RNA Kissing-Loop Interactions Supported by Bifacial Peptide Nucleic Acid

Home , Albert Eschenmoser, Biomolecular structure, Glycol nucleic acid, Nucleic acid design, Nucleic acid structure, Peptide nucleic acid

RNA kissing-loop interactions supported by bifacial peptide nucleic acid

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Christopher Amedeo DeSantis

Graduate Program in Chemistry

The Ohio State University

2017

Dissertation Committee:

Professor Dennis Bong, Advisor

Professor Venkat Gopalan

Professor Jovica Badjic

Copyrighted by

Christopher Amedeo DeSantis

2017

Abstract

The dissertation to follow is an account of research efforts to utilize bifacial peptide nucleic acids (bPNA) triplexes to support kissing-loop complexes. A kissing-loop complex is composed of two nucleic acid stem-loops hybridized via Watson-Crick base pairing between their loop regions. For our studies, we employed two kissing-loop complexes in which a bPNA binding site, composed of ten sequential U-U mismatches, was inserted into the duplex stem of the interacting hairpins. The first system was a tRNA in which the anticodon stem was mutated with a 10-mer bPNA binding site and the loop region extended to nine nucleotides to facilitate a six-nucleotide loop-loop duplex during heterodimerization with a complementary tRNA mutant. The second system, based on the

ColE1 plasmid replication control kissing-loop complex, involves two small hairpins which, after kissing complex formation, bind the protein Rop. The hairpins (RNAI-1 and

RNAII-1) were mutated with a 10-mer bPNA binding site and have complementary seven- nucleotide loops.

In the first part if this work, kissing-loop and Rop complex formation was analyzed in titration binding assays and native gel electrophoresis. tRNA duplex-triplex kissing complexes show a 5-fold decrease in affinity while omission of bPNA decreases affinity by a further 3-fold. Triplex-triplex tRNA mutant binding is 9-fold weaker compared to duplex kissing-loops and also show greater instability when bPNA is omitted. Triplex- duplex mutants in the ColE1 system show similar affinity to the wild type system with Rop ii present. Triplex-triplex kissing-loops bind 4-fold tighter than the wildtype system without the aid of Rop. Furthermore, Rop is able to bind to duplex-triplex and triplex-triplex kissing-loops; the first time a bPNA triplex has been installed at a protein-nucleic acid binding site without abolishing binding.

In the latter part of this work, fluorescently-labeled bPNA were used to monitor kissing-loop formation in vitro. Triplex-triplex kissing-loop formation was monitored by

FRET using Cy3- and Cy5-labeled bPNA triplexes. Competitive displacement of the U10 mutant tRNA by duplex tRNA in the triplex-triplex kissing-loop was observed via a decreased FRET signal. In the ColE1 system, Rop-catalyzed competitive displacement of a wild type hairpin by a U10 mutant in a WT-U10 kissing complex was monitored via increased FRET signal. In a separate study, fluorescence turn-on probes to detect the presence of a hairpin were developed. The fluorogen thiazole orange was conjugated to bPNA by several designed linkers and a series of synthetic RNA probes with a nine- nucleotide loop were tested for maximum fluorescence turn-on. A peptide with a 2-(2-(2- aminoethoxy)ethoxy)acetic acid linker combined with a probe in which the 1, 2 and 9 positions of the loop was mutated with propyl linkers provided 2.3-fold turn-on effect.

In summary, we have shown that hairpins mutated with a bPNA triplex in the stem region are able to form kissing-loop complexes. Furthermore, proteins which interact with kissing-loops are still able to bind complexes with the triplex mutation. Using fluorescently labeled bPNA, we have proposed new technology to site selectively label and monitor RNA-RNA interactions.

iii

To my family.

Acknowledgments

First and foremost, I would like to thank my family. They were a constant source of support and love when I needed it most throughout this experience. Their sacrifices made moving all the way to Ohio for school possible and endurable. Their visits provided a welcomed reprieve and delicious Italian treats while reminding me what was most important in life. I love you Laura, Claudia, Mom, and Dad.

Secondly, I would like to thank my friends Kendra Dewese, Laura Dzugan,

Amanda Natter, Mike Davala, Johnny Wysocki, Dan Dilts, Emma Wei, and Nao Oda for reminding me to have fun. Their encouragement meant the world to me and lightened my heart on the toughest of days. Here is to many more home cooked meals together.

I owe a debt of gratitude to Dr. Dennis Bong for the years of support as my advisor.

Your constant encouragement and problem-solving discussions helped me when the projects stalled and progress looked bleak. By working in your group, I have become a better scientist and for this I thank you.

I would also like to thank Jie Mao. My constant companion throughout grad school who was always ready with a friendly smile and encouraging words. My teachers, Xijun

Piao, Xin Xia, and Zhun Zhou for putting up with my incessant questions and teaching me a myriad of lab skills. I would also like to thank the other lab group members for their helpful discussions. Finally, I would like to thank Dr. Gopalan and Dr. Badjic.

Vita

2007...... Hamilton High School East

2011...... B.A. Chemistry, Rutgers, the State

University of New Jersey

2011 to present ...... Graduate Research Associate, The Ohio

State University

Publications

Mao, J., DeSantis, C., and Bong, D.* (2017) “Small molecule recognition triggers secondary and tertiary interactions in DNA folding and hammerhead ribozyme catalysis.” J. Am. Chem. Soc., DOI: 10.1021/jacs.7b05448

Fields of Study

Major Field: Chemistry

Table of Contents

Abstract ...... ii

Acknowledgments...... v

Vita ...... vi

Publications ...... vi

Fields of Study ...... vi

Table of Contents ...... vii

List of Tables ...... xii

List of Figures ...... xiii

Chapter 1: Structure of nucleic acids and their mimics ...... 1

1.1.1 SECONDARY STRUCTURES OF NUCLEIC ACIDS: bulges and loops...... 6

1.1.2 SECONDARY STRUCTURES OF NUCLEIC ACIDS: junctions ...... 8

1.1.3 SECONDARY STRUCTURES OF NUCLEIC ACIDS: G-quadruplex ...... 9

1.2 COMPONENTS OF TERTIARY STRUCTURE OF NUCLEIC ACIDS ...... 9

1.2.1 TERTIARY STRUCTURE OF NUCLEIC ACIDS: coaxial stacking...... 10

vii

1.2.2 COMPONENTS OF TERTIARY STRUCTURE OF NUCLEIC ACIDS:

kissing-loops and pseudoknots ...... 11

1.2.3 COMPONENTS OF TERTIARY STRUCTURE OF NUCLEIC ACIDS: base

triples...... 12

1.2.4 COMPONENTS OF TERTIARY STRUCTURE OF NUCLEIC ACIDS:

tetraloops ...... 13

1.2.5 COMPONENTS OF TERTIARY STRUCTURE OF NUCLEIC ACIDS:

triplexes...... 14

1.3 MODIFICATIONS TO NUCLEIC ACIDS ...... 16

1.3.1 MODIFICATIONS TO NUCLEIC ACIDS: natural modifications ...... 17

1.3.2 MODIFICATIONS TO NUCLEIC ACIDS: metal-coordinating bps...... 18

1.3.3 MODIFICATIONS TO NUCLEIC ACIDS: hydrogen bonding attenuation. . 19

1.3.4 MODIFICATIONS TO NUCLEIC ACIDS: triplex promoting modifications.

...... 20

1.3.5 MODIFICATIONS TO NUCLEIC ACIDS: triplex formation via Janus

wedge...... 21

1.4 MODIFICATIONS TO NUCLEIC ACID BACKBONES...... 23

1.4.1 MODIFICATIONS TO NUCLEIC ACID BACKBONES: phosphodiester

modifications...... 23

viii

1.4.2 MODIFICATIONS TO NUCLEIC ACID BACKBONES: ribose

modifications...... 25

1.4.3 MODIFICATIONS TO NUCLEIC ACID BACKBONES: addressing

backbone charge repulsion...... 26

1.4.4 MODIFICATIONS TO NUCLEIC ACID BACKBONES: ribose substitutes.

...... 27

1.5 PEPTIDE NUCLEIC ACIDS...... 29

1.5.1 PEPTIDE NUCLEIC ACIDS: incorporation of Janus wedge motifs...... 32

1.5.2 PEPTIDE NUCLEIC ACIDS: native peptide backbone...... 33

1.5.3 BIFACIAL PEPTIDE NUCLEIC ACIDS (bPNA) ...... 35

REFERENCES FOR CHAPTER 1 ...... 39

Chapter 2: bPNA promoted kissing-loops ...... 71

2.1 INTRODUCTION TO KISSING-LOOPS: ...... 71

2.1.1 HIV-1 DIMERIZATION INITIATION SITE: ...... 78

2.1.2 ColE1 KISSING COMPLEX: ...... 82

2.2 HIV-DIS: EXPERIMENTAL DESIGNS AND RESULTS ...... 87

2.3 ColE1 KISSING COMPLEX: EXPERIMENTAL DESIGNS AND RESULTS .. 96

2.4 DISCUSSION AND CONCLUSIONS: ...... 105

2.5 SUPPORTING INFORMATION CHAPTER 2 ...... 110

2.5.1 Materials and instrumentation ...... 110

2.5.2 Methods and Procedures...... 114

2.5.3 Synthetic Procedures and compound characterization...... 118

2.5.4 tRNA mutant EMSA gel results and dissociation constant determination: .... 126

2.5.5 ColE1 mutant EMSA gel results and dissociation constant determination: ... 134

2.6 REFERENCES CHAPTER 2 ...... 142

Chapter 3: Directed Chemistry with bPNA ...... 157

3.1 INTRODUCTION TO FLUORESCENTLY LABELING RNA: ...... 157

3.2 bPNA AS A FRET BASED PROBE: EXPERIMENTAL DESIGN AND

RESULTS: ...... 167

3.3 bPNA-THIAZOLE ORANGE CONJUGATES AS TURN ON PROBES: ...... 174

3.3.1 EXPERIMENTAL DESIGN AND RESULTS: ...... 174

3.3.2 DISCUSSION AND CONCLUSIONS: ...... 181

3.4 SUPPORTING INFORMATION CHAPTER 3 ...... 183

3.4.1 Materials and instrumentation: ...... 183

3.4.2 Fluorescence experiments procedure: ...... 184

3.4.3 EMSA gels of probes with targets...... 187

3.4.4 Synthetic Procedures and compound characterization...... 188

3.5 REFERENCES CHAPTER 3 ...... 201

Complete Reference list ...... 214

CHAPTER 1 REFERENCES: ...... 214

CHAPTER 2 REFERENCES: ...... 245

CHAPTER 3 REFERENCES: ...... 259

List of Tables

Table 1: Heterodimers in initial HIV-DIS system...... 91

Table 2: RNA and DNA templates for kissing-loop forming nucleic acids...... 111

Table 3: DNA templates for HIV-DIS mutants ...... 112

Table 4: DNA templates for tri-stem-loop ColE1 mutants ...... 113

Table 5: Turn-on factor of hybridized TO-bPNA conjugates and 9-membered loop probes...... 179

Table 6: Turn-on factor of hybridized TO-bPNA conjugates and 7-membered loop probes...... 180

xii

List of Figures

Figure 1: Canonical nucleosides and bps...... 2

Figure 2: Duplex structure of nucleic acids...... 3

Figure 3: Alternative base pairings...... 5

Figure 4: Hairpin and bulge structure...... 7

Figure 5: Structure three and four-way junctions...... 8

Figure 6: G-quadruplex structure...... 9

Figure 7: General structure of a kissing-loop and pseudoknot ...... 12

Figure 8: Base triples...... 13

Figure 9: Structures of tetraloops and receptors...... 14

Figure 10: Triplex- forming nucleic acids...... 16

Figure 11: Examples of metal-mediated bps and triples...... 18

Figure 12: Examples of triplex promoting nucleic acids...... 21

Figure 13: Janus wedge triplex forming motifs...... 22

Figure 14: Examples of phosphoramidates and phosphorothioate...... 24

Figure 15: Examples of locked and unlocked nucleic acids...... 26

Figure 16: Example of nucleobase modifications which introduce charge...... 27

Figure 17: Examples of ribose substitutes...... 28

Figure 18: Structure of PNA based on protein backbone...... 30

xiii

Figure 19: Mechanism of PNA strand invasion of duplex nucleic acids...... 31

Figure 20: Examples of Janus wedge motifs used in PNA...... 33

Figure 21: Native peptide backbone PNA with triazine ring recognition moiety...... 34

Figure 22: Structure of bPNA...... 36

Figure 23: bPNA as an allosteric switch...... 37

Figure 24: Structure of hairpins and kissing-loops...... 72

Figure 25: Intramolecular loop-loops interactions of Neurospora Varkud satellite ribozyme and tRNA...... 73

Figure 26: Cis-encoded antisense RNAs and their targets...... 76

Figure 27: DIS in the 5ˈ leader of the HIV genome...... 78

Figure 28: Crystal and NMR structure of DIS dimer...... 81

Figure 29: Plasmid copy number control mechanism of the ColE1 plasmid...... 82

Figure 30: Structure of Rop as dimer in solution...... 84

Figure 31: Solution structure ColE1 kissing-loop...... 85

Figure 32: Proposed experiment with mutated HIV-DIS hairpins...... 87

Figure 33: Initial design of HIV-DIS mutants...... 89

Figure 34: Dimerization of initial HIV-DIS system...... 90

Figure 35: Structures kissing-loop competent tRNA mutants...... 92

Figure 36: Heterodimerization of tRNA mutants...... 94

Figure 37: Dissociation constants of tRNA mutants...... 95

Figure 38: Initial designs of ColE1 kissing complex mutants...... 96

Figure 39: Heterodimerization of ColE1 mutants...... 98

xiv

Figure 40: Design of ColE1 stem loop 1 mutants...... 99

Figure 41: Dimerization of stem-loop 1 mutants of ColE1...... 100

Figure 42: Complexation of RNAI-1U10 and RNAII-1U10 with Rop...... 100

Figure 43: Dissociation constant of RNAII-1U10 and RNAI-1WT...... 102

Figure 44: Dissociation constants of ColE1 mutants...... 103

Figure 45: Proton NMR of compound 1...... 119

Figure 46: Proton NMR of Cy3...... 120

Figure 47: Proton NMR of Cy5...... 122

Figure 48: HPLC trace and MALDI-TOF of Cy5-(EM)10...... 124

Figure 49: HPLC trace and MALDI-TOF of Cy3-(EM)10...... 125

Figure 50: Negative control for non-specific dimerization of HD1U10 and HD1Nat. . 126

Figure 51: Negative control for non-specific dimerization of HD2U10 and HD2Nat. . 126

Figure 52: Mg2+ dependence of HD1U10-bPNA triplex and HD2Nat complexation. .. 127

Figure 53: Mg2+ dependence of HD1U10-bPNA triplex and HD2U10-bPNA triplex complexation...... 127

Figure 54: Kd determination of HD1Nat and HD2U10-bPNA triplex...... 128

Figure 55: Kd determination of HD1U10-EM10 and HD2U10-EM10...... 129

Figure 56: Kd determination of HD1Nat and HD2Nat...... 130

Figure 57: Kd determination of HD1Nat and unstructured HD2U10...... 131

Figure 58: Kd determination unstructured HD1U10 and unstructured HD2U10...... 132

Figure 59: Kd determination unstructured HD1U10 probe and unstructured HD2U10 probe ...... 133

Figure 60: Control for non-specific dimerization of RNAI...... 134

Figure 61: Control for non-specific dimerization of RNAII...... 134

Figure 62: Control for Rop binding to bPNA triplex...... 134

Figure 63: Rop complex of RNAII-1U10 and RNAI-1WT...... 135

Figure 64: Kissing complex of RNAI-1U10 and RNAII-1U10 without Rop...... 136

Figure 65: Kissing complex of RNAI-1U10 and RNAII-1U10 with Rop...... 137

Figure 66: Complex formation of unstructured RNAII-1U10 and RNAI-WT with Rop.

...... 138

Figure 67: Complex formation of unstructured RNAII-1U10 and RNAI-WT without

Rop...... 139

Figure 68: Rop complex formation with preformed U10-WT kissing-loop...... 140

Figure 69: Rop complex formation with preformed U10-U10 kissing-loop...... 141

Figure 70: Fluorescent kissing-loop probes...... 167

Figure 71: Experimental design of U10-U10 kissing-loop FRET experiment...... 168

Figure 72: FRET experiments with U10 mutants...... 169

Figure 73: tRNA competition assay...... 171

Figure 74: ColE1 competition assay...... 172

Figure 75: Rop dependence on displacement in ColE1 FRET competition assay...... 174

Figure 76: Kissing-loop turn on probe design...... 176

Figure 77: TO-bPNA kissing-loop detection...... 178

Figure 78: Fluorescent controls for FRET with Cy3-bPNA and unlabeled bPNA in tRNA kissing-loop...... 186

xvi

Figure 79: Effect of kissing loop complex formation on Cy3 fluorescence in ColE1 system...... 186

Figure 80: EMSA gel of kissing complex formation with probe 4...... 187

Figure 81: EMSA gel of kissing complex formation with probe 3...... 187

Figure 82: EMSA gel of kissing complex formation with probe 2...... 187

Figure 83: EMSA gel of kissing complex formation with probe 1...... 188

Figure 84: EMSA gel of kissing complex formation with probe 6 and 7...... 188

Figure 85: Proton NMR of thiazole orange acetate...... 189

Figure 86: Attempted TO-peptides that could not be purified...... 191

Figure 87: HPLC trace and MALDI-TOF of TO-(PEG)2(ME)10G-CONH2 ...... 192

Figure 88: HPLC trace and MALDI-TOF of TO-(PEG)(ME)10G-CONH2 ...... 193

Figure 89: HPLC trace and MALDI-TOF of TO-(bAla)2(EM)10G-CONH2 ...... 194

Figure 90: HPLC trace and MALDI-TOF of TO-(bAla)(EM)10G-CONH2 ...... 195

Figure 91: HPLC trace and MALDI-TOF of TO-dP-G-(EM)10G-CONH2...... 196

Figure 92: HPLC trace and MALDI-TOF of TO-G-dP-G-(EM)10G-CONH2 ...... 197

Figure 93: HPLC trace and MALDI-TOF of TO-G-(ME)10G-CONH2 ...... 198

Figure 94: HPLC trace and MALDI-TOF of TO-(ME)10G-CONH2 ...... 199

Figure 95: HPLC trace and MALDI-TOF of TO-(bAla)3-(EM)10G-CONH2 ...... 200

xvii

Chapter 1: Structure of nucleic acids and their mimics

Through evolution, nature has developed a code describing all the components of a cell necessary for the propagation of life. The code is encompassed in a polymer, named nucleic acid or polynucleotide, composed of monomers termed nucleotides which in turn are made up of a heterocycle and a sugar. The heterocycles, called nucleobases, typically found in the polymer are adenine (A), guanine (G), cytosine (C), Thymine (T), and uracil

(U), though these aromatic compounds do not represent the only ring structures present in the code and are often heavily modified.1 The C1 position of the ribose ring is covalently bound to purines via N9 and pyrimidines via N1. The sugars are covalently bound to each other via phosphodiester bonds through the 5ˈ-hydroxy and 3ˈ-hydroxy of ribose. The backbone of the polymer is therefore alternating phosphate and ribose moieties. Nucleotide polymers with ribose are called ribonucleic acids (RNA) and nucleotide polymers with 2ˈ- deoxyribose are called deoxyribonucleic acids (DNA) (Figure 1).

