complete host range of another important soilborne plant pathogen, Colletotrichum coccodes, is not yet fully understood (Lees and Hilton 2003). Solanaceous crops such as tomato

(Alkan et al. 2012; Lees and Hilton 2003) and weeds from the Cucurbitaceae, Fabaceae, and

Solanaceae (Chesters and Hornby 1965) plant families are other known hosts. C. coccodes is the causal agent of black dot on potato (Agrios 2005; Johnson and Miliczky 1993). Damage caused by C. coccodes infection of potato was considered to be a minor problem on potato until 1990, when observations of yield losses began (Johnson and Miliczky 1993; Tsror and Hazanovsky

1999).

The pale cyst nematode (PCN, Globodera pallida) is also an important potato pathogen

(Dandurand 2013; Timmermans et al. 2007). PCN is a regulated pathogen under a Federal

Domestic Quarantine Order from USDA Animal and Plant Health Inspection Service and the

Idaho State Department of Agriculture (Dandurand 2013, https://www.aphis.usda.gov/aphis/ourfocus/planthealth/plant-pest-and-disease-programs/pests- and-diseases/SA_Nematode/sa_potato/ct_pcn_home). The nematode was identified in southeastern Idaho in 2006 and has become the focus of quarantine and eradication efforts

(Dandurand 2013). One possible approach to PCN eradication is the use of trap crops. Trap crops are defined as plants that release root exudates that stimulate nematode egg hatch but are not a host to the nematode (Agrios 2005; Dandurand 2013; Timmermans et al. 2007). Litchi tomato

(Solanum sisymbriifolium) is a trap crop for PCN (Dandurand 2013; Scholte and Vos 2000;

Timmermans et al. 2007) as well as other nematodes such as Meloidogyne spp. (Dias et al. 2012) and Pratylenchus spp. (Evans and Kerry, 2007).

Employing a trap crop, such as the litchi tomato as part of PCN eradication may have unintended effects on populations of other soilborne potato pathogens. Litchi tomato was found to be resistant to V. dahliae and consequently used as a rootstock for eggplant in Greece (Bletsos et al. 2003). However, the work of Bletsos et al. (2003) should be expanded to include information on the interaction of litchi tomato with V. dahliae in other crop production regions, such as those in North America. It is also important to understand the response of litchi tomato to different host adapted pathotypes of V. dahliae compared to that of susceptible potato cultivars

(cvs.) in order to determine whether or not the use of litchi tomato as a trap crop for PCN could exacerbate potential Verticillium wilt outbreaks in vulnerable fields.

The goal of this research was to evaluate the ability of V. dahliae and C. coccodes host- adapted pathotypes to infect and produce microsclerotia within the stems and roots of litchi tomato, and to quantify microsclerotia production in potato cvs. that are susceptible and moderately resistant to V. dahliae relative to litchi tomato. Understanding the role of litchi tomato in V. dahliae and C. coccodes microsclerotia production is important to potato crop rotations to avoid increasing these pathogens when litchi tomato is used as a PCN trap crop. The objectives of this study were to (i) quantify inoculum production of two pathotypes of V. dahliae and an isolate of C. coccodes in stems and roots of greenhouse-grown litchi tomato plants to potato cvs. that differ in susceptibility to V. dahliae, and (ii) evaluate litchi tomato grown in tandem with potato in field soils infested with endemic C. coccodes and V. dahliae populations to determine if microsclerotia form within litchi tomato stems and roots.

MATERIALS AND METHODS

Origin and preparation of isolates.

V. dahliae and C. coccodes isolates were identified and previously characterized for aggressiveness to different hosts and VCG identity by Dung et al. (2013) and Nitzan et al.

(2002), respectively (Table 1). Inoculum for V. dahliae was prepared by placing a single microsclerotium on semiselective media (NPX) for V. dahliae (Butterfield and DeVay 1977) for ten days. C. coccodes inoculum was prepared in the same way except that potato dextrose agar

(PDA) (Difco Laboratories, Detroit, MI) was used instead of NPX. One subsection of the actively growing border of the colony was excised with a cork borer (7 mm diameter) and one agar disc was placed in Czapek-dox broth (Sigma-Aldrich, St. Louis, MO) for V. dahliae, and potato dextrose broth (Difco Laboratories, Detroit, MI) for C. coccodes. Liquid cultures were shaken at 150 RPM at room temperature (21 to 23ºC) for 10 days. Microsclerotia were generated from this conidial suspension by mixing the suspension with autoclaved sand (0.0197 to 0.0234 mm diameter) and placing the sand/conidia mixture on sterilized mesh in a Pyrex 4543 ml oblong baking dish (Corning Inc., Corning, NY). The sand/conidia mixture was then placed inside a sterilized enclosure and allowed to grow for seven days at room temperature (21 to

23ºC) before drying for approximately three weeks to facilitate the formation of microsclerotia

The mixture was stirred every 48 hours to prevent clumping.

Determining the minimum inoculum density of V. dahliae (CFU/g) in potting medium for litchi tomato infection.

The V. dahliae inoculum density required for subsequent greenhouse inoculations was determined experimentally. The experiment consisted of three plant species (litchi tomato, potato

cv. Ranger Russet and eggplant cv. Night Shadow) by four inoculum levels (5, 30, 50 and 100

CFU/g) and one V. dahliae isolate (potato pathotype, Table 1). Each combination was replicated four times in a completely randomized design. Plants were directly seeded in soilless potting medium (Sunshine Advanced Growing Mix #4, Sun Gro, Agawam, MA) infested with one isolate of the V. dahliae potato pathotype for 4 months. Plants were harvested, soilless potting medium was washed off roots, blotted dry, and dried for 1 month to allow the formation of microsclerotia. Dried stem sections from the crown to 16 cm up the plant were collected for V. dahliae and C. coccodes CFU enumeration. Roots were not collected in this experiment. Dried stems were ground with an electric coffee grinder (Secura, Appleton, WA) until the particle size was approximately less than 4 mm2. The removable cup from the grinder, as well as the lid, was surface sterilized with a mixture of 70% ethanol and 30% deionized water between plant samples. One gram of ground stem was placed evenly on the surface of a petri plate containing

NPX without serial dilution and the number of V. dahliae and C. coccodes CFU was counted after incubating the petri plates for 10 days with an Olympus SD-ILK dissecting microscope

(Olympus Optical Ltd, Tokyo, Japan).

Quantification of V. dahliae and C. coccodes CFU in greenhouse-grown potato and litchi tomato.

Seed of litchi tomato was germinated on moistened filter paper to determine if planted seed was free of V. dahliae and C. coccodes. Seed free of V. dahliae and C. coccodes was determined by visually assessing germinated seed for the presence or absence of disease symptoms (stunting or wilting), sporulation, and microsclerotia associated with either pathogen.

Potato tubers from cvs. Alturas, Russet Norkotah, and Ranger Russet were assayed for the

absence of both fungal pathogens by slicing an approximately 0.5 cm thick segment from the stolon end of the tuber, surface sterilized by submerging in 10% sodium hypochlorite (NaOCl,

6.0%, Independent Marketing Alliance, Houston, TX) for three minutes, rinsing in deionized water, and blotting dry. The segment from the stolon end of the tuber was then placed on NPX and incubated at room temperature (21 to 23ºC) for 10 days, after which the presence or absence of C. coccodes and V. dahliae microsclerotia was confirmed through visual observation of microsclerotia and sporulation using an Olympus SD-ILK dissecting microscope at 7 to 20X magnification (Olympus Optical Ltd, Tokyo, Japan). Potato tubers that did not test positive for microsclerotial growth and development from either fungal pathogen were planted in 3.79 liter pots with soilless potting medium and allowed to grow for one month before the potting medium was infested with V. dahliae or C. coccodes to ensure emergence. Soils for each litchi tomato and potato plant (experimental unit) were infested with either V. dahliae VCG 2B (mint pathotype, Table 1), V. dahliae VCG 4A (potato pathotype, Table 1), or a C. coccodes isolate

(Table 1) so that each pot contained 30 microsclerotia/g potting medium. Litchi tomato and potato seedlings were then transplanted into the infested potting medium. The greenhouse was maintained at a daytime average of approximately 23ºC and a nighttime temperature of 15.5ºC.

The experiment had four levels for host (litchi tomato, potato cvs. Russet Norkotah,

Alturas, and Ranger Russet) and three levels for pathogen (V. dahliae potato pathotype, V. dahliae mint pathotype, C. coccodes) as well as noninoculated controls arranged in a completely randomized design with four replicates. Cultivar Russet Norkotah is susceptible to V. dahliae

(Bae et al. 2007), Ranger Russet is moderately resistant to V. dahliae (Bae et al. 2007), and

Alturas is resistant to V. dahliae in the field (Novy et al. 2003). Cultivar Russet Norkotah has

been treated as moderately susceptible to C. coccodes (Aqueel et al. 2008), Ranger Russet has been reported as a susceptible host of C. coccodes in the field and greenhouse (Nitzan et al.

2009), and Alturas was not rated for disease susceptiblty in the field when evaluated by Novy et al. (2003). Soilless potting medium from each experimental unit was infested with one pathogen.

Plants were visually inspected for the presence or absence of Verticillium wilt or black dot symptoms once a week for five months post-inoculation. Plants were harvested in both 2014 and

2015 after five months of growth in the greenhouse and slowly dried for one month at ambient temperatures of 21 to 24ºC. Slow drying was necessary in order to facilitate the formation of microsclerotia and desiccation of conidia and hyphae. A 16 cm dried stem section from each experimental unit was excised starting from the base of the crown, ground as previously described until particle size was approximately less than 3 mm2, and 1 g placed on NPX to enumerate the number of V. dahliae or C. coccodes CFU’s that were present after incubation for

10 days as previously described. The greenhouse trial was conducted in the same manner in both

2013 and 2014. V. dahliae or C. coccodes CFU’s were enumerated in the stems of all plants in both 2013 and 2014. Root tissue consisting of the combined primary and secondary roots from the crown down 16 cm was also collected in 2014 for V. dahliae or C. coccodes CFU enumeration. Root samples were dried, ground and plated as previously described but separately from stems.

Evaluation of litchi tomato susceptibility to V. dahliae and C. coccodes under field conditions

Field trials were established to evaluate inoculum production of V. dahliae and C. coccodes in infected litchi tomato under field conditions. Research fields were selected based on

having a previous history of potato cultivation as well as Verticillium wilt and black dot, with 5 to 15 V. dahliae or C. coccodes microsclerotia per gram of soil based on soil samples. Soil samples were collected from a depth of 10 cm with a 7/8" X 21" plated soil probe (AMS,

American Falls, ID), and dried for one month at ambient temperatures of 21 to 24ºC. One gram of dry soil was placed on NPX, incubated for 10 days, and V. dahliae or C. coccodes microsclerotia were quantified as previously described for dry plant matter.

An observational study to evaluate inoculum production of V. dahliae and C. coccodes in infected litchi tomato under field conditions was established in Othello, WA in 2014 and Powell

Butte, OR in 2015. Natural levels of inoculum (>5 V. dahliae and C. coccodes microsclerotia) already present in the soil typified both field trials. One-row plots were established in Othello,

WA under overhead irrigation with 5 replicates each containing four potato plants (cv. Ranger

Russet) and three litchi tomato plants. The row was 9 m long row with 0.9 m alleys between replicates, and plant spacing of 25 cm for both potato and litchi tomato. Potato seed tubers were planted on 28 April and litchi tomato was planted on 28 May 2014 in Othello, WA. Flowers of litchi tomato were removed in July and August to prevent seed dispersal. In September 2014, all plants in Othello, WA were individually harvested and dried slowly for three weeks in the dark at temperatures of 21 to 24ºC to facilitate the formation of microsclerotia. Thirty litchi tomato plants were planted on 15 May 2015 in Powell Butte, OR approximately 45 cm apart. Plants were harvested after four months in the field on 23 September, dried as previously described.

Stem and root sections 16 cm in length were excised from dried potato or litchi tomato, washed, blotted dry, dried, and ground as previously described for the greenhouse experiments. Dried plant matter was placed evenly on the surface of NPX to determine the number of V. dahliae and

C. coccodes CFU from the stem and roots of each experimental unit after 10 days’ incubation as previously described.

Field trials with potato cv. Russet Burbank and litchi tomato were established in Prosser,

WA in 2015 to evaluate and compare inoculum production of V. dahliae and C. coccodes in infected litchi tomato to potato under field conditions using a randomized complete block design.

This experiment consisted of six litchi tomato or six potato plants per replicate with six replicates for a total of 72 experimental units. Potato and litchi tomato transplants approximately 15 to 18 cm tall were planted approximately 25 cm apart in June and harvested in September, 2015. Stem and root sections 16 cm in length were excised from dried potato or litchi tomato and ground as previously described for the greenhouse experiments. Dried plant matter was placed evenly on the surface of NPX to determine the number of V. dahliae and C. coccodes CFU from the stem and roots of each experimental unit after 10 days’ incubation again as previously described.

Data Analysis

Analysis of variance (ANOVA) was performed in SAS University Edition (SAS Inc.,

Cary, NC) using Tukey’s Honestly Significant Difference tests for all pairwise comparisons to determine differences in the number of CFU observed between plants subjected to the same fungal pathogen, separated by either plant part (stem or root). Greenhouse trial data was not pooled prior to analysis. Field data from Prosser, WA was pooled prior to analysis (with

ANOVA), with each field serving as the replicates. V. dahliae and C. coccodes data were analyzed separately because the experiment was designed to compare inoculum production of a single pathogen between the four plant hosts. ANOVA assumptions were verified using the same

program. Data sets that did not initially meet ANOVA assumptions were log transformed to allow continued use of parametric analysis, except for values of zero. Statistical comparisons were not made with ANOVA between noninoculated and C. coccodes-inoculated plants because of the inability to meet the ANOVA assumption of homoscedasticity and the unavailability of a suitably acceptable form of nonparametric 2-factor ANOVA.

RESULTS

Determining the minimum inoculum density of V. dahliae (CFU/g) in potting soil for litchi tomato infection.

The number of V. dahliae CFU in litchi tomato and eggplant did not differ regardless of the inoculum level in the potting medium (5 CFU/g (P = 0.9972), 30 CFU/g (P = 0.84), 50

CFU/g (P = 0.9967), 100 CFU/g (P = 0.53), Table 2). Eggplant was not used to compare differences in V. dahliae inoculum production because of nonsignificant differences in the number of observed V. dahliae CFU between eggplant and litchi tomato at any evaluated inoculum level (Table 2). V. dahliae infection of litchi tomato was observed at all levels of V. dahliae inoculum, but litchi tomato had significantly fewer observed V. dahliae CFU than potato cv. Ranger Russet at inoculation levels of 30 CFU/g (P < 0.0001), 50 CFU/g (P < 0.0001), and

100 CFU/g (P < 0.0001) (Table 2). Therefore, in subsequent experiments, plants were inoculated with 30 CFU/g which was the minimum V. dahliae inoculum density that consistently infected litchi tomato and resulted in significantly fewer observed CFU’s than potato.

Quantification of V. dahliae and C. coccodes CFU in greenhouse grown potato and litchi tomato.

The two-factor ANOVA test for differences in the number of microsclerotia between plant hosts was significant (P < 0.0001), and the interaction effect of plant host and fungal isolate was not significant (P = 0.3115). Greater numbers of CFUs were recorded for the V. dahliae potato pathotype than the mint pathotype on cv. Ranger Russet (P = 0.0331), Alturas (P <

0.0001), and Russet Norkotah (P < 0.0001) in 2013 (Table 3). Cultivars Alturas (P = 0.0003),

Ranger Russet (P = 0.0193) and Russet Norkotah (P = 0.0022) produced greater numbers of V. dahliae potato pathotype CFUs than litchi tomato (Table 3). Litchi tomato planted in soilless mix infested with either pathotype of V. dahliae was infected, based on the production of microsclerotia within the plants, however no difference in CFU’s was observed between the potato and mint pathotypes of V. dahliae (P = 0.1044, Table 3). No Verticillium wilt symptoms were observed on litchi tomato inoculated with either the V. dahliae mint or potato pathotype

(data not shown) in 2013.

The two-factor ANOVA test for differences in the number of microsclerotia between plant hosts was significant (P < 0.0001 for both stems and roots), and the interaction effect of plant host and fungal isolate was not significant (P = 0.1058 in stems, P = 0.27 for roots).

Greater numbers of CFU for the V. dahliae potato pathotype were observed than for the mint pathotype in cvs. Russet Norkotah (P = 0.0432) and Ranger Russet (P = 0.0029) roots in 2014

(Table 4). Significantly greater numbers of V. dahliae potato pathotype CFU were found in stems and roots of cv. Russet Norkotah than litchi tomato (P = 0.0001, Table 4). The number of V. dahliae potato and mint pathotype CFU did not differ in litchi tomato stems (P = 0.3962) or roots (P = 1.0) in 2014 (Table 4). No Verticillium wilt symptoms were observed on litchi tomato inoculated with either the V. dahliae mint or potato pathotype (data not shown) in 2014.

The number of observed CFU of C. coccodes from stems was significantly lower in litchi tomato than potato cv. Alturas (P = 0.0057), Russet Norkotah (P = 0.0041) and Ranger Russet (P

= 0.0041) in 2013 (Table 5). No differences were noted in 2014 between the C. coccodes CFU from stems or roots of any of the potato cvs. or in litchi tomato roots (P > 0.05, Table 5). No black dot symptoms were observed on litchi tomato inoculated in the greenhouse experiments

(data not shown) in either 2013 or 2014.

Evaluation of litchi tomato susceptibility to V. dahliae and C. coccodes under field conditions.

Greater numbers of CFUs of V. dahliae were observed in stems (P = 0.0307) and roots (P

= 0.0465) of cv. Russet Burbank than in litchi tomato in the Prosser, WA field trial (Table 6).

The numbers of CFU of C. coccodes did not differ in stems (P = 0.6296) and roots (P = 0.0576) of cv. Russet Burbank when compared to litchi tomato at this site (Table 6). Both pathogens infected and produced microsclerotia in litchi tomato in the Othello, WA field trial in 2014 and the Powell Butte, OR field trial in 2015 (Table 6). Comparisons could not be made between C. coccodes or V. dahliae CFU between potato or litchi tomato because of insufficient field replication in Othello, WA and no potato plants were planted in Powell Butte, OR. No symptoms of either disease were observed on litchi tomato at harvest in the field (data not shown).

DISCUSSION:

Litchi tomato was confirmed as a host for V. dahliae and C. coccodes as indicated by the isolation of V. dahliae and C. coccodes from the stems and roots of plants grown in both

greenhouse and field settings. Inoculum production, as measured by the number of CFU/g, of the

V. dahliae potato and mint pathotypes from litchi tomato did not significantly differ, which indicates the potato pathotype was not consistently more aggressive on litchi tomato. The difference in aggressiveness between the V. dahliae potato and mint pathotypes was replicated on the potato cultivars in the greenhouse as evidenced by the increased numbers of observed

CFU produced on the stems or roots of the Verticillium-susceptible cv. Russet Norkotah. In

2014, Russet Norkotah seed pieces were unexpectedly infected with V. dahliae and produced microsclerotia, however further improvements and diligence in checking seed pieces for infection reduced the number of microsclerotia observed in the subsequent trials. Because plant samples were dried before grinding, the CFU observed on the semiselective media (NPX) were likely derived from V. dahliae or C. coccodes microsclerotia instead of conidia or hyphae.

The potato cv. Russet Norkotah is highly susceptible to V. dahliae (Bae et al. 2007), which explains why this cultivar consistently had the greatest numbers of V. dahliae microsclerotia / g tissue. Observations of decreased inoculum production in litchi tomato stems in 2013 and roots in 2014 compared to cv. Russet Norkotah led to the initial conclusion that litchi tomato was less susceptible to V. dahliae than a susceptible potato cultivar. However, litchi tomato did not consistently have significantly greater V. dahliae inoculum production than cv.

Ranger Russet, a cultivar that is moderately resistant to V. dahliae infection (Bae et al. 2007).

The lack of a difference in inoculum production of V. dahliae potato pathotype between Ranger

Russet and litchi tomato in 2014 was probably due to partial resistance on the part of both

Ranger Russet and litchi tomato.

The litchi tomato plants used in this experiment were not expected to be genetically uniform because the seeds used to produce them were from selected intermated plants. The difference in V. dahliae resistance in litchi tomato likely varied between years due to the genetic variability in seed. Different sets of litchi tomato plants that were evaluated in 2013 and 2014 varied in V. dahliae resistance, and these plants also varied in resistance to different pathotypes of V. dahliae. For example, comparisons of the mint pathotype of V. dahliae on roots in 2014 revealed that lower inoculum production within Ranger Russet than litchi tomato but the same trend was not observed when inoculum was the mint pathotype and litchi tomato plants used in

2013.

The inconsistencies in litchi tomato resistance to the two specific V. dahliae pathotypes leaves no clear trend that has emerged across both years. Resistance on the part of litchi tomato could be imparted on certain seedlings, and not others, by genetic variability in resistance genes.

The case can be made for partial resistance since litchi tomato plants were infected but resulted in quantitatively less inoculum production than susceptible potato cultivars. Additionally, symptoms of black dot did not develop on inoculated litchi tomato plants. Litchi tomato could be a source of resistance that would be useful in breeding programs for solanaceous crops where

Verticillium wilt is a limiting factor to potato production. Only populations of litchi tomato selected for resistance to V. dahliae should be used as a trap crop for nematodes.

