DOCSLIB.ORG

Squaring Theory with Practice in RNA Design

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Squaring Theory with Practice in RNA Design COSTBI-1009; NO. OF PAGES 10 Available online at www.sciencedirect.com Squaring theory with practice in RNA design 1,2 1,3 JP Bida and R Das Ribonucleic acid (RNA) design offers unique opportunities recent work to expand each rule into predictive theories for engineering genetic networks and nanostructures that and tools, highlighting current mismatches between self-assemble within living cells. Recent years have seen the theory and practice. We conclude with a perspective creation of increasingly complex RNA devices, including proof- on trends that may radically accelerate the discovery of of-concept applications for in vivo three-dimensional scaffolding, new RNA design theories and devices. imaging, computing, and control of biological behaviors. Expert intuition and simple design rules — the stability of double helices, Three heuristic design rules the modularity of noncanonical RNA motifs, and geometric All successful RNA designs to date have leveraged three closure — have enabled these successful applications. Going basic rules, many first explored in the interrogation of beyond heuristics, emerging algorithms may enable automated natural RNA systems [3] and the design of DNA devices design of RNAs with nucleotide-level accuracy but, as illustrated [4]. We illustrate these ideas with an ‘RNA square’ on a recent RNA square design, are not yet fully predictive. (Figure 1a–g), recently assembled from eight strands as Looking ahead, technological advances in RNA synthesis and a potential scaffold for nanoscale chemical reactions interrogation are poised to radically accelerate the discovery and (Figure 1a) and crystallized by the Hermann lab [2 ]. stringent testing of design methods. Addresses Rule 1. Watson–Crick base pairs generate stable double helices. 1 Department of Biochemistry, Stanford University, Stanford, CA 94305, Every RNA design made to date has taken advantage of USA 2 helical stems formed as RNA strands double back on Department of Bioengineering, Stanford University, Stanford, CA themselves or associate with other strands to form Wat- 94305, USA 3 son–Crick base pairs. For the RNA square, its edges are four Department of Physics, Stanford University, Stanford, CA 94305, USA helices, each involving association of four strands Corresponding author: Das, R ([email protected]) (Figure 1b). Rule 2. RNA motifs can preserve their behavior when copied and Current Opinion in Structural Biology 2012, 22:xx–yy pasted into new contexts. Explorations of RNAs in living This review comes from a themed issue on Engineering and design systems and elegant in vitro selections have revealed a Edited by Jane Clarke and Bill Schief plethora of natural RNA catalysts, sensors, and structures. Many of these molecules’ functions are due to small (4–15 nucleotide) RNA motifs with non-canonical structure. These motifs can be grafted into if care is taken to avoid 0959-440X/$ – see front matter, Published by Elsevier Ltd. mispairings with flanking sequences. For example, the four http://dx.doi.org/10.1016/j.sbi.2012.06.003 ‘nanocorners’ of the RNA square (Figure 1c) are copies of a five-nucleotide bulge motif, drawn from a right-angle- forming structure in the Hepatitis C virus genome [5]. Ribonucleic acid (RNA) is, in many respects, an ideal polymer for biomolecular design. Natural and designed Rule 3. Geometric closure ensures correct three-dimensional struc- RNA chains can be exquisitely functional: they code for ture. For 3D structures, the geometry of helical stems must genetic information, assemble into intricate three-dimen- successfully interconnect with noncanonical motifs — a sional structures, catalyze chemical reactions, and engage in stringent requirement for RNA designs that encompass nearly every essential biological process in living cells closed ‘ring’ topologies (Figure 1d). For the RNA square, (extensively reviewed in [1]). Most appealingly, these the choice of 10 base pairs for the edges leads to a well- RNA behaviors can be explained and designed by rules ordered square assembly with no detectable alternative that appear strikingly simple and, in favorable cases, are species. Extension to 11 base pairs precludes the closure quantitatively predictive. Indeed, our motivation for study- of the square and gives higher-order assemblies [2 ]. ing RNA design puzzles is that they offer opportunities to discover and rigorously test such predictive rules, which Can these intuitive rules be explained and expanded into might, in turn, enable the modeling of any RNA ‘from quantitatively predictive theories for RNA