The four nucleobases create the code which is read by other nucleobases in complementary polynucleotides through hydrogen bonding which anneal, or hybridize, together into duplexes. Polynucleotides hybridize in solution through an enthalpically favorable process driven by non-covalent interactions between the nucleobases.2-4 Typical stacking interactions between two nucleobases contributes about 1 kcal/mol to the free energy of hybridization.5 Through complementary hydrogen bonds and favorable base

1 stacking, complementary strands of polynucleotides can form helical duplexes.6

Hybridization relies on the specific hydrogen bonding of the nucleobases with one another and are thought to contribute a. −0.25 to −1.6 kcal/mol to the free energy of the system.7

Forming base paris (bp) like rungs in a ladder, A recognizes U/T and G recognizes C via

Watson-Crick (W-C)-type hydrogen bonding and stack on one another, though, these are

Figure 1: Canonical nucleosides and bps. A) Nucleosides which are the main monomers in nucleic acid polymers. B) Examples of Watson-Crick hydrogen bonding. Hydrogen bonding shown as dotted lines.

not the only bps possible (Figure 1). Base pairing forces the ribose-phosphate backbone into a helical structure (Figure 2). The type of helix formed by hybridized polynucleotides is dependent upon the type (RNA or DNA) and the components of the solution in which they are dissolved. DNA-DNA duplexes are most commonly in the B-form helix with 10- bps per turn and 3.32 Å rise per bp. Another possible structure is the A-form helix, common for RNA-RNA and DNA-RNA duplexes, with 11-bps per turn and 2.3 Å rise per 2 bp. Lastly, duplexes can also adopt a rarer conformation designated Z form with 3.8 Å rise per bp and 12-bases per turn. Z-form DNA is thought to arise from a dehydrated state usually associated with high concentrations of positively charged counterions and certain types of sequences (Figure 2). The type of helix is largely predicated on the conformation of the sugar.8 The ribose ring in the B-form structure has a C2ˈ endo pucker whereas, in A

Figure 2: Duplex structure of nucleic acids. This figure shows the various forms of DNA and RNA duplexes. Image from reference.9

form, the ribose has a C3ˈ endo pucker. According to crystallographic data, RNA duplexes prefer A form to accommodate the hydroxyl group at C2ˈ and there is a larger energy barrier to convert double stranded RNA to a B form helix due to steric interactions brought about by the C2ˈ hydroxyl group. 3

Watson-Crick type hydrogen bonding was the first type of base pairing observed in early DNA and RNA studies. However, nucleobases are not limited to these types of interactions.10 The nucleobases display more than one face capable of forming hydrogen bonds (Figure 3). One such non-W-C. interaction is Hoogsteen hydrogen bonding11 which has been identified in nucleic acids bound to proteins12-13, small molecules14-15, RNA16-17,

DNA18, and damaged DNA.19-20 Recently, Hoogsteen hydrogen bonding has been found to transiently occur in canonical DNA duplexes21 and even utilized by DNA polymerase- tau during DNA polymerization.22 Reverse Hoogsteen hydrogen bonding, which involves a 180o flip of one base, has also been observed.23-25 Other examples of non-W-C base pairing include wobble bps which involve G-U, inosine-uracil (I-U), inosine-adenine (I-

A), and inosine-cytosine (I-C) as alternative nucleobase recognition events (Figure 3).

Wobble type hydrogen bonding is widely used throughout nucleic acid interactions26-28 and have proven to be critical for cellular processes such at translation, where the third bp of the codon-anticodon interaction utilizes wobble bps to faithfully translate mRNA into the correct protein sequence.29-30 Besides the above examples of non-W-C interactions, there are thousands of non-canonical hydrogen bonding motifs found in the literature and efforts are underway to predict their prevalence in structurally ambiguous oligonucleotides.31

Upon hybridization, two grooves, a major and minor groove, are formed (Figure

2). In B-form helices, the major groove is wide and deep, while the minor groove is narrow and deep. In contrast, the A-form helix has a narrow and deep major groove and a broad,

Figure 3: Alternative base pairings. The above figure shows a few examples of non-Watson-Crick type bps. Image from reference.32 5 shallow minor groove. The unusual structure of Z-form helices reveals a deep minor groove and a flattened out major groove. The major and minor grooves are solvent accessible and are binding sites for large macromolecules and small molecules. Typically, larger molecules such as proteins bind to larger, shallower grooves33 and small molecules, such as polyamides developed by the Dervan group, bind to the narrower, deeper groove where more intimate contacts can be made between small molecules and sides/floor of the groove.34 The walls of the grooves are lined by the backbone phosphate and sugar moieties.

The floor of the grooves is made up of the edge of the bps not engaged in Watson-Crick type hydrogen bonding and can provide sequence specific information. In B-form helices, the floor of the major groove is lined by the Hoogsteen face of the nucleobases which can engage in alternative base pairing interactions. A discussion of major/minor groove binding molecules and Hoogsteen-type interactions will follow later in this chapter.

1.1.1 SECONDARY STRUCTURES OF NUCLEIC ACIDS: bulges and loops.

While the helix is the most prominent structure for RNA and DNA, these biopolymers display an array of diverse and complicated secondary and tertiary structures.35 Furthermore, duplexes need not be perfect bp matches. Small numbers of mismatches within duplexes create bulges and, internal loops form via a large number of unpaired nucleobases (Figure 4). The mismatches may be symmetric on either side of the duplex or asymmetric with one strand of the duplex having more unpaired bases. Up to this point, only intermolecular helical duplexes made up two discreet polynucleotides have

6 been discussed, but duplexes may also be formed intramolecularly. For an intramolecular duplex to form, a polynucleotide must be self-complementary. The single strand will bend

Figure 4: Hairpin and bulge structure. Hairpins structures are composed of an intramolecular duplex region bridged by single stranded RNA. Bulges are composed of unpaired nucleobases within a double helix.

back on itself, creating a loop with unpaired nucleobases, and then hybridize with itself to create a duplex stem (Figure 4). This type of structure, called a hairpin or stem-loop, is the major secondary structure studied in this work and will be discussed in great detail in later chapters. The nucleobases in the loop region of a hairpin are unpaired and are therefore able to bp, and they commonly engage in non-Watson-Crick like interactions. Hairpin motifs are common recognition sites for numerous polynucleotides, proteins, and small molecules and are often important for the stabilization of RNA and DNA tertiary structure.

1.1.2 SECONDARY STRUCTURES OF NUCLEIC ACIDS: junctions

Other examples of RNA secondary structure are junctions. As polynucleotides begin to fold, it is not uncommon for them to contain various helical regions that intersect.

The intersection of helices separate by a region of zero or more single stranded sequences are called junctions. Common examples of junctions include three and four-way junctions found in hammerhead ribozyme and tRNA.36 An interesting feature of junctions is the propensity of helices to coaxially stack upon one another37-38 which has long range effects on the overall structure and stability of the nucleic acid.38-39

Figure 5: Structure three and four-way junctions.

1.1.3 SECONDARY STRUCTURES OF NUCLEIC ACIDS: G-quadruplex

Another motif found in nucleic acids whose biological relevance is only just beginning to be understood is the G-quadruplex.40 Formed by one or more nucleic acid strands, G-quadruplexes form when four guanine bases form Hoogsteen hydrogen bonds

(Figure 6). Typically stabilized by monovalent cations such as potassium41, G- quadruplexes form stacks on one another creating flat, large, and hydrophobic surfaces which have been used advantageously for drug design42-43 and fluorescence imaging.44-46

Studies into the biological relevance are underway.47

Figure 6: G-quadruplex structure. Squares are guanine and large spheres are potassium ions. Image modified from reference.43

1.2 COMPONENTS OF TERTIARY STRUCTURE OF NUCLEIC ACIDS

To this point, the discussion has focused on primary and secondary structure of nucleic acids. However, nucleic acids in cells are often large and their tertiary structure is 9 complicated and intricate. Polynucleotides fold into compact and fascinating structures that all start with basic secondary structures discussed above. The three-dimensional structure of RNA and DNA in the aqueous milieu of the cell often involves non-canonical and unexpected contacts made within the molecules that help stabilize the overall folding of the molecule. Interactions that stabilize tertiary interactions include coaxial stacking, the adenosine platform, 2ˈ-hydroxy-mediated helical interactions, base triples and triplexes, the tetraloop motif, metal-core motif, ribose zipper, kissing-loop, pseudoknot, kink turns, hook turns, and non-canonical hydrogen bonding and are covered extensively in reviews.48-49 A discussion of a few of these interactions follows below.

1.2.1 TERTIARY STRUCTURE OF NUCLEIC ACIDS: coaxial stacking.

Just as the major driving force for duplex formation is aromatic stacking, the major driving force for folding of nucleic acids into their most stable tertiary structure is base stacking, which is maximized through coaxial stacking of helices after duplex formation.50

As helices terminate near other helices or at junctions, the terminal bps are unstacked leaving the base of the helix exposed to solvent. When other helices terminate near each other, helices will stack the terminal bps and become coaxially stacked in order to maximize stacking and stabilize their structure.51-53 The stacking interactions can afford stability gains of 0.5 to 3.0 kcal/mole.51 These collinear helices are best exemplified in the tRNA crystal structures54, where the acceptor stem and T-arm stack to form a coaxial stack while the D-arm and anticodon arm form a separate coaxial stack. The coaxial stacking of

10 helices at junctions is determined not only by the sequence of the helix, but also by the topology of the junction, the most common being two, three, and four-way junctions.36, 50

Generally, the ionic conditions55-56 of the solution and type/number of intervening single nucleotides control57-58 how the helices interact and if they will coaxially stack. Coaxial stacking is further stabilized by long-range interactions such as kissing-loops and pseudoknots.

1.2.2 COMPONENTS OF TERTIARY STRUCTURE OF NUCLEIC ACIDS: kissing-loops and pseudoknots

A very common long-range interaction is the kissing-loop. A kissing-loop structure occurs when the two loops of two hairpins hybridize via Watson-Crick base pairing to from a duplex (Figure 7). Kissing-loops will be discussed in greater detail in Chapter 2 of this thesis. Like the kissing-loop, pseudoknots also involve the hybridization of a hairpin, except, in the case of pseudoknots, the complementary sequence is on a linear, single- stranded nucleic acid of the same RNA. Again, coaxial stacking can be invoked to describe the stability of the structure59 however, there is a dependence on Mg2+ or high concentrations of sodium.60 Pseudoknots provide structuring elements for catalytic

RNAs.61 In an exquisite example of a pseudoknot structuring a small piece of RNA for self-splicing, two pseudoknots involved in the structuring of the hepatitis delta virus ribozyme fold on top of one another to form the catalytic pocket of the ribozyme.62

Figure 7: General structure of a kissing-loop and pseudoknot

1.2.3 COMPONENTS OF TERTIARY STRUCTURE OF NUCLEIC ACIDS: base triples.

As discussed above, nucleobases have more than one face of the molecule which can hydrogen bond and these faces are exposed in the major and minor groove of the helices. Nucleic acids take advantage of these information-rich faces via triplex formation in which an unpaired base will hydrogen bond to a bp (Figure 8). Base triples can occur in both the major and minor groove and are prevalent throughout many structures.49, 63-64 For example, tRNAPhe displays base triples in both the major and minor groove.65 The D-arm in tRNAPhe forms two base triples via Hoogsteen face binding with bases A9, A23, and

U12 and also 46-22-13.65-66 Through the minor groove, a base triple in tRNAPhe is observed involving nucleobases 10-25-45.66

Figure 8: Base triples. A) A-U-A B) C-G-C+ C) C-G-m7G D) A-U-A (reverse Hoogsteen hydrogen bonding). Image from reference.49

1.2.4 COMPONENTS OF TERTIARY STRUCTURE OF NUCLEIC ACIDS: tetraloops

Tetraloop motifs are a widely-used interaction in nucleic acids used to stabilize tertiary structure and are composed of a hairpin motif with a loop of four nucleotides, typically UNCG or GNRA where N is any nucleotide and R is A or G. Tetraloops have been shown to have unusual intramolecular interactions and stabilities.67-69 While these hairpins themselves are unusually stable, they still interact with other motifs called tetraloop receptors.70-71 They involve Watson-Crick type interactions and non-canonical interactions including stacking of the nucleobases in the loop (Figure 9).72 In another

13 example, the tetraloop binds to the minor groove of duplexes through intramolecular interactions.73

Figure 9: Structures of tetraloops and receptors. A) Structure of a tetraloop. B-D) Tetraloop interacting with various helixes. Image taken from reference.74

1.2.5 COMPONENTS OF TERTIARY STRUCTURE OF NUCLEIC ACIDS: triplexes.

Base triples play an important role in stabilizing RNA and DNA tertiary structures through hydrogen-bonding and stacking interactions. Despite the possibility of base

14 triples, the biological occurrence of triple-stranded nucleic acids is thought to be much less prevalent and transient. Triple-stranded nucleic acids occur when two Watson-Crick hybridized nucleic acid interacts with third strand in either the minor or major groove of the duplex (Figure 10). Rich first discovered nucleic acid triplexes in which a poly-U and poly-A duplex interacted with another poly-U to form the triplex in the presence of divalent cations.75 Since then, much research has been performed to discover other triplexes which occur under physiological and non-physiological conditions76-81 such as the acidic

C triplex.82 The triplex hydrogen bonding interaction٭conditions required for the C+-G occurs via Hoogsteen and reverse-Hoogsteen interactions and can either be parallel or antiparallel depending on the orientation of third strand to the strand to which it is hydrogen bonded.83 Work by Breslauer and Dervan has been completed to study the energetics of intermolecular triplex formation from three individual DNA strands, finding that enthalpy of formation to be about 2 kcal/mole per bp or about one third that of a base pairing in a helix.84 Marky and coworkers studying intramolecular triplex formation found that formation of TAT/TAT, TAT/CGC+, and CGC+/CGC+ stacks had enthalpies of -24 kcal/mol, -23 kcal/mol, and -22 kcal/mol, respectively.85 Furthermore, intramolecular triplexes were found to be more robust due to the decrease in the entropic cost of triplex formation and stacking contributions from the loop region.86 The biological role of triplexes is just starting to be investigated but are thought to be important in long, noncoding RNAs, ribozymes, telomerases and other cellular functions.87-89 Work has also been performed to use triplexes to detect double stranded nucleic acids via directed redox chemistry and fluorescence.90-93

Figure 10: Triplex- forming nucleic acids. The green colored third strand binds to the duplex DNA or RNA in either a parallel or antiparallel orientation. Inset shows the NMR structure for a nucleic acid triplex (PDB- id:1BWG). Image taken from reference.89

1.3 MODIFICATIONS TO NUCLEIC ACIDS

Through the course of evolution, nature has utilized different selection pressures and sampling of chemical space to design the nucleic acid polymer that utilizes alternating phosphate and ribose moieties as the backbone. The nucleic acid’s polymeric backbone is a versatile scaffold used to display the nucleobases and the backbone has been tailored to its purpose. The deoxyribose-phosphate backbone for DNA, which catalogs all genetic information, is so stable that intact DNA is extracted from long deceased organisms.

Conversely, RNA’s backbone, composed of ribose and phosphate, is unstable and easily

16 degraded which suits its role perfectly as RNA levels are regulated by stress and environment, so chemical stability and persistence would greatly inhibit cell viability.

The uniformity of DNA and RNA has led chemists to investigate alternative backbones and bases in order to study how variants in nucleic acid structure would affect function within a living organism and to probe nucleic acid design. Modifications to the nucleobases and backbone have been performed to both strengthen and weaken hybridization, promote triplex formation, expand the genetic library, and provide alternate modes of interaction. Various modifications such as methylation of the canonical nucleobases, proposing a completely redesigned backbone, to introduction of new nucleobases have been attempted with varying degrees of success.

1.3.1 MODIFICATIONS TO NUCLEIC ACIDS: natural modifications

Nature has proven very adept at modifying nucleobases with over 100 reported modifications.1 These modifications are performed on the canonical nucleobases, meaning each new base has the same heterocycles at its core. Modifications can be as simple as methylation or as complicated as the addition of amino acids to form amino acid- nucleobase conjugates such as lysidine.94-95 Modifications to native nucleobases increases specificity, improves stability to enzymatic digestion, promotes signal transport to different cell compartments, and regulates splicing.96-100

1.3.2 MODIFICATIONS TO NUCLEIC ACIDS: metal-coordinating bps.

Evolutionary pressure has developed specialized machinery to modify and recognize modified nucleobases in order to expand the genetic code to fit many new purposes. Similarly, chemists have begun synthesizing new nucleobases to improve upon nucleic acid binding, expand the genetic code, create an alternate genetic code, study the principles behind nature’s design, and create new, interesting interactions. Nature settled on two purines and two pyrimidines to construct the recognition elements of its genetic code, presumably through a selection of different candidates.101 Chemists have used their creativity and knowledge to explore other chemical space to create new bps. Metal complexes have been explored102-103 as nucleobase surrogates (Figure 11). Mercury has

Figure 11: Examples of metal-mediated bps and triples. Taken from references.104-106

been used as a way of bridging weakly interacting T-T mismatches in DNA.104 Platinum coordinated to base triples has been used as a receptor for cytosine.105 Tanaka and coworkers developed a silver-mediated bp to increase duplex stability,107 and a similar

18 system was later used as a way to trigger conformational change in DNA from a hairpin to duplex initiated by the addition of silver ions.106 pH triggered binding of metal ion was also studied on halogenated uracil mismatches in DNA.108

1.3.3 MODIFICATIONS TO NUCLEIC ACIDS: hydrogen bonding attenuation.

Hydrogen bonding is an important interaction in supramolecular chemistry and provides a huge driving force in molecular recognition.109-112 Many chemists have created variants of the canonical nucleobases or have tried new heterocycles with various amounts of success. Freier and Altmann performed extensive experiment on over 200 nucleobase variants and found modifications which strengthen hydrogen bonding, neutralize charge repulsion, and pre-organize the backbone for hybridization to strengthen duplex stability.113 Some researchers have been able been able to completely do away with hydrogen bonding interactions while still being able to maintain specificity and canonical nucleic acid base stacking upon hybridization.114-117 The labs of Schultz and Kool have even shown that hydrogen bonding is not necessary for nucleic acid replication. Using isosteres incapable of hydrogen bonding, enzymes were able to faithfully insert the proper isostere according to the template strand even though no hydrogen bonds are present.7, 118-

121 Knowing that hydrogen bonding is not an absolute necessity for duplex formation and stability, many groups have designed fluorescent analogs of nucleobases as a way to study nucleic acids. Typically, the substitute is a fluorescent reporter acting through a quenching

19 mechanism or turn-on mechanism. These types of modified bases will be discussed in

Chapter 3.