Greater C. coccodes inoculum production was observed in cvs. Alturas and Russet

Norkotah than litchi tomato in 2013. However, no differences between any of the three potato cultivars and litchi tomato were observed in 2014. The inconsistency in less C. coccodes

inoculum production in litchi tomato stems compared to Alturas and Russet Norkotah is a possible indicator of partial resistance in some individual litchi tomato plants to C. coccodes as plants were infected in 2013 but with quantitatively less inoculum than susceptible potato.

Litchi tomato was infected with V. dahliae at all three field sites in Othello and Prosser,

WA, and Powell Butte, OR. In field trials at Prosser, WA, litchi tomato produced fewer V. dahliae microsclerotia as a result of natural infection than potato cv. Ranger Russet. Litchi tomato infection with C. coccodes was observed at Prosser, WA, and Powell Butte, OR, but not

Othello, WA, which further supports that litchi tomato was partially resistant to infection by either pathogen. However, litchi tomato planted at the Prosser, WA site did not produce fewer V. dahliae microsclerotia as a result of natural infection compared to potato cv. Ranger Russet.

Variation in severity of infection by C. coccodes and V. dahliae between field sites is likely due to differences in inoculum density, but could also be influenced by weather and irrigation events.

Consistent trends in susceptibility to either pathogen between field sites is important for identifying resistance in litchi tomato. Numerically greater numbers of V. dahliae and C. coccodes microsclerotia were sometimes observed in litchi tomato grown in the greenhouse than in the field, and perhaps was a function of greater levels of inoculum (30 CFU/gram) or an environment more conducive for infection by one or both pathogens in the greenhouse.

Litchi tomato was confirmed as a host for V. dahliae and C. coccodes, and the variation in inoculum production between the potato and mint pathotypes of V. dahliae indicate that neither pathotype is consistently more aggressive on litchi tomato. Observations of decreased V. dahliae inoculum densities in litchi tomato compared to potato cv. Russet Norkotah but not

Ranger Russet suggests that litchi tomato was partially resistant to V. dahliae like Ranger Russet.

The inconsistency in decreased C. coccodes inoculum production in litchi tomato stems compared to potato cvs. Alturas and Russet Norkotah could support litchi tomato as partially resistant to C. coccodes. Variation in resistance within the litchi tomato population is expected given that it is an intermated selected population which is genetically variable. Further supporting evidence that litchi tomato has partial resistance to both pathogens is the lack of visible disease symptoms for either pathogen in the greenhouse trials where plants were artificially inoculated.

The use of litchi tomato as a PCN trap crop is likely to have limited effect on the proliferation of V. dahliae or C. coccodes populations in the soil. Slattery et al. (1981) documented an increase of microsclerotia in soil over several seasons in the Red River Valley of

Minnesota and North Dakota with the use of the potato cv. Kennebec which returned relatively high numbers of microsclerotia to the soil after tillage. The conclusions from Slattery et al.

(1981) indicate that the amount of V. dahliae inoculum produced on preceding crops and potato cultivars has influence on the severity of Verticillium wilt in following potato crops (Slattery,

1981). Care would certainly need to be taken to manage both V. dahlaie and C. coccodes in a field planting of litchi tomato since litchi tomato can be infected by both pathogens and possibly return microsclerotia inoculum to the soil, albeit less than a susceptible potato cultivar such as

Russet Norkotah.

ACKNOWLEDGMENTS

This work was supported, in part, by funds from the Northwest Potato Consortium. I would like to thank Dr. Dennis Johnson, Dr. Rich Quick, and Dr. Chuck Brown, as well as Tom

Cummings, for assistance in conducting this research and planting the field trial in Prosser, WA.

I would also like to thank Dr. Inga Zasada for planting litchi tomato in Powell Butte, OR. I appreciate David Wheeler, Dr. Debra Inglis, Dr. Mark Pavek, and Dr. Weidong Chen’s efforts with editorial suggestions before submission.

Literature Cited:

1. Agrios G. N. (2005). Plant Pathology. (5th ed.). San Diego, CA: Elsevier Academic

Press.

2. Alkan, N., Fluhr, R., and Prusky, D. 2012. Ammonium secretion during Colletotrichum

coccodes infection modulates salicylic and jasmonic acid pathways of ripe and unripe

tomato fruit. Mol. Plant-Microbe Interact. 25: 85-96.

3. Aqeel, A. M., Pasche, J. S., and Gudmestad, N. C. 2008. Variability in

morphology and aggressiveness among vegetative compatibility groups of

Colletotrichum coccodes. Phytopathology 98:901-909.

4. Bae, J., Atallah, Z. K., Jansky, S. H., Rouse, D. I., and Stevenson, W. R. 2007.

Colonization dynamics and spatial progression of Verticillium dahliae in individual stems

of two potato cultivars with differing responses to potato early dying. Plant Dis. 91:

1137-1141.

5. Bhat, R. G., Smith, R. F., Koike, S. T., Wu, B. M., and Subbarao, K. V. 2003.

Characterization of Verticillium dahliae isolates and wilt epidemics of pepper. Plant Dis.

87: 789-797.

6. Bhat, R. G., and Subbarao, K. V. 1999. Host range specificity in Verticillium dahliae.

Phytopathology 89: 1218-1225.

7. Bletsos, F., Thanassoulopoulos, C., and Roupakias, D. 2003. Effect of grafting on

growth, yield, and Verticillium wilt of eggplant. HortScience 38: 183-186.

8. Butterfield, E. J., and DeVay, J. E. 1977. Reassessment of soft assays for Verticillium

dahliae. Phytopathology 67: 1073-1078.

9. Chesters, C. G. C., Hornby, D. 1965. Studies on Colletotrichum coccodes 2. Alternative

host tests and tomato fruit inoculations using a typical tomato root isolate. T. Brit. Mycol.

Soc. 48: 583–94.

10. Dandurand, J. M. 2013. Novel eradication strategies for pale cyst nematode. Potato

Progress 13: No. 10.

11. Dias, M. C., Conceição, I. L., Abrantes, I., and Cunha, M. J. 2012. Solanum

sisymbriifolium - a new approach for the management of plant-parasitic nematodes. Eur.

J. Plant Pathol. 133: 171-179.

12. Dung, J. K., Peever, T. L., and Johnson, D. A. 2013. Verticillium dahliae populations

from mint and potato are genetically divergent with predominant haplotypes.

Phytopathology 103: 445-459.

13. Evans, K., and Kerry, B. 2007. Changing priorities in the management of potato cyst

nematodes. Outlooks Pest. Manag. 18: 265–269.

14. Fordyce, C., and Green, K. J. 1960. Studies of host specificity of Verticillium albo-atrum

var. menthae. Phytopathology 50: 635.

15. Ingram, J., and Johnson, D. A. 2010. Colonization of potato roots and stolons by

Colletotrichum coccodes from tuberborne inoculum. Am. J. of Potato Res. 87: 382-389.

16. Joaquim, T. R., and Rowe, R. C. 1991. Vegetative compatibility and virulence of strains

of Verticillium dahliae from soil and potato plants. Phytopathology 81: 552-558.

17. Joaquim, T. R., and Rowe, R. C. 1990. Reassessment of vegetative compatibility

relationships among strains of Verticillium dahliae using nitrate-nonutilizing mutants.

Phytopathology 80: 1160-1166.

18. Johnson, D.A., and Miliczky, E.R., 1993. Effects of wounding and wetting duration on

infection of potato foliage by Colletotrichum coccodes. Plant Dis. 77: 13-17.

19. Katan, T. 2000. Vegetative compatibility in populations of Verticillium—an overview.

Pages 69-86 in: E. C. Tjamos, R. C. Rowe, J. B. Heale, and D. R. Fravel. Advances in

Verticillium: Research and Disease Management. St. Paul, MN: American

Phytopathological Society Press.

20. Lees, A. K., and Hilton, A. J. 2003. Black dot (Colletotrichum coccodes): an increasingly

important disease of potato. Plant Pathol. 52: 3-12.

21. Nitzan, N., Evans, M. A., Cummings, T. F., Johnson, D. A., Batchelor, D. L., Olsen, C.,

Haynes, K. G., and Brown, C. R. 2009. Field resistance to potato stem colonization by

the black dot pathogen Colletotrichum coccodes. Plant Dis. 93: 1116-1122.

22. Nitzan, N., Hazanovsky, M., Tal, M., and Tsror, L. 2002. Vegetative compatibility

groups in Colletotrichum coccodes, the causal agent of black dot on potato.

Phytopathology 92: 827-832.

23. Novy, R. G., Corsini, D. L., Love, S. L., Pavek, J. J., Mosley, A. R., James, S. R., and

Thornton, R. E. 2003. Alturas: a multi-purpose, russet potato cultivar with high yield and

tuber specific gravity. Am. J. of Potato Res. 80: 295-301.

24. Pegg, G. F., and Brady, B. L. 2002. Verticillium wilts. CABI Bioscience Publishing, New

York.

25. Schnathorst, W. C. 1981. Life cycle and epidemiology of Verticillium. New York, New

York: Academic Press.

26. Scholte, K., and Vos, J. 2000. Effects of potential trap crops and planting date on soil

infestation with potato cyst nematodes and root‐knot nematodes. Ann. Appl. Biol 137:

153-164.

27. Slattery, R. J. 1981. Inoculum potential of Verticillium-infested potato cultivars. Am. J.

of Potato Res. 58: 135-142.

28. Timmermans, B. G. H., Vos, J., Van Nieuwburg, J., Stomph, T. J., Van der Putten, P. E.

L., and Molendijk, P. G. 2007. Field performance of Solanum sisymbriifolium, a trap crop

for potato cyst nematodes. Ann. Appl. Biol. 150: 89-97.

29. Tsror, L., Erlich, O., and Hazanovsky, M. 1999. Effect of Colletotrichum coccodes on

potato yield, tuber quality, and stem colonization during spring and autumn. Plant Dis.

83: 561-565.

Table 1. Verticillium dahliae and Colletotrichum coccodes isolates used to confirm host status of litchi tomato (Solanum sisymbriifolium).

Host-adapted Original plant Source Pathogen State of origin VCGa pathotype host citation

Potato Seed Dung et Verticillium dahliae Potato Idaho 4A Tuber al. 2013

Dung et Verticillium dahliae Mint Washington Peppermint 2B al. 2013

Colletotrichum Potato Seed Nitzan et -b Montana 3 coccodes Tuber al. 2002 a Vegetative Compatibility Group. b Not considered for this study.

Table 2. Verticillium dahliae potato pathotype microsclerotia counts (CFU/g) from eggplant, potato, or litchi tomato (Solanum sisymbriifolium) stems at senescence by initial V. dahliae colony forming units (CFU)/g potting medium.

Verticillium dahliae CFU/g potting medium

5 30 50 100

Potato cv. Ranger Russet 49.5 bcz 55.6 ab 72.9 ab 114.5 a

Eggplant cv. Night Shadow 6.4 c 27.0 bc 16.6 bc 39.9 bc

Litchi tomato 2.7 c 4.1 c 8.1 c 10.6 bc

z Letters denote mean separation by Tukey’s Honestly Significant Difference tests for all pairwise comparisons across columns and rows (P < 0.05).

Table 3. Mean number of Verticillium dahliae microsclerotia from stems of three potato cultivars

Alturas, Russet Norkotah, and Ranger Russet, and litchi tomato in a greenhouse experiment in

2013.

Mean CFU / g Stem z

Isolate Russet Ranger Litchi Alturas Norkotah Russet Tomato

Potato pathotype 97.0 a 107.8 a 72.0 a 11.1 d

Mint pathotype 46.3 b 20.5 c 4.5 d 0.8 d

Noninoculated 5.0 d 18.5 c 0.2 d 0.6 d control

z Letters denote mean separation by ANOVA followed by Tukey’s Honestly Significant

Difference tests for all pairwise comparisons for V. dahliae CFU counts across columns and rows (P < 0.05).

Table 4. Mean number of Verticillium dahliae CFU from stems and roots of three potato cultivars Alturas, Russet Norkotah Ranger Russet, and litchi tomato (Solanum sisymbriifolium) in a greenhouse in 2014.

Mean CFU / g Plant Part z Plant V. dahliae isolate Russet Ranger Litchi Part Alturas Norkotah Russet tomato

Potato pathotype 40.8 abc 88.4 a 25.4 abcd 6.1 cdef

Stem Mint pathotype 22.5 abcd 19.5 abcde 6.2 def 12.4 ef

Noninoculated 2.3 f 2.0 f 0.6 f 1.1 f Control

Potato pathotype 57.8 ab 87.4 a 30.4 ab 20.5 b

Root Mint pathotype 31.7 ab 17.8 bc 3.6 cd 22.0 b

Noninoculated 2.3 cd 0.3 d 1.4 cd 1.9 cd control

z Letters denote mean separation by ANOVA followed by a Tukey’s Honestly Significant

Difference tests for all pairwise comparisons for V. dahliae CFU counts across columns and rows (P < 0.05).

Table 5: Mean number of Colletotrichum coccodes CFU from stems and roots of three potato cultivars Alturas, Russet Norkotah Ranger Russet, and litchi tomato (Solanum sisymbriifolium) in a greenhouse in 2013 and 2014.

Mean CFU / g Plant Part z Plant Year Russet Ranger Litchi Part Alturas Norkotah Russet tomato

2013 Stem C. coccodes 40.5 a 19.8 b 19.8 b 3.0 c

Stem C. coccodes 56.0 a 77.0 a 28.8 a 14.8 a 2014 Root C. coccodes 56.0 a 79.3 a 33.0 a 46.1 a z Letters denote mean separation by ANOVA followed by a Tukey’s Honestly Significant

Difference tests for all pairwise comparisons for C. coccodes CFU counts across the 2013 row and for all columns and rows in 2014 (P < 0.05). Each year was analyzed separately.

Table 6: Mean number of Verticillium dahliae or Colletotrichum coccodes CFU from stems of potato and litchi tomato (Solanum sisymbriifolium) in the 2014 field trial in Othello, WA and the

2015 field trials in Prosser, WA and Powell Butte, OR.

V. dahliae C. coccodes Year Location Plant Stem z Root z Stem z Root z

Prosser, WA Potato y 26.6 a 49.6 a 7.6 a 19.6 a 2015 Prosser, WA Litchi tomato 5.4 b 18.9 b 2.3 a 1.6 b

Othello, WA x Potato w 22.4 16.8 18.9 23.3 2014 Othello, WA x Litchi tomato 1 1.1 0 0

Powell Butte, 2015 Litchi tomato 20 3.3 43.3 30 OR x z Letters denote mean separation by ANOVA followed by a Tukey’s Honestly Significant

Difference tests for all pairwise comparisons within columns only (P < 0.05). Each pathogen, year, and each plant part were analyzed separately. y Potato cultivar Russet Burbank x No statistical test conducted (insufficient replication) w Potato cultivar Ranger Russet

CHAPTER THREE

Susceptibility of Weedy Hosts from Pacific Northwest Potato Production Systems to Crop-

Aggressive Isolates of Verticillium dahliae.

ABSTRACT

Verticillium wilt, caused by Verticillium dahliae, is a disease of dicotyledonous crops such as potato and has a wide host range and persistent, long-term survival structures called microsclerotia in soil that can persist for up to 14 years. Some V. dahliae isolates are particularly aggressive on a specific plant host while retaining the abililty to infect a wide range of other hosts. Weeds can serve as hosts for V. dahliae, but whether they serve as sources of inoculum for aggressive isolates of V. dahliae to crop hosts is unknown. The goal of this research was to quantify V. dahliae microsclerotia obtained from 16 weeds which were grown in the greenhouse.

Potting medium was infested with one of eight V. dahliae isolates from potato, mint, sugar beet, sunflower, tomato, and watermelon. The isolates from mint and potato were aggressive on the host they were originally isolated from. All 16 weeds were infected by at least one V. dahliae isolate, although the number of microsclerotia produced from some infections was relatively low

(< 5 microsclerotia/g dry plant). Black nightshade yielded greater numbers of microsclerotia of the V. dahliae potato isolate than any other isolate in three of four trials in the greenhouse

(Second trial False Discovery Rate (FDR) adjusted P < 0.0158, third trial P < 0.0264, fourth trial

P < 0.0193). Litchi tomato yielded greater numbers of microsclerotia of the V. dahliae potato isolate than any other isolate in one of four trials (first trial P < 0.0149). A V. dahliae isolate from tomato yielded greater number of microsclerotia in large crabgrass and wild oats in a second trial P < 0.0158. Weeds, depending on the species, grown during and in-between potato

crop rotations may increase the number of microsclerotia of the potato-aggressive isolates of V. dahliae.

INTRODUCTION

Verticillium wilt, caused by the soil-borne fungus Verticillium dahliae Kleb., is one of the most important diseases of potato in North America (Agrios 2005; Omer et al. 2008).

Microsclerotia function as the source of primary V. dahliae inoculum (Schnathorst 1981).

Microsclerotia are usually found in the top 10-30 cm of soil (Jordon 1971; Taylor et al. 2005), and are distributed where infected plant residues decompose (Mace et al. 1981). Viable microsclerotia can persist in soil for 14 years (Wilhelm 1955), and may be found embedded in decaying host tissue or freely existing in soil (Mace et al. 1981).

Development of Verticillium wilt epidemics depends on the presence and number of microsclerotia in potato field soil prior to planting (Schnathorst 1981). Reducing the number of

V. dahliae microsclerotia, or limiting their ability to germinate, is an important consideration prior to planting potatoes (Mace et al. 1981). Successful Verticillium wilt management hinges on the combined effects of chemical treatments (soil fumigants), suppressive soils, resistant cultivars (when available), and irrigation management (Johnson and Dung 2010; Pegg and Brady

2002). Verticillium dahliae infection can occur whenever microsclerotia are present in soil, but epidemics of Verticillium wilt of potato typically arise when a minimum of 5 to 30 microsclerotia per gram of soil are present (Powelson and Rowe 1993). The disparity in

Verticillium wilt severity and the number of microsclerotia in soil has been attributed to V. dahliae aggressiveness (Mace et al. 1981; Schnathrost 1981).

Certain V. dahliae isolates are considered more aggressive than other isolates when increasingly severe symptoms or greater numbers of microsclerotia are produced within one host compared to other plants in the host range (Douhan and Johnson 2001). Repeated infection of the same host by the same V. dahliae isolate is thought to accentuate aggressiveness. This phenomenon may occur over a relatively short period of time and within both annual and perennial crop hosts (Bhat et al. 2003; Fordyce and Green 1960).

Individual V. dahliae isolates that are aggressive to a particular host are called host- adapted pathotypes (Dung et al. 2013; Pegg and Brady 2002). The term is sometimes abbreviated to pathotype for ease of explanation. Certain V. dahliae isolates that are grouped into pathotypes often fall into a vegetative compatibility group (VCG; Katan 2000), although every isolate classified into a single VCG is not necessarily the same pathotype (Bhat and Subbarao 1999;

Dung et al. 2013). Classifying V. dahliae to VCGs is conducted by complementation of nitrate- nonutilizing (nit) mutants that fuse with previously identified VCG tester cultures when cultured on minimal media with defined nitrogen sources (Joaquim and Rowe 1990; 1991).

Weeds present in the field are competitors for water, nutrients, sunlight, and space (Baker

1974). Hairy nightshade (Solanum physalifolium) at a density of one or three plants per 3-ft row of potato can reduce U.S. No. 1 yield of potato cultivars Russet Norkotah and Russet Burbank by up to 27% and 10%, respectively (Hutchinson et al. 2011). One barnyard grass (Echinochloa crus-galli) plant per m2 of potato reduced marketable tuber yield by 19% if the barnyard grass

emerged prior to the adjacent potato plants and continued to grow throughout the season in

Michigan (Vangessel and Renner 1990).

Weedy hosts also can pose a problem by supporting pathogen populations (Linde et al.

2016) and by returning inoculum to the soil when residue decomposes at the end of the season

(Woolliams 1966). Busch et al (1978) emphasized that even immature weedy seedlings can host

V. dahliae when distinctive Verticillium conidiophores were observed on 3-week-old seedlings.

Aggressive pathotypes of a fungal pathogen may infect and persist in the environment through a potential weedy host, and possibly maintain aggressiveness until the crop host is infected again.

The hypothesis that an aggressive pathogen can persist in the environment through a weedy host was confirmed in the pathosystem involving Rhynchosporium commune, a fungal pathogen of weedy barley grass (Hordeum spp.), as well as barley (Hordeum vulgare). In this case “barley grass acts as an important ancillary host to R. commune, harbouring highly virulent pathogen types capable of transmission to barley.” This observation underlies the point that management of disease where pathogen aggressiveness can be maintained from a crop to weedy host and then back to the original crop must include an understanding of the maintenance of pathogen aggressiveness and ultimately control of the weed host (Linde et al. 2016).