design? scratch’. Expanding Rule 1: theories for RNA secondary This review focuses on current and missing rules for RNA structure design design, starting with a description of three basic heuristics Physical theories underlying RNA secondary structure in universal use. The three subsequent sections review formation are the most developed models in RNA science www.sciencedirect.com Current Opinion in Structural Biology 2012, 22:1–10 Please cite this article in press as: Bida JP, Das R. Squaring theory with practice in RNA design, Curr Opin Struct Biol (2012), http://dx.doi.org/10.1016/j.sbi.2012.06.003 COSTBI-1009; NO. OF PAGES 10 2 Engineering and design Figure 1 (a) Inner Strand: 5′-CCGGCAGCCU-3 ′ [x4] Outer Strand: 5′-CCGG AGGAACUACUG-3′ [x4] Crystallographic Modeled (b) 5′ (e) C C G A 5′ C C C CGG AG A Pairings with neigh- G G C boring nanocorners G G ′ ′ GU C C G3 3 AU 3′ A U CC G G U C C G C 3′UCCG A A CC G G A G G U 5′CCGG C 5′ A A C (c) (f) Rosetta loop model (5 nucleotides) Sr2+ (d) (g) Cobalt hexammine3+ Mg2+ Rosetta model (outer strand) Current Opinion in Structural Biology A square illustrates RNA design. (a) Sequences (inner and outer) determined ‘by hand’ by Hermann group [2 ]; four copies of the two sequences form the square. (b) Multi-strand secondary structure involves each inner and outer strand forming a nanocorner, and four nanocorners pairing through three-nucleotide sticky ends. (c) Inspiration for the nanocorner, a 5-nt bulge that forms a 90 8C bend in the Hepatitis C virus internal ribosomal entry site (crystallized in PDB ID 2PN4). (d) Crystallographic analysis for full RNA square (PDB ID 3P59). (e) Secondary structure predictions for square design are inaccurate (NUPACK models shown [26]). (f) The ab initio modeling problem of rebuilding the nanocorner’s 5-nt bulge — even given the rest of the coordinates — is not solvable at atomic resolution. (g) An RNA-Puzzle [70 ]: blind prediction of the nanosquare conformation by Rosetta methods is not atomically accurate, even when given the inner strand coordinates as a constraint. and arguably amongst the most predictive theories avail- such as three-way junctions [7–13]. Given such energetic able in biophysics. Several decades of melt experiments models, dynamic programming algorithms implemented on thousands of RNA sequences have been distilled into in packages such as mfold/UNAfold [14], RNAstructure models that parameterize canonical base pair formation [15], and ViennaRNA [16] permit the comprehensive into two dozen ‘nearest-neighbor’ parameters, where the statistical mechanical description of RNA secondary thermodynamic stability of a given base pair depends on structure ensembles for arbitrary sequences (Figure 2b) adjacent base pairs and temperature [6,7]. Further mod- with the ability to recover 70% of phylogenetically eling and measurements have provided approximate determined base pairs [7]. Modeling methods for second- energetic rules (Figure 2a) for many hairpin loops, base ary structure formation kinetics are also under exploration pair mismatches, and more complex inter-helical motifs in packages such as Kinefold [17]. Current Opinion in Structural Biology 2012, 22:1–10 www.sciencedirect.com Please cite this article in press as: Bida JP, Das R. Squaring theory with practice in RNA design, Curr Opin Struct Biol (2012), http://dx.doi.org/10.1016/j.sbi.2012.06.003 COSTBI-1009; NO. OF PAGES 10 Squaring theory with practice in RNA design Bida and Das 3 Figure 2 (a) (b) GUGCA G A A A C +5.7 kcal/mol G Traceback A G A A A G Minimum free G C –2.10 kcal/mol A energy structure or A U –2.40 kcal/mol A A base pair G C probabilities G C U ΔG = +1.2 kcal/mol C (c) Hierarchical Substructure Sequence Global Sequence Target Structure Decomposition Optimization Optimization (d) C U U G C U C U C U G C C U U G U G U G A U G G C G C G C U A G C A A A C G A U A U A A U A A U A C G C G C G C G U A A A A AC GA U A A A U A U A U A U U A U A C G A A U A U A A C G C G C G C G C G C G C G C G C G C G C G A A U A U A U A U A U A C G C G C G A G A G A G 5′ 3′ 5′ 3′ 5′ 3′ 5′ 3′ 5′ 3′ 5′ 3′ -3.0 -4.4 -4.6 -5.2 -5.8 -6.9 kcal/mol No translation Translation Ribosome binding Site Ribosome binding Site 17 °C 37 °C Metastable Hairpins U C U (e) U C AC UC (f) C C U A A U A G U G C G Initiators U AC U A 5′GACCCUAAGCAUACAUCGUCCUUC3′ A U G C C G G C A U G C U A A U A U U A U A H1 C G C G H2 G C G C A U U A A U A U U A U A C G G C C G U A C G A U A U G 3′ G C C mRNA target 5′ U A A G U G G A G A A G A 5′ G Fluorescent in situ U C hybridization chain 3′ reaction H2 H2 H2 H1 H1 Tethered Fluorescent H2 H2 H2 Amplification Polymers H1 H1 H1 H2 H2 H2 H1 H1 H1 Current Opinion in Structural Biology Theory and practice in RNA secondary structure design.