1.3.4 MODIFICATIONS TO NUCLEIC ACIDS: triplex promoting modifications.

Nucleic acid triplex formation is typically not accessible under physiological conditions with the canonical bases. Using unmodified nucleotides, a triplex can form under acidic conditions and is highly dependent on divalent cations. Efforts have been made to promote triple-stranded nucleic acid formation under more physiologically relevant conditions via modifications to nucleobases (Figure 12). Early efforts focused on tailoring the nucleobases so that triplex formation could occur at neutral pH. Lee and coworkers produced a nucleic acid incorporating 5-methylcytosine that was able to form a stable triplex with duplex DNA at pH 8.122 Xodo and coworkers showed methylation produced an entropically favorable interaction.123 This methylation strategy in not general across all nucleic acids as Kool and coworkers showed a destabilization of the triplex upon the incorporation of 5-methylcytosine in RNA triplexes.124 However, they did report a stabilization of RNA triplexes when using 5-methyluracil.

Most modifications have focused on improving binding to purines in the major groove by modulating the artificial nucleobases ability to form Hoogsteen and reverse

Hoogsteen hydrogen bonds and is covered extensively in a review.125 A few examples of these modifications include introducing new aromatic heterocycles to reduce pH dependence126, extending the π-system to induce intercalation127, increasing hydrogen

20 bonding to increase stability128, introducing positive charge to shield electrostatic repulsion129, incorporation of reactive moieties for covalent linking130, and other more intricate designs.125, 131-132

Figure 12: Examples of triplex promoting nucleic acids. Bottom image from reference.129

1.3.5 MODIFICATIONS TO NUCLEIC ACIDS: triplex formation via Janus wedge.

The final modification to be discussed involves the Janus wedge motif. Named after the Roman god Janus with two faces looking forward and backwards, Janus wedge motifs present two faces on the molecule capable of interaction with two separate nucleobases via hydrogen bonding and base stacking (Figure 13). Janus wedge motifs have been designed to insert into base mismatches within RNA/DNA and to create triplexes with 21 two non-interacting strands of nucleic acids. Efforts have been made in materials chemistry to create complex assemblies using Janus wedges and nucleobases105, 133-135.

Several groups have sought Janus wedge motifs in an effort to drug various forms of malignant DNA and RNA such G or C nucleotides in viral genomes136, G-U mismatches in Tau pre-mRNA137, and repeated U-U mismatches in the DMPK gene causing myotonic

Figure 13: Janus wedge triplex forming motifs. Examples from references above.

dystrophy type 1.138 Baranger and Zimmerman used a melamine heterocycle attached to an intercalator to target U-U mismatches. The melamine moiety provided a discriminatory motif that would hydrogen bond with two uracil Watson-Crick faces while the intercalator acridine provided the binding driving force.138 Shin and Tor were able to create a bicyclic nucleotide surrogate capable of stably forming DNA duplexes with A or T.139 Similarly,

Perrin and coworkers developed a nucleotide which was used to target A-T bps,

22 preferentially binding to the A-analogue.140 In a series of elegant experiments, McLaughlin and coworkers were able to use PNA to insert a series of Janus wedge motifs into 8 continuous T-C mismatches, A-T bps, and G-C bps by forming PNA triplexes with

DNA.141-142 Finally, melamine and cyanuric acid were used to create hexameric rosettes of DNA which further assembled into fibers.143

1.4 MODIFICATIONS TO NUCLEIC ACID BACKBONES.

Before Bruce Merrifield invented solid phase synthesis144 in the 1960s, nucleic acids, especially designed nucleic acids, were difficult to obtain. Thanks to solid phase synthesis and phosphoramidite chemistry, chemists are able to chemically synthesize any nucleic acid sequence imaginable in high yields and purity. Chemists have begun to experiment with the structure of nucleic acids by introducing new and unusual nucleic acid monomers by modifying the ribose and phosphate moieties. Due to the possible application of nucleic acids as therapeutic reagents145-146, efforts have been made to strengthen their binding to target sequences and protect them against degradation within biological systems.

1.4.1 MODIFICATIONS TO NUCLEIC ACID BACKBONES: phosphodiester modifications.

Examples of modifications to the phosphodiester bond are less prevalent than modifications to the sugar moiety of nucleic acids (Figure 14). Eckstein and coworkers

23 introduced phosphorothioates in 1967147 which showed resistance to enzymatic degradation.148 Sulfur atom-substituted oligonucleotides have been used to form stable triplexes with targeted duplex nucleic acids with minimal change in triplex stability.149

Phosphorothioate nucleotides have been effective in inhibition of transcription through triplex formation in an antisense strategy and effective antisense reagents in gene knockdown experiments.150-153 Improvements in duplex stability was achieved by

Gryaznov and coworkers by introducing phosphoramidates into the backbone of nucleic acids by replacing the 3ˈ-oxygen atom in the 2ˈ-deoxyfuranose system with an NH group.

Increased stability is thought to arise from a more rigid backbone.154-155 These zwitterionic nucleotides are also able to form triplexes in low salt, possibly due to reduced electrostatic repulsion.156-157 Other modifications have aimed at conformationally restricting the backbone of the nucleic acids via cyclization. Leumann and coworkers have created a bicyclodeoxynucleoside (bcdX) with a furanose ring as the core sugar moiety. While the bcdX nucleosides showed slightly weaker duplex stability, the triplex stability incorporating the bicyclic moiety showed greater stability.158

Figure 14: Examples of phosphoramidates and phosphorothioate.

1.4.2 MODIFICATIONS TO NUCLEIC ACID BACKBONES: ribose modifications.

The ribose moiety has been targeted for modification not only to increase stability, but also as a target for the study of evolution of the basic building blocks of life (Figure

15). A rather simple modification was the methylation of the 2ˈ-hydroxy moiety which has shown to increase stability of duplexes and triplexes by preventing 2ˈ-hydroxyl- catalyzed hydrolysis.159-160 Removal of the C-C bond between C2ˈ and C3ˈ has created a new class of nucleotides called unlocked nucleic acids (UNA) which are resistant to enzymatic degradation.161-162 UNAs destabilize a duplex with respect to its native sequence due to greater mobility in the backbone. The greater entropy of the UNA is utilized to create synthetic oligonucleotides with varied specificity. Preceding UNA was the locked nucleic acid (LNA) which greatly stabilized duplex formation when hybridized with native nucleic acids due to greater preorganization of the backbone via introduction of a 2ˈ-C, 4ˈ-

C-oxymethylene linkers. LNAs show enhanced stability to enzymatic degradation.163-164

Imanishi’s lab has shown the ability of LNAs to form triplexes with DNA in more basic conditions, pH 7.0, possibly due to greater rigidity.165-167 LNAs modified with a 5ˈ- acridine derivative have formed stable triplexes with DNA at physiologically relevant temperature and pH with sub micromolar efficacy in gene silencing.166, 168 A fluorinated

LNA at the C2ˈ and C4ˈ has shown increased activity in gene silencing studies.169 Usage of LNA has become a popular modification seeing use in various applications in bioengineering,170-172 and LNAs have been further modified with the 2ˈ-amino

25 functionality which allows for the appendage of fluorescent reporters.173-175 The diastereomer of LNA, 2ˈ-amino-α-L-LNA, has also been developed further increasing the toolbox of modified base technology as a stabilizing moiety that allows for fluorescent labeling of target RNA with abasic sites.171, 176-177 α-L-LNA have been shown to form stable triplexes with DNA at pH 6.8 with greater thermal stability when compared to its DNA counterpart.161, 178

Figure 15: Examples of locked and unlocked nucleic acids. Images taken from references.161, 176

1.4.3 MODIFICATIONS TO NUCLEIC ACID BACKBONES: addressing backbone charge repulsion.

One of the major factors affecting hybridization of nucleic acids is charge. Nucleic acids fold in a way which minimizes electrostatic repulsion between negatively charged phosphate groups while maximizing base stacking and hydrogen bonding.179-180 One way to stabilize duplexes and triplexes is the introduction of positively charged moieties which help alleviate charge repulsion from the backbone (Figure 16). Atsumi and coworkers found that introduction of an amino group at the C4ˈ position via ethyl and propyl linkers stabilized triplex formation whereas methyl and 2-[N-(2-aminoethyl)carbamoyl]oxy]ethyl- 26 linker destabilized triplexes.181 Introduction of 2ˈ-aminoethoxy oligonucleotides also stabilizes triplex formation182-183 via hydrogen bonding to the nearest phosphate.183-184 Fox and Brown added additional positively charged groups to DNA systems via addition of a nucleobase modified with 5-propargylamino group.185-186 These systems were even more stable than 2ˈ-amionethyoxy modified systems due to the additive effects of two positive charges.187

Figure 16: Example of nucleobase modifications which introduce charge. Images taken from references.181, 183

1.4.4 MODIFICATIONS TO NUCLEIC ACID BACKBONES: ribose substitutes.

Chemists have explored surrogates for the ribose moiety (Figure 17). Substitution with a morpholine ring for the ribose results in a phosphoramidite bond and a new class of antisense nucleotides. Phosphorodiamidate morpholino oligomers also form triplexes but are still limited to low pHs for complexation to occur.188 Another ribose substitution which destabilized both duplex (-4 to -2°C Tm change) and triplex (-13 to -1°C Tm change) formation was presented by Leumann and coworkers in which they introduced pyrrolidino-

C-nucleosides.189-190 Herdewijn and coworker substituted the ribose for 1’,5ˈ-

27 anhydroxhexitol into nucleic acids (HNA) and found, under specific conditions (50 times excess) that triplex formation was favored.191-192 Utilizing a rather interesting W-shaped nucleic acid (WNA), which incorporates a bicyclic ringed system and a benzene ligand to

Figure 17: Examples of ribose substitutes. Images taken from references.188, 190-191, 193-195

provide stacking interactions, Sasaki and coworkers formed stable triplexes with great selectivity for oligo TA duplexes.196 Finally, Zhang and coworkers found that glycol nucleic acids (GNA), in which a simple 1,2-ethandiol links the phosphate groups, have greater duplex thermal stability than canonical DNA and RNA by 22.5 °C and 20.5 °C, respectively, for the sequences they studied.195 The unusual stability arises from preorganization of the backbone into a helix, as determined by CD experiments. Pedersen and coworkers interspersed GNA-intercalating conjugate monomers into native ssDNA to

28 increase stability of duplex but could only modestly stabilize triplexes at physiologically relevant pH.194, 197 A peptoid nucleic acid was attempted by Zarra and coworkers, but no

CD or thermal melting signature could be found.193

1.5 PEPTIDE NUCLEIC ACIDS

After the discovery of nucleic acids, chemists have explored not only why this polymer has achieved such a privileged position, but if any other polymer could suitably replace the natural backbone of nucleic acids. Jones and coworkers was able to weakly bind DNA with various polyacrylate and polyacrylamide polymers functionalized with nucleobases.198-201 Other groups have worked with polyvinyl polymers202-203 and acryloylnucleosides204 as nucleobase displaying polymers with some success. Work in

Albert Eschenmoser’s lab has shown that the ribose sugar is not privileged structure and that other sugars are as effective as ribose in displaying genetic information.205 Lo and

Sleiman used DNA-mimetic π-conjugated poly(p-phenylenebutadiynylene) as a DNA targeting molecule which was able to bind and d[A20] and d[T20] nucleic acids and enhance fluorescence.206 In similar studies, the Bong group has been able to bind both RNA and

DNA with ten sequential U-U/T-T mismatches using a polyacrylate polymer displaying a

Janus-wedge motif.207

Surprisingly, a backbone similar to the poly-α-amino acid bearing the canonical nucleobases was discovered which was capable of binding single stranded nucleic acids.

Using achiral 2-aminoethylglycine units connected via amide bonds, Nielsen and coworkers introduced peptide nucleic acids (PNA) which were able to bind to oligo-A

Figure 18: Structure of PNA based on protein backbone. Image from reference.208

DNA and outcompete native, complementary Oligo-T to form triplexes (Figure 18).209

Later work expanded the recognition of PNA to all nucleic acid sequences and showed its ability to form duplexes with DNA, RNA and other PNA molecules through Watson-Crick type hydrogen bonding with base discrimination.210-213 The superior stability of PNA complexes, as shown by higher Tm values, appears to stem from the neutral backbone which eliminates the charge repulsion found in the natural nucleic acid duplex. Several structures have been solved via different techniques for the RNA-PNA duplex, RNA-PNA duplex, and DNA-PNA2 triplex. The RNA-PNA duplex structure seems to be biased towards RNA as it appears to adopt an A-form structure similar to RNA-RNA duplexes.214

DNA-PNA complexes adopt a conformation completely different from the typical A-form and B-form of natural nucleic acid duplexes. The duplex and triplex of DNA-PNA adopts 30 a new formation called P-form, which has characteristics of 3.4 Å rise per nucleobase similar to B-form DNA but with 16 bps per turn.215-216 PNA can form duplexes and triplexes with single stranded RNA and DNA, and it is able to displace a hybridized nucleic acid in a duplex through a mechanism called strand invasion.209, 217 Nielsen and coworkers

Figure 19: Mechanism of PNA strand invasion of duplex nucleic acids. Image from reference.218

investigated the mechanism using an elegant CD experiment and proposed that the PNA invasion takes place after non-specific association of the PNA, breathing of the Watson-

Crick bps, and subsequent binding of the PNA (Figure 19).218 Later work by Nielsen and coworkers improved invasion efficiency via covalent linking of intercalators to the PNA219 and showed the ability to perform double duplex invasion with diaminopurine-thiouracil bps.220 A major obstacle for using PNAs as an antisense type drug was its propensity to form invasive triplexes with a PNA2/DNA ratio. Researchers were eventually able to outcompete the invasive mechanism by using pseudoisocytosine, oligo-lysine, and 9-

221 aminoacridine conjugated to the PNA oligomers to achieve PNA/DNA2 ratio. 31

1.5.1 PEPTIDE NUCLEIC ACIDS: incorporation of Janus wedge motifs.

PNA recognizes single-stranded and double-stranded nucleic acids through hydrogen bonding via Watson-Crick and Hoogsteen faces of the nucleobases. This approach works well for triplexes T-A-T, C+-G-C, A-A-T, and G-G-C but does not cover the full scope of possibilities, such as mismatched nucleobases, due to difficulty in triplex formation with pyrimidine bases. Lehn initially proposed the use of a Janus wedge motif which would present Watson-Crick like hydrogen bonds on both faces of a heterocycle to form a base triple as a way of binding mismatched nucleic acids (Figure 20).133

McLaughlin and coworkers successfully used an oligo-PNA with a Janus wedge motifs to target T-C mismatches in DNA.141 Using a heterocycle called W which presents hydrogen bonding motifs that would complement the Watson-Crick faces of thymine and cytosine, they were able to form stable triplexes with a duplex DNA with 8 consecutive T-C mismatches flanked by eleven canonical bps. In later work, heterocycles targeting A-T and G-C bps were able to successfully form triplexes when canonical bps were flanked by multiple mismatched bases and discriminate against non-complementary nucleobases.142

Ganesh and coworkers utilized a cyanuric acid moiety displayed on a PNA backbone to strengthen triplex formation with oligo-A DNA.222 They found that a single cyanuric acid

° moiety in the middle of an oligo-T displaying PNA stabilized the triplex by a 12 C in Tm measurements by providing a Watson-Crick competent binding face no matter the rotamer of the cyanuric acid presented to the DNA nucleobase.

Figure 20: Examples of Janus wedge motifs used in PNA.

1.5.2 PEPTIDE NUCLEIC ACIDS: native peptide backbone.

After Nielsen discovered PNA as a competent nucleic acid mimic, other groups have looked at native peptide backbones as a way of displaying genetic information. Lenzi first attempted a native peptide backbone nucleic acid with a self-complementary sequence incorporating thymine and adenine nucleobases, but the hairpin had a modest Tm of 19 °C, possibly due to a lack of flexibility in the backbone.223 Diederichsen synthesized alanyl peptide nucleic acids with alternating stereo centers to create nucleobase displaying beta sheets, again with modest success compared to PNA.224 Impressively, Huang and coworkers introduced αPNA in which the nucleobases are displayed on an alpha-helical peptide. Using a positively-charged helical structure, tight binding to the DNA sequence

GGAGG with a Kd of 200 nM was achieved as well as high melting temperatures in a possible triplex structure.225

Eschenmoser and Krishnamurthy, interested in the primordial evolution of genetic material, studied α-peptides and peptoids displaying triazine heterocycles as potential precursors to modern nucleic acids (Figure 21).226 In their systems 2,4-diamino-1,3,5- triazine and 2,4-dioxo-1,3,5-triazine rings were displayed on a glutamyl, aspartyl, 33 iminodiacetic acid, and ethylenediamine monomers with alternating aspartic acid or dialkyl-ammonium groups for solubility. Their findings showed that the binding of these small oligos, displaying as few as six nucleobase mimics, were robust in binding to RNA and DNA when containing the 2,4-diamino-1,3,5-triazine heterocycle displayed on the longest linker. They found that the 2,4-dioxo-1,3,5-triazine nucleobase mimic did not bind to nucleic acid targets due to deprotonation in the assay buffer. While they ruled out that the triazine heterocycles as possible nucleobase precursors, they did show that α-peptides

Figure 21: Native peptide backbone PNA with triazine ring recognition moiety.

Image from reference.226

are competent as nucleic acid analogs even with negatively charged backbones.

Furthermore, while not a major finding of the paper, they found that the 2,4-diamino-1,3,5- triazine is effective as a nucleobase mimic capable of recognizing uracil and thymine. In a follow up communication using α-peptides, the researchers showed that pKa of the nucleobase is important.227 Their findings yielded a relationship between pKa of the base and pH of the solution, in that if the base becomes deprotonated or tautomerizes in the 34 buffer (has a pKa near or equal to the pH of the solution), then molecular recognition is weak.

1.5.3 BIFACIAL PEPTIDE NUCLEIC ACIDS (bPNA)

In 2012, the Bong laboratory at The Ohio State University reported the binding of a 21mer α-protein bPNA, composed of alternating lysine and glutamic acid amino acids displaying 2,4,6-diamino-1,3,5-triazine on the lysine side chain, to oligo-thymine DNA

(Figure 22).228 The system was designed to bind oligo thymine and oligo uracil using melamine as a Janus wedge motif capable of forming a triplex with the nucleobases.228-229

Fluorescence anisotropy and molecular beacon experiments indicate discreet triplex

2 formation with two dT10 tracks with high affinity (dT10 Kd ~ 4000 nM ). Triplex formation can also occur via hybridization of bPNA with two dT10 tracks attached via a single stranded region to form a hairpin triplex (Kd= 2.7 nM) with high thermal stability (54

°C).228 The sequence of bPNA follows the spacing presented by Eschenmoser’s work with the negative charge providing no destabilizing electrostatic effects. Aside from the backbone structure and unnatural nucleobase, bPNA differs from triplex-forming nucleic acids and PNA via its mechanism of formation. Triplex-forming nucleic acids interact with a preformed duplex through interaction with the major or minor groove and standard PNA involves the invasion of a preformed duplex. bPNA acts through an associative mechanism bringing two non-interacting nucleic acids together during triplex formation. In contrast to PNA and TNA which require a preformed duplex, bPNA binds to two non-interacting strands of nucleic acids to form a triplex.