Weedy hosts such as black nightshade and hairy nightshade are important to potato production in the Pacific Northwest because of their ability to directly compete for resources and serve as a host for potato pathogens (Hutchinson et al. 2011). The interaction of V. dahliae host- adapted pathotypes with weedy hosts has not been explored, despite the importance of aggressive isolates of V. dahliae to Verticillium wilt epidemics on potato. Complete understanding of the

interaction of aggressive isolates of V. dahliae with weedy hosts is important to successful long- term management of Verticillium wilt of potato because locations where Verticillium-susceptible weedy hosts are prevalent in the potato field could present greater inoculum pressure from V. dahliae aggressive to potato in subsequent years. The objective of this study was to: (i) identify the susceptibility of 16 weeds from the Columbia basin to eight V. dahliae isolates, and (ii) identify weedy hosts where the potato or mint pathotype produce greater numbers of microsclerotia compared to other V. dahliae isolates.

MATERIALS AND METHODS

Origin and preparation of V. dahliae isolates.

V. dahliae isolates were previously characterized for aggressiveness to various hosts and

VCG identity by Dung et al. (2013) (Table 1). Inoculum was prepared by placing a single microsclerotium on semiselective media (NPX) for V. dahliae (Butterfield and DeVay 1977) and allowing growth for ten days before identification by morphology was confirmed following the protocol from Inderbitzin et al. (2011). A subsection of the actively growing border of the colony was collected with a cork borer (7 mm diameter) and agar disks were placed in Czapek-dox broth

(Sigma-Aldrich, St. Louis, MO). Liquid cultures were shaken at 150 RPM at a room temperature of 21 to 23ºC for 10 days. The CFU of conidial suspensions were standardized using a hemocytometer.

Quantification of V. dahliae CFU in weedy hosts and crops.

Comparisons in the aggressiveness of V. dahliae isolates to 16 weedy hosts and three crops hosts (Table 1) were made in four trials in a greenhouse from 2014 to 2016. A broad range

of weeds were evaluated for V. dahliae susceptibility in the first two trials. The third and fourth trial focused on nightshades to further explore the interaction of the potato pathotype of V. dahliae and weedy nightshade hosts. A total of eight V. dahliae isolates were used in all four trials (Table 1), with one noninoculated control treatment. Potato (Russet Norkotah) was planted as a positive control in third and fourth trials because of susceptibility to infection by V. dahliae and the potato pathotype of V. dahliae was expected to produce more microsclerotia than other isolates within potato. Eggplant was expected to be susceptible to all V. dahliae isolates employed in these experiments and was planted in second, third, and fourth trials to demonstrate the ability of all isolates employed in the study to infect a universally susceptible host.

Seeds of the 16 weeds and two crop hosts (Table 1) were germinated on moistened filter paper to determine if seed was free from V. dahliae. Germinated seed was visually assessed for the presence or absence of disease symptoms, sporulation, and microsclerotia associated with V. dahliae. Potato tubers from cultivars Alturas, Russet Norkotah, and Ranger Russet were assayed for the absence of V. dahliae by slicing an approximately 0.5 cm thick segment from the stolon end of the tuber, surface sterilized by submerging in 10% sodium hypochlorite (NaOCl, 6.0%,

Independent Marketing Alliance, Houston, TX) for three minutes, rinsing in deionized water, and blotting dry. The segment from the stolon end of the tuber then was placed on NPX and incubated at room temperature (21 to 23ºC) for 10 days, after which the presence or absence of

V. dahliae microsclerotia was confirmed through visual observation of microsclerotia and sporulation using an Olympus SD-ILK dissecting microscope at 7 to 20X magnification

(Olympus Optical Ltd, Tokyo, Japan). Potato tubers that did not test positive for microsclerotia were planted in 3.79 liter pots with soilless potting medium (Sunshine Advanced Growing Mix

#4, Sun Gro, Agawam, MA) and allowed to grow for one month. Soilless potting medium was assumed to be free of V. dahliae.

The experiment had 18 levels for host and eight levels for pathogen (Table 1) and pots were arranged in a completely randomized design with three replicates. Each potential weedy or crop host in each individual pot (experimental unit) was inoculated by dipping roots in a conidial suspension of a single V. dahliae isolate (Table 1). Seedlings no greater than 8 cm in length were inoculated by submerging the hypocotyl and primary root in agitated conidial suspension of one

V. dahliae isolate at a concentration of approximately 1.0 X 106 colony forming units (CFU)/ mL for 2 to 3 seconds. Potential weedy and crop host seedlings were then directly transplanted into moistened soilless potting medium in 3.79 liter pots. Seedlings from the non-inoculated reference control treatment were kept separate from seedlings inoculated with V. dahliae during the inoculation step in order to prevent cross-contamination. Seedlings that were inoculated with V. dahliae or were noninoculated were kept in the same greenhouse for the duration of the experiment. The greenhouse was maintained a daytime average of approximately 23ºC and a nighttime average temperature of 15.5ºC with no supplemental lighting.

Plants were visually inspected for symptoms of Verticillium wilt once a week during four months of growth after inoculation. Plants were harvested after four months of growth in the greenhouse, soilless potting mix was washed off, blotted dry, and slowly dried for one month at ambient temperatures of 21-24ºC. Slow drying was necessary in order to facilitate the formation of microsclerotia and desiccation of conidia and hyphae. A dried stem section from the crown to upwards of 16 cm and a root section from the crown downward to approximately 9 cm was

harvested from each plant. Dried stems or roots were ground with an electric coffee grinder

(Secura, Appleton, WA) until the particle size was approximately less than 4 mm2. The removable cup from the grinder, as well as the lid, was sprayed with a mixture of 70% ethanol and 30% deionized water between plant samples in order to sterilize grinder surfaces that plant matter contacted.

The number of V. dahliae CFU for each dried plant part was determined by placing one gram of dried plant stem or root on NPX and counting the number of colonies after 10 days using an Olympus SD-ILK dissecting microscope at 7 to 20X magnification (Olympus Optical Ltd,

Tokyo, Japan). Verticillium dahliae colonies were identified and differentiated from other fungi using the protocol not unlike what is outlined by Inderbitzin et al. (2011): including first by growth on the semi-selective medium (NPX), the absence of the yellow pigment (flavexudan) in culture, followed by observations of the irregularly shaped and melanized microsclerotia, and finally by the presence of the characteristic verticillate conidiophores with slimy, terminal amerospores.

Data analysis

Differences in the number of observed V. dahliae microsclerotia for each V. dahliae isolate on a weed or crop host were determined by Permutational multivariate analysis of variance or PERMANOVA (Plymouth Routine In Multivariate Ecological Research, PRIMER-E

Ltd., v7 Lutton, Ivybridge, UK). PERMANOVA has been employed for testing hypotheses with ecological data sets that do not satisfy parametric assumptions and nonparametric analyses

(Anderson 2001). PERMANOVA also has been used recently to test both incidence of V. dahliae

infected stems and microsclerotia number differed among or within different field crops

(Wheeler and Johnson 2016). PERMANOVA was selected for these data because the use of nonparametric permutation techniques do not require parametric assumptions since no distribution is assumed, which is important because not every weedy host interacted with every

V. dahliae isolate and resulted in zero-rich data. The mean number of microsclerotia recovered from the same plant (experimental unit) was determined by averaging microsclerotia counts from stem and roots in order to remove plant part as a factor in the analysis and reduce the number of factors for PERMANOVA testing. PERMANOVA tests operated under the null hypotheses that the number of microsclerotia were not different within weedy or crop hosts between the eight V. dahliae isolates (Table 1) and one noninoculated reference control. PERMANOVA conditions are important to note for the purposes of repeatability, and were based upon a log(X+1) transformation, followed by the creation of a Bray-Curtis dissimilarity matrix; PERMANOVA was conducted with 9999 permutations under a reduced model. Monte Carlo tests were employed to calculate P-values for pairwise comparisons when there were fewer than 100 unique permutations (Anderson et al. 2008). Familywise type I error (false discoveries) can become a problem for numerous pairwise comparisons, but this problem was controlled using a false discovery rate (FDR, Benjamini and Hochberg 1995; Glickman et al. 2014) to adjust

PERMANOVA P-values to differentiate truly significant differences from false positives not unlike a Bonferroni correction. Because the FDR corrects the P-value is significant for a specific data set, the P-value value indicative of significance will vary with each trial in this experiment.

The V. dahliae isolate with the greatest microsclerotia counts within one weed or crop was assigned whenever pairings of one weed and isolate was greater than 6/7 comparisons between

V. dahliae isolates within that same weed. One V. dahliae isolate was not expected to produce

greater numbers of microsclerotia than every isolate evaluated because multiple isolates came from the same host or were from the same pathotype, and would theoretically produce similar numbers of microsclerotia within the same type of weedy host. Specific comparisons between microsclerotia counts of any two isolates within a weed were not conducted because the goal was to identify which isolate produced more microsclerotia within a weed compared to a range of isolates.

RESULTS

Quantification of V. dahliae CFU in weedy hosts and crops. All weed and crop hosts evaluated were infected by at least one isolate of V. dahliae as evident by microsclerotia produced in the hosts (Tables 2-5). V. dahliae infections of weedy hosts often yielded small numbers of observed microsclerotia (<5 microsclerotia per gram of plant, Tables 2-5).

Differences in V. dahliae microsclerotia production by V. dahliae isolate existed for some, but not all weedy hosts (Tables 2-5).

The FDR-adjusted P-value for significance was set at P < 0.0149 for the first trial. A significant host × isolate interaction (P < 0.0001) was detected, necessitating comparisons of cell mean microsclerotia counts within the factor of host. The V. dahliae potato pathotype (isolate

653, Table 1) produced more microsclerotia within litchi tomato than V. dahliae isolates 111 (P

= 0.0107), 155 (P = 0.0001), 381 (P =0.0085), 625 (P = 0.0104), SF (P = 0.0143), and VMD-4

(P = 0.0059) (Table 2). There was no difference in the number of microsclerotia in litchi tomato between the potato pathotype and the tomato isolate (isolate 461, P = 0.0473). A V. dahliae isolate from tomato (isolate 461) infected pigweed tumble resulting in greater numbers of V.

dahliae microsclerotia than other V. dahliae isolates 111 (P = 0.0112), 155 (P = 0.0008), 381 (P

=0.0001), 625 (P = 0.0003), SF (P = 0.0001), and VMD-4 (P = 0.0001) (Table 2). There was no difference in the number of microsclerotia in pigweed tumble between the potato pathotype

(isolate 653) and the isolate from tomato (isolate 461, P = 0.0884). No symptoms of Verticillium wilt were observed at any time in any of the weedy hosts evaluated during this trial (Data not shown).

The FDR-adjusted P-value for significance was set at P < 0.0158 for the second trial. A significant host × isolate interaction (P < 0.0001) was detected, necessitating comparisons of cell mean microsclerotia counts within the factor of host. The V. dahliae potato pathotype (isolate

653, Table 1) produced more microsclerotia within black nightshade than other V. dahliae isolates 111 (P = 0.005), 155 (P = 0.0004), 381 (P =0.0001), 461 (P = 0.0132), 625 (P = 0.0001),

SF (P = 0.0132), and VMD-4 (P = 0.0149) (Table 3). The V. dahliae potato pathotype (isolate

653) unexpectedly produced more microsclerotia within eggplant than other V. dahliae isolates

(P < 0.0158) except the isolate SF (P = 0.1572). Inoculation of large crabgrass with a V. dahliae isolate from tomato (isolate 461) caused infections with significantly greater numbers of V. dahliae microsclerotia than other V. dahliae isolates 111 (P = 0.0001), 155 (P = 0.0015), 381 (P

=0.0015), 625 (P = 0.0001), 653 (P = 0.0058), and VMD-4 (P = 0.0001) (Table 3). There was no difference in the number of microsclerotia in large crabgrass between isolate SF and the isolate from tomato (isolate 461, P = 0.3766). Similarly, a V. dahliae isolate from tomato (isolate 461) caused infections wild oat with significantly greater numbers of V. dahliae microsclerotia than other V. dahliae isolates 111 (P = 0.0038), 155 (P = 0.0001), 625 (P = 0.0059), 653 (P =

0.0136), SF (P = 0.0005), and VMD-4 (P = 0.0001) (Table 3). There was no difference in the

number of microsclerotia in wild oat between an isolate from watermelon (isolate 381) and the isolate from tomato (isolate 461, P = 0.0655, Table 3). No symptoms of Verticillium wilt were observed at any time in any of the weedy hosts evaluated during this trial (Data not shown).

The FDR-adjusted P-value for significance was set at P < 0.0264 for the third trial. A significant host × isolate interaction (P < 0.0001) was detected, necessitating comparisons of cell mean microsclerotia counts within the factor of host. The V. dahliae potato pathotype (isolate

653, Table 1) produced more microsclerotia within black nightshade than other V. dahliae isolates 111 (P = 0.0240), 155 (P = 0.0201), 381 (P =0.0241), 625 (P = 0.0243), SF (P =

0.0210), and VMD-4 (P = 0.0109) (Table 4). There was no difference in the number of microsclerotia in black nightshade between the potato pathotype and the tomato isolate (isolate

461, P = 0.0368). The V. dahliae potato pathotype produced more microsclerotia within potato than other V. dahliae isolates (P < 0.0264). Potato cv. Russet Norkotah was used as a universally susceptible control in this experiment, but it was expected that the potato would also be more susceptible to the potato pathotype of V. dahliae (Table 4). A V. dahliae isolate from tomato

(isolate 461) infected henbit with significantly greater numbers of V. dahliae microsclerotia than other V. dahliae isolates 111 (P = 0.0248), 155 (P = 0.0090), 381 (P =0.0228), 625 (P = 0.0162),

653 (P = 0.0021), SF (P = 0.0257), and VMD-4 (P = 0.0172) (Table 4). A V. dahliae isolate from tomato (isolate 461, Table 1) caused infections in wild oat with significantly greater numbers of V. dahliae microsclerotia than other V. dahliae isolates 111 (P = 0.0002), 155 (P =

0.0084), 381 (P =0.0888), 625 (P = 0.0093), 653 (P = 0.0095), SF (P = 0.0097), and VMD-4 (P

= 0.0160) (Table 4). No symptoms of Verticillium wilt were observed at any time in any of the weedy hosts evaluated during this trial (Data not shown).

The FDR-adjusted P-value for significance was set at P < 0.0193 for the fourth trial. A significant host × isolate interaction (P < 0.0001) was detected, necessitating comparisons of cell mean microsclerotia counts within the factor of host. The V. dahliae potato pathotype (isolate

653) produced more microsclerotia within black nightshade than other V. dahliae isolates 111 (P

= 0.0106), 155 (P = 0.0001), 381 (P = 0.0124), 461 (P = 0.0187), 625 (P = 0.0147), SF (P =

0.0140), and VMD-4 (P = 0.0045) (Table 5). The V. dahliae potato pathotype produced more microsclerotia within potato than other V. dahliae isolates (P < 0.0193). No symptoms of

Verticillium wilt were observed at any time in any of the weedy hosts evaluated during this trial

(Data not shown).

The V. dahliae potato pathotype (isolate 653) produced more microsclerotia than other V. dahliae isolates within black nightshade in three of four trials (Fig. 1). The V. dahliae isolate from tomato (isolate 461) produced more microsclerotia than other V. dahliae isolates within wild oats in two of three trials (Fig. 1). That same V. dahliae isolate from tomato (isolate 461) caused infections with significantly greater numbers of V. dahliae microsclerotia than other V. dahliae isolates in pigweed tumble (first trial), large crabgrass (second trial), and henbit (third trial) (Fig. 1) but only in one trial each. Other nightshade weedy hosts, such as bittersweet nightshade, did not produce many microsclerotia when infected with any of these V. dahliae isolates in either trial (<5 microsclerotia for one out of eight in the third trial and four out of eight in the fourth trial, Tables 4-5). Conversely, weedy hosts such as eastern black nightshade and hairy nightshade were susceptible to infection by six of eight and all eight V. dahliae isolates, respectively, although no one isolate produced more microsclerotia than the seven other isolates

(Tables 4-5). However, both hairy and eastern black nightshade were susceptible to infection by the V. dahliae potato pathotype (isolate 653, Tables 4-5), as evident by numerous microsclerotia recovered from the dried tissues.

DISCUSSION

A broad range of potential weedy hosts was evaluated for V. dahliae susceptibility in the first two trials. The third and fourth trial focused on nightshades because of the interaction of black nightshade with the potato pathotype of V. dahliae, and questions were raised if that observation was consistent for other nightshades. Every weed tested in this study was confirmed

(or re-confirmed) as a host for V. dahliae as indicated by the recovery of V. dahliae from plants grown in greenhouse settings. Detection of significant crop × isolate interactions in all four trials for mean microsclerotia counts supports the existence of differential aggressiveness for isolates of V. dahliae because differences in observed number of microsclerotia depended on the isolate with which each weedy or crop host was infected.

Symptoms of Verticillium wilt such as chlorosis, stunting, and premature senescence

(Mace et al. 1981) were not observed in any of the weedy hosts evaluated within any of the four trials despite the presence of microsclerotia in infected stems. Verticillium dahliae infections that lack symptoms have been described previously and are referred to as asymptomatic infections

(Wheeler and Johnson 2016; Woolliams 1966). Asymptomatic V. dahiae infections have been noted previously from the recovery of V. dahliae from susceptible crops in rotation with potato

(Wheeler and Johnson 2016), some weedy hosts (Woolliams 1966), and even monocots hosts such as barley (Mol 1995).

The CFU observed on semiselective media (NPX) were likely derived from microsclerotia of V. dahliae instead of conidia or hyphae because plant samples were dried before grinding. The absence of V. dahliae infection in most of the weedy hosts that were not inoculated with any V. dahliae isolate (nontreated controls) in each trial suggests potting medium or seedlings planted were generally free of V. dahliae microsclerotia or infected plant material.

The 0.2 to 0.3 mean microsclerotia that were observed in the first trial were few in number and unlikely to confound microsclerotia counts from plants inoculated with a particular V. dahliae isolate.

The V. dahliae potato pathotype produced more microsclerotia than other isolates when infecting black nightshade in three of four trials. Eastern black nightshade and hairy nightshade were generally susceptible to most of the V. dahliae isolates, including the potato pathotype, but no isolate produced more microsclerotia than the other isolates as a result of infection. Weedy hosts such as black nightshade and hairy nightshade could increase the microsclerotia of potato pathotype isolates of V. dahliae present in the field. These potato-aggressive V. dahliae isolates are likely to persist in-between or during potato rotations provided no Verticillium control practice eliminates them.

This is not the first report of V. dahliae infections on the monocotyledonous plant hosts.

Previous reports suggest new inoculum of V. dahliae can form in monocot stems and roots such as barley (Mathre 1989; Schnathorst 1981; Wheeler and Johnson 2016). While interesting, these observations of increased microsclerotia as a result of infection with isolate 461 (from tomato) in

wild oat and large crabgrass did not occur in every trial that they were included in.

Microsclerotia from the potato pathotype of V. dahliae were observed also in wild oat, indicating that the potato pathotype can infect wild oat, but these infections did not produce significantly greater numbers of microsclerotia than all the other isolates infecting wild oat. The possibility for potato-aggressive isolates of V. dahliae to persist through infections of wild oat exists. This effect of monocot susceptibility to V. dahliae may be inconsistent in the field and depends on the susceptibility of the individual plant in question, therefore explaining why the result wasn’t consistent across all trials.

Eggplant and potato were planted as positive controls that was susceptible to infection by

V. dahliae, and some isolates were expected to produce more microsclerotia when infecting these hosts. The potato pathotype consistently produced more microsclerotia than other isolates of V. dahliae within potato, as anticipated. Eggplant was susceptible to all V. dahliae isolates employed in these experiments, although one isolate from tomato (isolate 461) produced more microsclerotia than other isolates in one of three trials, while the V. dahliae potato pathotype produced more microsclerotia also in one of three trials. This disparity reflects the overall susceptibility of eggplant to all of these different V. dahliae isolates in that no consistent trend emerged across the three trials that eggplant was included in, despite the fact that most isolates were capable of infecting eggplant and producing microsclerotia.

The weeds used in this experiment were not expected to be genetically uniform because the seeds used to produce them were from open pollinated plants. The difference in V. dahliae susceptibilityin these weedy hosts, especially to different pathotypes, may have varied between

years due to the genetic variability of the seed. Each plant evaluated in each trial was genetically distinct and possibly more or less susceptible to this V. dahliae isolate. Even though the weeds were genetically diverse, consistent observations of increased microsclerotia production by aggressive isolates of V. dahliae within one weedy hosts means that these weeds could pose a potential threat to potato production.

The recurring observation of black nightshade being susceptible to the potato pathotype of V. dahliae is important in managing Verticillium wilt of potato because locations where black nightshade are prevalent in the potato field may have greater inoculum pressure from V. dahliae aggressive to potato in subsequent years. Linde et al. (2016) highlighted that management of disease where pathogen aggressiveness can be maintained between a crop to weedy host must include an understanding of two important factors: (i) the maintenance of pathogen aggressiveness, and (ii) ultimately control of the weed host. These greenhouse trials have highlighted how black nightshade could be an important source of microsclerotia from the potato pathotype of V. dahliae, which is the first factor Linde et al. (2016) described. Further research can link the field location of weedy hosts such as black nightshade and the distribution of V. dahliae microsclerotia in potato fields. The goal of improving Verticillium wilt disease management by simultaneously decreasing weedy competitors and eliminating alternative hosts for potato-aggressive isolates of V. dahliae could then be achieved.