Load more

Recommended publications
  • Chapter 23 Nucleic Acids
    7-9/99 Neuman Chapter 23 Chapter 23 Nucleic Acids from Organic Chemistry by Robert C. Neuman, Jr. Professor of Chemistry, emeritus University of California, Riverside [email protected] <http://web.chem.ucsb.edu/~neuman/orgchembyneuman/> Chapter Outline of the Book ************************************************************************************** I. Foundations 1. Organic Molecules and Chemical Bonding 2. Alkanes and Cycloalkanes 3. Haloalkanes, Alcohols, Ethers, and Amines 4. Stereochemistry 5. Organic Spectrometry II. Reactions, Mechanisms, Multiple Bonds 6. Organic Reactions *(Not yet Posted) 7. Reactions of Haloalkanes, Alcohols, and Amines. Nucleophilic Substitution 8. Alkenes and Alkynes 9. Formation of Alkenes and Alkynes. Elimination Reactions 10. Alkenes and Alkynes. Addition Reactions 11. Free Radical Addition and Substitution Reactions III. Conjugation, Electronic Effects, Carbonyl Groups 12. Conjugated and Aromatic Molecules 13. Carbonyl Compounds. Ketones, Aldehydes, and Carboxylic Acids 14. Substituent Effects 15. Carbonyl Compounds. Esters, Amides, and Related Molecules IV. Carbonyl and Pericyclic Reactions and Mechanisms 16. Carbonyl Compounds. Addition and Substitution Reactions 17. Oxidation and Reduction Reactions 18. Reactions of Enolate Ions and Enols 19. Cyclization and Pericyclic Reactions *(Not yet Posted) V. Bioorganic Compounds 20. Carbohydrates 21. Lipids 22. Peptides, Proteins, and α−Amino Acids 23. Nucleic Acids **************************************************************************************
    [Show full text]
  • An O(N5) Algorithm for MFE Prediction of Kissing Hairpins and 4-Chains in Nucleic Acids
    JOURNAL OF COMPUTATIONAL BIOLOGY Volume 16, Number 6, 2009 # Mary Ann Liebert, Inc. Pp. 803–815 DOI: 10.1089/cmb.2008.0219 An O(n5) Algorithm for MFE Prediction of Kissing Hairpins and 4-Chains in Nucleic Acids HO-LIN CHEN,1 ANNE CONDON,2 and HOSNA JABBARI2 ABSTRACT Efficient methods for prediction of minimum free energy (MFE) nucleic secondary struc- tures are widely used, both to better understand structure and function of biological RNAs and to design novel nano-structures. Here, we present a new algorithm for MFE secondary structure prediction, which significantly expands the class of structures that can be handled in O(n5) time. Our algorithm can handle H-type pseudoknotted structures, kissing hairpins, and chains of four overlapping stems, as well as nested substructures of these types. Key words: kissing hairpins, pseudoknot, RNA, secondary structure prediction. 1. INTRODUCTION ur knowledge of the amazing variety of functions played by RNA molecules in the cell Ocontinues to expand, with the functions determined in part by structure (Lee et al., 1997). Additionally, DNA and RNA sequences are designed to form novel structures for a wide range of applications, such as algorithmic DNA self-assembly (He et al., 2008; Rothemund et al., 2004), detection of low concentrations of other molecules of interest (Dirks and Pierce, 2004) or to exhibit motion (Simmel and Dittmer, 2005). In order to improve our ability to determine function from DNA or RNA sequences, and also to aid in the design of nucleic acids with novel structural or functional properties, accurate and efficient methods for predicting nucleic acid structure are very valuable.