Figure 22: Structure of bPNA. Recognition unit melamine (Left), structure of bPNA (Center) and proposed triplex structure (Right). Image from reference.228

The Bong lab has employed this bPNA a number of systems as a regulatory switch

(Figure 23). They have shown that bPNA stably binds to oligo-uracil RNA in a comparable fashion to the DNA system.229 bPNA triplex formation has been able to compete with native enzymes to block transcription, exonuclease digestion, and reverse transcription due to significant structural reorganization.229 Enzymes are able to function until their encounter with the bPNA triplex, at which point enzymatic activity is aborted. While bPNA has been used to turn off enzymatic processing, it has also been used to restore function to aptamers and ribozymes. As an allosteric switch, bPNA has been shown to refold crippled ribozymes and restore self-cleaving activity.230 Similarly, bPNA is able to rescue crippled RNA and DNA aptamers which bind to a small fluorogen and protein, respectively.230 Furthermore, using oligo-thymine tracks as templates, the Bong lab have

36 been able to catalyze ligation of bPNA modules to restore function to a crippled ribozyme.230

Figure 23: bPNA as an allosteric switch. A) hammerhead ribozyme B) spinach aptamer C) protein aptamer. Images from reference.230

Up to now, the triplex-incorporating bPNA has been used as a surrogate for a duplex region of a nucleic acid. When the triplex has been formed within the context of a hairpin, the loop sequence is usually an innocuous sequence with no function other than to bridge the binding tracks for bPNA. However, the loop regions of stem-loop structures are often utilized by nature as docking sites and readily bind to various targets. Hairpins may dock to proteins, bind small molecules, or bind other RNAs intermolecularly and intramolecularly. In the following work, we study the extent to which bPNA triplexes can promote loop-loop hybridization of hairpins, the so called “kissing-loop” complex. In

Chapter 2, two kissing-loop systems were mutated with a bPNA binding site in their stem regions in order to examine the behavior of bPNA promoted kissing-loop complexes. Data will be presented showing the effect of bPNA triplex incorporation on hairpin binding

37 hybridization and show compelling evidence that bPNA structuring of the stem aids in complex formation. In Chapter 3, we will investigate the use of bPNA triplexes as a selective and specific modification that can be used to chemically tag and modify a target hairpin nucleic acid. Efforts have been made to turn the triplex-modified hairpins into fluorescence reporters to detect not only the presence of a hairpin, but also kissing-complex formation. We hope to use this directed chemistry approach to fluorescently label and modify specific nucleic acid structures through functionalization of bPNA with reactive moieties.

REFERENCES FOR CHAPTER 1

1. Chawla, M.; Oliva, R.; Bujnicki, J. M.; Cavallo, L., An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies. Nucleic

Acids Research 2015, 43 (14), 6714-6729.

2. Gill, S. J.; Downing, M.; Sheats, G. F., The Enthalpy of Self-Association of

Purine Derivatives in Water*. Biochemistry 1967, 6 (1), 272-276.

3. Farquhar, E. L.; Downing, M.; Gill, S. J., Enthalpy of self-association of pyrimidine derivatives in water. Biochemistry 1968, 7 (3), 1224-1225.

4. Dado, G. P.; Gellman, S. H., Intramolecular Hydrogen Bonding in Derivatives of

.beta.-Alanine and .gamma.-Amino Butyric Acid; Model Studies for the Folding of

Unnatural Polypeptide Backbones. J. Am. Chem. Soc. 1994, 116 (3), 1054-1062.

5. Mak, C. H., Unraveling Base Stacking Driving Forces in DNA. J. Phys. Chem. B

2016, 120 (26), 6010-6020.

6. Watson, J. D.; Crick, F. H. C., Molecular Structure of Nucleic Acids: A Structure for Deoxyribose Nucleic Acid. Nature 1953, 171 (4356), 737-738.

7. Kool, E. T., Hydrogen Bonding, Base Stacking, and Steric Effects in Dna

Replication. Annual Review of Biophysics and Biomolecular Structure 2001, 30 (1), 1-22.

8. Rich, A., The double helix: a tale of two puckers. Nat Struct Mol Biol 2003, 10

(4), 247-249.

9. Hightower, L. Structure of Nucleic Acids. http://web.uconn.edu/mcb201/lecture03.html (accessed July 7, 2017).

10. Leontis, N. B.; Westhof, E., Geometric nomenclature and classification of RNA base pairs. RNA 2001, 7 (4), 499-512.

11. Hoogsteen, K., The crystal and molecular structure of a hydrogen-bonded complex between 1-methylthymine and 9-methyladenine. Acta Cryst, Acta Crystallogr

1963, 16 (9), 907-916.

12. Kitayner, M.; Rozenberg, H.; Rohs, R.; Suad, O.; Rabinovich, D.; Honig, B.;

Shakked, Z., Diversity in DNA recognition by p53 revealed by crystal structures with

Hoogsteen base pairs. Nat Struct Mol Biol 2010, 17 (4), 423-429.

13. Patikoglou, G. A.; Kim, J. L.; Sun, L.; Yang, S.-H.; Kodadek, T.; Burley, S. K.,

TATA element recognition by the TATA box-binding protein has been conserved throughout evolution. Genes Dev. 1999, 13 (24), 3217-3230.

14. Gessner, R. V.; Quigley, G. J.; Wang, A. H. J.; Van der Marel, G. A.; Van Boom,

J. H.; Rich, A., Structural basis for stabilization of Z-DNA by cobalt hexaammine and magnesium cations. Biochemistry 1985, 24 (2), 237-240.

15. Seaman, F. C.; Hurley, L., Interstrand cross-linking by bizelesin produces a

Watson-Crick to Hoogsteen base-pairing transition region in d(CGTAATTACG)2.

Biochemistry 1993, 32 (47), 12577-12585.

16. Nissen, P.; Ippolito, J. A.; Ban, N.; Moore, P. B.; Steitz, T. A., RNA tertiary interactions in the large ribosomal subunit: The A-minor motif. PNAS 2001, 98 (9), 4899-

4903.

17. Theimer, C. A.; Blois, C. A.; Feigon, J., Structure of the Human Telomerase RNA

Pseudoknot Reveals Conserved Tertiary Interactions Essential for Function. Molecular

Cell 2005, 17 (5), 671-682.

18. Abrescia, N. G. A.; Thompson, A.; Huynh-Dinh, T.; Subirana, J. A., Crystal structure of an antiparallel DNA fragment with Hoogsteen base pairing. PNAS 2002, 99

(5), 2806-2811.

19. Yang, H.; Zhan, Y.; Fenn, D.; Chi, L. M.; Lam, S. L., Effect of 1-methyladenine on double-helical DNA structures. FEBS Letters 2008, 582 (11), 1629-1633.

20. Shanmugam, G.; Kozekov, I. D.; Guengerich, F. P.; Rizzo, C. J.; Stone, M. P.,

Structure of the 1,N2-Ethenodeoxyguanosine Adduct Opposite Cytosine in Duplex DNA:

Hoogsteen Base Pairing at pH 5.2. Chem. Res. Toxicol. 2008, 21 (9), 1795-1805.

21. Nikolova, E. N.; Kim, E.; Wise, A. A.; O’Brien, P. J.; Andricioaei, I.; Al-

Hashimi, H. M., Transient Hoogsteen base pairs in canonical duplex DNA. Nature 2011,

470 (7335), 498-502.

22. Nair, D. T.; Johnson, R. E.; Prakash, S.; Prakash, L.; Aggarwal, A. K.,

Replication by human DNA polymerase-ι occurs by Hoogsteen base-pairing. Nature

2004, 430 (6997), 377-380.

23. Sánchez, V.; Redfield, A. G.; Johnston, P. D.; Tropp, J., Nuclear Overhauser effect in specifically deuterated macromolecules: NMR assay for unusual base pairing in transfer RNA. PNAS 1980, 77 (10), 5659-5662.

24. Roy, S.; Redfield, A. G., Nuclear Overhauser effect study and assignment of D stem and reverse-Hoogsteen base pair proton resonances in yeast tRNA Asp. Nucleic

Acids Research 1981, 9 (24), 7073-7083.

25. Wimberly, B.; Varani, G.; Tinoco, I., The conformation of loop E of eukaryotic

5S ribosomal RNA. Biochemistry 1993, 32 (4), 1078-1087.

26. Kennard, O., Structural Studies of DNA Fragments: The G·T Wobble Base Pair in A, B and Z DNA; The G·A Base Pair in B-DNA. Journal of Biomolecular Structure and Dynamics 1985, 3 (2), 205-226.

27. Martin, F. H.; Castro, M. M.; Aboul-ela, F.; Tinoco, I., Base pairing involving deoxyinosine: implications for probe design. Nucleic Acids Research 1985, 13 (24),

8927-8938.

28. Varani, G.; McClain, W. H., The G·U wobble base pair. EMBO reports 2000, 1

(1), 18-23.

29. Topal, M. D.; Fresco, J. R., Base pairing and fidelity in codon–anticodon interaction. Nature 1976, 263 (5575), 289-293.

30. Murphy, F. V.; Ramakrishnan, V., Structure of a purine-purine wobble base pair in the decoding center of the ribosome. Nat Struct Mol Biol 2004, 11 (12), 1251-1252.

31. Lemieux, S.; Major, F., RNA canonical and non‐canonical base pairing types: a recognition method and complete repertoire. Nucleic Acids Research 2002, 30 (19),

4250-4263.

32. Biotechnology, I. o. M. Nucleic Acid Nomenclature and Structure. http://jenalib.leibniz-fli.de/ImgLibDoc/nana/IMAGE_NANA.htm (accessed July 7,

2017).

33. Seeman, N. C.; Rosenberg, J. M.; Rich, A., Sequence-specific recognition of double helical nucleic acids by proteins. PNAS 1976, 73 (3), 804-808.

34. Kielkopf, C. L.; White, S.; Szewczyk, J. W.; Turner, J. M.; Baird, E. E.; Dervan,

P. B.; Rees, D. C., A Structural Basis for Recognition of A·T and T·A Base Pairs in the

Minor Groove of B-DNA. Science 1998, 282 (5386), 111-115.

35. Hendrix, D. K.; Brenner, S. E.; Holbrook, S. R., RNA structural motifs: building blocks of a modular biomolecule. Quarterly Reviews of Biophysics 2005, 38 (03), 221.

36. Laing, C.; Wen, D.; Wang, J. T. L.; Schlick, T., Predicting coaxial helical stacking in RNA junctions. Nucleic Acids Research 2012, 40 (2), 487-498.

37. Lescoute, A.; Westhof, E., Riboswitch Structures: Purine Ligands Replace

Tertiary Contacts. Chemistry & Biology 2005, 12 (1), 10-13.

38. Kim, J.; Walter, A. E.; Turner, D. H., Thermodynamics of Coaxially Stacked

Helixes with GA and CC Mismatches. Biochemistry 1996, 35 (43), 13753-13761.

39. Schwille, P.; Oehlenschläger, F.; Walter, N. G., Quantitative Hybridization

Kinetics of DNA Probes to RNA in Solution Followed by Diffusional Fluorescence

Correlation Analysis. Biochemistry 1996, 35 (31), 10182-10193.

40. Gellert, M.; Lipsett, M. N.; Davies, D. R., Helix Formation by Guanylic Acid.

PNAS 1962, 48 (12), 2013-2018.

41. Williamson, J. R.; Raghuraman, M. K.; Cech, T. R., Monovalent cation-induced structure of telomeric DNA: The G-quartet model. Cell 1989, 59 (5), 871-880.

42. Neidle, S., Quadruplex Nucleic Acids as Novel Therapeutic Targets. J. Med.

Chem. 2016, 59 (13), 5987-6011.

43. Bugaut, A.; Balasubramanian, S., 5′-UTR RNA G-quadruplexes: translation regulation and targeting. Nucleic Acids Research 2012, 40 (11), 4727-4741.

44. Paige, J. S.; Wu, K. Y.; Jaffrey, S. R., RNA Mimics of Green Fluorescent Protein.

Science 2011, 333 (6042), 642-646.

45. Warner, K. D.; Chen, M. C.; Song, W.; Strack, R. L.; Thorn, A.; Jaffrey, S. R.;

Ferré-D'Amaré, A. R., Structural basis for activity of highly efficient RNA mimics of green fluorescent protein. Nat Struct Mol Biol 2014, 21 (8), 658-663.

46. Dolgosheina, E. V.; Jeng, S. C. Y.; Panchapakesan, S. S. S.; Cojocaru, R.; Chen,

P. S. K.; Wilson, P. D.; Hawkins, N.; Wiggins, P. A.; Unrau, P. J., RNA Mango

Aptamer-Fluorophore: A Bright, High-Affinity Complex for RNA Labeling and

Tracking. ACS Chem. Biol. 2014, 9 (10), 2412-2420.

47. Bochman, M. L.; Paeschke, K.; Zakian, V. A., DNA secondary structures: stability and function of G-quadruplex structures. Nat Rev Genet 2012, 13 (11), 770-780.

48. Butcher, S. E.; Pyle, A. M., The Molecular Interactions That Stabilize RNA

Tertiary Structure: RNA Motifs, Patterns, and Networks. Acc. Chem. Res. 2011, 44 (12),

1302-1311.

49. Batey, R. T.; Rambo, R. P.; Doudna, J. A., Tertiary Motifs in RNA Structure and

Folding. Angewandte Chemie International Edition 1999, 38 (16), 2326-2343.

50. Bailor, M. H.; Sun, X.; Al-Hashimi, H. M., Topology Links RNA Secondary

Structure with Global Conformation, Dynamics, and Adaptation. Science 2010, 327

(5962), 202-206.

51. Walter, A. E.; Turner, D. H., Sequence dependence of stability for coaxial stacking of RNA helixes with Watson-Crick base paired interfaces. Biochemistry 1994,

33 (42), 12715-12719.

52. Walter, A. E.; Turner, D. H.; Kim, J.; Lyttle, M. H.; Müller, P.; Mathews, D. H.;

Zuker, M., Coaxial stacking of helixes enhances binding of oligoribonucleotides and improves predictions of RNA folding. PNAS 1994, 91 (20), 9218-9222.

53. Tyagi, R.; Mathews, D. H., Predicting helical coaxial stacking in RNA multibranch loops. RNA 2007, 13 (7), 939-951.

54. Kim, S. H.; Quigley, G. J.; Suddath, F. L.; McPherson, A.; Sneden, D.; Kim, J. J.;

Weinzierl, J.; Rich, A., Three-Dimensional Structure of Yeast Phenylalanine Transfer

RNA: Folding of the Polynucleotide Chain. Science 1973, 179 (4070), 285-288.

55. Lafontaine, D. A.; Norman, D. G.; Lilley, D. M. J., Structure, folding and activity of the VS ribozyme: importance of the 2‐3‐6 helical junction. The EMBO Journal 2001,

20 (6), 1415-1424.

56. Al-Hashimi, H. M.; Pitt, S. W.; Majumdar, A.; Xu, W.; Patel, D. J., Mg2+- induced Variations in the Conformation and Dynamics of HIV-1 TAR RNA Probed

Using NMR Residual Dipolar Couplings. Journal of Molecular Biology 2003, 329 (5),

867-873.

57. Lescoute, A.; Westhof, E., Topology of three-way junctions in folded RNAs. RNA

2006, 12 (1), 83-93.

58. Selmer, M.; Dunham, C. M.; Murphy, F. V.; Weixlbaumer, A.; Petry, S.; Kelley,

A. C.; Weir, J. R.; Ramakrishnan, V., Structure of the 70S Ribosome Complexed with mRNA and tRNA. Science 2006, 313 (5795), 1935-1942.

59. Puglisi, J. D.; Wyatt, J. R.; Tinoco, I., Conformation of an RNA pseudoknot.

Journal of Molecular Biology 1990, 214 (2), 437-453.

60. Wyatt, J. R.; Puglisi, J. D.; Tinoco, I., RNA pseudoknots. Journal of Molecular

Biology 1990, 214 (2), 455-470.

61. Staple, D. W.; Butcher, S. E., Pseudoknots: RNA Structures with Diverse

Functions. PLOS Biology 2005, 3 (6), e213.

62. Ferré-D'Amaré, A. R.; Zhou, K.; Doudna, J. A., Crystal structure of a hepatitis delta virus ribozyme. Nature 1998, 395 (6702), 567-574.

63. Almakarem, A.; S, A.; Petrov, A. I.; Stombaugh, J.; Zirbel, C. L.; Leontis, N. B.,

Comprehensive survey and geometric classification of base triples in RNA structures.

Nucleic Acids Research 2012, 40 (4), 1407-1423.

64. Firdaus-Raih, M.; Harrison, A.-M.; Willett, P.; Artymiuk, P. J., Novel base triples in RNA structures revealed by graph theoretical searching methods. BMC Bioinformatics

2011, 12 (13), S2.

65. Robertus, J. D.; Ladner, J. E.; Finch, J. T.; Rhodes, D.; Brown, R. S.; Clark, B. F.

C.; Klug, A., Structure of yeast phenylalanine tRNA at 3 |[angst]| resolution. Nature

1974, 250 (5467), 546-551.

66. Jack, A.; Ladner, J. E.; Klug, A., Crystallographic refinement of yeast phenylalanine transfer RNA at 2·5Å resolution. Journal of Molecular Biology 1976, 108

(4), 619-649.

67. Tuerk, C.; Gauss, P.; Thermes, C.; Groebe, D. R.; Gayle, M.; Guild, N.; Stormo,

G.; d'Aubenton-Carafa, Y.; Uhlenbeck, O. C.; Tinoco, I., CUUCGG hairpins: extraordinarily stable RNA secondary structures associated with various biochemical processes. PNAS 1988, 85 (5), 1364-1368.

68. Molinaro, M.; Tinoco, I., Use of ultra stable UNCG tetraloop hairpins to fold

RNA structures: thermodynamic and spectroscopic applications. Nucleic Acids Research

1995, 23 (15), 3056-3063.

69. Heus, H. A.; Pardi, A., Structural features that give rise to the unusual stability of

RNA hairpins containing GNRA loops. Science 1991, 253 (5016), 191-194.

70. Jaeger, L.; Michel, F.; Westhof, E., Involvement of a GNRA tetraloop in long- range RNA tertiary interactions. Journal of Molecular Biology 1994, 236 (5), 1271-1276.

71. Murphy, F. L.; Cech, T. R., GAAA Tetraloop and Conserved Bulge Stabilize

Tertiary Structure of a Group I Intron Domain. Journal of Molecular Biology 1994, 236

(1), 49-63.

72. Cate, J. H.; Gooding, A. R.; Podell, E.; Zhou, K.; Golden, B. L.; Kundrot, C. E.;

Cech, T. R.; Doudna, J. A., Crystal Structure of a Group I Ribozyme Domain: Principles of RNA Packing. Science 1996, 273 (5282), 1678-1685.

73. Pley, H. W.; Flaherty, K. M.; McKay, D. B., Model for an RNA tertiary interaction from the structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. Nature 1994, 372 (6501), 111-113.

74. Fiore, J. L.; Nesbitt, D. J., An RNA folding motif: GNRA tetraloop–receptor interactions. Quarterly Reviews of Biophysics 2013, 46 (3), 223-264.

75. Felsenfeld, G.; Davies, D. R.; Rich, A., FORMATION OF A THREE-

STRANDED POLYNUCLEOTIDE MOLECULE. J. Am. Chem. Soc. 1957, 79 (8),

2023-2024.