ACKNOWLEDGMENTS

This work was supported, in part, by funds from the Northwest Potato Consortium. I would like to extend thanks to Dr. Dennis Johnson and Tom Cummings for assistance in conducting this research. I thank Dr. Rick Boydston for providing the seed of weedy hosts, and

Dr. Chuck Brown for providing litchi tomato seeds. I appreciate David Wheeler, Dr. Denns

Johnson, Tom Cummings, Dr. Debra Inglis, Dr. Mark Pavek, and Dr. Weidong Chen’s efforts with editorial suggestions before submission.

Literature cited:

1. Agrios G. N. (2005). Plant Pathology. (5th ed.). San Diego, CA: Elsevier Academic

Press.

2. Anderson, M. J. 2001. A new method for non-parametric multivariate analysis of

variance. Austral Ecol. 26: 32-46.

3. Baker, H. G. (1974). The evolution of weedy hosts. Annual review of ecology and

systematics (Vol. 5). Palo Alto, CA; Annual Reviews.

4. Benjamini, Y., and Hochberg, Y. 1995. Controlling the false discovery rate: A practical

and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B. Stat. Methodol. 57:

289-300.

5. Bhat, R. G., Smith, R. F., Koike, S. T., Wu, B. M., and Subbarao, K. V. 2003.

Characterization of Verticillium dahliae isolates and wilt epidemics of pepper. Plant Dis.

87: 789-797.

6. Bhat, R.G. and Subbarao, K.V. 1999. Host range specificity in Verticillium dahliae.

Phytopathology 89: 1218–1225.

7. Busch, L. V., Smith, E. A., and Njoh-Elango, F. 1978. The effect of weedy hosts on the

value of rotation as a practical control for Verticillium wilt of potato. Can. Plant Dis.

Surv. 58: 61.

8. Butterfield, E.J., and DeVay, J.E. 1977. Reassessment of soft assays for Verticillium

dahliae. Phytopathology 67: 1073-1078.

9. Douhan, L. I., and Johnson, D. A. 2001. Vegetative compatibility and pathogenicity of

Verticillium dahliae from spearmint and peppermint. Plant Dis. 85: 297-302.

10. Dung, J. K., Peever, T. L., and Johnson, D. A. 2013. Verticillium dahliae populations

from mint and potato are genetically divergent with predominant haplotypes.

Phytopathology 103: 445-459.

11. Fordyce, C., and Green, K.J. 1960. Studies of host specificity of Verticillium albo-atrum

var. menthae. Phytopathology 50: 635.

12. Glickman, M. E., Roa, S. R., and Schultz, M. R. 2014. False discovery rate control is a

recommended alternative to Bonferroni-type adjustments in health studies. J. Clin.

Epidemiol. 67: 850-857.

13. Hutchinson, P. J. S., Beutler, B. R., and Farr, J. 2011. Hairy nightshade (Solanum

sarrachoides) competition with two potato varieties. Weed science 59: 37-42.

14. Inderbitzin, P., Bostock, R. M., Davis, R. M., Usami, T., Platt, H. W., and Subbarao, K.

V. 2011. Phylogenetics and taxonomy of the fungal vascular wilt pathogen Verticillium,

with the descriptions of five new species. PloS one 6: e28341.

15. Joaquim, T. R., and Rowe, R. C. 1991. Vegetative compatibility and virulence of strains

of Verticillium dahliae from soil and potato plants. Phytopathology 81: 552-558.

16. Joaquim, T. R., and Rowe, R. C. 1990. Reassessment of vegetative compatibility

relationships among strains of Verticillium dahliae using nitrate-nonutilizing mutants.

Phytopathology 80: 1160-1166.

17. Johnson, D.A., and Dung, J.K.S. 2010. Verticillium wilt of potato-the pathogen, disease

and management. Can. J. Plant Pathol. 32: 58-67.

18. Jordon, V.W. 1971. Estimation of the distribution of Verticillium populations in infected

strawberry plants and soil. Plant Pathol. 20: 21-24.

19. Katan, T. 2000. Vegetative compatibility in populations of Verticillium—an overview.

Pages 69-86 in: E. C. Tjamos, R. C. Rowe, J. B. Heale, and D. R. Fravel. Advances in

Verticillium: Research and Disease Management. St. Paul, MN: American

Phytopathological Society Press.

20. Linde, C. C., Smith, L. M., and Peakall, R. 2016. Weedy hosts, as ancillary hosts, pose

disproportionate risk for virulent pathogen transfer to crops. BMC Evol. Boil. 16: 101.

21. Mace, M; Bell, A; and Beckman, C. (1981). Fungal Wilt Diseases of Plants. New York,

NYL Academic Press, Inc.

22. Mathre, D. E. 1989. Pathogenicity of an isolate of Verticillium dahliae from barley. Plant

Dis. 73: 164-167.

23. Mol, L. 1995. Formation of microsclerotia of Verticillium dahliae on various crops. Neth.

J. Agric. Sci. 43: 205-215.

24. Omer, M. A., Johnson, D. A., Douhan, L. I., Hamm, P. B., and Rowe, R. C. 2008.

Detection, quantification, and vegetative compatibility of Verticillium dahliae in potato

and mint production soils in the Columbia Basin of Oregon and Washington. Plant Dis.

92: 1127-1131.

25. Pegg, G.F. and Brady, B.L. (2002).Verticillium Wilts. Wallingford, UK: CABI

Publishing.

26. Powelson, M.L., and Rowe, R.C. 1993. Biology and management of early dying of

potatoes. Annu. Rev. Phytopathol. 31: 111-126.

27. Schnathorst, W. C. 1981. Chapter 4: Life cycle and epidemiology of Verticillium.

Chapter from Mace, Marshall, Bell, Alois, and Beckman, Carl. Fungal wilt diseases of

plants, Academic Press, New York.

28. Taylor, R.J., Pasche, J.S., and Gudmestad, N.C. 2005. Influence of tillage and methods of

metam sodium application on distribution and survival of Verticillium dahliae in the soil

and the development of potato early dying disease. Amer J of Potato Res. 82: 450-461.

29. Vangessel, M. J., and Renner, K. A. 1990. Redroot pigweed (Amaranthus retroflexus)

and barnyardgrass (Echinochloa crus-galli) interference in potatoes (Solanum

tuberosum). Weed Sci. 38: 338-343.

30. Wheeler, D. L., and Johnson, D. A. 2016. Verticillium dahliae infects, alters plant

biomass, and produces inoculum on rotation crops. Phytopathology 106: 602-613.

31. Wilhelm, S. 1955. Longevity of Verticillium wilt fungus in the laboratory and field.

Phytopathology 45: 180-81.

32. Woolliams, G. E. 1966. Host range and symptomatology of Verticillium dahliae in

economic, weed, and native plants in interior British Columbia. Canadian Journal of

Plant Sci. 46: 661-669.

Table 1. Weed plants and crop hosts, number of trials, and isolate characteristics of Verticillium dahliae used to determine microsclerotia production when potential host plants were inoculated with V. dahliae host-adapted isolates in four greenhouse trials in 2014-2016.

Common Name Latin Binomial No. of Trials

Annual Bluegrass Poa annua 2

Annual Sowthistle Sonchus oleraceus 2

Barnyard Grass Echinochloa crusgalli 2

Bittersweet Nightshade Solanum dulcamara 2

Black Nightshade Solanum nigrum 4

Common Lambsquarters Chenopodium album 2

Downy Brome Bromus tectorum 2

Eastern Black Nightshade Solanum ptycanthum 2

Eggplant (cv. 'Night Shadow') Solanum melongena 3

Green Foxtail Setaria viridis 2

Hairy Nightshade Solanum physalifolium 2

Large Crabgrass Digitaria sanguinalis 2

Litchi Tomato Solanum sisymbriifolium 2

Pigweed Powell Amaranthus powellii 2

Pigweed Tumble Amaranthus albus 1

Potato (cv. ‘Russet Norkotah’) Solanum tuberosum 2

Rattail Fescue Vulpia myuros 2

Wild Oat Avena fatua 3

V. dahliae VCG a Pathotype Original Host b Isolate Name

111 2B Mint Mint

155 2B Mint Mint

381 2 A/B - Watermelon

461 2 - Tomato

625 2B - Sugar Beet

653 4A Potato Potato

SF 2A - Sunflower

VMD-4 2 A/B - Tomato

a VCG: vegetative compatibility group b Host of origin for the V. dahliae isolate. Isolates originating from potato or mint are the potato or mint pathotypes, respectively.

Table 2. Mean and standard error for the number of microsclerotia from eight isolates obtained from 13 weedy hosts in the greenhouse when inoculated with Verticillium dahliae in the first trial.

Isolate

Control Host 111 a 155 a 381 461 625 653 b SF VMD-4 c

Annual bluegrass 0.5 ± 0.3 6.0 ± 3.2 0.2 ± 0.2 19.2 ± 5.4 5.8 ± 2.3 3.0 ± 1.1 15.3 ± 11.6 1.5 ± 0.9 0.0 ± 0.0

Annual 23.7 ±

3.3 ± 2 2.8 ± 0.7 2.0 ± 1.3 11.5 ± 9.3 2.3 ± 1.1 11.5 ± 10.3 0.0 ± 0.0 0.3 ± 0.2 2 sowthistle 16.2 9

Barnyard grass 0.7 ± 0.4 5.5 ± 3.3 0.3 ± 0.2 0.3 ± 0.3 0.3 ± 0.3 0.2 ± 0.2 5.0 ± 1.8 0.7 ± 0.4 0.0 ± 0.0

16.5 ± 12.8 ± Black nightshade 3.5 ± 0.5 9.8 ± 1.2 8.0 ± 2.0 6.8 ± 3.5 5.8 ± 1.5 8.2 ± 2.0 0.0 ± 0.0 4.2 6.8

Common 12.8 ± 44.0 ± 1.0 ± 1.0 6.5 ± 2.2 16.3 ± 8.8 0.3 ± 0.3 7.0 ± 0.9 5.7 ± 1.3 0.2 ± 0.2 lambsquarters 9.2 20.8

100.2 ± 22.5 ± 48.3 ± 26.8 ± Downy brome 2.7 ± 1.3 0.5 ± 0.5 7.3 ± 4.2 34.3 ± 30.4 0.0 ± 0.0 62.7 14.0 26.0 13.2

21.5 ± Green foxtail 6.5 ± 3.8 0.0 ± 0.0 0.0 ± 0.0 13.7 ± 9.2 1.2 ± 0.7 9.3 ± 4.4 2.7 ± 1.5 0.0 ± 0.0 13.9

15.5 ± Large crabgrass 0.2 ± 0.2 2 ± 0.9 1.2 ± 0.7 10.2 ± 4.8 0.8 ± 0.7 2.8 ± 1.2 0.0 ± 0.0 0.0 ± 0.0 11.1

5.8 ±

Litchi tomato 0.5 ± 0.3 0.2 ± 0.2 2.3 ± 1.7 6.8 ± 2 1.3 ± 0.8 2.3 ± 0.6 1.3 ± 0.7 0.0 ± 0.0

0.9* 3 9

23.5 ± Pigweed powell 1.0 ± 0.6 0.3 ± 0.2 1.3 ± 0.6 1.8 ± 0.2 3.8 ± 2.5 9.3 ± 2.0 1.7 ± 1.1 0.0 ± 0.0 19.9

12.3 ± Pigweed tumble 5.2 ± 1.3 2.8 ± 2.8 0.0 ± 0.0 1.2 ± 0.5 29 ± 24.3 2.2 ± 0.2 0.2 ± 0.2 0.0 ± 0.0 1.8*

Rattail Fescue 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 4.7 ± 3.0 0.0 ± 0.0 2.3 ± 0.7 0.0 ± 0.0 3.2 ± 2.5 0.0 ± 0.0

48.7 ± 113.7 ± 38.2 ± 33.2 ± 70 ± Wild Oat 0.0 ± 0.0 2.8 ± 1.8 6.5 ± 3.4 0.0 ± 0.0 41.5 47.2 14.8 13.2 19.9

a Mint pathotype of V. dahliae b Potato pathotype of V. dahliae c Non-inoculated control

Bold* Indicates V. dahliae pathotype or isolate with greatest microsclerotia counts. Pairwise comparisons were considered

significant at corrected P < 0.0149.

Table 3. Mean and standard error for the number of microsclerotia from eight isolates obtained from 12 weedy hosts and one crop in the greenhouse when inoculated with Verticillium dahliae in the second trial.

Isolate

Control Host 111 a 155 a 381 461 625 653 b SF VMD-4 c

0.0 ± 8.8 ± Annual bluegrass 0.2 ± 0.2 0.7 ± 0.4 0.0 ± 0.0 0.0 ± 0.0 0.5 ± 0.2 29.5 ± 9.9 0.0 ± 0.0

0.0 5.0

Annual 0.8 ± 1.0 ± 5 0.2 ± 0.2 12.0 ± 6.8 0.0 ± 0.0 4.2 ± 1.0 2.2 ± 0.6 3.5 ± 1.6 0.0 ± 0.0 9 sowthistle 0.4 0.4

0.0 ± 0.0 ± Barnyard grass 1.3 ± 0.2 0.7 ± 0.2 1.7 ± 0.3 0.0 ± 0.0 17.2 ± 13.3 3.2 ± 0.8 0.0 ± 0.0 0.0 0.0

2.0 ± 25.0 ± 5.7 ± Black nightshade 3.2 ± 1.4 0.5 ± 0.2 3.0 ± 2.0 0.3 ± 0.2 3.3 ± 1.2 0.0 ± 0.0 0.3 13.6* 0.7

Common 10.7 ± 7.8 ± 25.8 ± 2.8 ± 1.8 ± 0.9 9 ± 1.9 0.7 ± 0.3 18.0 ± 8.7 0.0 ± 0.0 lambsquarters 3.1 5.1 15.4 0.8

0.0 ± 22.5 ± 0.8 ± Downy brome 5.0 ± 2.0 1.3 ± 0.7 0.0 ± 0.0 2.8 ± 1.3 74.0 ± 33.4 0.0 ± 0.0 0.0 11.8 0.5

8.0 ± 2.2 ± Eggplant 0.0 ± 0.0 2.8 ± 0.8 6.2 ± 2.5 4.3 ± 1.5 15.0 ± 1.2* 29.5 ± 16.8 0.0 ± 0.0 0.9 1.1

5.2 ± 2.7 ±

Green foxtail 0.2 ± 0.2 0.0 ± 0.0 0.0 ± 0.0 0.2 ± 0.2 0.0 ± 0.0 26.8 ± 17.2 0.0 ± 0.0 6 5.2 0.3 9

0.7 ± 0.3 ± Large crabgrass 0.0 ± 0.0 0.8 ± 0.8 6.3 ± 2.2* 0.0 ± 0.0 1.0 ± 0.5 25.7 ± 20.2 0.0 ± 0.0 0.4 0.2

3.5 ± 5.2 ± Litchi tomato 2.7 ± 0.7 3.0 ± 0.8 0.0 ± 0.0 8.2 ± 2.8 10.7 ± 2.6 5.8 ± 2.9 0.0 ± 0.0 2.4 3.1

0.0 ± 0.7 ± Pigweed powell 2.0 ± 0.6 2.2 ± 1.0 2.0 ± 1.5 0.3 ± 0.3 0.0 ± 0.0 1.5 ± 0.3 0.0 ± 0.0 0.0 0.4

0.0 ± 0.0 ± Rattail fescue 0.2 ± 0.2 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.2 ± 0.2 0.0 ± 0.0 0.0 0.0

1.0 ± 68.2 ± 101.5 ± 0.5 ± Wild oat 5.2 ± 1.7 6.3 ± 2.2 58.5 ± 3.2 2.7 ± 1.4 0.0 ± 0.0 0.6 46.7 22.5* 0.3

a Mint pathotype of V. dahliae b Potato pathotype of V. dahliae c Non-inoculated control

Bold* Indicates V. dahliae pathotype or isolate with greatest microsclerotia counts. Pairwise comparisons were considered

7 9 significant at corrected P < 0.0158.

Table 4. Mean and standard error for the number of microsclerotia from eight isolates obtained from seven weedy hosts and two crop in the greenhouse when inoculated with Verticillium dahliae in the third trial.

Isolate

Host 111 a 155 a 381 461 625 653 b SF VMD-4 Control c

Black 10.3 ± 1.1 7.2 ± 0.2 7.1 ± 0.6 9.8 ± 1.8 5.1 ± 0.7 14.0 ± 0.7* 7.0 ± 0.5 3.3 ± 0.3 0.0 ± 0.0 nightshade

Bittersweet 2.1 ± 0.3 5.3 ± 0.6 1.3 ± 0.2 3.6 ± 0.5 6.0 ± 0.8 1.7 ± 0.2 3.6 ± 0.6 2.6 ± 0.3 0.0 ± 0.0 nightshade

Eastern black 28.4 ± 75.7 ± 40.7 ±

74.0 ± 10.2 63.6 ± 6.5 5.1 ± 0.6 53.8 ± 1.8 8.3 ± 1.6 0.0 ± 0.0 8 nightshade 5.4 8.2 8.8 9

11.0 ± Eggplant 1.4 ± 0.2 2.9 ± 0.4 5.2 ± 1.0 37.5 ± 1.7 * 17.2 ± 2.3 10.1 ± 0.5 2.1 ± 0.5 0.0 ± 0.0 1.7

Hairy 15.1 ± 27.9 ± 169.0 ± 38.5 ± 183.6 ± 24.5 210.3 ± 14.8 102.9 ± 10.1 0.0 ± 0.0 0.0 ± 0.0 nightshade 1.1 7.6 10.6 2.6

65.1 ± 49.4 ± 11.7 ± Henbit 66.5 ± 10.5 7.4 ± 0.8 101.4 ± 4.2 * 3.4 ± 1.7 3.4 ± 0.8 0.0 ± 0.0 8.7 5.8 1.7

Litchi tomato 2.0 ± 0.2 1.3 ± 0.1 2.9 ± 0.4 6.3 ± 0.4 4.1 ± 0.4 9.5 ± 1.3 2.0 ± 0.2 1.9 ± 4.2 0.0 ± 0.0

17.4 ± 212.8 ± 26.9 51.4 ± Potato 8.5 ± 1.5 2.3 ± 0.7 8.2 ± 1.5 42.5 ± 5.9 7.5 ± 0.7 0.0 ± 0.0 3.2 * 6.2

185.5 ± 19.7 10.7 ± Wild oat 1.7 ± 0.9 2.0 ± 0.4 0.8 ± 0.4 2.4 ± 0.3 2.7 ± 0.3 2.1 ± 0.4 0.0 ± 0.0 * 2.7

a Mint pathotype of V. dahliae b Potato pathotype of V. dahliae c Non-inoculated control

Bold* Indicates V. dahliae pathotype or isolate with greatest microsclerotia counts. Pairwise comparisons were considered

significant at corrected P < 0.0264.

9 9

Table 5. Mean and standard error for the number of microsclerotia from eight isolates obtained from 12 weedy hosts and one crop in the greenhouse when inoculated with Verticillium dahliae in the fourth trial.

Isolate

Host 111 a 155 a 381 461 625 653 b SF VMD-4 Control c

Black 52.0 ± 1.2 5.7 ± 1.7 2.3 ± 0.8 7.3 ± 2.0 17.3 ± 0.5 9.7 ± 2.9 8.3 ± 0.2 3.7 ± 1.6 0.0 ± 0.0 nightshade *

Bittersweet 3.7 ± 1.3 1.0 ± 0.3 6.7 ± 0.4 0.0 ± 0.0 4.0 ± 2.0 10.0 ± 3.0 10.3 ± 0.5 12.7 ± 5.2 0.0 ± 0.0 nightshade

Eastern black

51.0 ± 25.5 10.3 ± 5.0 0.0 ± 0.0 43.3 ± 3.6 10.0 ± 4.9 24.7 ± 2.5 0.0 ± 0.0 13.0 ± 5.2 0.0 ± 0.0 100 nightshade

31.7 ± Eggplant 5.3 ± 2.0 18.0 ± 5.8 14.6 ± 4.7 39.0 ± 6.5 17.3 ± 6.5 32.0 ± 6.8 1.0 ± 0.5 0.0 ± 0.0 10.5

Hairy 294.3 ± 149.3 ± 55.7 ± 36.0 ± 153.3 ± 55.6 20.3 ± 1.0 44.0 ± 13.4 37.3 ± 5.6 0.0 ± 0.0 nightshade 35.7 25.4 11.8 13.0

67.0 ± Henbit 14.0 ± 6.9 4.3 ± 1.3 75.7 ± 33.4 0.0 ± 0.0 5.3 ± 2.1 2.7 ± 1.5 7.0 ± 0.6 0.0 ± 0.0 30.1

Litchi tomato 1.3 ± 0.4 2.7 ± 0.5 2.3 ± 0.5 7.3 ± 2.5 5.0 ± 1.7 15.0 ± 1.5 2.3 ± 0.2 3.0 ± 0.3 0.0 ± 0.0

160.1 ± Potato 42.7 ± 6.2 14.0 ± 0.3 21.7 ± 5.6 50.3 ± 9.9 70.7 ± 5.3 34.3 ± 1.1 35.7 ± 9.6 0.0 ± 0.0 15.8 *

a Mint pathotype of V. dahliae b Potato pathotype of V. dahliae c Non-inoculated control

Bold* Indicates V. dahliae pathotype or isolate with greatest microsclerotia counts. Pairwise comparisons were considered significant at corrected P < 0.0193.