    [Show full text]
  • Nucleotides and Nucleic Acids
    Nucleotides and Nucleic Acids Energy Currency in Metabolic Transactions Essential Chemical Links in Response of Cells to Hormones and Extracellular Stimuli Nucleotides Structural Component Some Enzyme Cofactors and Metabolic Intermediate Constituents of Nucleic Acids: DNA & RNA Basics about Nucleotides 1. Term Gene: A segment of a DNA molecule that contains the information required for the synthesis of a functional biological product, whether protein or RNA, is referred to as a gene. Nucleotides: Nucleotides have three characteristic components: (1) a nitrogenous (nitrogen-containing) base, (2) a pentose, and (3) a phosphate. The molecule without the phosphate groups is called a nucleoside. Oligonucleotide: A short nucleic acid is referred to as an oligonucleotide, usually contains 50 or fewer nucleotides. Polynucleotide: Polymers containing more than 50 nucleotides is usually referred to as polynucleotide. General structure of nucleotide, including a phosphate group, a pentose and a base unit (either Purine or Pyrimidine). Major purine and Pyrimidine bases of nucleic acid The roles of RNA and DNA DNA: a) Biological Information Storage, b) Biological Information Transmission RNA: a) Structural components of ribosomes and carry out the synthesis of proteins (Ribosomal RNAs: rRNA); b) Intermediaries, carry genetic information from gene to ribosomes (Messenger RNAs: mRNA); c) Adapter molecules that translate the information in mRNA to proteins (Transfer RNAs: tRNA); and a variety of RNAs with other special functions. 1 Both DNA and RNA contain two major purine bases, adenine (A) and guanine (G), and two major pyrimidines. In both DNA and RNA, one of the Pyrimidine is cytosine (C), but the second major pyrimidine is thymine (T) in DNA and uracil (U) in RNA.
    [Show full text]
  • The Structure and Function of Large Biological Molecules 5
    The Structure and Function of Large Biological Molecules 5 Figure 5.1 Why is the structure of a protein important for its function? KEY CONCEPTS The Molecules of Life Given the rich complexity of life on Earth, it might surprise you that the most 5.1 Macromolecules are polymers, built from monomers important large molecules found in all living things—from bacteria to elephants— can be sorted into just four main classes: carbohydrates, lipids, proteins, and nucleic 5.2 Carbohydrates serve as fuel acids. On the molecular scale, members of three of these classes—carbohydrates, and building material proteins, and nucleic acids—are huge and are therefore called macromolecules. 5.3 Lipids are a diverse group of For example, a protein may consist of thousands of atoms that form a molecular hydrophobic molecules colossus with a mass well over 100,000 daltons. Considering the size and complexity 5.4 Proteins include a diversity of of macromolecules, it is noteworthy that biochemists have determined the detailed structures, resulting in a wide structure of so many of them. The image in Figure 5.1 is a molecular model of a range of functions protein called alcohol dehydrogenase, which breaks down alcohol in the body. 5.5 Nucleic acids store, transmit, The architecture of a large biological molecule plays an essential role in its and help express hereditary function. Like water and simple organic molecules, large biological molecules information exhibit unique emergent properties arising from the orderly arrangement of their 5.6 Genomics and proteomics have atoms. In this chapter, we’ll first consider how macromolecules are built.
    [Show full text]
  • Chapter 22. Nucleic Acids
    Chapter 22. Nucleic Acids 22.1 Types of Nucleic Acids 22.2 Nucleotides: Building Blocks of Nucleic Acids 22.3 Primary Nucleic Acid Structure 22.4 The DNA Double Helix 22.5 Replication of DNA Molecules 22.6 Overview of Protein Synthesis 22.7 Ribonucleic Acids Chemistry at a Glance: DNA Replication 22.8 Transcription: RNA Synthesis 22.9 The Genetic Code 22.10 Anticodons and tRNA Molecules 22.11 Translation: Protein Synthesis 22.12 Mutations Chemistry at a Glance: Protein Synthesis 22.13 Nucleic Acids and Viruses 22.14 Recombinant DNA and Genetic Engineering 22.15 The Polymerase Chain Reaction 22.16 DNA Sequencing Students should be able to: 1. Relate DNA to genes and chromosomes. 2. Describe the structure of a molecule of DNA including the base-pairing pattern. 3. Describe the structure of a nucleotide of RNA. 4. Describe the structure of a molecule of RNA. 5. Describe the three kinds of RNA and construct a pictorial representation. 6. Summarize the physiology of DNA in terms of replication and protein synthesis. 7. List the sequence of events in DNA replication and explain why it is referred to as semiconservative. 8. Evaluate the process of transcription. 9. Evaluate the process of translation. 10. Given a DNA coding strand and the genetic code , determine the complementary messenger RNA strand, the codons that would be involved in peptide formation from the messenger RNA sequence, and the amino acid sequence that would be translated. 11. Define mutation. 12. Differentiate between base substitutions and base insertions and/or deletions. 13. Discuss sickle-cell anemia.