76. Morgan, A. R.; Wells, R. D., Specificity of the three-stranded complex formation between double-stranded DNA and single-stranded RNA containing repeating nucleotide sequences. Journal of Molecular Biology 1968, 37 (1), 63-80.

77. Riley, M.; Maling, B.; Chamberlin, M. J., Physical and chemical characterization of two- and three-stranded adenine-thymine and adenine-uracil homopolymer complexes.

Journal of Molecular Biology 1966, 20 (2), 359-389.

78. Howard, F. B.; Frazier, J.; Lipsett, M. N.; Miles, H. T., Infrared demonstration of two- and three-strand helix formation between poly C and guanosine mononucleotides and oligonucleotides. Biochemical and Biophysical Research Communications 1964, 17

(1), 93-102.

79. Moser, H. E.; Dervan, P. B., Sequence-specific cleavage of double helical DNA by triple helix formation. Science 1987, 238 (4827), 645-650.

80. Beal, P. A.; Dervan, P. B., Second Structural Motif for Recognition of DNA by

Oligonucleotide-Directed Triple-Helix Formation. Science 1991, 251 (4999), 1360-1363.

81. Strobel, S. A.; Dervan, P. B., Single-Site Enzymatic Cleavage of Yeast Genomic

DNA Mediated by Triple Helix Formation. Nature; London 1991, 350 (6314), 172-4.

82. Lyamichev, V. I.; Mirkin, S. M.; Frank-Kamenetskii, M. D.; Cantor, C. R., A stable complex between homopyrimidine oligomers and the homologous regions of duplex DNAs. Nucleic Acids Research 1988, 16 (5), 2165-2187.

83. Radhakrishnan, I.; Patel, D. J., Solution structure of a purine·purine·pyrimidine

DNA triplex containing G·GC and T·AT triples. Structure 1993, 1 (2), 135-152.

84. Plum, G. E.; Park, Y. W.; Singleton, S. F.; Dervan, P. B.; Breslauer, K. J.,

Thermodynamic characterization of the stability and the melting behavior of a DNA triplex: a spectroscopic and calorimetric study. PNAS 1990, 87 (23), 9436-9440.

85. Soto, A. M.; Loo, J.; Marky, L. A., Energetic Contributions for the Formation of

TAT/TAT, TAT/CGC+, and CGC+/CGC+ Base Triplet Stacks. J. Am. Chem. Soc. 2002,

124 (48), 14355-14363.

86. Lee, H.-T.; Arciniegas, S.; Marky, L. A., Unfolding Thermodynamics of DNA

Pyrimidine Triplexes with Different Molecularities. J. Phys. Chem. B 2008, 112 (15),

4833-4840.

87. Li, Y.; Syed, J.; Sugiyama, H., RNA-DNA Triplex Formation by Long

Noncoding RNAs. Cell Chemical Biology 2016, 23 (11), 1325-1333.

88. Bacolla, A.; Wang, G.; Vasquez, K. M., New Perspectives on DNA and RNA

Triplexes As Effectors of Biological Activity. PLOS Genetics 2015, 11 (12).

89. Buske, F. A.; Mattick, J. S.; Bailey, T. L., Potential in vivo roles of nucleic acid triple-helices. RNA Biol 2011, 8 (3), 427-439.

90. Van Daele, I.; Bomholt, N.; Filichev, V. V.; Van Calenbergh, S.; Pedersen, E. B.,

Triplex Formation by Pyrene-Labelled Probes for Nucleic Acid Detection in

Fluorescence Assays. ChemBioChem 2008, 9 (5), 791-801.

91. Sato, T.; Sato, Y.; Nishizawa, S., Triplex-Forming Peptide Nucleic Acid Probe

Having Thiazole Orange as a Base Surrogate for Fluorescence Sensing of Double- stranded RNA. J. Am. Chem. Soc. 2016, 138 (30), 9397-9400.

92. Patterson, A.; Caprio, F.; Vallée-Bélisle, A.; Moscone, D.; Plaxco, K. W.;

Palleschi, G.; Ricci, F., Using Triplex-Forming Oligonucleotide Probes for the

Reagentless, Electrochemical Detection of Double-Stranded DNA. Anal. Chem. 2010, 82

(21), 9109-9115.

93. Boutorine, A. S.; Novopashina, D. S.; Krasheninina, O. A.; Nozeret, K.;

Venyaminova, A. G., Fluorescent Probes for Nucleic Acid Visualization in Fixed and

Live Cells. Molecules 2013, 18 (12), 15357-15397.

94. Muramatsu, T.; Nishikawa, K.; Nemoto, F.; Kuchino, Y.; Nishimura, S.;

Miyazawa, T.; Yokoyama, S., Codon and amino-acid specificities of a transfer RNA are both converted by a single post-transcriptional modification. Nature 1988, 336 (6195),

179-181.

95. Stadler, A. L.; Delos Santos, J. O.; Stensrud, E. S.; Dembska, A.; Silva, G. L.;

Liu, S.; Shank, N. I.; Kunttas-Tatli, E.; Sobers, C. J.; Gramlich, P. M. E.; Carell, T.;

Peteanu, L. A.; McCartney, B. M.; Armitage, B. A., Fluorescent DNA Nanotags

Featuring Covalently Attached Intercalating Dyes: Synthesis, Antibody Conjugation, and

Intracellular Imaging. Bioconjugate Chem. 2011, 22 (8), 1491-1502.

96. Dunkle, J. A.; Vinal, K.; Desai, P. M.; Zelinskaya, N.; Savic, M.; West, D. M.;

Conn, G. L.; Dunham, C. M., Molecular recognition and modification of the 30S ribosome by the aminoglycoside-resistance methyltransferase NpmA. PNAS 2014, 111

(17), 6275-6280.

97. Hoerter, J. A. H.; Walter, N. G., Chemical modification resolves the asymmetry of siRNA strand degradation in human blood serum. RNA 2007, 13 (11), 1887-1893.

98. Engelke, D. R.; Hopper, A. K., Modified View of tRNA: Stability amid Sequence

Diversity. Molecular Cell 2006, 21 (2), 144-145.

99. Motorin, Y.; Helm, M., tRNA Stabilization by Modified Nucleotides.

Biochemistry 2010, 49 (24), 4934-4944.

100. Yi, C.; Pan, T., Cellular Dynamics of RNA Modification. Acc. Chem. Res. 2011,

44 (12), 1380-1388.

101. Katz, L.; Penman, S., Association by hydrogen bonding of free nucleosides in non-aqueous solution. Journal of Molecular Biology 1966, 15 (1), 220-231.

102. Ono, A.; Torigoe, H.; Tanaka, Y.; Okamoto, I., Binding of metal ions by pyrimidine base pairs in DNA duplexes. Chemical Society Reviews 2011, 40 (12), 5855-

5866.

103. Takezawa, Y.; Shionoya, M., Metal-Mediated DNA Base Pairing: Alternatives to

Hydrogen-Bonded Watson–Crick Base Pairs. Acc. Chem. Res. 2012, 45 (12), 2066-2076.

104. Miyake, Y.; Togashi, H.; Tashiro, M.; Yamaguchi, H.; Oda, S.; Kudo, M.;

Tanaka, Y.; Kondo, Y.; Sawa, R.; Fujimoto, T.; Machinami, T.; Ono, A., MercuryII-

Mediated Formation of Thymine−HgII−Thymine Base Pairs in DNA Duplexes. J. Am.

Chem. Soc. 2006, 128 (7), 2172-2173.

105. Lüth, M. S.; Freisinger, E.; Lippert, B., Metal-Modified Nucleobase Pairs and

Triplets as Cytosine Receptors. Chem. Eur. J. 2001, 7 (10), 2104-2113.

106. Johannsen, S.; Megger, N.; Böhme, D.; Sigel, R. K. O.; Müller, J., Solution structure of a DNA double helix with consecutive metal-mediated base pairs. Nat Chem

2010, 2 (3), 229-234.

107. Tanaka, K.; Yamada, Y.; Shionoya, M., Formation of Silver(I)-Mediated DNA

Duplex and Triplex through an Alternative Base Pair of Pyridine Nucleobases. J. Am.

Chem. Soc. 2002, 124 (30), 8802-8803.

108. Okamoto, I.; Iwamoto, K.; Watanabe, Y.; Miyake, Y.; Ono, A., Metal-Ion

Selectivity of Chemically Modified Uracil Pairs in DNA Duplexes. Angewandte Chemie

International Edition 2009, 48 (9), 1648-1651.

109. White, S.; Szewczyk, J. W.; Turner, J. M.; Baird, E. E.; Dervan, P. B.,

Recognition of the four Watson–Crick base pairs in the DNA minor groove by synthetic ligands. Nature 1998, 391 (6666), 468-471.

110. Prins, L. J.; Reinhoudt, D. N.; Timmerman, P., Noncovalent Synthesis Using

Hydrogen Bonding. Angewandte Chemie International Edition 2001, 40 (13), 2382-2426.

111. Mignon, P.; Loverix, S.; Steyaert, J.; Geerlings, P., Influence of the π–π interaction on the hydrogen bonding capacity of stacked DNA/RNA bases. Nucleic Acids

Research 2005, 33 (6), 1779-1789.

112. Leist, R.; Frey, J. A.; Ottiger, P.; Frey, H.-M.; Leutwyler, S.; Bachorz, R. A.;

Klopper, W., Nucleobase–Fluorobenzene Interactions: Hydrogen Bonding Wins over π

Stacking. Angewandte Chemie International Edition 2007, 46 (39), 7449-7452.

113. Freier, S. M.; Altmann, K.-H., The ups and downs of nucleic acid duplex stability:

Structure-stability studies on chemically-modified DNA:RNA duplexes. Nucleic Acids

Research 1997, 25 (22), 4429-4443.

114. Matsuda, S.; Henry, A. A.; Schultz, P. G.; Romesberg, F. E., The Effect of Minor-

Groove Hydrogen-Bond Acceptors and Donors on the Stability and Replication of Four

Unnatural Base Pairs. J. Am. Chem. Soc. 2003, 125 (20), 6134-6139.

115. Tae, E. L.; Wu, Y.; Xia, G.; Schultz, P. G.; Romesberg, F. E., Efforts toward

Expansion of the Genetic Alphabet: Replication of DNA with Three Base Pairs. J. Am.

Chem. Soc. 2001, 123 (30), 7439-7440.

116. Brotschi, C.; Häberli, A.; Leumann, C. J., A Stable DNA Duplex Containing a

Non-Hydrogen-Bonding and Non-Shape-Complementary Base Couple: Interstrand

Stacking as the Stability Determining Factor. Angewandte Chemie International Edition

2001, 40 (16), 3012-3014.

117. Matray, T. J.; Kool, E. T., Selective and Stable DNA Base Pairing without

Hydrogen Bonds. J. Am. Chem. Soc. 1998, 120 (24), 6191-6192.

118. Moran, S.; Ren, R. X. F.; Rumney; Kool, E. T., Difluorotoluene, a Nonpolar

Isostere for Thymine, Codes Specifically and Efficiently for Adenine in DNA

Replication. J. Am. Chem. Soc. 1997, 119 (8), 2056-2057.

119. Guckian, K. M.; Kool, E. T., Highly Precise Shape Mimicry by a Difluorotoluene

Deoxynucleoside, a Replication-Competent Substitute for Thymidine. Angew. Chem. Int.

Ed. Engl. 1997, 36 (24), 2825-2828.

120. Dzantiev, L.; Alekseyev, Y. O.; Morales, J. C.; Kool, E. T.; Romano, L. J.,

Significance of Nucleobase Shape Complementarity and Hydrogen Bonding in the

Formation and Stability of the Closed Polymerase−DNA Complex. Biochemistry 2001,

40 (10), 3215-3221.

121. Matsuda, S.; Fillo, J. D.; Henry, A. A.; Rai, P.; Wilkens, S. J.; Dwyer, T. J.;

Geierstanger, B. H.; Wemmer, D. E.; Schultz, P. G.; Spraggon, G.; Romesberg, F. E.,

Efforts toward Expansion of the Genetic Alphabet: Structure and Replication of

Unnatural Base Pairs. J. Am. Chem. Soc. 2007, 129 (34), 10466-10473.

122. Lee, J. S.; Woodsworth, M. L.; Latimer, L. J. P.; Morgan, A. R., Poly(pyrimidine) poly(purine) synthetic DNAs containing 5-methylcytosine form stable triplexes at neutral pH. Nucleic Acids Research 1984, 12 (16), 6603-6614.

123. Xodo, L. E.; Manzini, G.; Quadrifoglio, F.; Marel, V. D.; A, G.; Boom, V.; H, J.,

Effect pf 5-methylcytosine on the stability of triple-stranded DNA—a thermodynamic study. Nucleic Acids Research 1991, 19 (20), 5625-5631.

124. Wang, S.; Xu, Y.; Kool, E. T., Recognition of RNA by triplex formation:

Divergent effects of pyrimidine C-5 methylation. Bioorganic & Medicinal Chemistry

1997, 5 (6), 1043-1050.

125. Malnuit, V.; Duca, M.; Benhida, R., Targeting DNA base pair mismatch with artificial nucleobases . Advances and perspectives in triple helix strategy. Organic &

Biomolecular Chemistry 2011, 9 (2), 326-336.

126. Stilz, H. U.; Dervan, P. B., Specific recognition of CG base pairs by 2- deoxynebularine within the purine.cntdot.purine.cntdot.pyrimidine triple-helix motif.

Biochemistry 1993, 32 (9), 2177-2185.

127. Lehmann, T. E.; Greenberg, W. A.; Liberles, D. A.; Wada, C. K.; Dervan, P. B.,

Triple-Helix Formation by Pyrimidine Oligonucleotides Containing Nonnatural

Nucleosides with Extended Aromatic Nucleobases: Intercalation from the major groove as a method for recognizing C·G and T · A base pairs. Helvetica Chimica Acta 1997, 80

(6), 2002-2022.

128. Sasaki, S.; Nakashima, S.; Nagatsugi, F.; Tanaka, Y.; Hisatome, M.; Maeda, M.,

Design of a novel artificial nucleobase for the selective formation of a triple-complex with a cytosine-guanine base pair. Tetrahedron Letters 1995, 36 (52), 9521-9524.

129. Rusling, D. A.; Powers, V. E. C.; Ranasinghe, R. T.; Wang, Y.; Osborne, S. D.;

Brown, T.; Fox, K. R., Four base recognition by triplex-forming oligonucleotides at physiological pH. Nucleic Acids Research 2005, 33 (9), 3025-3032.

130. Nagatsugi, F.; Matsuyama, Y.; Maeda, M.; Sasaki, S., Selective cross-linking to the adenine of the TA interrupting site within the triple helix. Bioorganic & Medicinal

Chemistry Letters 2002, 12 (3), 487-489.

131. Li, J.-S.; Fan, Y.-H.; Zhang, Y.; Marky, L. A.; Gold, B., Design of Triple Helix

Forming C-Glycoside Molecules. J. Am. Chem. Soc. 2003, 125 (8), 2084-2093.

132. Li, J.-S.; Chen, F.-X.; Shikiya, R.; Marky, L. A.; Gold, B., Molecular Recognition via Triplex Formation of Mixed Purine/Pyrimidine DNA Sequences Using OligoTRIPs.

J. Am. Chem. Soc. 2005, 127 (36), 12657-12665.

133. Branda, N.; Kurz, G.; Lehn, J.-M., JANUS WEDGES: a new approach towards nucleobase-pair recognition. Chemical Communications 1996, (21), 2443-2444.

134. Asadi, A.; Patrick, B. O.; Perrin, D. M., Janus-AT Bases: Synthesis, Self-

Assembly, and Solid State Structures. J. Org. Chem. 2007, 72 (2), 466-475.

135. Asadi, A.; Patrick, B. O.; Perrin, D. M., G^C Quartet — A DNA-Inspired Janus-

GC Heterocycle: Synthesis, Structural Analysis, and Self-Organization. J. Am. Chem.

Soc. 2008, 130 (39), 12860-12861.

136. Yang, H.-Z.; Pan, M.-Y.; Jiang, D.-W.; He, Y., Synthesis of Janus type nucleoside analogues and their preliminary bioactivity. Organic & Biomolecular Chemistry 2011, 9

(5), 1516-1522.

137. Artigas, G.; Marchán, V., Synthesis of Janus Compounds for the Recognition of

G-U Mismatched Nucleobase Pairs. J. Org. Chem. 2013, 78 (21), 10666-10677.

138. Arambula, J. F.; Ramisetty, S. R.; Baranger, A. M.; Zimmerman, S. C., A simple ligand that selectively targets CUG trinucleotide repeats and inhibits MBNL protein binding. Proceedings of the National Academy of Sciences of the United States of

America 2009, 106 (38), 16068-16073.

139. Shin, D.; Tor, Y., Bifacial Nucleoside as a Surrogate for Both T and A in Duplex

DNA. J. Am. Chem. Soc. 2011, 133 (18), 6926-6929.

140. Largy, E.; Liu, W.; Hasan, A.; Perrin, D. M., Base-Pairing Behavior of a

Carbocyclic Janus-AT Nucleoside Analogue Capable of Recognizing A and T within a

DNA Duplex. ChemBioChem 2013, 14 (16), 2199-2208.

141. Chen, D.; Meena; Sharma, S. K.; McLaughlin, L. W., Formation and Stability of a

Janus-Wedge Type of DNA Triplex. J. Am. Chem. Soc. 2004, 126 (1), 70-71.

142. Chen, H.; Meena; McLaughlin, L. W., A Janus-Wedge DNA Triplex with A-W1-

T and G-W2-C Base Triplets. J. Am. Chem. Soc. 2008, 130 (40), 13190-13191.

143. Avakyan, N.; Greschner, A. A.; Aldaye, F.; Serpell, C. J.; Toader, V.; Petitjean,

A.; Sleiman, H. F., Reprogramming the assembly of unmodified DNA with a small molecule. Nat Chem 2016, advance online publication.

144. Merrifield, R. B., Solid Phase Peptide Synthesis. I. The Synthesis of a

Tetrapeptide. J. Am. Chem. Soc. 1963, 85 (14), 2149-2154.

145. Buske, F. A.; Bauer, D. C.; Mattick, J. S.; Bailey, T. L., Triplexator: Detecting nucleic acid triple helices in genomic and transcriptomic data. Genome Res. 2012, 22 (7),

1372-1381.

146. Jain, A.; Wang, G.; Vasquez, K. M., DNA triple helices: Biological consequences and therapeutic potential. Biochimie 2008, 90 (8), 1117-1130.

147. Eckstein, F., Nucleoside Phosphorothioates. J. Am. Chem. Soc. 1966, 88 (18),

4292-4294.

148. Eckstein, F., Phosphorothioates, Essential Components of Therapeutic

Oligonucleotides. Nucleic Acid Therapeutics 2014, 24 (6), 374-387.

149. Latimer, L. J. P.; Hampel, K.; Lee, J. S., Synthetic repeating sequence DNAs containing plsosphorothioates: nuclease sensitivity and triplex formation. Nucleic Acids

Research 1989, 17 (4), 1549-1561.