101

Fig. 1

Fig. 1. Summary of the number of trials where a V. dahliae pathotype or isolate was more aggressive than the other isolates. Aggressiveness (Differential effect of pathotype) was determined by a greater number of microsclerotia produced by one isolate than the other isolates for a specific weedy host. The host of origin or the pathotype of the V. dahliae isolate is written within or above each bar, and the weedy host evaluated is along the horizontal axis.

102

CHAPTER FOUR

The Effect of Alfalfa Residue Incorporation on Soil Bacterial Communities and the

Quantity of Verticillium dahliae Microsclerotia in Potato Fields in the Columbia Basin of

Washington State, USA.

ABSTRACT

Verticillium wilt, caused by the soil-borne fungus Verticillium dahliae, is one of the most important diseases of potato in North America. Soil incorporation of alfalfa residues prior to planting potato could be a nonchemical Verticillium wilt management tactic by reducing the number of viable microsclerotia in field soil. Verticillium dahliae microsclerotia were quantified in field soils where organic material from alfalfa was incorporated, and numbers of microsclerotia were compared to fields where alfalfa residue was not incorporated. In addition, bacterial metagenomics was utilized to characterize soils where organic material from alfalfa was or was not incorporated to determine if alfalfa residue incorporation facilitates the formation of soils that suppress or kill V. dahliae microsclerotia. The number of V. dahliae microsclerotia in soil was greater (P = 0.0003) in fields where crop residue was incorporated than fields without incorporation when chloropicrin was used as a fumigant. Conversely, the number of V. dahliae microsclerotia observed in potato plants did not differ (P = 0.4020) between fields where residues were or were not incorporated if chloropicrin was used. Alfalfa residue incorporation did not significantly alter the soil bacterial metagenome compared to fields not subject to residue incorporation in both years of study. Despite these conclusions, the method can be employed to analyze the effect of grower practices with the intent of linking a field practice to increasing soil bacterial diversity and decreasing Verticillium wilt severity on potato.

103

INTRODUCTION

Verticillium wilt of potato limits potato production worldwide. The causal agent,

Verticillium dahliae Kleb, has an extensive host range and worldwide distribution in temperate climates (Schnathorst 1981; Rowe et al. 1985). Development of Verticillium wilt outbreaks depends on the presence of microsclerotia in potato fields prior to planting (Schnathorst 1981).

Microsclerotia function as the primary source of inoculum and the long-term survival mechanism for V. dahliae (Schnathorst 1981). Viable microsclerotia can persist in soil for 14 years (Wilhelm

1955) and may be found embedded in infected host tissue, on dying or decomposing infected host tissue, or freely distributed in soil (Mace et al. 1981). Microsclerotia densities in soil are generally greatest in the top 10 to 30 cm of soil (Jordon 1971; Taylor et al. 2005), and distributed near the place where an infected plant decomposed (Mace et al. 1981). Reducing the number of

V. dahliae microsclerotia or limiting their ability to germinate is an important consideration prior to planting potato fields (Powelson and Rowe 1993; Schnathorst 1981).

(Harrison 1976; Larkin and Halloran 2014). Larkin and Halloran (2014) noted that crop residue incorporation has not been investigated as an effective disease management tactic in many cropping systems. This statement implies that crop residue incorporation in specific regions, such as alfalfa residue incorporation and its effect on Verticillium wilt of potato in the Columbia

Basin of Washington State has yet to be fully explored.

104

One method in which organic matter from a previous crop can be incorporated into soil is through tillage. Tillage techniques can alter the distribution of V. dahliae microsclerotia in soil profiles (Taylor et al. 2005), potentially reducing the microsclerotia density. Tillage practices could move V. dahliae microsclerotia to deeper soil horizons than the 30cm that has been previously reported by Jordon (1971) and Taylor et al. (2005). Chellimi et al. (2016) also stated that dispersal of V. dahliae microsclerotia within a field is facilitated by tillage practices because of the burial of infected crop residues. Apporpriate tillage could be an effective method of reducing the number of viable V. dahliae microsclerotia in soil, especially in combination with fumigation (Taylor et al. 2005). Tillage is sometimes a label requirement for using a fumigant.

For example, the specimen label for chloropicrin 100 (Cardinal Professional Products, Hollister,

CA) states that tillage must be done as soon as possible prior to the application date and the product must be tilled to a depth of 13 to 20 cm for compliance with the mandatory good agricultural practices established in 2010

(http://www.cdpr.ca.gov/docs/emon/fumigants/labels/chloro_100_8536-2-za.pdf).

Soil disinfestation with chemical fumigants is pursued when V. dahliae is present in sufficient numbers to cause quantifiable yield losses to the detriment of potato growers.

Verticillium wilt outbreaks typically arise when a minimum of 5 to 30 V. dahliae microsclerotia per gram of soil are present in a field where a susceptible potato crop is planted (Powelson and

Rowe 1993). Soil fumigation with methyl bromide and chloropicrin was developed in the 1950s to control Verticillium wilt of strawberry (Wilhelm et al. 1961) and was the standard practice in many production systems (besides strawberries) until methyl bromide was slowly phased out of

105

agriculture after 1995, except for emergency exceptions (Zasada et al. 2010; USEPA 2009). The present soil fumigation practices for potato in Washington State’s Columbia Basin include chloropicrin coupled with or without 1,3-dichloropropene. Soil fumigants such as chloropicrin are often mixed with a nematicide like 1,3-dichloropropene to ensure reduction in the number of pathogenic nematodes in soil (Chellimi et al. 2016; Mace et al. 1981; Wilhelm et al. 1956).

One of the underlying concepts supporting the practice of crop residue incorporation is reducing or suppressing soilborne pathogen inocula through beneficial shifts in soil microbial community composition (Chellimi et al. 2016). Authorities argue that up to 99.8% of the microbes present in many environments are not readily culturable on most forms of agar medium, making it difficult to identify all bacteria taxa from soil samples (Paul and Clark 1989;

Streit and Schmitz 2004). There is an opposing argument that these unculturable bacteria are actually bacteria that have yet to be cultured (Handelsman 2004; Kowalchuk et al. 2007). The problem of comparing bacterial taxa identified from soil samples, regardless of ability to be cultured, is compounded by the fact that one gram of cultivated soil is estimated to contain a minimum of 2,000,000,000 bacterial cells (Paul and Clark 1989) and that these bacteria make up the largest component of the biomass in a given soil sample (Hassink et al. 1993). Streit and

Schmitz (2004) state that “metagenome technology” [metagenomics] surmounts this problem through a culture-independent approach that employs software to identify and enumerate bacterial taxa using well-defined 16S DNA sequences. Reisenfield et al. (2004) defines metagenomics as “the functional and sequence-based analysis of the collective microbial genomes contained in an environmental sample”, which differs from a microbiome because a

106

microbiome also includes the metabolic products produced by these organisms in the particular environmental sample (Whiteside et al. 2015).

The premise of using these metagenomic tools is to obtain sequence information that will identify which organisms comprise the sampled material (Daniel 2005), or soil in this case. PCR amplifications are completed using conserved primers which can amplify conserved regions of prokaryotic (bacterial) or eukaryotic (fungi, nematodes etc.) organisms. In general, the analysis of pooled data consisting of PCR amplicons that are identified as a particular family, genus, or species enables the determination of which organisms are present in the soil at various time points and in relation to various treatments (Tringe et al. 2005). Metagenomic tools also can be used to highlight the diversity of organisms, such as bacteria, soil samples in order to to identify which taxa are “globally [across all environments] as well as locally diverse [within the same environment]” (Fierer et al. 2007). Soil microbial communities catalyze chemical processes in soil and are the primary drivers of many disease-suppressive properties of soil (Garbeva et al.

2004). Being able to highlight the bacterial taxa which are the primary constituents of the biotic part of soil samples (Hassink et al. 1993) offers a valuable tool for characterizing Verticillium- suppressive soils. The ability to identify bacterial communities present in Verticillium- suppressive soils can then be used to evaluate if a practice by a grower facilities the formation of the bacterial community complexes that compose Verticillium-suppressive soils.

The goal of this research was to determine if alfalfa residue incorporation facilitates the formation of soils that suppress or kill V. dahliae microsclerotia during crop rotations with potato. Verticillium dahliae microsclerotia were quantified in field soils where organic material

107

from alfalfa was incorporated, and numbers of microsclerotia were compared to fields where alfalfa residue was not incorporated. In addition, bacterial metagenomics were characterized for soils where organic material from alfalfa was or was not incorporated.

MATERIALS AND METHODS:

Site selection and grower preplant site preparation.

Fields were chosen in 2014 and 2015 based on availability and practices of two grower cooperators (A and B) in Grant County, WA. Growers A and B had three to four-year rotations in-between crops of potato. Potato plantings were followed with one year of wheat, then two to three years of alfalfa, then potato was planted again. Field soils with and without alfalfa residue incorporation from grower A also were fumigated with chloropicrin via a shank ripper by 18

March each year. Field soils with and without alfalfa incorporation from grower B were not fumigated in either year, but were treated with 1,3-dichloropropene as an insecticide and nematicide treatment (Table 1).

Green alfalfa stubble with little to no regrowth was incorporated into soil and the stubble will be referred to as residues. Residues were incorporated into field soil at a depth of 30 to 36 cm with an Imants 57 series spading machine (Imants, Reusel, Netherlands) of the year prior to cultivating potato, and incorporation was complete by 15 Oct of 2013 and 2014. The spading machine was used by grower cooperators to prepare ground with stubble to a seedbed in a single pass at speeds of up to 8 kph.

108

Both growers A and B planted potato cultivar Russet Burbank in the fields in 2014 and

2015 and followed standard cultural practices for the region. Russet Burbank is considered susceptible to Verticllium wilt (Novy et al. 2003; Perry and Evert 1983). Fields were irrigated by over-head sprinklers through center pivot systems. Different field sites were studied in 2014 and

2015 because of grower descions on where crops were planted, but the potato rotation following two to three years of alfalfa cropping always was selected. Area of all circles in this study was at least 51 ha. Soils for all fields in this study had a surface layer of fine sandy loam that was approximately 5 to 7 cm in depth. The subsoil is gravelly fine sandy loam that increases in gravel content starting at a depth of approximately 152 cm.

Effect of alfalfa residue incorporation on quantity of V. dahliae microsclerotia in potato field soil.

Field trials were established in 2014 and 2015 with two levels for alfalfa residue status

(incorporated and nonincorporated) and two levels for soil chemical treatment (fumigated with chloropicrin and no fumigation). The experiment consisted of two replicates (potato fields served as replicates) with sampling sites arranged in a completely randomized design in both years. Five fields where alfalfa residues were incorporated had paired 28 m2 plots left by the grower where residues were not incorporated, and the grower did not assume any patterns for selecting the plots. Eight sampling sites were determined for each incorporation treatment for a total of 16 sampling sites per field.

Soil collection for sites subject to residue incorporation in both years were made at least

15 meters inside the field and within a 28 m2 plot. Plots where residues were not incorporated

109

(nonincorporated) were randomly selected. The paired plot where resides were incorporated was created adjacent to the nonincorpated plot with a 4.5 m gap between the plots. Plots where residues were incorporated also were 28 m2 in size. Each collection site was mapped by GPS for repeated sampling using a Garmin Etrex 20 (Garmin International Inc, Olathe, Kansas) with a known deviation of 3.05 meters.

Soil collections were completed four times throughout the production season in each year. Sampling dates were 18 March, 5 June, 22 August and 29 September in 2014. The collection on 18 March was a preplant collection and the 29 September collection date coincided with harvest. Potato plant samples were collected on 5 June and 22 August 2014. Sampling dates were 18 March, 5 June, 20 August and 4 September, 2015. Sampling dates were within two days of each collection month and day in 2014 and 2015 with the exception of harvest, which had to be adjusted so collections could precede the grower’s dates for harvesting their fields. Soil was collected from a depth of 25 to 28 cm using a 2.2 by 53 cm plated soil probe (AMS, American

Falls, ID) in both years of study. The soil probe was wiped clean between samples, fields and collection dates, but not sterilized. Soils and plants were dried for one month at temperatures of

21 to 24ºC without light to allow the formation of microsclerotia. Slow drying, warm temperatures, and no direct sunlight was necessary in order to facilitate the formation of microsclerotia and desiccation of the conidia and hyphae of V. dahliae.

Sections of the crown to 16 cm up the plant stem were collected from the field as stem samples for V. dahliae microsclerotia enumeration. Sections from the crown to approximately 9 cm down the underground stem were collected from the field as “root” samples for the same

110

purpose. Stems and roots were washed, blotted dry, and dried. Dried stems and roots were ground separately with an electric coffee grinder (Secura, Appleton, WA) until the particle size was approximately less than 4 mm2. The removable cup from the grinder, as well as the lid, was surface sterilized with a mixture of 70% ethanol and 30% deionized water between plant samples and plant parts. One gram of ground stem or root was spread evenly on the surface of a petri plate containing NPX without serial dilution. The number of V. dahliae microsclerotia was counted under an Olympus SD-ILK dissecting microscope at 7 to 20X magnification (Olympus

Optical Ltd, Tokyo, Japan) after incubating for 10 days at room temperatures of 21 to 24ºC with no supplemental lighting or direct exposure to sunlight.

Soil collected on 5 June 2015 was dried, sieved through a 3 mm2 mesh for soil organic content testing. Organic content was evaluated using four composite samples/field that were collected in field using a 2.2 by 53 cm plated soil probe. Each field sample consisted of three collections at a depth of 10 cm in a 0.09 m2 area in areas of the field denoted as alfalfa residue incorporated or no incorporation as previously described. A 0.2 g sample from each composite field sample was analyzed for percentage carbon and nitrogen using a Leco TruSpec Micro CHN

(Leco Corporation, St. Joseph, MI) following the manufacturer’s instructions with the assistance of Margaret Davies in the Crop and Soil Science department at Washington State University.

Tubers were hand harvested using garden forks on 8 Sept 2015 to acquire yield data. Two adjacent plants were selected from the same row for each sampling site. The sampling sites were from areas of the field denoted as alfalfa residue incorporated or no incorporation as previously

111

described. The yield data consisted of total weight per sampling site of harvested tubers and the number of tubers from the two adjoining potato plants.

Effect of alfalfa residue incorporation on quantity of V. dahliae microsclerotia in potato field soil.

Differences in the number of observed V. dahliae microsclerotia for each V. dahliae isolate from an inoculated plant host was determined using an analysis of variance with distance matrices from both within and among assigned groups called PERMANOVA (Plymouth Routine

In Multivariate Ecological Research, PRIMER-E Ltd., v7 Lutton, Ivybridge, UK).

PERMANOVA was selected for these data because the use of nonparametric permutation techniques does not require parametric assumptions since no distribution is assumed (Anderson

2001). This feature is important because the distribution and number of microsclerotia was not even within a field, nor was the variance in number of microsclerotia equivalent across fields.

PERMANOVA can also accommodate more factors than some forms of nonparametric analyses

(Anderson 2001). This feature is important because the number of factors for PERMANOVA testing needed to be reduced. Averages were used for stem and root data from the same plant, the number of microsclerotia from the same site across all four collection dates, and the fields from the same grower across year. This removed plant part, collection date, and year as factors for

PERMANOVA analysis. The factors that were included in the PERMANOVA analysis were residue incorporation status and fumigant employed.

PERMANOVA conditions are important to note for the purposes of repeatability.

PERMANOVA was conducted based upon a log(X+1) transformation on microsclerotia counts,

112

followed by the creation of a Bray-Curtis dissimilarity matrix, with 9999 permutations under a reduced model. The mean number of microsclerotia recovered from the same plant (stems and roots) was determined from the average number of microsclerotia between stems and roots in order to remove plant part as a factor from analysis and reduce the number of factors for

PERMANOVA testing.

The percentage nitrogen and carbon, number of tubers, and weight of tubers were analyzed from areas with and without residue incorporation using the PROC GLM function of

SAS University Edition (SAS, Cary, NC) after verifying that assumptions of homoscedasticity and normal distribution of residuals were met using the same program.

Effect of alfalfa residue incorporation on soil bacterial metagenomics in potato field soil.

Soil samples were collected on 18 March 2014 and 2015 for metagenomics analyses.

Thirty soil samples were collected in 2014 and 2015, with 15 from fields subject to alfalfa residue incorporation and 15 from soils where residues were not incorporated. Soil samples were collected at the same location and from the same depth as soil samples for V. dahliae enumeration (25 to 28 cm), and using the same soil probe technique as previously described.

However, soil samples for this study were stored immediately in falcon tubes (Thermo Fisher

Scientific, Waltham, MA) with loosened caps on ice and out of direct sunlight.

Extraction of DNA in 2014 and 2015 was performed using Mo Bio Powersoil DNA extraction kit (Mo Bio Laboratories, Carlsbad, CA) following the manufacturer’s directions. All

113

DNA samples had a nucleic acid concentration of 5 to 35 ng/ul following extraction as determined by a Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA).

Amplification of an approximately 250 bp segment of 16S V1/V3 region of the ribosomal

RNA gene for the first year (2014) was conducted using PCR with primers 1492R(l) and 27F

(Table 2) following a protocol similar to Lane (1991) and Wang et al. (2002). The PCR protocol began with an initial denaturation step of 95⁰C for 5 minutes, followed by 30 cycles of denaturation at 95⁰C for 30 seconds, an annealing step of 50⁰C for 30 seconds, and an extension step of 72⁰C for 2 minutes. The protocol concluded with a final elongation step of 72⁰C for 5 minutes. Gel electrophoresis was conducted with a 1% agarose gel at 108 volts for 45 minutes.

Amplicons were sequenced using Illumina MiSeq by Dr. Noah Rosenzweig at the Department of

Plant, Soil, and Microbial Sciences at Michigan State University.

Amplification of an approximately 250 bp segment of 16S ribosomal RNA gene in the second year (2015) used a dual barcoded two-step PCR procedure for amplicon sequencing for

Illumina MiSeq. The PCR protocol was provided by the Illumina sequencing core (IBEST core,

University of Idaho, Moscow, ID) and consisted of two steps. The first step (or first PCR) amplified the target region and the second PCR ligated Illumina barcodes to the amplicon from the first reaction. The first PCR was conducted with five primers (Table 2) and began with an initial denaturation step of 95⁰C for 3 minutes, followed by 35 cycles of denaturation at 95⁰C for

1 minute, an annealing step of 51⁰C for 1 minute, and an extension step of 68⁰C for 1 minute.

The protocol concluded with a final elongation step of 68⁰C for 5 minutes. Gel electrophoresis was conducted with a 1% agarose gel at 108 volts for 45 minutes. Because of low DNA

114

concentration, the PCR products were not diluted before being subjected to a second PCR reaction. The second PCR involved primers with barcodes designed specifically for this experiment (IBEST core, University of Idaho, Moscow, ID). The second PCR protocol began with an initial denaturation step of 95⁰C for 1 minute, followed by 10 cycles of denaturation at

95⁰C for 1 minute, an annealing step of 60⁰C for 1 minute, and an extension step of 68⁰C for 1 minute. The protocol concluded with a final elongation step of 68⁰C for 5 minutes. Gel electrophoresis was conducted with a 1% agarose gel at 108 volts for 45 minutes. Illumina

MiSeq was completed upon confirmation of the synthesis of a successful amplicon in the second

PCR by the Institute for Bioinformatics and Evolutionary Studies (IBEST) core at the University of Idaho.

Metagenomic analyses.

Microbial community data based on 16S rRNA sequence from the 2014 Illumina MiSeq were analyzed using MOTHUR (Schloss et al. 2009, v1.33, https://www.mothur.org/) following the protocol from Kozich et al. (2013, https://www.mothur.org/wiki/MiSeq_SOP). In short, sequences were screened for errors and duplicates, aligned to reference alignment, and trimmed to a desired length. Chimeric constructs were removed with UChime (Edgar et al. 2011, http://drive5.com/usearch/manual/uchime_algo.html). OTU-based analyses were conducted in

MOTHUR using the cluster.split command for sorting taxonomic information, followed by measures for alpha and beta diversity. Analysis of molecular variance (AMOVA) was also employed to confirm genetic diversity within soil samples following the protocol from Kozich et al. (2013).

115

Microbial community data based on 16S rRNA sequence from the 2015 Illumina MiSeq were analyzed using PRIMER-E (PRIMER Ltd., v7 Lutton, Ivybridge, UK) in 2015. The

ANOSIM and SIMPER routines were employed to compare bacterial taxa composition and highlight differences in bacterial taxa between soils subject to different forms of residue incorporation. Analysis of similarity (ANOSIM) is similar to ANOVA although ANOSIM evaluates a dissimilarity matrix (Clarke, 1993). Dissimilarity between soil samples where residues were or were not incorporated were analyzed by the contributions from each bacterial genera using the similarity percentages from the SIMPER routine (Clarke and Gorley 2006). The

DIVERSE routine was used to calculate Shannon and Inverse Simpson biodiversity indices. All routines were employed following the instructions from the manual written by Clarke and Gorley

(2006).