    [Show full text]
  • De Novo Nucleic Acids: a Review of Synthetic Alternatives to DNA and RNA That Could Act As † Bio-Information Storage Molecules
    life Review De Novo Nucleic Acids: A Review of Synthetic Alternatives to DNA and RNA That Could Act as y Bio-Information Storage Molecules Kevin G Devine 1 and Sohan Jheeta 2,* 1 School of Human Sciences, London Metropolitan University, 166-220 Holloway Rd, London N7 8BD, UK; [email protected] 2 Network of Researchers on the Chemical Evolution of Life (NoR CEL), Leeds LS7 3RB, UK * Correspondence: [email protected] This paper is dedicated to Professor Colin B Reese, Daniell Professor of Chemistry, Kings College London, y on the occasion of his 90th Birthday. Received: 17 November 2020; Accepted: 9 December 2020; Published: 11 December 2020 Abstract: Modern terran life uses several essential biopolymers like nucleic acids, proteins and polysaccharides. The nucleic acids, DNA and RNA are arguably life’s most important, acting as the stores and translators of genetic information contained in their base sequences, which ultimately manifest themselves in the amino acid sequences of proteins. But just what is it about their structures; an aromatic heterocyclic base appended to a (five-atom ring) sugar-phosphate backbone that enables them to carry out these functions with such high fidelity? In the past three decades, leading chemists have created in their laboratories synthetic analogues of nucleic acids which differ from their natural counterparts in three key areas as follows: (a) replacement of the phosphate moiety with an uncharged analogue, (b) replacement of the pentose sugars ribose and deoxyribose with alternative acyclic, pentose and hexose derivatives and, finally, (c) replacement of the two heterocyclic base pairs adenine/thymine and guanine/cytosine with non-standard analogues that obey the Watson–Crick pairing rules.
    [Show full text]
  • Structural Aspects of Nucleic Acid Analogs and Antisense Oligonucleotides
    REVIEWS Structural Aspects of Nucleic Acid Analogs and Antisense Oligonucleotides Martin Egli" Hybridization of complementary launch an extensive search for oligonu- tions at selected sites in quantities suit- oligonucleotides is essential to highly cleotide analogs with improved binding able for three-dimensional structure in- valuable research tools in many fields properties for hybridization with RNA vestigations. Such studies should reveal including genetics, molecular biology, and higher resistance toward nuclease the structural origins of the observed and cell biology. For example, an anti- degradation. During the last years this changes in affinity and specificity of sense molecule for a particular segment research has resulted in a flurry of new binding for particular modifications and of sense messenger RNA allows gene ex- chemical analogs of DNA and RNA may guide the development of second- pression to be selectively turned off, and with modifications in the sugar-phos- and third-generation antisense mole- the polymerase chain reaction requires phate backbone as well as in the nucleo- cules. In addition, the availability of a complementary primers in order to pro- base sites. However, to date little effort previously unimaginable variety of ceed. It is hoped that the antisense ap- has been directed toward uncovering the modified building blocks and the inves- proach may lead to therapeutics for exact origins of the gain or loss in stabil- tigation of their structures provides the treatment of various diseases including ity when nucleic acid analogs bind to basis for a deeper understanding of the cancer. Areas of active research in the RNA. Although large amounts of native DNA and RNA structures.