150. Xodo, L.; Alunni-Fabbroni, M.; Manzini, G.; Quadrifoglio, F., Pyrimidine phosphorothioate oligonucleotides form triplestranded helices and promote transcription inhibition. Nucleic Acids Research 1994, 22 (16), 3322-3330.

151. Lacoste, J.; François, J.-C.; Hélène, C., Triple helix formation with purine-rich phosphorothioate-containing oligonucleotides covalently linked to an acridine derivative.

Nucleic Acids Research 1997, 25 (10), 1991-1998.

152. Cogoi, S.; Rapozzi, V.; Quadrifoglio, F.; Xodo, L., Anti-gene Effect in Live Cells of AG Motif Triplex-Forming Oligonucleotides Containing an Increasing Number of

Phosphorothioate Linkages. Biochemistry 2001, 40 (5), 1135-1143.

153. Joseph, J.; Kandala, J. C.; Veerapanane, D.; Weber, K. T.; Guntaka, R. V.,

Antiparallel polypurine phosphorothioate oligonucleotides form stable triplexes with the rat α1(I) collagen gene promoter and inhibit transcription in cultured rat fibroblasts.

Nucleic Acids Research 1997, 25 (11), 2182-2188.

154. Gryaznov, S.; Chen, J.-K., Oligodeoxyribonucleotide N3ˈ.fwdarw.P5ˈ

Phosphoramidates: synthesis and Hybridization Properties. J. Am. Chem. Soc. 1994, 116

(7), 3143-3144.

155. Chen, J.-K.; Schultz, R. G.; Lioyd, D. H.; Gryaznov, S. M., Synthesis of oligodeoxyribonucleotide N3′→P5′ phosphoramidates. Nucleic Acids Research 1995, 23

(14), 2661-2668.

156. Schultz, R. G.; Gryaznov, S. M., Oligo-2′-Fluoro-2′-Deoxynucleotide N3′→P5′

Phosphoramidates: Synthesis and Properties. Nucleic Acids Research 1996, 24 (15),

2966-2973.

157. Mignet, N.; Gryaznov, S. M., Zwitterionic oligodeoxyribonucleotide N3′→P5′ phosphoramidates: Synthesis and properties. Nucleic Acids Research 1998, 26 (2), 431-

438.

158. Tarköy, M.; Bolli, M.; Leumann, C., Nucleic-Acid Analogues with Restricted

Conformational Flexibility in the Sugar-Phosphate Backbone (‘bicyclo-DNA’). Part 3.

Synthesis, pairing properties, and calorimetric determination of duplex and triplex stability of decanucleotides from [(3′S,5′R)-2′-deoxy-3′,5′- ethano-β -D- ribofuranosyl]adenine and -thymine. Helvetica Chimica Acta 1994, 77 (3), 716-744.

159. Wang, S.; Kool, E. T., Relative stabilities of triple helices composed of combinations of DNA, RNA and 2'- O -methyl-RNA backbones: chimeric circular oligonucleotides as probes. Nucleic Acids Research 1995, 23 (7), 1157-1164.

160. Shimizu, M.; Konishi, A.; Shimada, Y.; Inoue, H.; Ohtsuka, E., Oligo(2′-O- methyl)ribonucleotides Effective probes for duplex DNA. FEBS Letters 1992, 302 (2),

155-158.

161. Nielsen, P.; Dreiøe, L. H.; Wengel, J., Synthesis and evaluation of oligodeoxynucleotides containing acyclic nucleosides: Introduction of three novel analogues and a summary. Bioorganic & Medicinal Chemistry 1995, 3 (1), 19-28.

162. Langkjær, N.; Pasternak, A.; Wengel, J., UNA (unlocked nucleic acid): A flexible

RNA mimic that allows engineering of nucleic acid duplex stability. Bioorganic &

Medicinal Chemistry 2009, 17 (15), 5420-5425.

163. Koshkin, A. A.; Singh, S. K.; Nielsen, P.; Rajwanshi, V. K.; Kumar, R.;

Meldgaard, M.; Olsen, C. E.; Wengel, J., LNA (Locked Nucleic Acids): Synthesis of the adenine, cytosine, guanine, 5-methylcytosine, thymine and uracil bicyclonucleoside monomers, oligomerisation, and unprecedented nucleic acid recognition. Tetrahedron

1998, 54 (14), 3607-3630.

164. Obika, S.; Nanbu, D.; Hari, Y.; Morio, K.-i.; In, Y.; Ishida, T.; Imanishi, T.,

Synthesis of 2′-O,4′-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C3, -endo sugar puckering. Tetrahedron Letters 1997, 38 (50), 8735-8738.

165. Torigoe, H.; Hari, Y.; Sekiguchi, M.; Obika, S.; Imanishi, T., 2′-O,4′-C-

Methylene Bridged Nucleic Acid Modification Promotes Pyrimidine Motif Triplex DNA

Formation at Physiological pH THERMODYNAMIC AND KINETIC STUDIES. J. Biol.

Chem. 2001, 276 (4), 2354-2360.

166. Obika, S.; Uneda, T.; Sugimoto, T.; Nanbu, D.; Minami, T.; Doi, T.; Imanishi, T.,

2′-O,4′-C-methylene bridged nucleic acid (2′,4′-BNA): synthesis and triplex-forming properties1. Bioorganic & Medicinal Chemistry 2001, 9 (4), 1001-1011.

167. Koizumi, M.; Morita, K.; Daigo, M.; Tsutsumi, S.; Abe, K.; Obika, S.; Imanishi,

T., Triplex formation with 2′‐O,4′‐C‐ethylene‐bridged nucleic acids (ENA) having C3′‐ endo conformation at physiological pH. Nucleic Acids Research 2003, 31 (12), 3267-

3273.

168. Brunet, E.; Corgnali, M.; Perrouault, L.; Roig, V.; Asseline, U.; Sørensen, M. D.;

Babu, B. R.; Wengel, J.; Giovannangeli, C., Intercalator conjugates of pyrimidine locked nucleic acid-modified triplex-forming oligonucleotides: improving DNA binding properties and reaching cellular activities. Nucleic Acids Research 2005, 33 (13), 4223-

4234.

169. Martínez-Montero, S.; Deleavey, G. F.; Martín-Pintado, N.; Fakhoury, J. F.;

González, C.; Damha, M. J., Locked 2′-Deoxy-2′,4′-Difluororibo Modified Nucleic

Acids: Thermal Stability, Structural Studies, and siRNA Activity. ACS Chem. Biol. 2015.

170. Hernandez, F. J.; Kalra, N.; Wengel, J.; Vester, B., Aptamers as a model for functional evaluation of LNA and 2′-amino LNA. Bioorganic & Medicinal Chemistry

Letters 2009, 19 (23), 6585-6587.

171. Kumar, T. S.; Madsen, A. S.; Østergaard, M. E.; Sau, S. P.; Wengel, J.; Hrdlicka,

P. J., Functionalized 2′-Amino-α-L-LNA: Directed Positioning of Intercalators for DNA

Targeting. J. Org. Chem. 2009, 74 (3), 1070-1081.

172. Campbell, M. A.; Wengel, J., Locked vs. unlocked nucleic acids (LNAvs.UNA): contrasting structures work towards common therapeutic goals. Chemical Society

Reviews 2011, 40 (12), 5680-5689.

173. Hrdlicka, P. J.; Babu, B. R.; Sørensen, M. D.; Harrit, N.; Wengel, J., Multilabeled

Pyrene-Functionalized 2‘-Amino-LNA Probes for Nucleic Acid Detection in

Homogeneous Fluorescence Assays. J. Am. Chem. Soc. 2005, 127 (38), 13293-13299.

174. Babu, B. R.; Hrdlicka, P. J.; McKenzie, C. J.; Wengel, J., Optimized DNA targeting using N,N-bis(2-pyridylmethyl)-β-alanyl 2′-amino-LNA. Chemical

Communications 2005, (13), 1705-1707.

175. Lou, C.; Samuelsen, S. V.; Christensen, N. J.; Vester, B.; Wengel, J.,

Oligonucleotides Containing Aminated 2′-Amino-LNA Nucleotides: Synthesis and

Strong Binding to Complementary DNA and RNA. Bioconjugate Chem. 2017.

176. Kumar, T. S.; Madsen, A. S.; Wengel, J.; Hrdlicka, P. J., Synthesis and

Hybridization Studies of 2‘-Amino-α-L-LNA and Tetracyclic “Locked LNA”. J. Org.

Chem. 2006, 71 (11), 4188-4201.

177. Kumar, T. S.; Madsen, A. S.; Østergaard, M. E.; Wengel, J.; Hrdlicka, P. J.,

Nucleic Acid Structural Engineering Using Pyrene-Functionalized 2′-Amino-α-L-LNA

Monomers and Abasic Sites. J. Org. Chem. 2008, 73 (18), 7060-7066.

178. Kumar, N.; Nielsen, K. E.; Maiti, S.; Petersen, M., Triplex Formation with α-L-

LNA (α-l-Ribo-Configured Locked Nucleic Acid). J. Am. Chem. Soc. 2006, 128 (1), 14-

15.

179. Lipfert, J.; Doniach, S.; Das, R.; Herschlag, D., Understanding Nucleic Acid–Ion

Interactions. Annual review of biochemistry 2014, 83, 813-841.

180. Tan, Z.-J.; Chen, S.-J., Nucleic Acid Helix Stability: Effects of Salt

Concentration, Cation Valence and Size, and Chain Length. Biophysical Journal 2006,

90 (4), 1175-1190.

181. Atsumi, N.; Ueno, Y.; Kanazaki, M.; Shuto, S.; Matsuda, A., Nucleosides and nucleotides. Part 214: thermal stability of triplexes containing 4′α-C-Aminoalkyl-2′- deoxynucleosides. Bioorganic & Medicinal Chemistry 2002, 10 (9), 2933-2939.

182. Buchini, S.; Leumann, C. J., Stable and Selective Recognition of Three Base Pairs in the Parallel Triple-Helical DNA Binding Motif. Angewandte Chemie International

Edition 2004, 43 (30), 3925-3928.

183. Cuenoud, B.; Casset, F.; Hüsken, D.; Natt, F.; Wolf, R. M.; Altmann, K.-H.;

Martin, P.; Moser, H. E., Dual Recognition of Double-Stranded DNA by 2′-

Aminoethoxy-Modified Oligonucleotides. Angewandte Chemie International Edition

1998, 37 (9), 1288-1291.

184. Blommers, M. J. J.; Natt, F.; Jahnke, W.; Cuenoud, B., Dual Recognition of

Double-Stranded DNA by 2‘-Aminoethoxy-Modified Oligonucleotides: The Solution

Structure of an Intramolecular Triplex Obtained by NMR Spectroscopy. Biochemistry

1998, 37 (51), 17714-17725.

185. Sollogoub, M.; Dominguez, B.; Fox, K. R.; Brown, T., Synthesis of a novel bis- amino-modified thymidinemonomer for use in DNA triplex stabilisation. Chemical

Communications 2000, (23), 2315-2316.

186. Osborne, S. D.; Powers, V. E. C.; Rusling, D. A.; Lack, O.; Fox, K. R.; Brown,

T., Selectivity and affinity of triplex-forming oligonucleotides containing 2′- aminoethoxy-5-(3-aminoprop-1-ynyl)uridine for recognizing AT base pairs in duplex

DNA. Nucleic Acids Research 2004, 32 (15), 4439-4447.

187. Sollogoub, M.; Darby, R. A. J.; Cuenoud, B.; Brown, T.; Fox, K. R., Stable DNA

Triple Helix Formation Using Oligonucleotides Containing 2‘-Aminoethoxy,5- propargylamino-U. Biochemistry 2002, 41 (23), 7224-7231.

188. Basye, J.; Trent, J. O.; Gao, D.; Ebbinghaus, S. W., Triplex formation by morpholino oligodeoxyribonucleotides in the HER-2/neu promoter requires the pyrimidine motif. Nucleic Acids Research 2001, 29 (23), 4873-4880.

189. Häberli, A.; Leumann, C. J., Synthesis of Pyrrolidine C-Nucleosides via Heck

Reaction. Organic Letters 2001, 3 (3), 489-492.

190. Häberli, A.; Leumann, C. J., DNA Binding Properties of Oligodeoxynucleotides

Containing Pyrrolidino C-Nucleosides. Organic Letters 2002, 4 (19), 3275-3278.

191. Aerschot Van, A.; Verheggen, I.; Hendrix, C.; Herdewijn, P., 1,5-Anhydrohexitol

Nucleic Acids, a New Promising Antisense Construct. Angew. Chem. Int. Ed. Engl. 1995,

34 (12), 1338-1339.

192. Hendrix, C.; Rosemeyer, H.; Verheggen, I.; Van Aerschot, A.; Seela, F.;

Herdewijn, P., 1′, 5′ -Anhydrohexitol Oligonucleotides: Synthesis, Base Pairing and

Recognition by Regular Oligodeoxyribonucleotides and Oligoribonucleotides. Chem.

Eur. J. 1997, 3 (1), 110-120.

193. Zarra, R.; Montesarchio, D.; Coppola, C.; Bifulco, G.; Di Micco, S.; Izzo, I.; De

Riccardis, F., Design, Synthesis, and Hybridisation of Water-Soluble, Peptoid Nucleic

Acid Oligomers Tagged with Thymine. European Journal of Organic Chemistry 2009,

2009 (35), 6113-6120.

194. Filichev, V. V.; Pedersen, E. B., Stable and Selective Formation of Hoogsteen-

Type Triplexes and Duplexes Using Twisted Intercalating Nucleic Acids (TINA)

Prepared via Postsynthetic Sonogashira Solid-Phase Coupling Reactions. J. Am. Chem.

Soc. 2005, 127 (42), 14849-14858.

195. Zhang, L.; Peritz, A.; Meggers, E., A Simple Glycol Nucleic Acid. J. Am. Chem.

Soc. 2005, 127 (12), 4174-4175.

196. Sasaki, S.; Yamauchi, H.; Takahasi, R.; Taniguchi, Y.; Maeda, M., New base analogs for the formation of non-natural triplexes. Nucleic Acids Symp Ser (Oxf) 2001, 1

(1), 23-24.

197. Christensen, U. B.; Pedersen, E. B., Intercalating nucleic acids containing insertions of 1‐ O ‐(1‐pyrenylmethyl)glycerol: stabilisation of dsDNA and discrimination of DNA over RNA. Nucleic Acids Research 2002, 30 (22), 4918-4925.

198. Cassidy, F.; Jones, A. S., Synthetic analogues of polynucleotides—I. The synthesis and properties of copolymers of 5′-o-acrylylthymidine and 5′-o-acrylyluridine with acrylamide. European Polymer Journal 1966, 2 (4), 319-328.

199. Jones, A. S.; Taylor, N., Synthetic Analogues of Polynucleotides: Interaction of a

Polymeric Adenine Derivative with DNA. Nature 1967, 215 (5100), 505-506.

200. Jones, A. S., Synthetic analogues of nucleic acids — a review. International

Journal of Biological Macromolecules 1979, 1 (5), 194-207.

65 minute]-dideoxy-erythro-pentonucleosides) containing 3[prime or minute](O)[rightward arrow] 5[prime or minute](C) acetamidate linkages. Journal of the Chemical Society,

Perkin Transactions 1 1979, (0), 1389-1394.

202. Boguslawski, S.; Olson, P. E.; Mertes, M. P., Mechanism of stimulation of in vitro protein synthesis by some copolymers of styrene, vinyluracil, and vinyladenine with maleic acid and acrylic acid. Biochemistry 1976, 15 (16), 3536-3540.

203. Kaye, H., Nucleic acid analogs. Interaction of poly-9-vinyladenine with polyuridylic acid. J. Am. Chem. Soc. 1970, 92 (19), 5777-5779.

204. McHale, R.; O’Reilly, R. K., Nucleobase Containing Synthetic Polymers:

Advancing Biomimicry via Controlled Synthesis and Self-Assembly. Macromolecules

2012, 45 (19), 7665-7675.

205. Eschenmoser, A., Chemical Etiology of Nucleic Acid Structure. Science 1999,

284 (5423), 2118-2124.

206. Lo, P. K.; Sleiman, H. F., Synthesis and Molecular Recognition of Conjugated

Polymer with DNA-Mimetic Properties. Macromolecules 2008, 41 (15), 5590-5603.

207. Zhou, Z.; Xia, X.; Bong, D., Synthetic Polymer Hybridization with DNA and

RNA Directs Nanoparticle Loading, Silencing Delivery, and Aptamer Function. J. Am.

Chem. Soc. 2015, 137 (28), 8920-8923.

208. Nielsen, P. E., Peptide Nucleic Acid. A Molecule with Two Identities. Acc. Chem.

Res. 1999, 32 (7), 624-630.

209. Nielsen, P. E.; Egholm, M.; Berg, R. H.; Buchardt, O., Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide.

Science 1991, 254 (5037), 1497-1500.

210. Egholm, M.; Buchardt, O.; Christensen, L.; Behrens, C.; Freier, S. M.; Driver, D.

A.; Berg, R. H.; Kim, S. K.; Norden, B.; Nielsen, P. E., PNA hybridizes to complementary oligonucleotides obeying the Watson-Crick hydrogen-bonding rules.

Nature; London 1993, 365 (6446), 566-8.

211. Egholm, M.; Behrens, C.; Christensen, L.; Berg, R. H.; Nielsen, P. E.; Buchardt,

O., Peptide nucleic acids containing adenine or guanine recognize thymine and cytosine in complementary DNA sequences. J. Chem. Soc., Chem. Commun. 1993, (9), 800-801.

212. Egholm, M.; Nielsen, P. E.; Buchardt, O.; Berg, R. H., Recognition of guanine and adenine in DNA by cytosine and thymine containing peptide nucleic acids (PNA). J.

Am. Chem. Soc. 1992, 114 (24), 9677-9678.

213. Wittung, P.; Nielsen, P. E.; Buchardt, O.; Egholm, M.; Norde´n, B., DNA-like double helix formed by peptide nucleic acid. Nature 1994, 368 (6471), 561-563.

214. Brown, S. C.; Thompson, S. A.; Veal, J. M.; Davis, D. G., NMR Solution

Structure of a Peptide Nucleic Acid Complexed with RNA. Science 1994, 265 (5173),

777-780.

215. Betts, L.; Josey, J. A.; Veal, J. M.; Jordan, S. R., A Nucleic Acid Triple Helix

Formed by a Peptide Nucleic Acid-DNA Complex. Science 1995, 270 (5243), 1838-

1841.

216. Eriksson, M.; Nielsen, P. E., Solution structure of a peptide nucleic acid–DNA duplex. Nat Struct Mol Biol 1996, 3 (5), 410-413.

217. Peffer, N. J.; Hanvey, J. C.; Bisi, J. E.; Thomson, S. A.; Hassman, C. F.; Noble, S.

A.; Babiss, L. E., Strand-invasion of duplex DNA by peptide nucleic acid oligomers.

Proceedings of the National Academy of Sciences of the United States of America 1993,

90 (22), 10648-10652.

218. Wittung, P.; Nielsen, P.; Nordén, B., Direct Observation of Strand Invasion by

Peptide Nucleic Acid (PNA) into Double-Stranded DNA. J. Am. Chem. Soc. 1996, 118

(30), 7049-7054.