RESULTS:

Effect of alfalfa residue incorporation on quantity of V. dahliae microsclerotia in potato field soil.

There was a significant interaction (P < 0.0001, Table 3) between the pre-season soil chemical treatment (chloropicrin fumigation or no fumigant) and residue incorporation on the number of V. dahliae microsclerotia in soil or within potato plants. The number of V. dahliae microsclerotia in soil was greater (P = 0.0003) in fields where crop residue was incorporated than fields without incorporation when chloropicrin was used as a fumigant. Conversely, the number of V. dahliae microsclerotia observed in potato plants did not differ (P = 0.4020) between fields where residues were or were not incorporated if chloropicrin was used (Table 3).

The number of V. dahliae microsclerotia from soil (P = 0.4421) and potato plants (P = 0.4214)

116

did not differ between fields that were or were not subjected to residue incorporation, but only when no fumigant was used (Table 3).

The number of V. dahliae microsclerotia from soil (P = 0.0018) and potato plants (P =

0.0044) was greater in fields subjected to chloropicrin fumigation than fields that were not, but only when considering the fields subjected to residue incorporation (Table 4). The number of V. dahliae microsclerotia from soil (P = 0.3878) and plants (P = 0.2472) was not greater in fields with no fumigation compared to fields that were fumigated with chloropicrin but only when considering fields where residues were not incorporated (Table 4).

The percentage nitrogen in soil did not differ (P = 0.45) and percentage carbon did not differ (P = 0.196) between fields where alfalfa residues were or were not incorporated (Table 5).

Significant differences were not observed for either the number (P = 0.1223) and weight of harvested tubers (P = 0.2874) between fields where alfalfa residues were or were not incorporated (Table 5).

Effect of alfalfa residue incorporation on bacterial metagenomics in potato field soil.

Bacterial composition of the soil samples from 2014 at the genus level did not differ

(Pars score P = 0.3030) between soils where alfalfa residues were or were not incorporated as determined by the parsimony method (P-test) using the beta analysis protocol from Kozich et al.

(2013). Kozich et al. (2013) states “The parsimony method is a generic test that describes whether two or more communities have the same structure”. The AMOVA between bacterial

117

genera diversity from soils samples with and without residue incorporation was not significant (P

= 0.2997).

Bacterial diversity was calculated based on the total number of sequence reads from the

V1/V3 region of the 16S rRNA gene sequencing for 2014 samples. The number of 16S sequencing reads for bacterial genera from sites not subject to residue incorporation ranged from

5,535 to 58,626 reads with and Inverse Simpson indices ranging from 146.5 to 326.6. The number of 16S sequencing reads from bacterial genera from sites subjected to residue incorporation ranged from 11,011 to 38,460 reads with and Inverse Simpson indices ranging from 180.2 to 417.3 (Table 6). The Inverse Simpson indices were slightly lower for bacterial genera from soils where residues were incorporated compared to soils where residues were not incorporated (Table 6). However, the numerical difference in diversity indices was not significant given the P-test and AMOVA analyses.

Bacterial composition of the 2015 soil samples at the genus level was not different between soils where alfalfa residues were or were not incorporated as determined by the

ANOSIM routine with 322 significant permutations out of 9999, which failed to exceed a sample statistic significance level of 0.08%. The R value for the ANOSIM between sites subject to residue incorporation and those that were not was 0.31. Clarke and Gorley (2006) state an R value close to 1.0 indicates dissimilarity between the groups being tested, while an R value closer to 0 indicates similarity between the groups being tested. An R value of 0.31 provides further evidence that bacterial genera did not differ regardless of residue incorporation or not.

Bacterial genera that contributed to the upper 33% dissimilarity between soils that were subject

118

to residue incorporation compared to soils with no incorporation were identified using the

SIMPER routine (Table 7). There were 67 bacterial genera that contributed to the upper 33% dissimilarity, indicating that many genera differed between samples, but at minute percentages.

The top five bacterial genera that differed between soils where alfalfa residues were or were not incorporated were identified as genus Bacteria (0.83%), Gp4 (0.76%), Rhizobiales (0.73%),

Gemmatimonas (0.67%), and Bacillus (0.65%). Gp refers to subdivisions of the bacterial phylum

Acidobacteria (Kielak et al. 2016). These top five bacterial genera comprised 3.63% of the upper

33% dissimilarity in the identified bacterial genera (Table 7).

Bacterial abundance and diversity were calculated based on the number of bacterial genera identified using the V1/V3 region of the 16S rRNA gene sequencing in 2015. The number of bacterial genera identified from sites not subject to residue incorporation ranged from 273 to

1425 genera with Shannon diversity indices ranging from 5.275 to 6.193 and an Inverse Simpson indices ranging from 0.9971 to 0.9983 (Table 8). The number of bacterial genera identified from sites subjected to residue incorporation ranged from 623 to 1754 genera with Shannon diversity indices ranging from 5.668 to 6.256 and an Inverse Simpson indices ranging from 0.9973 to

0.9983. The number of genera and Shannon’s diversity indices were slightly higher for bacterial genera from soils where residues were incorporated compared to soils where residues were not incorporated (Table 8). However, the numerical difference in diversity indices was not significant given the ANOSIM and SIMPER results.

119

DISCUSSION

Development of Verticillium wilt suppressive soils requires identification and promotion of the mechanisms responsible for eliminating or suppressing microsclerotia inoculum in potato cropping systems. One possible mechanism was analyzed in detail here, and that is the incorporation of alfalfa residues to depths of 30 to 36 cm. Despite differences in the number of

V. dahliae microsclerotia by alfalfa residue incorporation or fumigant use, the number of V. dahliae microsclerotia present in the fields did not cause complete loss to the potato crop or unprofitability to the grower.

The premise of this research was that crop residue incorporation may decrease V. dahliae initial inoculum (microsclerotia) at the beginning of the growing season prior to planting potatoes. In practice, V. dahliae microsclerotia numbers from soil where alfalfa was incorporated were unexpectedly greater than from soil where residue was not incorporated. Residue incorporation for a single season was not sufficient in suppressing V. dahliae populations within a single year. However, a reduction in the number of V. dahliae microsclerotia may occur several years after incorporation, a timeframe which was outside the scope of this study.

Incorporating crop residue has the advantage of returning organic matter into soil for decomposition. Incorporating high levels of organic matter over many seasons may increase soil health and have other positive effects, despite the observation that percentage carbon and nitrogen did not differ between fields where alfalfa resiues were or were not incorporated in this study.

120

Incorporating alfalfa residues did not significantly alter the soil bacterial metagenome compared to fields not subject to residue incorporation in 2014, and any differences in the inverse Simpsons diversity index were likely due to the small differences between given fields as indicated by the nonsignificant AMOVA test. Similarly, incorporating alfalfa residues did not significantly alter the soil metagenome compared to fields not subject to residue incorporation in

2015 due to the nonsignificant ANOSIM test. The SIMPER routine revealed slight differences in the genera composing the soil bacterial metagenome, but the percentage difference of any one bacterial genus between soil samples amounted to less than 1%. This small difference in percentage composition of soil by bacterial genera could be explained by variability in bacteria populations across different soil samples, even from the same field. Both extreme and minor differences in metagenomic results have been attributed to artifacts of spatial heterogeneity in sampling, or due to the varying gases, liquids, and solids that comprise a soil sample and have effects on populations of bacteria (Daniel 2005).

Chloropicrin has been shown to be a soil fumigant that is effective at reducing the number of viable V. dahliae microsclerotia in soil (Hamm et al. 2003). The observation of increased numbers of V. dahliae microsclerotia in chloropicrin-fumigated fields compared to fields with no fumigation was unexpected and only observed when alfalfa residues were incorporated. This observation does not draw the efficacy of chloropicrin into question because the effect was not repeated when alfalfa residues weren’t incorporated. The inconsistency suggests that other explanations exist for the observation, such as a strong interaction between residue incorporation and fumigant use exists. There may be more fine-tuning neccesary to mix these practices for the greatest benefit to the grower.

121

The effect of alfalfa residue incorporation on the number V. dahliae microsclerotia in the field appeared to be smaller than the effect of fumigation on the number of V. dahliae microsclerotia in both years of study. Similarly, alfalfa residue incorporation did not significantly alter the soil bacterial metagenome compared to fields not subject to residue incorporation in both years of study. Despite these results, the method can be employed to analyze the effect of grower practices with the intent of linking a practice to increasing soil bacterial diversity and decreasing Verticillium wilt severity on potato.

ACKNOWLEDGMENTS

This work was supported by funds from the Northwest Potato Consortium. I would like to thank Aaron Mahoney for assistance in formatting Illumina MiSeq files for input into

MOTHUR for metagenomic analyses. I appreciate David Wheeler, Dr. Dennis Johnosn, Tom

Cummings, Dr. Debra Inglis, Dr. Mark Pavek, and Dr. Weidong Chen’s efforts with editorial suggestions before submission.

122

Literature Cited:

1. Anderson, M. J. 2001. A new method for non-parametric multivariate analysis of

variance. Austral Ecol. 26: 32-46.

2. Butterfield, E.J., and DeVay, J.E. 1977. Reassessment of soft assays for Verticillium

dahliae. Phytopathology 67: 1073-1078

3. Cappaert, M.R. Powelson, M.L. Christensen, N.W., and Crowe, G.J. 1992. Influence of

irrigation on severity of potato early dying and associated yield loss. Phytopathology 86:

1448-1453.

4. Chellemi, D. O., Gamliel, A., Katan, J., and Subbarao, K. V. 2016. Development and

deployment of systems-based approaches for the management of soilborne plant

pathogens. Phytopathology 106: 216-225.

5. Clarke, K. R., and Gorley, R. N. 2006. PRIMER v6: User Manual PRIMER-E. Plymouth,

UK.

6. Clarke, K.R. 1993. Non-parametric multivariate analyses of changes in community

structure. Aust J Ecol 18: 117-43.

7. Daniel, R. 2005. The metagenomics of soil. Nature Reviews Microbiology 3: 470-478.

8. Dung, J. K., Peever, T. L., and Johnson, D. A. 2013. Verticillium dahliae populations

from mint and potato are genetically divergent with predominant haplotypes.

Phytopathology 103: 445-459.

9. Edgar, R. C., Haas, B. J., Clemente, J. C., Quince, C., and Knight, R. 2011. UCHIME

improves sensitivity and speed of chimera detection. Bioinformatics 27: 2194-2200.

123

10. Fierer, N., Breitbart, M., Nulton, J., Salamon, P., Lozupone, C., Jones, R., and Knight, R.

2007. Metagenomic and small-subunit rRNA analyses reveal the genetic diversity of

bacteria, archaea, fungi, and viruses in soil. Appl. Environ. Microbiol. 73: 7059-7066.

11. Garbeva, P., Van Veen, J. A., and Van Elsas, J. D. 2004. Microbial diversity in soil:

selection of microbial populations by plant and soil type and implications for disease

suppressiveness. Annu. Rev. Phytopathol. 42: 243-270.

12. Hamm, P. B., Ingham, R. E., Jaeger, J. R., Swanson, W. H., and Volker, K. C. 2003. Soil

fumigant effects on three genera of potential soilborne pathogenic fungi and their effect

on potato yield in the Columbia Basin of Oregon. Plant Dis. 87: 1449-1456.

13. Handelsman, J. 2004. Metagenomics: application of genomics to uncultured

microorganisms. Microbiol. Mol. Biol. Rev. 68: 669-685.

14. Harrison, M. D. 1976. The effect of barley straw on the survival of Verticillium albo-

atrum in naturally infested field soil. Am Potato J. 53:385-394.

15. Hassink, J., Bouwman, L. A., Zwart, K. B. and Brussaard, L. 1993. Relationship between

habitable pore space, soil biota, and mineralization rates in grassland soils. Soil. Biol.

Biochem. 25 47–55.

16. Inderbitzin, P., Davis, R. M., Bostock, R. M., and Subbarao, K. V. 2013. Identification

and differentiation of Verticillium species and V. longisporum lineages by simplex and

multiplex PCR assays. PloS one, 8: e65990.

17. Jordon, V.W. 1971. Estimation of the distribution of Verticillium populations in infected

strawberry plants and soil. Plant Pathol. 20: 21-24.

124

18. Kielak, A. M., Barreto, C. C., Kowalchuk, G. A., van Veen, J. A., and Kuramae, E. E.

2016. The ecology of Acidobacteria: moving beyond genes and genomes. Frontiers in

Microbiology 7: 744.

19. Kowalchuk, G. A., Speksnijder, A. G., Zhang, K., Goodman, R. M., and Van Veen, J. A.

2007. Finding the needles in the metagenome haystack. Microbial ecology 53: 475-485.

20. Kozich JJ, Westcott SL, Baxter NT, Highlander SK, Schloss PD. 2013. Development of a

dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence

data on the MiSeq Illumina sequencing platform. Appl. Environ. Microbiol. 79: 5112-20.

< https://www.mothur.org/wiki/MiSeq_SOP>

21. Lane, D. J. 1991. 16S/23S rRNA sequencing, p. 115–175. In E. Stackebrandt and M.

Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley & Sons,

Ltd., Chichester, United Kingdom.

22. Larkin, R.P., and Halloran, J.M. 2014. Management effects of disease-suppressive

rotation crops on potato yield and soilborne diseases. Am J. Potato 91: 429-439.

23. Mace, M; Bell, A; and Beckman, C. 1981. Fungal Wilt Diseases of Plants. New York,

Academic Press, Inc.

24. National Agricultural Statistics Service. Quick Stats (NASS). 2013. United States

Department of Agriculture, Washington D.C.

25. Novy, R. G., Corsini, D. L., Love, S. L., Pavek, J. J., Mosley, A. R., James, S. R., and

Thornton, R. E. 2003. Alturas: a multi-purpose, russet potato cultivar with high yield and

tuber specific gravity. Am. J. of Potato Res. 80: 295-301.

26. Paul, E. A. and Clark, F. E. 1989. Soil microbiology and biochemistry. Academic Press,

San Diego, CA.

125

27. Perry, J. W., and Evert, R. F. 1983. The effect of colonization by Verticillium dahliae on

the root tips of Russet Burbank potatoes. Canadian journal of botany 61: 3422-3429.

28. Powelson, M.L., and Rowe, R.C. 1993. Biology and Management of Early Dying of

Potatoes. Annu. Rev. Phytopathol. 31: 111-126.

29. Riesenfeld, C. S., Schloss, P. D., and Handelsman, J. 2004. Metagenomics: genomic

analysis of microbial communities. Annu. Rev. Genet. 38: 525-552.

30. Rowe, R.C., Riedel, R.M., and Martin, M.J. 1985. Synergistic interactions between

Verticillium dahliae and Pratylenchus penetrans in potato early dying disease.

Phytopathology 75: 412–418.

31. Schnathorst, W. C. 1981. Life cycle and epidemiology of Verticillium. Pages 81-111 in:

Fungal Wilt Diseases of Plants. M. E. Mace, A. A. Bell, and C. H. Beckman, eds.

Academic Press, New York.

32. Schloss, P. D., Westcott, S. L., Ryabin, T., Hall, J. R., Hartmann, M., Hollister, E. B.,

and Sahl, J. W. 2009. Introducing mothur: open-source, platform-independent,

community-supported software for describing and comparing microbial communities.

Appl. Environ. Microbiol. 75: 7537-7541.

33. Streit, W. R., and Schmitz, R. A. 2004. Metagenomics–the key to the uncultured

microbes. Current opinion in microbiology 7: 492-498.

34. Subbarao, K. V., Hubbard, J. C., and Koike, S. T. 1999. Evaluation of broccoli residue

incorporation into field soil for Verticillium wilt control in cauliflower. Plant Dis. 83:

124-129.

126

35. Taylor, R.J., Pasche, J.S., and Gudmestad, N.C. 2005. Influence of tillage and methods of

metam sodium application on distribution and survival of Verticillium dahliae in the soil

and the development of potato early dying disease. Amer J Potato 82: 450-461.

36. Tringe, S. G., Von Mering, C., Kobayashi, A., Salamov, A. A., Chen, K., Chang, H. W.,

and Bork, P. 2005. Comparative metagenomics of microbial communities. Science, 308:

554-557.

37. U.S. Environmental Protection Agency. 2009. Implementation of risk mitigation

measures for soil fumigant pesticides. 18 Jan 2017.

oppsrrd1/reregistration/soil_fumigants/>.

38. Wang, J., C. Jenkins, R. I. Webb, and J. A. Fuerst. 2002. Isolation of Gemmata-like and

Isosphaera-like planctomycete bacteria from soil and freshwater. Appl. Environ.

Microbiol. 68: 417–422.

39. Whiteside, S. A., Razvi, H., Dave, S., Reid, G., and Burton, J. P. 2015. The microbiome

of the urinary tract [mdash] a role beyond infection. Nature Reviews Urology 12: 81-90.

40. Wilhelm, S., Storkan, R., and Sagen, J. 1961. Verticillium wilt of strawberry controlled

by fumigation of soil with chloropicrin and chloropicrin-methyl bromide mixtures.

Phytopathology 51: 744.

41. Wilhelm, S. 1955. Longevity of Verticillium wilt fungus in the laboratory and field.

Phytopathology 45: 180-81.

42. WSDA. 2015. Agriculture – A Cornerstone of Washington’s Economy. AGRI-PUB 103-

127 (R/2/15). Retrieved from

43. Zasada, I. A., Walters, T. W., and Pinkerton, J. N. 2010. Post-plant nematicides for the

control of root lesion nematode in red raspberry. HortTechnology 20: 856-862.

127

Table 1: Fields and treatment structure employed to determine if soil inoculum density of

Verticillium dahliae in field soils where alfalfa residue from previous crops was incorporated into soil were different than field soils where alfalfa residues were not incorporated in 2014 and

2015.

Mean Mean

Field Residue V. dahliae V. dahliae Year Grower Fumigant Nematicide Designation Status microsclerotia microsclerotia

/g in soil 1 /g in plant 1

2014 Unit 3 A Incorp 2 Chloropicrin3 Dichloro 4 8.4 3.3

Not 2014 Unit 3 A Chloropicrin3 Dichloro 4 3.6 1.8 Incorp

Not 2014 Unit 5 A Chloropicrin3 Dichloro 4 4.3 2.1 Incorp

2014 Unit 1 B Incorp None Oxamyl5 3.4 1.2

Not 2014 Unit 1 B None Oxamyl5 2.9 1.7 Incorp

2015 Unit 247 A Incorp Chloropicrin3 Dichloro 4 14 3.1

Not 2015 Unit 247 A Chloropicrin3 Dichloro 4 14.7 8.4 Incorp

Not 2015 Unit 22 A Chloropicrin3 Dichloro 4 1.1 Incorp 5.1

2015 Unit 39 B Incorp None Oxamyl5 15.5 0.9

Not 2015 Unit 39 B None Oxamyl5 25.8 0.5 Incorp

2015 Unit 7 B Incorp None Oxamyl5 12.8 0.3

Not 2015 Unit 7 B None Oxamyl5 24.7 1.3 Incorp

128

1. No statistical analyses were performed on data in these columns.

2. Incorp = incorporated, not incorp = not incorporated

3. The amount of Chloropicrin (60 lbs/A) used by grower A.

4. Dichloro = 1,3-dichloropropene. The amount of 1,3-dichloropropene used by grower A

was 18 gal/A.

5. The amount of Oxamyl used by grower B was 2.1 pts/A.

129

Table 2. Primers employed to amplify an approximately 250 bp amplicon from bacterial 16S rRNA for bacterial taxa classification from soil samples collected in 2014 and 2015.

2014:

1492R(l) GGTTACCTTGTTACGACTT

27F AGAGTTTGATCMTGGCTCAG

2015:

534R_YM1 Reverse ACACTGACGACATGGTTCTACAGTAGAGTTTGATCCTGGCTCAG

534R_YM2 Reverse ACACTGACGACATGGTTCTACACGTAGAGTTTGATCATGGCTCAG

534R_YM3 Reverse ACACTGACGACATGGTTCTACAACGTAGAGTTTGATTCTGGCTCAG

534R_YM4 Reverse ACACTGACGACATGGTTCTACATACGTAGAGTTTGATTATGGCTCAG

27F_1 Forward TACGGTAGCAGAGACTTGGTCTCCATTACCGCGGCTGCTGG

130

Table 3: Pairwise comparisons between fields where alfalfa crop residue was or was not incorporated. Mean Verticillium dahliae microsclerotia/g for both soil and potato plant samples are presented.

Mean Verticillium dahliae microsclerotia/g

Fumigant 1 Residue Status 1, 2 Soil 3 Plant 3

None Not Incorp 14.1 a (P = 0.4421) 1.1 a (P = 0.4214)

None Incorp 8.1 a 1.0 a

Chloropicrin Incorp 13.3 a (P = 0.0003) 6.5 a (P = 0.4020)

Chloropicrin Not Incorp 6.3 a 3.5 a

1. A significant fumigant * residue interaction was observed (P < 0.0001), necessitating

analysis by cell means of differences in V. dahliae microsclerotia/g between residue

incorporation and not incorporation by the same level of fumigant.

2. Incorp = incorporated, not incorp = not incorporated

3. Significance (bold) was determined by pairwise comparisons of cell means (within

box) using PERMANOVA (P < 0.05).