    [Show full text]
  • The Structure and Function of Nucleic Acids Revised Edition
    The Structure and Function of Nucleic Acids Revised edition C.F.A. Bryce* and D. Pacini† *Department of Biological Sciences, Napier University, Edinburgh, and †Bolton School Boy’s Division, Bolton The Biochemistry Across the School Curriculum Group (BASC) was set up by the Biochemical Society in 1985. Its membership includes edu- cation professionals as well as Society members with an interest in school science education. Its first task has been to produce this series of booklets, designed to help teachers of syllabuses which have a high bio- chemical content. Other topics covered by this series include: Essential Chemistry for Biochemistry; Enzymes and their Role in Biotechnology; Metabolism; Immunology; Photosynthesis; Recombinant DNA Technology; Biological Membranes; and The Biochemical Basis of Disease. More information on the work of BASC and these booklets is available from the Education Officer at the Biochemical Society, 59 Portland Place, London W1N 3AJ. Comments on the content of this booklet will be welcomed by the Series Editor Mrs D. Gull at the above address. ISBN 0 90449 834 4 © The Biochemical Society 1998 First edition published 1991 All BASC material is copyright by the Biochemical Society. Extracts may be photocopied for classroom work, but complete reproduction of the entire text or incorporation of any of the material with other doc- uments or coursework requires approval by the Biochemical Society. Printed by Holbrooks Printers Ltd, Portsmouth, U.K. Contents Foreword................................................................................v
    [Show full text]
  • Nucleotides and Nucleic Acids
    Nucleotides and Nucleic Acids gene = chromosomal segment that codes for a functional polypeptide chain or RNA molecule 1. Composition of Nucleic Acids (RNA --> N base + 5 C ribose sugar + Pi) (DNA --> N base + 5 C deoxyribose sugar + Pi) - Nucleotides as building blocks: Nucleotide = N base + ribose sugar + phosphate ribonucleotides (RNAs ; ribose sugar) deoxyribonucleotides (DNA ; deoxyribose sugar) 2. N bases (Pyrimidines and Purines) / tautomeric forms (know structures) - Pyrimidines : U = uracil ; T = Thymine ; C = Cytosine - Purines : A = Adenine ; G = Guanine 3. Nucleosides (deoxynucleosides) - N base + ribose sugar ( or deoxyribose sugar ) − β-N-glycosidic bonds (C1’ to N1 of pyrimidine or N9 of purine) - Nomenclature : Adenosine / deoxyadenosine (dA) Guanosine Uridine Thymidine Cytidine - Conformations of nucleosides - syn / anti - Other nucleosides : AZT (3’-azido-2’,3’-dideoxythymidine) 4. Nucleotides (deoxynucleotides) - Nucleotides = nucleoside + 5’ phosphates - AMP / ADP (ppA) / ATP (pppA) - Other nucleotides : dideoxynucleotides (DNA ladder sequencing) 5. Roles of Nucleotides - Building blocks of Nucleic Acids ( --> RNA ; --> DNA) - 3’,5’ phosphodiester bonds (direction to sugar-phosphate backbone) - Nucleotide Derivatives used in Metabolic Cosubstrates - Glycogen synthesis : UDP-Glucose (hemiacetal phos.) - Lipid biosynthesis : CDP-ethanolamine / CDP-choline - Energy currency : ATP/ADP; GTP/GDP - Nucleotides as Regulatory Molecules: cAMP / G proteins 6. Nucleic Acids - Primary Structure: - polymers: two types: DNA = deoxyribonucleic
    [Show full text]
  • A Suite of RNA Secondary Structure Prediction and Design Software Tools
    3416–3422 Nucleic Acids Research, 2003, Vol. 31, No. 13 DOI: 10.1093/nar/gkg612 RNAsoft: a suite of RNA secondary structure prediction and design software tools Mirela Andronescu, Rosalı´a Aguirre-Herna´ndez, Anne Condon* and Holger H. Hoos Department of Computer Science, University of British Columbia, Vancouver, BC V6T 1Z4, Canada Received February 15, 2003; Revised and Accepted April 7, 2003 Downloaded from https://academic.oup.com/nar/article/31/13/3416/2904234 by guest on 01 October 2021 ABSTRACT RNA Designer designs an RNA sequence that folds to a given input secondary structure. The tool is intended for DNA and RNA strands are employed in novel ways in designers of RNA molecules with particular structural or the construction of nanostructures, as molecular functional properties. tags in libraries of polymers and in therapeutics. New software tools for prediction and design of molecular The RNAsoft web site, at http://www.RNAsoft.ca, provides structure will be needed in these applications. The online access to all three tools. Following a brief overview of RNAsoft suite of programs provides tools for pre- RNA secondary structure modeling and representation, we dicting the secondary structure of a pair of DNA or describe the function and output of each of the online services. RNA molecules, testing that combinatorial tag sets of All tools are based on a standard free energy model (1), DNA and RNA molecules have no unwanted second- which provides a measure of thermodynamic stability for ary structure and designing RNA strands that fold to possible secondary structures that a molecule or molecules a given input secondary structure.