219. Bentin, T.; Nielsen, P. E., Superior Duplex DNA Strand Invasion by Acridine

Conjugated Peptide Nucleic Acids. J. Am. Chem. Soc. 2003, 125 (21), 6378-6379.

220. Lohse, J.; Dahl, O.; Nielsen, P. E., Double duplex invasion by peptide nucleic acid: A general principle for sequence-specific targeting of double-stranded DNA. PNAS

1999, 96 (21), 11804-11808.

221. Hansen, M. E.; Bentin, T.; Nielsen, P. E., High-affinity triplex targeting of double stranded DNA using chemically modified peptide nucleic acid oligomers. Nucleic Acids

Research 2009, 37 (13), 4498-4507.

222. Vysabhattar, R.; Ganesh, K. N., Cyanuryl peptide nucleic acid: synthesis and

DNA complexation properties. Tetrahedron Letters 2008, 49 (8), 1314-1318.

223. Lenzi, A.; Reginato, G.; Taddei, M.; Trifilieff, E., Solid phase synthesis of a self complementary (antiparallel) chiral peptidic nucleic acid strand. Tetrahedron Letters

1995, 36 (10), 1717-1718.

224. Diederichsen, U., Pairing Properties of Alanyl Peptide Nucleic Acids Containing an Amino Acid Backbone with Alternating Configuration. Angew. Chem. Int. Ed. Engl.

1996, 35 (4), 445-448.

225. Huang, Y.; Dey, S.; Zhang, X.; Sönnichsen, F.; Garner, P., The α-Helical Peptide

Nucleic Acid Concept: Merger of Peptide Secondary Structure and Codified Nucleic

Acid Recognition. J. Am. Chem. Soc. 2004, 126 (14), 4626-4640.

226. Mittapalli, G. K.; Reddy, K. R.; Xiong, H.; Munoz, O.; Han, B.; De Riccardis, F.;

Krishnamurthy, R.; Eschenmoser, A., Mapping the Landscape of Potentially Primordial

Informational Oligomers: Oligodipeptides and Oligodipeptoids Tagged with Triazines as

Recognition Elements. Angewandte Chemie International Edition 2007, 46 (14), 2470-

2477.

227. Mittapalli, G. K.; Osornio, Y. M.; Guerrero, M. A.; Reddy, K. R.; Krishnamurthy,

R.; Eschenmoser, A., Mapping the Landscape of Potentially Primordial Informational

Oligomers: Oligodipeptides Tagged with 2,4-Disubstituted 5-Aminopyrimidines as

Recognition Elements. Angewandte Chemie International Edition 2007, 46 (14), 2478-

2484.

228. Zeng, Y.; Pratumyot, Y.; Piao, X.; Bong, D., Discrete Assembly of Synthetic

Peptide–DNA Triplex Structures from Polyvalent Melamine–Thymine Bifacial

Recognition. J. Am. Chem. Soc. 2012, 134 (2), 832-835.

229. Xia, X.; Piao, X.; Fredrick, K.; Bong, D., Bifacial PNA Complexation Inhibits

Enzymatic Access to DNA and RNA. ChemBioChem 2014, 15 (1), 31-36.

230. Xia, X.; Piao, X.; Bong, D., Bifacial Peptide Nucleic Acid as an Allosteric Switch for Aptamer and Ribozyme Function. J. Am. Chem. Soc. 2014, 136 (20), 7265-7268.

Chapter 2: bPNA promoted kissing-loops

2.1 INTRODUCTION TO KISSING-LOOPS:

The hairpin motif, also called a stem-loop motif is one of the most common secondary structures in nucleic acids.1 Hairpins are formed when two complementary nucleic acid sequences within the same oligo nucleic acid hybridize to form a duplex with a single stranded sequence connecting the two strands at one end of the duplex (Figure

24A). The intervening unhybridized loop displays information-rich nucleobases which engage in a wide variety of recognition events with proteins, small molecules, and other nucleic acids. The loop region can hybridize with single stranded nucleic acids through

Watson-Crick type interactions such as the binding between the anticodon loop of tRNA and mRNA inside the ribosome.2 Alternatively, two hairpins could hybridize with one another by Watson-Crick base pairing to form a duplex with the two loop regions and this has been termed a “kissing” loop complex (Figure 24B). Kissing complex formation can occur with as few as two bps3-7 and has a very strong Mg2+ dependence.8-15 The Mg2+ ion sits in a pocket at the kissing-loop interface, stabilizing the loop-loop duplex by minimizing the charge repulsion of the nucleic acid backbones.8-10

Loop-loop interactions can form intramolecularly and help to stabilize the tertiary structure of nucleic acids. This is best exemplified in the very first nucleic acid crystal structure, yeast phenylalanine tRNA, in which the canonical L-shape tertiary structure is stabilized via loop-loop interactions through the D-loop and T-loop hairpins (Figure

Figure 24: Structure of hairpins and kissing-loops. A) Intramolecular formation of a hairpin with duplex stem (red and blue squares) and single stranded loop (green squares). B) Kissing complex formation via Mg2+ dependent hybridization of single stranded loop regions between hairpins.

25B).16 In an example of kissing complexes in regulation of cellular processes, viral genomes often utilize intramolecular kissing-loops to stabilize their genome in order to obtain the necessary conformation for binding to target proteins. Disruption of these kissing-loops negatively disrupts viral mRNA levels and even inhibits infectivity.17-19

Catalytic RNA and riboswitches also depend on kissing-loop formation in order to achieve their function. Group II introns stabilize their tertiary structure with a kissing-loop between loops α and α’ in order to achieve splicing activity during regulation of gene expression.20

Similarly, Neurospora Varkud satellite ribozyme requires kissing-loop formation to induce

72 structural changes in the RNA21 and loss of the kissing-loop lowers ribozyme activity and favors cleavage over ligation (Figure 25A).22 Cells control gene expression through riboswitches which bind a small molecule in a process that monitors cellular concentrations of the ligand. As the concentration of small molecules change in a cell, a reversible binding event causes structural changes to the RNA and modulates gene expression. Often, riboswitches rely upon kissing-loops to fold and stabilize the pocket for ligand binding, and when these kissing-loops are abolished, riboswitch function is similarly abolished.23-26

From the examples above, it is shows that long range interactions through kissing-loop formation play important roles in cellular activities.

Figure 25: Intramolecular loop-loops interactions of Neurospora Varkud satellite ribozyme and tRNA. A) Intramolecular kissing-loop of Neurospora Varkud satellite ribozyme as indicated by dotted line. B) Intramolecular loop-loop interaction of tRNA as indicated by red box. Images take from reference.16, 21

Stem loops need not be part of the same nucleic acid to form a kissing-loop complex. Intermolecular loop-loop interactions have also been evolved to mediate important molecular recognition events in cellular and viral life cycles.27-28 There are many examples of intermolecular kissing-loops and a few interesting examples involve 73 retrovirus genomic RNA dimerization and antisense regulation.27, 29 Retroviruses carry two near identical copies of their RNA genome and often form homodimers of their genomic RNAs to allow for more efficient operations such recombination during reverse transcription, translation, and packaging.29-30 The dimerization initiation site (DIS) within the dimer linkage structure (DLS) of the HIV retroviral genome typically employs a stem- loop structure with a self-complementary loop sequence which allows homodimerization.

Retroviruses that utilize kissing-loops in genomic dimerization include HIV-130-31, HIV-

232, HTLV-I33, human foamy virus34, bovine leukaemia virus35, avian retroviruses36, HaSV,

MuSV and MoMuLV.29, 37-39 Kissing-loop formation has proven to be vital for HIV-1 and avian retroviruses dimerization, however, it does not sufficient enough to promote dimerization in other retroviruses which utilize further tertiary contacts.29 A discussion of the DIS in HIV-1 will follow below.

Cells utilize kissing-loop competent RNAs to control the copy number of genomic material.27-28 One such example of regulation in the production of genomic material is cis- encoded antisense RNAs which are produced from the same DNA locus as their target sequence and prime their target sequence for destruction. Being from the same DNA locus, the antisense sequence is perfectly complementary to their target’s sequence because the

DNAs they are transcribed from are complementary. These antisense RNAs work by affecting transcription, primer formation, and translation by causing conformational changes or creating persistent hybrids with sense RNAs. There are many examples throughout nature, but we will only highlight a few here involving kissing-loop complexes.

The first example involves translation of initiator protein RepA which is required for

74 replication of plasmid R1 (Figure 26C).40-41 RepA is translated from repA mRNA. CopA is an antisense RNA which binds to the stem-loop region CopT in the repA mRNA. CopA-

CopT hybridization is initiated by kissing-loop formation followed by reorganization into an extended duplex. The extended duplex is primed for digestion by nucleases which prevent overproduction of the RepA protein. The next example involves the expression of

RepR protein in Streptococcus agalactiae. RepR controls plasmid copy number through a role in the initiation complex during replication and is controlled by antisense RNAIII binding to the plasmid pIP501 (Figure 26A).42 Transcription of the repR gene is prevented via a multistep process which first involves kissing-loop complex formation and then duplex formation causing transcription abortion. Repression of RepA and RepR proteins involve priming of RNA target for destruction via RNA-RNA interactions. The next two examples require a protein to mediate the RNA-RNA binding event. An example of protein expression control by antisense RNA is the TraJ protein and antisense RNA FinP (Figure

26B).43 Antisense FinP is a small RNA with a stem-loop structure which binds to traJ mRNA, preventing translation. This RNA kissing complex is stabilized by another protein,

FinO which increase the half-life of the complex. It is thought to do so by a chaperone mechanism in which FinP is protected against degradation and duplex formation is promoted between sense and antisense RNA.44 The FinP-traJ interaction is an example in which two negative feedback controls are required for regulation, both a nucleic acid and a protein. Another example of protein-mediated antisense control of plasmid copy number can be found in E. coli (Figure 29).45-49 The ColE1 plasmid replication is primed by RNAII binding to the plasmid DNA followed an enzymatically catalyzed cleavage event to form

75 the mature primer. RNAII binding is controlled by antisense RNAI which induces a conformational change in RNAII preventing primer formation. The interaction between sense and antisense RNAs is mediated by kissing-loop formation between three complementary stem loop structures in each RNA. The protein Rop (or Rom) encoded in the plasmid then binds the kinetically unstable kissing complex to create a stable protein-

RNA complex. Again, two feed-back systems are employed to regulate plasmid production, both a nucleic acid and a protein. A more detailed discussion of the ColE1 kissing complex will follow below.

Figure 26: Cis-encoded antisense RNAs and their targets. This image shows intermolecular kissing-loop interactions used to control transcription, translation, and replication. A) Suppression of RepR protein production via duplex formation first initiated by RNAII and mRNA kissing-loop formation. B) Antisense FinP forms kissing-loop complex traJ mRNA which is stabilized by FinO. Duplex formation prevents translation. C) Cop A forms kissing complex with CopT in mRNA encoding repA. Duplex formation prevents expression of repA. Images from references.28, 40

Nature has adopted the kissing-loop interaction to form specific binding events with high affinity and it only makes sense that chemists would take advantage of this reliable interaction to create synthetic molecules. One such example by Scarabino and coworkers utilizes in vitro selection to create an aptamer for tRNA.50 Using an 80-nucleotide random library, they were able to pull out aptamers which were able to bind to the anticodon loop of the phenylalanine tRNA of Saccharomyces cerevisiae. These aptamers formed perfect kissing-loop complexes with Watson-Crick type interactions. A second set of aptamers complexed to the D-loop and T-loop showed improved affinity when the kissing complex between the D-loop and T-loop was abolished. Furthermore, a simple single-stranded complement did not bind to the anti-codon loop of the tRNA. Luc Jaeger and coworkers have utilized kissing-loops to engineer RNA-based materials.51-53 Using designed kissing- loop interactions based on HIV-1 DIS kissing-loop, they have been able to create 3 dimensional, cubic RNA scaffolds and two-dimensional programmable materials that can be used to coat surfaces. The complexity of their systems is possible due to the use of orthogonal loop sequences to ensure proper base pairing and reliable structuring. Finally, the Peixuan Guo group has created pRNA nanoparticles to deliver RNA based drugs using kissing-loop interactions.54-57 To create cyclic trimers and heptamers of small RNAs, orthogonal kissing-loop interactions were mutated into bacteriophage phi29 DNA packaging motor. These motors are then loaded with drug protein and associate with viral proteins to form the nano-delivery vehicle. The above examples are just a few attempts to use kissing-loops to design nucleic acid materials using naturally occurring motifs. Thanks

77 to databases which store structures and sequences, chemists can design nucleic acid structures and kissing-loops can serve as key motifs for non-covalent assembly.

2.1.1 HIV-1 DIMERIZATION INITIATION SITE:

Figure 27: DIS in the 5ˈ leader of the HIV genome. A) Dimerization initiation site of the HIV genome. B) Kissing-loop formed by DIS and loop sequences of various subtypes. Image taken from reference.29

Retroviruses, such as HIV-1, commonly have dimerized copies of genomic RNA which is thought to be tied to key events in the viral life cycle. The HIV-1 DIS, the structure responsible for dimerization, is in the DLS of the 5ˈ-leader (Figure 27). The DIS is thought to be a stem-loop with a palindromic loop sequence which allows for homodimerization

78 via kissing complex formation.13, 31, 58 The DIS stem-loop hybridization to dimeric RNA is controlled by an equilibrium in which the DIS is exposed for dimerization or unexposed for replication.59 When unexposed, the DIS is bound to an internal sequence known as the unique-5ˈ (U5). The conformation is believed to be controlled by the number of guanosines at the 5ˈ end of the leader (1G, 2G, or 3G) which causes a shift in base pairing.60 When exposed, the DIS displays a nine-nucleotide loop with two major sequences subtypes; subtype A (AGGUGCACA) and subtype B (AAGCGCGCA).61 Perturbations to the kissing-loop sequence have been found to be detrimental to dimerization. For example, alkylation of the phosphate groups and N7-methylation of the guanine residues completely abolishes dimerization.61 Furthermore, single mismatches in the loop sequences and unstructuring of the stem loop results in abolished dimerization.31, 62-63 However, compensatory mutations and strategically placed wobble bps allowed for the formation of homodimers while introduction of RNAs with complementary sequences resulted in heterodimers.31, 63 The unpaired purines flanking the self-complementary dimerization sequences have proven to be very important for dimerization.64 While DIS mutants with deletion of one of the flanking adenines on either the 5ˈ for 3ˈ side of the loop remain dimerization competent, deletion of two or more results in unstable dimerization.31, 63, 65

Mutations of the purines to uracil results in a dimerization competent mutant but alters the kinetics.65 Aptamers selected for dimerization competence also have provided evidence of the importance of the purine heterocycles.66-67 In these studies, adenines were selected preferentially in position 1, 2 and 9 due to an optimal sheared bp geometry. Substitution of an unpaired flanking base with another bp did not improve complex stability. The exact

79 role of these purine bases is still under debate though evidence supports that they interact in non-canonical interactions and base triples.68-69

The structure of the HIV DIS kissing complex has been studied by NMR, crystallography, and FRET. The structures presented in NMR and crystallography differ greatly in structural assignment (Figure 28). In the NMR presented by Parslow and coworkers, the duplex stems are not coaxially stacked onto the kissing-loop duplex.70 The planes of the kissing-loop’s bps are perpendicular to the bps in the stem duplex. The unpaired adenines are projected into the kissing-loop region forming non-canonical interactions with the base-paired palindromic sequence and partially stacked in an intermolecular fashion with one another. In the crystal structure published by Ehresmann and coworkers, the kissing-loop duplex is coaxially stacked onto the duplex stem with the bps in the kissing complex parallel to the bps in the stem.8 The unpaired adenines are bulged out to form crystal contacts in the form of a purine-zipper.71 Later crystal structures showed there was in fact a Mg2+ ion bound at the kissing-loop interface which could be displaced by spermine.71 The cation dependence was studied in depth in work by

Weixlbaumer and coworkers using UV-melting experiments.72 Their findings show a 4 kcal/mol more stable kissing duplex compared to a standard RNA helix and the phenomena is sequence independent. Furthermore, the Tm of the loop-loop complex is more ion dependent than a standard helix by a factor of 2 or more per bp. Conformational analysis using single-molecule FRET analysis of the kissing complex, with dyes covalently bound the termini of the stem loop duplexes, reveals a bent geometry.73 This bent geometry seems to agree with the solution structure presented by Parslow. The structure of the kissing

80 complex formed by the DIS of HIV-1 is understood thanks to the work described above, however, the actual structure within the context of the full RNA genome is not yet known.

Figure 28: Crystal and NMR structure of DIS dimer. Left) Crystal structure. Right) NMR structure. Images taken from references.8, 70

Due to the importance of this structure and the HIV-AIDS epidemic, the HIV-DIS has been studied as a possible drug target. Researchers have found success using various glycosides as drugs after noticing the similarities between the HIV-DIS kissing-loop and the site targeted by glycosides in bacterial ribosomal A site.74-78 Ennifar and coworkers were able to crystalize the DIS kissing complex with neamine, ribostamycin, neomycin, and lividomycin. These aminoglycosides were able to stabilize the kissing complex by

81 acting as a bridge, binding to both RNAs cooperatively.74 They also found that aminoglycoside binding inhibited extended duplex formation of the DIS hairpins.75

2.1.2 ColE1 KISSING COMPLEX:

Figure 29: Plasmid copy number control mechanism of the ColE1 plasmid. Primer maturation is inhibited by RNAI via kissing complex formation with RNAII which is stabilized by Rop protein. Image from reference.28

The kissing complex used in the process to control ColE1 plasmid replication is an intricate study on design dictating function. In the HIV DIS system, the kissing-loop complex is quick to form and very stable, as might be expected given its role as an anchor to bring two identical RNAs together to form a stable dimer for packaging. The kissing complex in the ColE1 system has been designed to control the copy number of the plasmid 82 and therefore must be not be persistent but able to adapt to the various conditions of the cell. Reversibility and carefully designed kinetics allow the cells to modulate plasmid production by forming and degrading the RNA kissing complex.79 Plasmid replication begins by the hybridization of RNAII, which is produced via transcription, to the plasmid at the origin site of replication (Figure 29).80 The DNA-RNA hybrid is then cleaved by

RNAase H to form the primer for DNA synthesis.80-82 As transcription proceeds, a small

RNA, RNAI, is produced on the opposite strand of DNA in the same location as RNAII.