131

Table 4: Pairwise comparisons between chloropicrin-fumigated fields and fields with no fumigation for mean Verticillium dahliae microsclerotia/g for both soil and potato plant samples.

Mean Verticillium dahliae

microsclerotia/g in plant Residue Status 1, 2 Fumigant 1 microsclerotia/g in soil 3 3

Incorp Chloropicrin 13.3 b (P = 0.0018) 6.5 a (P = 0.0044)

Incorp None 8.1 a 1.0 b

Not Incorp Chloropicrin 6.3 a (P = 0.3878) 3.5 a (P = 0.2472)

Not Incorp None 4.4 a 1.1 a

1. A significant fumigant * residue interaction was observed (P < 0.0001),

necessitating analysis by cell means of differences in V. dahliae microsclerotia/g

between fumigants by the same level of residue incorporation.

2. Incorp = incorporated, not incorp = not incorporated

3. Significance (bold) was determined by pairwise comparisons of cell means

(within box) using PERMANOVA (P < 0.05).

132

Table 5: Percentage carbon and nitrogen, as well as potato yield data from fields where alfalfa residue was and was not incorporated in 2015.

Residue Mean % Mean % Total Tuber No. of Tubers 1 Status Carbon 1 Nitrogen 1 Weight (Kg) 1

0.76 a 0.08 a 23.45 a 4.17 a Incorp 2 (P = 0.196) (P = 0.45) (P = 0.1223) (P = 0.2874)

Not Incorp 2 0.91 a 0.10 a 20.25 a 3.42 a

1. Significance (bold) was determined by pairwise comparisons of cell means (within box)

using ANOVA (proc glm, SAS) (P < 0.05).

2. Incorp = incorporated, not incorp = not incorporated

133

Table 6: The number of bacterial genera sequences recovered1 and Inverse Simpson2 measure of diversity from soil samples where alfalfa residue was or was not incorporated. The soil samples were collected in 2014.

Number of Inverse

Sample Name Residue Status Sequences Simpson

FR1 Incorporated 30529 329.689717

FR2 Incorporated 38460 417.30163

FR3 Incorporated 20998 285.173283

FR4 Incorporated 16089 375.439249

FR5 Incorporated 22095 289.61053

FR6 Incorporated 15649 315.748449

FR7 Incorporated 31823 354.989023

FR8 Incorporated 31236 393.887928

FR9 Incorporated 18467 214.441159

FR10 Incorporated 16062 313.0376

FR11 Incorporated 14406 318.471274

FR12 Incorporated 13997 235.941809

FR13 Incorporated 25636 218.747686

FR14 Incorporated 37364 192.702844

FR15 Incorporated 11448 212.742712

FR16 Incorporated 20466 208.464412

FR17 Incorporated 20613 163.111013

FR18 Incorporated 11011 180.213034

134

FR19 Incorporated 11371 250.376218

FR20 NonIncorporated 17756 296.916086

FR21 NonIncorporated 5535 188.068337

FR22 NonIncorporated 29378 146.486647

FR23 NonIncorporated 17730 277.257033

FR24 NonIncorporated 11038 199.544662

FR25 NonIncorporated 29834 250.001748

FR26 NonIncorporated 13420 221.182709

FR27 NonIncorporated 8674 234.272552

FR28 NonIncorporated 35728 228.71991

FR29 NonIncorporated 17245 321.343043

FR30 NonIncorporated 7512 317.512645

FR31 NonIncorporated 54752 249.600856

FR32 NonIncorporated 17727 232.939109

FR33 NonIncorporated 13138 326.569435

FR34 NonIncorporated 58626 13.385941

1 Bacterial genera classified by sequences of the V1/V3 region of the 16S rRNA gene through an

Illumina MiSeq sequencing platform by Dr. Noah Rosenzweig at the Department of Plant, Soil, and Microbial Sciences at Michigan State University.

2 Inverse Simpson measure of diversity in bacterial genera from sites with or without residue incorporation were determined using MOTHUR (Schloss et al. 2009, v1.33, https://www.mothur.org/) following the protocol from Kozich et al. (2013, https://www.mothur.org/wiki/MiSeq_SOP).

135

Table 7: Bacterial genera1 that contributed to the top 33% dissimilarity2 between soil samples where alfalfa residue was or was not incorporated. The soil samples were collected in 2015.

Genus Percent Contribution Cumulative Percent

Bacteria 0.83 0.83

Gp4 0.76 1.59

Rhizobiales 0.73 2.31

Gemmatimonas 0.67 2.98

Bacillus 0.65 3.63

Bacillales 0.63 4.26

Actinomycetales 0.61 4.87

Chitinophagaceae 0.61 5.48

Alphaproteobacteria 0.6 6.08

Proteobacteria 0.59 6.67

Sphingomonadaceae 0.58 7.25

Betaproteobacteria 0.57 7.82

Gp6 0.57 8.39

Gp3 0.56 8.96

Sphingomonas 0.56 9.52

Saccharibacteria_genera_incertae_sedis 0.55 10.07

Gammaproteobacteria 0.55 10.61

Planctomycetaceae 0.54 11.16

Gp16 0.53 11.69

Bacillaceae 2 0.53 12.21

136

Gaiella 0.52 12.73

Gp1 0.52 13.25

Blastocatella 0.51 13.76

WPS-1_genera_incertae_sedis 0.51 14.27

Bacteroidetes 0.5 14.77

Deltaproteobacteria 0.49 15.26

Terrimonas 0.49 15.75

Arthrobacter 0.49 16.23 unknown 0.48 16.71

Subdivision3_genera_incertae_sedis 0.48 17.19

WPS-2_genera_incertae_sedis 0.48 17.67

Pseudomonas 0.47 18.14

Bradyrhizobiaceae 0.47 18.61

Nitrospira 0.47 19.08

Flavitalea 0.46 19.54

Afipia 0.46 20

Sphingosinicella 0.46 20.47

Rhizomicrobium 0.46 20.93

Spartobacteria_genera_incertae_sedis 0.46 21.39

Blastomonas 0.46 21.84

Burkholderiales 0.46 22.3

Ohtaekwangia 0.46 22.76

Streptomyces 0.45 23.21

137

Nitrosospira 0.45 23.66

Hyphomicrobium 0.45 24.12

Pirellula 0.45 24.57

Paenibacillus 0.45 25.01

Micromonosporaceae 0.44 25.46

Longilinea 0.44 25.9

Acidobacteria_Gp1 0.44 26.35

Acidobacteria_Gp4 0.44 26.79

Parcubacteria_genera_incertae_sedis 0.43 27.22

Anaerolineaceae 0.42 27.64

Hyphomicrobiaceae 0.42 28.06

Thermovum 0.42 28.48

Actinobacteria 0.41 28.89

Microbacteriaceae 0.41 29.3

Phenylobacterium 0.41 29.71

Gp7 0.41 30.11

Tumebacillus 0.41 30.52

Xanthomonadaceae 0.41 30.93

Bacillaceae 1 0.41 31.33

Bradyrhizobium 0.41 31.74

Mesorhizobium 0.4 32.14

Rhodoplanes 0.4 32.55

Niastella 0.4 32.95

138

Firmicutes 0.4 33.35

1 Bacterial genera classified by sequences of the V1/V3 region of the 16S rRNA gene through an

Illumina MiSeq sequencing platform by the Institute for Bioinformatics and Evolutionary

Studies (IBEST) core at the University of Idaho.

2 Bacterial genera that contributed to the dissimilarity between soil samples from sites with or without residue incorporation were determined by the SIMPER routine using Plymouth Routine

In Multivariate Ecological Research (PRIMER Ltd., v7 Lutton, Ivybridge, UK).

139

Table 8: The number of bacterial genera1 and diversity measures2 (Shannon’s H and Inverse

Simpson) where alfalfa residue was or was not incorporated. The soil samples were collected in

2015.

Residue Status Total Genera Shannon Inverse Simpson

Nonincorporated 273 5.257 0.9976

Nonincorporated 524 5.507 0.9971

Nonincorporated 838 5.73 0.9974

Nonincorporated 793 5.733 0.9975

Nonincorporated 863 5.774 0.9975

Nonincorporated 806 5.779 0.9976

Nonincorporated 854 5.829 0.9977

Nonincorporated 1007 5.914 0.9978

Nonincorporated 902 5.927 0.998

Nonincorporated 1134 5.938 0.9978

Nonincorporated 1144 6.064 0.9981

Nonincorporated 1230 6.071 0.9981

Nonincorporated 1239 6.106 0.9982

Nonincorporated 1360 6.113 0.9982

Nonincorporated 1490 6.127 0.9981

Nonincorporated 1495 6.139 0.9982

Nonincorporated 1425 6.193 0.9983

Incorporated 623 5.668 0.9975

Incorporated 828 5.713 0.9973

140

Incorporated 1203 5.943 0.9978

Incorporated 1060 5.988 0.998

Incorporated 1176 5.999 0.998

Incorporated 1285 6.03 0.998

Incorporated 1298 6.055 0.998

Incorporated 1273 6.114 0.9982

Incorporated 1324 6.131 0.9982

Incorporated 1541 6.15 0.9981

Incorporated 1504 6.158 0.9982

Incorporated 1418 6.161 0.9982

Incorporated 1361 6.179 0.9983

Incorporated 1754 6.256 0.9983

1 Bacterial genera classified by sequences of the V1/V3 region of the 16S rRNA gene through an

Illumina MiSeq sequencing platform by the Institute for Bioinformatics and Evolutionary

Studies (IBEST) core at the University of Idaho.

2 Bacterial genera diversity fromsoil samples from sites with or without residue incorporation were determined by the DIVERSE routine using Plymouth Routine In Multivariate Ecological

Research (PRIMER Ltd., v7 Lutton, Ivybridge, UK).

141

CHAPTER FIVE

The Low Potential of Teff (Eragrostis tef) as an Inoculum Source for Verticillium dahliae.

ABSTRACT

Teff (Eragrostis tef) is a fine stemmed annual grass and gluten free small grain that is of interest as a forage, cover, or a rotation crop. Little is known about the susceptibility of teff to many diseases. Teff could be grown in rotation with potato in the northwestern United States provided teff cultivation is economical and does not increase soil populations for pathogens affecting rotation crops such as Verticillium dahliae. Verticillium dahliae infects a wide range of dicotyledonous plants, making it one of the most important fungal pathogens of crop plants in

North America, including potato. The objective of this study was to quantify the susceptibility of teff to eight V. dahliae isolates and compare the susceptibility of teff to eggplant. Teff was confirmed as a host for V. dahliae, as indicated by the presence of microsclerotia in teff stems and roots after artificial inoculation in two years of greenhouse studies. The number of microsclerotia produced in teff did not differ between mint and potato pathotypes of V. dahliae.

No V. dahliae isolate produced significantly greater numbers of microsclerotia than any of the seven other isolates tested in a two-year study. Microsclerotia production of V. dahliae in teff was consistently less than in susceptible eggplant cv. Night shadow in both greenhouse experiments (P < 0.02). It is unlikely that teff infected by V. dahliae will proliferate microsclerotia of mint or potato-aggressive pathotypes, especially when compared to susceptible eggplant cultivars.

142

INTRODUCTION

Teff (Eragrostis tef) is a fine stemmed annual grass and gluten free small grain

(Stallknecht et al. 1993). Ethiopia is the center of origin for teff and it is still grown there today

(Mengesha et al. 1965). Teff accounts for a large part of the grain grown in Ethiopia, which was approximately half of the Ethiopian cereals planted in 1996 (Brown 1999) and 35% of all cereals planted in 2014 (USDA Foreign Agriculture Service). Teff is planted due to its traditional role as a foodstuff for certain ethnic groups, but also due to its nutritional properties and ability to grow in sites subject to waterlogging or drought (Stallknecht et al. 1993).

Little is known about the susceptibility of teff to many diseases. Teff is susceptible to three diseases in Ethiopia: teff rust (Uromyces eragrostidis), head smudge (Helminthosporium miyakei), and damping off (Drechslera poae and H. poae) (Ketema 1997; 1987). Head smudge of teff can cause yield losses of 10-15% (Ketema 1997). Early sown teff in Ethiopia is the most susceptible to damping off (Ketema 1987). Teff has not been found to be susceptible to other important soilborne diseases such as Verticillium wilt, which is caused by Verticillium dahliae.

Experimental teff cultivation highlighted that teff does not take an entire season to mature in the Columbia Basin of Washington State and the Treasure Valley of Idaho (Norberg et al.

2008). Teff can be double cropped in these areas with a planting in July serving as a green manure crop followed by another short-season crop. Research results indicated that teff could serve as an excellent rotation crop due to an inability to tolerate freezing temperatures (and therefore teff has a low overwintering potential), plus the small crowns and thin, fibrous roots don’t impede production of subsequent crops of the next rotation (Norberg et al. 2008).

143

Teff could be grown in rotation with potato in the Columbia Basin as a forage, green manure, cover, or rotation crop provided teff cultivation is economical and does not increase soilborne inoculum of important soilborne pathogens for crops being grown in rotation with teff.

The terms green manure and cover crop refer to different practices. Sullivan (2003) defines green manure cropping as a practice that “involves the soil incorporation of any field or forage crop while green or soon after flowering for the purpose of soil improvement.” Sullivan (2003) continues by differentiating a cover crop from a green manure crop “as a cover crop is any crop grown to provide soil cover, regardless of whether it is later incorporated.” Cover crops are often included in crop rotations as a way to suppress weeds, reduce pest and disease pressure on other crops in the rotation, and provide positive contributions to the soil microbiome, organic content, and soil structure (Clark 1998; Sullivan 2003). Both cover crops and green manures can be double cropped within the same season, depending on climate, to cover bare soil before or after a season and provide nutrients to subsequent crops (Clark 1998).

Verticillium dahliae infects a wide range of plants, making it one of the most important fungal pathogens of dicotyledonous crop plants in North America, including potato (Bhat et al.

2003; Bhat and Subbarao 1999; Fordyce and Green 1960). Despite the wide host range of V. dahliae, individual isolates can vary in aggressiveness when introduced to different plant hosts.

Aggressiveness in this case refers to increased severity of disease symptoms or increased production of overwintering inoculum, i.e. microsclerotia. V. dahliae aggressiveness is a function of the fungus reproducing within annual or perennial crop hosts such as pepper or mint, respectively (Bhat et al. 2003; Fordyce and Green 1960). Aggressive V. dahliae isolates are

144

called host-adapted pathotypes (Bhat and Subbarao 1999), can be shortened to pathotype for ease of reference.

The potato-aggressive pathotype of V. dahliae could infect teff, but still maintain its aggressiveness until infecting a potato plant again. This hypothesis was supported recently by

Linde et al. (2016) in a different fungal pathosystem involving Rhynchosporium commune, a pathogen on weedy barley grass and barley. Linde et al. (2016) determined that “barley grass acts as an important ancillary host to R. commune, harbouring highly virulent pathogen types capable of transmission [back] to barley.” This observation underlies the need to verify whether pathogen aggressiveness is maintained during inocula transfers between plant hosts. It is possible that a similar situation could exist between rotation crops as well.

Barley, a monocot, has been reported to be susceptible to Verticillium wilt (Mathre

1989). Mathre (1989) noticed symptoms associated with Cephalosporium stripe (caused by

Cephalosporium gramineum) on spring-sown barley and noted it was unusual “because this pathogen primarily attacks fall-sown [barley] crops whose roots experience wounding during winter”. Although Mathre (1989) stated V. dahliae is unlikely to become a major pathogen of barley or other cereal crops, the information on the susceptibility of a monocot host to

Verticillium wilt makes it important to verify whether teff is susceptible to infection by V. dahliae. The susceptibly of teff to aggressive pathotypes of V. dahliae also must be determined given that V. dahliae isolates can be aggressive to a particular host (Bhat and Subbarao 1999) such as potato, and aggressiveness could be maintained across different hosts as the case with R. commune and weedy barley grass to barley (Linde et al. 2016). The objectives of this study were

145

to identify the susceptibility of teff to eight V. dahliae isolates, including isolates from the mint and potato pathotypes, and to compare the susceptibility of teff to the Verticillium-susceptible host eggplant.

MATERIALS AND METHODS:

Origin of V. dahliae isolates and preparation of V. dahliae inocula.

V. dahliae isolates were previously characterized for aggressiveness to various hosts and

VCG identity by Dung et al. (2013) (Table 1). The V. dahliae isolates were assigned to the mating type MAT1-2 idiomorph except for isolate 461 from tomato, which was from a rarer mating type MAT1-1 idiomorph (Dung et al. 2013). The eight V. dahliae isolates represent a diverse collection due to documented aggressiveness on different hosts, isolation from different crop hosts, and classification to different VCGs and mating types (Table 1).

Inoculum of each V. dahliae isolate was prepared by placing a microsclerotium on V. dahliae semiselective media (Butterfield and DeVay 1977) and allowing growth for ten days.

Identification by morphology was confirmed following the protocol of Inderbitzin et al. (2011).

A subsection of the actively growing border of the colony was collected with a cork borer (7 mm diameter) and agar disks were placed in Czapek-dox broth (Sigma-Aldrich, St. Louis, MO) to increase inoculum for pathogenicity studies. Liquid cultures were shaken at 150 RPM at a room temperature of 21 to 23ºC for 10 days. The colony forming units (CFUs) of conidial suspensions were standardized using a hemocytometer.

Quantification of V. dahliae in teff and eggplant.

146

Comparisons were made for the aggressiveness of the eight V. dahliae isolates to teff and eggplant cv. Night Shadow in two greenhouse trials in 2014 and 2016. Eggplant was selected as a host that is susceptible to all V. dahliae isolates (Klosterman et al. 2009) to confirm infectivity of each V. dahliae isolate. Experimental units were arranged in a randomized complete block design with three replications in a greenhouse each year.

Teff and eggplant seeds were germinated on moistened filter paper to determine if seed was free from V. dahliae. Germinated seed was visually assessed for the presence or absence of disease symptoms, sporulation, and microsclerotia associated with V. dahliae after approximately two weeks. Seedlings no greater than 10 cm in length were then inoculated by submerging the hypocotyl and primary root in an agitated conidial suspension of each V. dahliae isolate at a concentration of approximately 1.0 X 106 CFU/ mL for 2 to 3 seconds. Inoculated seedlings were directly transplanted into moistened soilless potting medium in 3.79 liter pots.

Seedlings from the non-inoculated treatment were kept separate from seedlings inoculated with

V. dahliae during the inoculation step in order to prevent cross-contamination. Seedlings that were inoculated with V. dahliae or were noninoculated were kept in the same greenhouse for the duration of the experiment. The greenhouse was maintained at an average daytime temperature of approximately 23ºC and 15.5ºC at night with no supplemental lighting.

Plants were visually inspected for symptoms of Verticillium wilt once a week during four months of growth after inoculation. Plants were harvested after four months in the greenhouse, potting mix was washed off the plants, blotted dry, and plants were slowly dried for four weeks at ambient temperatures of 21-24ºC. Slow drying facilitates the formation of microsclerotia and

147

desiccation of conidia and hyphae. A dried stem section from the crown to upwards of 16 cm, and a root section from the crown downward to approximately 9 cm was harvested from each plant. Dried stems or roots were ground with an electric coffee grinder (Secura, Appleton, WA) until the particle size was approximately less than 4 mm2. The removable cup from the grinder, as well as the lid, was sprayed with a mixture of 70% ethanol and 30% deionized water between plant samples and between stem and root samples in order to sterilize grinder surfaces that plant matter contacted.

The number of V. dahliae CFU for each dried plant part was determined by spreading one gram of dried plant stem or root on NPX and counting the number of colonies after incubation for 10 days using an Olympus SD-ILK dissecting microscope at 7 to 20X magnification

(Olympus Optical Ltd, Tokyo, Japan). Verticillium dahliae colonies were differentiated from other fungi using the protocol similar to Inderbitzin et al. (2011) which includes: growth on the semi-selective medium (NPX), the absence of the yellow pigment (flavexudan) in culture, irregularly shaped and melanized microsclerotia, and the presence of the characteristic verticillate conidiophores with slimy, terminal amerospores.

Differences in the number of observed V. dahliae microsclerotia for each V. dahliae isolate infecting teff or eggplant was determined by PERMANOVA (Primer-E Ltd, v7, Devon,

UK). PERMANOVA has been used with data sets that do not satisfy assumptions of parametric and nonparametric analyses (Anderson 2001) and helped to determine differences in the number of microsclerotia number among or within different field crops (Wheeler and Johnson 2016).

PERMANOVA was carried out following instructions from (Clarke and Gorley 2006).

148

Familywise type I error was controlled using a false discovery rate (FDR, Benjamini and

Hochberg 1995; Glickman et al. 2014) to adjust PERMANOVA p-values to smaller values than

0.05 to ascertain truly significant differences. The V. dahliae isolate with the greatest microsclerotia counts within teff or eggplant was determined if this one pairing of host and isolate had significantly greater numbers of V. dahliae microsclerotia than pairwise comparisons with all seven other V. dahliae isolates within that same host for a minimum of 100 permutations.

RESULTS:

V. dahliae quantification in teff and eggplant.

Teff was infected by each isolate of V. dahliae, as indicated by the recovery of microsclerotia from within the plants (Figs. 1 and 2). Teff did not develop symptoms of

Verticillium wilt over four months of the experiment during either year (data not shown).