    [Show full text]
  • Branched Kissing Loops for the Construction of Diverse RNA Homooligomeric 2 Nanostructures 3 Di Liu1, Cody W
    1 Branched kissing loops for the construction of diverse RNA homooligomeric 2 nanostructures 3 Di Liu1, Cody W. Geary2,3, Gang Chen1, Yaming Shao4, Mo Li5, Chengde Mao5, Ebbe S. Andersen2, Joseph A. Piccirilli1,4, 4 Paul W. K. Rothemund3, Yossi Weizmann1,* 5 1Department of Chemistry, the University of Chicago, Chicago, Illinois 60637, USA 6 2Interdisciplinary Nanoscience Center and Department of Molecular Biology and Genetics, Aarhus University, 8000 Aarhus, Denmark 7 3Bioengineering, Computational + Mathematical Sciences, and Computation & Neural Systems, California Institute of Technology, 8 Pasadena, CA 91125, USA 9 4Department of Biochemistry and Molecular Biology, the University of Chicago, Chicago, Illinois 60637, USA 10 5Department of Chemistry, Purdue University, West Lafayette, IN 47907, USA 11 *Correspondence to: [email protected] (Y. W.) 12 13 Summary figure 14 15 16 17 This study presents a robust homooligomeric self-assembly system based on RNA and DNA tiles that are 18 folded from a single-strand of nucleic acid and assemble via a novel artificially designed branched 19 kissing-loops (bKL) motif. By adjusting the geometry of individual tiles, we have constructed a total of 16 20 different structures that demonstrate our control over the curvature, torsion, and number of helices of 21 assembled structures. Furthermore, bKL-based tiles can be assembled cotranscriptionally, and can be 22 expressed in living bacterial cells. 23 24 Branched kissing loops for the construction of diverse RNA homooligomeric 25 nanostructures
    [Show full text]
  • Success and Challenge in Modeling Nucleic Acid Structure and Dynamics
    Success and challenge in modeling nucleic acid structure and dynamics …beware of too much sampling? Thomas E. Cheatham III [email protected] Professor, Dept. of Medicinal Chem., College of Pharmacy Director, Research Computing and CHPC, University Information Technology, University of Utah Ultimate goal: Use simulation to model RNA folding and ligand-induced conformational exchange / capture This requires: Accurate and fast simulation methods Validated RNA, protein, water, ion, and ligand “force fields” “good” high-resolution experiments to assess results dynamics and complete sampling: (convergence, reproducibility) Question: Is the movement real or artifact? assessment & validation ? are the force fields reliable? (free energetics, sampling, dynamics) Short simulations stay near experimental structure; longer simulations invariably move away and often to unrealistic lower energy structures… Computer power? experimental J energy energy vs. “reaction coordinate” are the force fields reliable? (free energetics, sampling, dynamics) Computer power? What we typically experimental J found if we ran long enough… energy energy “reaction coordinate” Updated nucleic acid force fields: α,γ (γ=trans): parmbsc0 RNA ladder, Χ: ΧOL (ff11, ff12) or ΧYildirim or Chen/Garcia or bb/OPC DNA ε/ζ: ε/ζ 2013 and/or ΧOL4 or parmbsc1 or CHARMM36 We can fully sample conformational ensembles! (helices, tetranucleotides, RNA hairpins, …) brute force – long contiguous in time MD requires: special purpose / unique hardware D.E. Shaw’s Anton machine, 16 µs/day or AMBER on GPUs ensembles of independent fs ps ns simulations (replica-exchange) > 200 ns/day! What did we learn? - Ensembles of independent simulations show similar convergence properties with respect to the structure and dynamics of the internal part of a DNA helix - Independent simulations (on special purpose hardware or GPUs or CPUs) give reproducible results What are implications for DNA recognition? - See: Nature Comm.
    [Show full text]