V. dahliae infections of teff generally yielded small numbers of microsclerotia (< 5 microsclerotia per gram of stem, Figs. 1 and 2). The fewest microsclerotia per gram of teff stem was zero from plants inoculated with the V. dahliae potato pathotype, isolate 461 (from tomato), and isolate VMD-4 (from tomato) in 2014 (Fig. 1). The greatest mean number of microsclerotia per gram of teff root was 6.67 microsclerotia from the V. dahliae isolate from sunflower (Fig. 2).

No single V. dahliae isolate produced more microsclerotia than any of the other seven isolates in teff stems (false discovery rate corrected for significance P < 0.006) and roots (false discovery rate corrected for significance P < 0.007) in 2014 and 2016 (Figs. 1-2). No microsclerotia of V. dahliae were recovered from noninoculated teff plants in either year (Figs. 1-2).

149

Eggplant was infected by all isolates of V. dahliae (Fig. 1) except the mint pathotype of

V. dahliae (isolate 111) in 2016 (Fig. 2) as indicated the presence of microsclerotia from the plants. All inoculated eggplants did develop Verticillium wilt symptoms of stunting and chlorosis over four months of growth in both years (data not shown).

V. dahliae infections of eggplant generally yielded five to thirty microsclerotia per gram of plant part in 2014 and 2016 (Figs. 1-2). Infected eggplant produced significantly greater mean numbers of V. dahliae microsclerotia than teff in both stems (P < 0.02) and roots (P < 0.02) in

2014 and 2016. The fewest microsclerotia per gram of eggplant stem was 1.67 from plants inoculated with V. dahliae isolate VMD-4 (from tomato) in 2014 (Fig. 1). The greatest mean number of microsclerotia per gram of eggplant root was 40.0 microsclerotia when infected with

V. dahliae isolate 461 (from tomato) (Fig. 1). No single V. dahliae isolate produced more microsclerotia than any of the other seven isolates in eggplant stems (false discovery rate corrected for significance P < 0.006) and roots (false discovery rate corrected for significance P

< 0.007) in 2014 and 2016 (Figs. 1-2). The observation that no single V. dahliae isolate produced more microsclerotia than the other seven isolates in eggplant stems and roots implies no V. dahliae pathotype was more aggressive than the other in terms of microsclerotia production from infected eggplant. No microsclerotia of V. dahliae were recovered from noninoculated eggplants in either year (Figs. 1-2).

150

DISCUSSION:

Teff was confirmed as a host for V. dahliae as indicated by the presence of microsclerotia in stems and roots. Teff did not produce any Verticillium wilt symptoms as a result of V. dahliae infection. These infections have been reported previously as asymptomatic infections (Wheeler and Johnson 2016; Woolliams 1966) in brassica rotation crops within potato production systems

(Wheeler and Johnson 2016), some weedy hosts (Woolliams 1966), and even monocots crop hosts such as barley (Mol et al. 1995).

The number of microsclerotia produced in teff did not differ between the mint and potato pathotypes of V. dahliae in this study. No V. dahliae isolate produced significantly greater numbers of microsclerotia than any of the seven other isolates in either year as well. It is unlikely that teff infected by V. dahliae will proliferate microsclerotia of mint or potato- aggressive pathotypes, especially when compared to susceptible eggplant cultivars. Evaluation of the maintenance of potato or mint pathotype aggressiveness upon reinfecting potato or mint after completing the lifecycle within teff was not pursued given so few V. dahliae microsclerotia were recovered from teff for the potato pathotype of V. dahliae. Zero microsclerotia were recovered from the V. dahliae potato pathotype from inoculated teff stems in 2014 and an average of 1.33 microsclerotia from the V. dahliae potato pathotype in were recovered from inoculated teff stems in 2016.

Microsclerotia production of V. dahliae in teff was consistently less than in eggplant cv.

Night Shadow in both greenhouse experiments. Teff is likely to produce fewer microsclerotia than many other Verticillium-susceptible hosts in the field. This information supports the

151

possibility that teff can return V. dahliae microsclerotia to the soil under field conditions, but the effect of widespread planting of teff on increasing V. dahliae microsclerotia in soil would be less than the widespread planting of hosts susceptible to Verticillium wilt such as eggplant.

The numbers of microsclerotia returned to soil are important for Verticillium wilt potential on susceptible crops planted in the future. Slattery et al. (1981) documented an increase of microsclerotia in soil over several seasons in the Red River Valley of Minnesota and North

Dakota with the use of the potato cv. Kennebec returned relatively high numbers of microsclerotia to the soil. The conclusions from Slattery et al. (1981) indicate that the amount of

V. dahliae inoculum produced on preceding crops and potato cultivars influenced the severity of

Verticillium wilt in following potato crops (Slattery, 1981). Teff as a potential rotation, cover or green manure crop for potato production systems is unlikely to return many microsclerotia to the field.

ACKNOWLEDGMENTS

This work was supported by funds from the Northwest Potato Consortium. I would like to thank Dr. Dennis Johnson, as well as Tom Cummings, for assistance in conducting this research. I appreciate David Wheeler, Dr. Debra Inglis, Dr. Mark Pavek, and Dr. Weidong

Chen’s efforts with editorial suggestions before submission.

152

Literature Cited:

Anderson, M. J. 2001. A new method for non-parametric multivariate analysis of variance.

Austral Ecol. 26: 32-46.

Benjamini, Y., and Hochberg, Y. 1995. Controlling the false discovery rate: A practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B. Stat. Methodol. 57: 289-300.

Bhat, R. G., Smith, R. F., Koike, S. T., Wu, B. M., and Subbarao, K. V. 2003. Characterization of Verticillium dahliae isolates and wilt epidemics of pepper. Plant Dis. 87: 789-797.

Bhat, R. G., and Subbarao, K. V. 1999. Host range specificity in Verticillium dahliae.

Phytopathology 89: 1218-1225.

Boe, A., J. Sommerfeldt, R. Wynia, and N. Thiex. 1986. A Preliminary Evaluation of the Forage

Potential of Teff. Proc. South Dakota Acad. Sci. 65: 75–82.

Butterfield, E.J., and DeVay, J.E. 1977. Reassessment of soft assays for Verticillium dahliae.

Phytopathology 67: 1073-1078.

Clark, A. 1998. Managing cover crops profitably. Second edition. Sustainable Agriculture

Publications; Burlington, VT.

Clarke, K. R., and Gorley, R. N. 2006. PRIMER v6: User Manual PRIMER-E. Plymouth, UK.

153

Dung, J. K., Peever, T. L., and Johnson, D. A. 2013. Verticillium dahliae populations from mint and potato are genetically divergent with predominant haplotypes. Phytopathology 103: 445-459.

Fordyce, C., and Green, K.J. 1960. Studies of host specificity of Verticillium albo-atrum var. menthae. Phytopathology 50: 635.

Glickman, M. E., Roa, S. R., and Schultz, M. R. 2014. False discovery rate control is a recommended alternative to Bonferroni-type adjustments in health studies. J. Clin. Epidemiol.

67: 850-857.

Inderbitzin, P., Bostock, R. M., Davis, R. M., Usami, T., Platt, H. W., and Subbarao, K. V. 2011.

Phylogenetics and taxonomy of the fungal vascular wilt pathogen Verticillium, with the descriptions of five new species. PloS one 6: e28341.

Ketema, S. 1997. Tef-Eragrostis Tef (Zucc.) (Vol. 12). Bioversity International.

Ketema, S. 1987. Research recommendations for production and brief outline of strategy for the improvment of tef [Eragrostis tef (Zucc.) Trotter]. In: Proc. 19th Natl. Crop. Imp. Conf. IAR.

Addis Ababa, Ethiopia.

Klosterman, S. J., Atallah, Z. K., Vallad, G. E., and Subbarao, K. V. 2009. Diversity, pathogenicity, and management of Verticillium species. Ann Rev Phytopathology 47: 39-62.

154

Linde, C. C., Smith, L. M., and Peakall, R. 2016. Weeds, as ancillary hosts, pose disproportionate risk for virulent pathogen transfer to crops. BMC evolutionary biology 16: 1.

Mathre, D. E. 1989. Pathogenicity of an isolate of Verticillium dahliae from barley. Plant Dis.

73: 164-167.

Mengesha, M.H. 1965. Chemical composition of Teff (Eragrostis tef) compared with that of wheat, barley and grain sorghum. Econ. Bot. 19: 268-273.

Mengesha, M.H., R.C. Pickett, and R.L. Davis. 1965. Genetic variability and interrelationship of characters in Teff, Eragrostis tef (Zucc.) Trotter. Crop Sci. 5:155-157.

Mol, L. 1995. Formation of microsclerotia of Verticillium dahliae on various crops. Neth. J.

Agric. Sci. 43: 205-215.

Norberg, S., Roseberg, R. J., Charlton, B. A., and Shock, C. C. 2008. Teff: a new warm-season annual grass for Oregon. Corvallis, Or.: Extension Service, Oregon State University. Retrieved from

Slattery, R.J. 1981. Inoculum potential of Verticillium-infested potato cultivars. Am. Potato J.

58: 135-142.

155

Stallknecht, G.F., K.M. Gilbertson, and J.L. Eckhoff. 1993. Teff: Food crop for humans and animals. p. 231-234. In: J. Janick and J.E. Simon (eds.), New crops. Wiley, New York.

Sullivan, P. 2003. Overview of Cover Crops and Green Manures. ATTRA; Fayettevilla, AK.

Retrieved from

Cover-Crops-and-Green-Manures-19wvmad.pdf>

USDA Foreign Agriculture Service. 2014. Ethiopia grain and feed annual report. Retrieved from

Addis%20Ababa_Ethiopia_3-25-2014.pdf>

Wheeler, D. L., and Johnson, D. A. 2016. Verticillium dahliae infects, alters plant biomass, and produces inoculum on rotation crops. Phytopathology 106: 602-613.

Woolliams, G. E. 1966. Host range and symptomatology of Verticillium dahliae in economic, weed, and native plants in interior British Columbia. Can J Plant Sci. 46: 661-669.

156

Table 1: The isolates of Verticllium dahliae used in in two greenhouse trials in 2014 and 2016 to evaluate if teff (Eragrostis tef) is susceptible to V. dahliae infection, and if teff is susceptible to potato or mint pathotypes of V. dahliae.

Vd Isolate VCG b Pathotype Original Host c Name

111 2B Mint Mint

155 2B Mint Mint

381 2 A/B - Watermelon

461 2 - Tomato

625 2B - Sugar Beet

653 4A Potato Potato

Sunflower 2A - Sunflower

Vmd4 2 A/B - Tomato b VCG: vegetative compatibility group c Host original isolate had infected. Isolates originating from potato or mint are the potato or mint pathotypes, respectively.

157

for both teff and eggplant were noninoculated.

MeanNumber microsclerotia

Host and Verticillium dahliae isolate

158

for both teff and eggplant were noninoculated.

MeanNumber microsclerotia MeanNumber microsclerotia

Host and Verticillium dahliae isolate

159

CHAPTER SIX

Conclusions

Potato production is important to Washington State agriculture. The total market value of potatoes produced in Washington in 2011 was an estimated 790 million dollars, making potatoes fourth out of the top ten agricultural commodities produced in Washington State in 2011 (WSDA

2015). Washington State planted 170,000 acres of processing potatoes in 2015 with an average yield of 590 CWT/acre, which is the highest yield per acre in the United States (NASS 2016).

Verticillium wilt, caused by Verticillium dahliae, is one of the most important diseases of dicotylendous crop plants in North America (Bhat and Subbarao 1999; Malik and Milton 1980), including potato (Johnson and Miliczky 1993; Omer et al. 2008).

Infection of potato by V. dahliae can occur whenever microsclerotia are present, but

Verticillium wilt epidemics typically arise when a minimum of 5 to 30 of V. dahliae microsclerotia per gram of soil are present in soil wherever a susceptible potato crop is planted

(Powelson and Rowe 1993). Verticillium wilt epidemics depends on the presence of microsclerotia in field soil prior to planting (Schnathorst, 1981). Reducing of the number of V. dahliae microsclerotia, or limiting their ability to germinate, is an important consideration in potato fields prior to planting (Mace et al. 1981). One objective of these experiments was to characterize the susceptibility of litchi tomato, teff, and weedy hosts to crop-aggressive isolates of V. dahliae. Doing so allows growers to infer where microsclerotia from aggressive V. dahliae isolates are likely to be distributed in their fields based on the distribution of weeds or planting of susceptible hosts. The second objective was to determine if alfalfa residue incorporation was an

160

effective management strategy for Verticillium wilt of potato by comparing the number of V. dahliae microsclerotia and soil metagenomics in field soils that alfalfa residues were or were not incorporated.

Understanding the potential role of litchi tomato in the production of V. dahliae and C. coccodes microsclerotia is important to potato crop rotation sequences if litchi tomato is going to be planted as a pale cyst nematode trap crop. The study entitled “Evaluation of Solanum sisymbriifolium as a Potential Inoculum Source of Verticillium dahliae and Colletotrichum coccodes” compared inoculum production of two pathotypes of V. dahliae and an isolate of C. coccodes in stems and roots of greenhouse-grown litchi tomato plants with potato cultivars that differ in susceptibility to V. dahliae. Litchi tomato was confirmed as a host for V. dahliae and C. coccodes. The variation in inoculum production between the potato and mint pathotypes of V. dahliae indicate that neither pathotype is consistently more aggressive on litchi tomato.

Observations of decreased V. dahliae inoculum densities in litchi tomato compared to potato cv.

Russet Norkotah but not Ranger Russet suggests that litchi tomato was partially resistant to V. dahliae like Ranger Russet. The inconsistency in decreased C. coccodes inoculum production in litchi tomato stems compared to potato cvs. Alturas and Russet Norkotah is evidence supporting litchi tomato as also being partially resistant to C. coccodes. The use of litchi tomato as a PCN trap crop is likely to have limited effect on the proliferation of V. dahliae or C. coccodes populations in field soil.

Weeds such as black nightshade and hairy nightshade are important to potato production in the Pacific Northwest because of their ability to directly compete for resources and serve as a

161

host for potato pathogens (Hutchinson et al. 2011). The interaction of V. dahliae host-adapted pathotypes with weedy hosts has not been explored, despite the importance of aggressive isolates of V. dahliae to Verticillium wilt epidemics on potato. Complete understanding of the interaction of aggressive isolates of V. dahliae with weeds is important to successful long-term management of Verticillium wilt. Fields where Verticillium-susceptible weedy hosts are prevalent could pose greater inoculum pressure from V. dahliae pathotypes in subsequent years. The objective of the study entitled “Susceptibility of Weedy Hosts from Pacific Northwest Potato Production Systems to Crop-Aggressive Isolates of Verticillium dahliae.” evaluated the susceptibility of 16 weeds from the Columbia basin to eight V. dahliae isolates and identified weedy hosts in which the potato or mint pathotype produce greater numbers of microsclerotia compared to the other V. dahliae isolates.

Every weed tested in this study was confirmed (or re-confirmed) as a host for V. dahliae when V. dahliae was recovered from plants grown in greenhouse settings. The consistent observation of black nightshade being susceptible to the potato pathotype of V. dahliae is important in managing Verticillium wilt of potato because field locations where black nightshade are prevalent would correspond to greater inoculum pressure to the potato crop in subsequent years.

Teff cultivation by Norberg et al. (2008) has highlighted a benefit for a crop that does not take an entire season to mature in the Columbia Basin and Treasure Valley. Therefore, teff could be grown in rotation with potato in the Columbia Basin as a forage crop, green manure, cover crop, or rotation crop that may not increase soil populations of V. dahliae. Confirmation that teff

162

does not serve as a host for V. dahliae should be completed before teff can be employed as a crop rotation in a potato production system. The first objective of this study entitled “The Low

Potential of Teff (Eragrostis tef) as an Inoculum Source for Verticillium dahliae.” confirmed host status of teff by artificially inoculating teff with one of eight V. dahliae isolates. The second objective of this study quantified the number of V. dahliae microsclerotia from potato or mint pathotypes of V. dahliae infecting teff and to determine if aggressiveness of the isolate is maintained through teff infection by observing greater numbers of microsclerotia from a V. dahliae pathotype compared to the other isolates.

Teff was confirmed as a host for V. dahliae as indicated by the presence of microsclerotia in stems and roots. However, teff did not produce any Verticillium wilt symptoms. In addition, there were no significant differences for numbers of microsclerotia produced among the eight isolates in either year. It is unlikely that teff infected by V. dahliae will increase microsclerotia of mint or potato-aggressive pathotypes, especially when compared to susceptible eggplant and potato cultivars. The microsclerotia production of V. dahliae on teff was consistently less than eggplant cv. Night Shadow in both greenhouse experiments. Teff is likely to produce fewer microsclerotia than many other Verticillium-susceptible hosts in the field. This information supports the possibility that teff can return V. dahliae microsclerotia to the soil under field conditions, but the effect of planting teff on increasing V. dahliae microsclerotia in soil would be less than a similar planting of hosts susceptible to Verticillium wilt such as eggplant.

Disease-suppressive soils may potentially reduce the number of viable V. dahliae microsclerotia, or suppress their germination. Disease-suppressive soils can be promoted by

163

incorporating relatively large amounts of either green manures or plant residues of specific crops into greenhouse and field soils (Larkin and Halloran 2014). It has not been determined if

Verticillium-suppressive soils can be facilitated by alfalfa residue incorporation in the Columbia

Basin of Washington State, nor have the bacterial populations been characterized for soils subject to alfalfa residue incorporation. The study entitled “The Effect of Alfalfa Residue

Incorporation on Soil Bacterial Communities and the Quantity of Verticillium dahliae

Microsclerotia in Potato Fields in the Columbia Basin of Washington State, USA.” determined

V. dahliae microsclerotia numbers from soil where alfalfa was incorporated were unexpectedly greater than in soil where residue was not incorporated. Residue incorporation within a single season was not sufficient in suppressing V. dahliae populations. The effect of alfalfa residue incorporation on the number V. dahliae microsclerotia in the field appeared to be smaller than the effect of fumigant on the number of V. dahliae microsclerotia in both years of study.

Incorporating alfalfa residues did not significantly alter the soil bacterial metagenome compared to fields not subject to residue incorporation in 2014 or 2015.

164

Literature Cited:

1. Bhat, R.G. and Subbarao, K.V. 1999. Host range specificity in Verticillium dahliae.

Phytopathology: 89 1218–1225.

2. Hutchinson, P. J. S., Beutler, B. R., and Farr, J. 2011. Hairy nightshade (Solanum

sarrachoides) competition with two potato varieties. Weed science 59: 37-42.

3. Larkin, R.P., and Halloran, J.M. 2014. Management effects of disease-suppressive

rotation crops on potato yield and soilborne diseases. Am J. Potato 91: 429-439.

4. Mace, M; Bell, A; and Beckman, C. 1981. Fungal Wilt Diseases of Plants. New York,

Academic Press, Inc. Page 65.

5. Malik, N.K., Milton, J.M. 1980. Survival of Verticillium in Monocotyledonous host

plants. Trans. Br. Mycol. Soc.75: 496-497.

6. National Agricultural Statistics Service. Quick Stats (NASS). 2013-2016. United States

Department of Agriculture, Washington D.C. Resources employed include:

ates/potco10.pdf> ;

5151C503501D> ;

ket_Value/Washington/>

7. Powelson, M.L., and Rowe, R.C. 1993. Biology and Management of Early Dying of

Potatoes. Annu. Rev. Phytopathol. 31:111-126.

8. Schnathorst, W.C. 1981. Life cycle and epidemiology of Verticillium. In Fungal Wilt

Diseases of Plants (Mace, M.E., Bell, A.A. and Beckman, C.H., eds), pp. 81–111. New

York: Academic Press.

165

9. WSDA. 2015. Agriculture – A Cornerstone of Washington’s Economy. AGRI-PUB 103-

127 (R/2/15). Retrieved from

10. Bhat, R.G. and Subbarao, K.V. 1999. Host range specificity in Verticillium dahliae.

Phytopathology: 89 1218–1225.

11. Mace, M; Bell, A; and Beckman, C. 1981. Fungal Wilt Diseases of Plants. New York,

Academic Press, Inc. Page 65.

12. Malik, N.K., Milton, J.M. 1980. Survival of Verticillium in Monocotyledonous host

plants. Trans. Br. Mycol. Soc.75: 496-497.

13. National Agricultural Statistics Service. Quick Stats (NASS). 2013-2016. United States

Department of Agriculture, Washington D.C. Resources employed include:

ates/potco10.pdf> ;

5151C503501D> ;

ket_Value/Washington/>

14. Powelson, M.L., and Rowe, R.C. 1993. Biology and Management of Early Dying of

Potatoes. Annu. Rev. Phytopathol. 31:111-126.

15. Schnathorst, W.C. 1981. Life cycle and epidemiology of Verticillium. In Fungal Wilt

Diseases of Plants (Mace, M.E., Bell, A.A. and Beckman, C.H., eds), pp. 81–111. New

York: Academic Press.

16. WSDA. 2015. Agriculture – A Cornerstone of Washington’s Economy. AGRI-PUB 103-

127 (R/2/15). Retrieved from

166