RNAI controls the priming of the DNA template by binding to RNAII via three successive kissing-loop interactions.81 The kinetics of kissing-loop complexation is vastly different from the HIV DIS kissing-loop in that the kissing-loop complex is slow to form.83 A protein, called Rop, which is encoded in the plasmid, stabilizes the initial unstable kissing complex.45, 47 Rop is a 63-amino acid protein which dimerizes to form a four-helical bundle84 and has low affinity for the individual RNAs but high affinity for the kissing complex (Figure 30).85 Rop binds to the kissing complex using two phenylalanine side chains and polar interactions which appear to interact with a general shape of kissing complexes rather than a specific sequence.48, 86 Rop increases binding affinity by decreasing the dissociation rate of the kissing complex.48 This kissing complex forces

RNAII into a conformation which prevents hybridization to the plasmid and shuts down replication. Through this mechanism, plasmid copy number is controlled by the changing concentrations of two components. The kissing-loop complex is unstable and unable to completely shut down the replication process until enough Rop protein synthesis has

83 occurred in the cell. The levels of Rop would only be sufficient when plasmid copy number is sufficient.87

Figure 30: Structure of Rop as dimer in solution. Image from reference.86

The interesting behavior of the larger RNA transcripts lead to studies of individual

ColE1 hairpins. Tomizawa and Eguchi first noticed that when the three kissing-loops in the ColE1 complex were individually studied they did not have the same stability in spite of having the same G-C bp content and loop size.46 In later work, they showed that inverting the loop sequence of hairpin 1 increased complex stability 350 fold and simply swapping positions of 1 and 7 in the loop increased stability 133 fold. Furthermore, mutants with 6-membered and 8-membered loops were able to bind more efficiently than the wild type kissing-loop and were recognized by Rop.48 Crothers and Gregorian carried out further investigations into the loop sequence of ColE1 and confirmed the importance

84 of the identity of the nucleobase at positions 1 and 7 when they observed a 19°C increase in Tm for the inverted loop sequence and 15°C increase in Tm when position 1 and 7 were swapped.87 This effect seemed to be specific to G1-U7 sequence with a complementary

A1-C7 mutation in the binding partner. This sequence specificity may have something to do with preorganization within the stem loops of the wild type which destabilized the kissing complex and inter-strand interactions, which are present in the inverted loop, are not present in the wild type.87 Marino and Crothers have analyzed the structure of the individual hairpins by NMR and found a highly-structured loop in RNAI wild type, which supports this idea of a preorganized wild type stem-loop.88 Initial NMR solution structure

Figure 31: Solution structure ColE1 kissing-loop.

of the kissing complex of isolated stem-loops pointed to a fully base stacked, bent structure at the interface of hybridization with all seven nucleotides involved in Watson-Crick type base recognition (Figure 31).87 The bend is towards the major groove and allows for the continuous stacking of the bps. Critically, the inverse sequence has a purine-purine 85 stacking interaction at the stem-loop interface and this may be the key interaction for increased stability of the inverse loop sequence.89 The kissing loop for the ColE1 plasmid replication was selected to be meta-stable in order for copy number to be concentration dependent

Clearly hairpins and their kissing-loop complexes play a key role in numerous cellular activities across all cellular domains. Therefore, it would be of great use to develop biologically compatible systems capable of reporting, both in vitro and in vivo, on stem- loop life time, complexation, and localization within cells. We believe the bPNA triplex is a promising biotechnology that could fit this need based on the ease of synthesis of the bPNA peptides and tolerance of bPNA triplexes in functional nucleic acid. bPNA presents an easily modifiable molecule that can adorned with any functional molecule that is compatible with peptide synthesis. We have shown that as a duplex surrogate, bPNA triplexes are well tolerated in various functional nucleic acids, bPNA binds specifically to poly-U and poly-T domains, and is resistant to nucleases.90-94 It is therefore reasonable to expect that mutations of the duplex stem in hairpins to include a bPNA binding site would still be able to function as wild type hairpins in kissing complexes. To test this hypothesis, we chose to study two systems of kissing-loops modeled after the HIV-1 DIS and

ColE1kissing complexes. We chose these two systems to explore how triplex mutations affect kissing complexes with different loop sizes, and, in the case of the ColE1 system, how proteins such as Rop which interact with kissing-loop interfaces, bind to kissing complexes incorporating a bPNA triplex. This chapter will discuss various designs to achieve bPNA-supported kissing complexes and the characterization of these complexes.

2.2 HIV-DIS: EXPERIMENTAL DESIGNS AND RESULTS

Figure 32: Proposed experiment with mutated HIV-DIS hairpins. Hybridization of bPNA with U10 mutant would fold RNA into a hairpin structure which would induce kissing complex formation when Mg2+ is present.

The bPNA binding mutant HIV-DIS experimental design is shown in Figure 32.

We would mutate a stem-loop structure in the 5ˈ-leader sequence of the HIV genome called the HIV-DIS (nucleotides 240-280) by inserting the bPNA binding site, which is ten consecutive U-U mismatches, causing the hairpin to become unstructured. Upon addition of bPNA with the sequence G(EM)10, triplex formation would refold the RNA into the required stem-loop structure allowing for kissing-loop complex formation. Our initial design of the HIV-DIS system aimed at maintaining as much of the structure of the wild type stem-loop as possible (Figure 33) and we included the bulged region which separates the upper stem and lower stem. The loop region would have the sequence 5ˈ-

AAGCGCGCA-3ˈ with the 6-nucleobase palindromic sequence in the middle which would be able to form homodimers. We designed four variants of the mutated HIV-DIS in which the duplex stems of three of the hairpins would be mutated to have ten consecutive uracil bases while maintaining a G-C clamp at the triplex-loop interface to preserve the native structure of the loop. The designs included a lower stem modification (DIS-LS), upper stem modification (DIS-US), a positive control (DIS-PC), and negative control (DIS-NC)

(Figure 33). The most ambitious of the designs, DIS-US, would extend the upper stem to ten bases and place the triplex near the interface of the loop just below the G-C clamp. A more conservative design, DIS-LS, would extend the lower stem to ten bases with a G-C clamp before the bulge. The positive control, DIS-PC, would have the bPNA binding site appended onto the 3ˈ-end of the wild type hairpin. Finally, the negative control, DIS-NC, would have the same mutation to the upper stem as DIS-US but a non-complementary loop sequence would prevent dimerization.

Figure 33: Initial design of HIV-DIS mutants. This figure shows the structures of the initial designs of the mutate HIV-DIS systems. The upper stem, lower stem, bulge, and loop region are labeled on the wild type structure. The dots in the structures represent predicted bps.

The RNAs were produced via T7 transcription runoff from templates hybridized to a T7 primer, purified by denaturing acrylamide gel electrophoresis, and RNA stocks stored in water at -20°C. bPNA was prepared by solid phase synthesis, labeled with cyanine dyes and stored in water with 5 mM of sodium bicarbonate to increase solubility90. Samples were prepared by diluting stocks of RNA and bPNA into 1x dimerization buffer to appropriate concentrations, annealing at 95°C for 5 min, and snap cooling on ice for 5 min.

1x dimerization buffer was composed of 50 mM Tris-Cl pH=7.6, 10% glycerol, 250 mM

NaCl, and 5 mM MgCl2. Dimerization of the mutant hairpins were determined using native

PAGE assays in 1x TBM1 with 0.1 mM Mg2+. The result for dimerization experiments are shown in Figure 34.

As expected, the negative control showed no dimerization even at 10 μM and the positive control showed near complete dimerization even at 10 nM, the lowest concentration tested and visible by SYBR gold staining. DIS-LS also showed near

Figure 34: Dimerization of initial HIV-DIS system. This figure shows the dimerization efficiency, by native PAGE in TBM, of the various HIV-DIS mutants. Sample buffers contain 10 mM MgCl2 while running buffer contained 0.1 mM MgCl2. Concentration of unlabeled (EM)10 was 1:1 with U10 RNA. RNA was stained with SYBR gold.

complete dimerization, however, DIS-US would not completely dimerize even at high concentrations such as 20 μM. We found this a troubling result considering the literature

67 Kd of this system is 0.3 + 0.14 nM. This unstable dimerization could be due to the triplex either inducing a conformational change upon folding or disruption of important contacts within the kissing complex which destabilizes the system. Finding it difficult to drive the complexation to completion using higher Mg2+ concentrations (Using 1x TBM2 with 10 mM Mg2+), we turned our attention to forming heterodimers using loop sequences derived from an in vitro evolution by Lodmell and coworkers (Table ).67 We created five pairs of heterodimers, called DIS-HD#, with complementary sequences in positions 3 through 9 of the loop, leaving the flanking adenines intact, in the DIS-US scaffold. Heterodimers were 90 chosen as it would give us better control as to when dimerization would occur.

Unfortunately, all variants tested were unable to form stable heterodimers in our hands due to either homodimerization or incomplete dimerization (Table 1).

Table 1: Heterodimers in initial HIV-DIS system. This table shows the results of the native PAGE dimerization assay of heterodimeric DIS- HD#. The number in the name is simply a means to name the sequences. DIS Loop Sequence Heterodimerization Result

HD1 5ˈ-AAGCGCACA-3ˈ Failed Homodimerization

HD2 3ˈ-ACGCGTGAA-5ˈ

HD3 5ˈ-AAGUGGACA-3ˈ Failed Homodimerization

HD4 3ˈ-ACACCUGAA-5ˈ

HD5 5ˈ-AAGCAGGCA-3ˈ Failed Homodimerization

HD6 3ˈ-ACGUCCGAA-5ˈ

HD7 5ˈ-AACCUCCGA-3ˈ Failed Incomplete

HD8 3ˈ-AGGAGGCAA-5ˈ Dimerization

HD9 5ˈ-AACGCUUCA-3ˈ Failed Incomplete

HD10 3ˈ-AGCGAAGAA-5ˈ Dimerization

Following these disappointing results, we decided to completely redesign the system. One issue we wished to address, from a practical standpoint, was the low transcription efficiency of the RNA transcripts which caused major delays as material for the experiments required multiple transcriptions. It has been shown that using a tRNA 91 scaffold during in vivo RNA synthesis of small constructs greatly increased the yield of

RNA and we expected that in vitro T7 runoff transcription would also benefit from such a reliably transcribed scaffold.95 As small RNAs are very difficult to transcribe in vitro, we decided to mutate the anticodon stem of a tRNA scaffold by adding the bPNA binding site and loop sequence. Of course, the biggest issue to address was the inefficient dimerization, which could be attributed to disruption of a key structure at the loop and stem interface.

We decided to remove the G-C clamp at the stem-loop junction and simply bring the triplex into the loop sequence. The triplex mutant would have the body of the tRNA, a bPNA binding site in the anticodon stem, and a designed loop. We also performed a mutation to the tRNA scaffold incorporating the wild type duplex, to create a wild type mimic. Finally, we chose to create a heterodimer system with a more heterogeneous complementary loop sequence, 5ˈ-AAGCCCCGA-3ˈ and the complementary sequence 5ˈ-AACGGGGCA-3ˈ67 with the expectation of suppressing homodimerization (Figure 35).

Figure 35: Structures kissing-loop competent tRNA mutants. This figure shows the redesign of the mutant HIV-DIS. The sequence in red designates the tRNA scaffold while the sequence in black denotes the mutant DIS sequence.

We used the same conditions reported above for the synthesis, purification, and binding assays of the new RNA constructs. The redesigned mutants with tRNA scaffolds did in fact have higher yields in transcription efficiency. Perhaps more importantly, both duplex and triplex containing mutants showed efficient heterodimerization in kissing-loop assays ran on agarose gels in 1x TBM1 (Figure 36). We were able to visualize kissing complexes with the wild type mimics, mixed duplex-triplex heterodimers, and triplex- triplex heterodimers via a gel-shift assay. There is clear shift from a monomeric form to a discreet, slower moving heterodimeric complex. A negative control using a triplex containing tRNA mutant and duplex mutant with the same loop sequence showed no dimerization indicating dimerization occurs due to complementary loop sequences forming a kissing complex and not non-specific interactions between tRNA mutants (Supporting information, Figure 50 and 51). As kissing complexes are Mg2+ dependent, we were interested to examine if our mutant tRNA kissing complex could form without divalent cations. As expected, in buffers lacking Mg2+ in the reaction or gel complexation was suppressed (Supporting information, Figure 52 and 53). This result indicates the mutant kissing complexes also require Mg2+ to form stable heterodimeric complexes much like naturally occurring kissing-loops. To further characterize our mutant complexes and the role bPNA plays, we proceeded to radio label the mutant variants in order to determine their dissociation constants by native PAGE gel.

The results for Kd determination are shown in Figure 37. Literature value for the wild type loop was reported as 0.8 + 0.3 nM.67 The mutants designed to mimic the wild type complex have a dissociation constant in near agreement with the literature value

Figure 36: Heterodimerization of tRNA mutants. This figure shows the heterodimerization of tRNA mutants. The gels were electrophoresed using 1x TBM1 in agarose matrix. One tRNA was held at a constant concentration of 100 nM and the complementary tRNA titrated in. Complexes with U10 species are visualized using a Cy5 labeled bPNA in a 1:1 complex. The wild type mimic was imaged using a 32 P-labeld RNA and phosphorimager.

with a Kd of 2.4 + 0.6 nM. Confident in our design and assay, we then determined the dissociation constants of the U10 mutants with and without the presence of bPNA. Our findings indicate that the triplex is tolerated in the kissing complex. A duplex-triplex mutant heterodimer has a Kd of 9.3 + 2.0 nM which about 5-fold weaker than the wild type heterodimer. A triplex-triplex mutant heterodimer is 2-fold weaker than the duplex triplex kissing complex but is still a relatively strong binding interaction with a Kd of 18.5 + 3.2 94

Figure 37: Dissociation constants of tRNA mutants. This figure shows the dissociation constants for the various mutant tRNAs. The last two dissociation constants were determined without bPNA.

nM. To our surprise, the heterodimer between U10 tRNA and duplex tRNA without bPNA only showed a modest decrease in affinity with a Kd of 30.3 + 10.1 nM which is about 3- fold weaker than when bPNA is bound in the triplex. This surprisingly tight binding could be due to the tRNA body whose structuring may rescue what one would expect to be a crippled dimerization due to the increase in entropy of the unstructured U10 tRNA mutant.

A 2-fold decrease in binding affinity was observed in the U10-U10 tRNA dimerization without bPNA which we attribute to the somewhat less structured, larger loops. It should be noted that when bPNA is not incorporated, complexation of the tRNA is incomplete most likely due to an alternative structure incapable of forming a kissing complex. We also determined the apparent Kd for the loop sequences without the tRNA body and bPNA to be 14.4 + 3.7 nM, however two complex bands were formed. The small changes in Kd when bPNA is left out is consistent with Bouchard and Legault’s observation that kissing loops are no more stable than the theoretical stability of a corresponding duplex.96

Encouraged by these results, we began using the U10 tRNA mutants with fluorescently-labeled bPNA as reporting molecules to monitor the wild type tRNA mutants during kissing-loop formation, the results of which will be discussed in Chapter 3. With these results in hand, we turned our attention to a kissing-loop interaction with a more homogeneous loop sequence, the ColE1 kissing-loop.

2.3 ColE1 KISSING COMPLEX: EXPERIMENTAL DESIGNS AND RESULTS

The ColE1 kissing complex was chosen for a few key reasons: 1) the loop size was smaller, 2) the loop sequence was more homogeneous, 3) with three consecutive stem- loops capable of forming kissing complex, we assumed complex formation would be facile even in U10 mutants were weaker binding, and 4) interest in exploring if triplex insertion

Figure 38: Initial designs of ColE1 kissing complex mutants. This figure shows the mutations made to the proposed ColE1 kissing complex. A) The proposed wild type structure of the ColE1 kissing-loop from reference 46. Structure of Native sequence. B) Closed loop mutation of stem 1. C) Open loop mutation of stem 1.

96 would inhibit Rop binding to a kissing complex. Our two initial designs of the ColE1 system is shown in Figure 38. Two designs were considered with mutations taking place in the first stem loop of each construct RI-I and RII-I. The primary difference between the constructs is the loop-stem interface. RNAI and RNAII maintained the native structure in stem 1. RNAI CL an RNAII CL had the ten consecutive U-U mismatches in the stem with two G-C clamps at the stem and loop interface. RNAI OL and RNAII OL also had ten consecutive U-U mismatches but with an A-A mismatch at the loop and stem interface to provide more flexibility in the loop by increasing its size by two nucleotides. The constructs were again synthesized using T7 runoff transcription from PCR amplified templates and purified via gel electrophoresis. Dimerization of these constructs were tested via native PAGE binding assay in 1x TBM2 after incubation in a buffer containing 20 mM

Tris-Cl pH = 7.6, 100 mM NaCl, and 10 mM Mg2+. Dimerization of these constructs was again inefficient under our assay conditions (Figure 39). We had expected that three potential kissing-loops would be enough for effective complexation, however our designed constructs could not form the desired complexes efficiently. Poor complexation could arise through either improper base pairing or perhaps, without the larger body of the RNA constructs to provide proper spatial orientation, the mutants were not properly oriented to interact. Even with the addition of Rop to the reaction solution, we were not able to observe complete complexation in the gel assay (data not shown). As we were working on this system at the same time as the HIV-DIS system mentioned in the above section, we took the lessons from that successful attempt and redesigned the ColE1 mutants. Simplicity was again adopted and rather than three consecutive stem-loops in our construct, the new

Figure 39: Heterodimerization of ColE1 mutants. This figure shows the dimerization of the three loop ColE1 constructs. A) shows the dimerization of the wild type construct stained by SYBR gold. RNAII was titrated into RNAI. B) shows the dimerization of RNAI CL and RNAII CL visualized with Cy5 functionalized bPNA. RNA was incubated 1:1 with bPNA. RNA-triplexes were then mixed. C) shows the dimerization of RNAI OL and RNAII OL visualized with Cy5 functionalized bPNA. bPNA and RNAII OL were incubated together in 1:1 ratio. RNAI was titrated into RNAII OL.

designs would take the form of a single stem-loop similar to those studied in previous reports. Single hairpins from the ColE1 system, specifically stem-loop one, have shown to be efficient at kissing-loop formation and Rop binding.46, 48, 86-87 The redesign would

98 also have the triplex binding site brought up to the loop sequence without a clamp or extra nucleobase added to the loop to influence flexibility. As experiments with the new constructs would involve Rop, we avoided the tRNA scaffold to prevent steric blocking of

Rop binding or Rop binding to the intramolecular tRNA loop-loop interface. Finally,

RNAI-1’s construct would be clamped with two G-C pairs at the termini to prevent slippage in the structure as the ten U-U mismatches would run into the first two uracil nucleobases in the loop sequence. The newly designed ColE1 mutants are shown in Figure

40 and were chemically synthesized.

Figure 40: Design of ColE1 stem loop 1 mutants. This figure shows the single stem-loops designed for the ColE1 mutants. The hairpin design is derived from stem-loop 1 of RNAI and RNAII. RNAI-1U10 has two G-C clamps to ensure proper alignment.

With the new constructs in hand, we began testing them by studying their dimerization by native PAGE assay in 1x TBM2, which contained 10 mM Mg2+. Control experiments for non-specific dimerization showed no complexation when RNAI-1U10 was titrated into RNAI-1WT (Supporting information, Figure 60 and 61). Again, simplicity in design seemed to be key as we were able to observe dimerization of the wild type RNA

99 and U10 triplex hairpin, and the binding of the Rop protein to the mutant kissing complex

(Figure 41). Furthermore, we were able to observe dimerization between RNAI-1U10 and

RNAII-1U10 along with complexation of the Rop protein to the U10-U10 kissing complex

(Figure 42). Control experiments showed that Rop did not bind to U10 mutants alone

(Supporting information, Figure 62).

Figure 41: Dimerization of stem-loop 1 mutants of ColE1. Dimerization and binding of Rop to the ColE1 mutants. RNAI-1WT was held at 1 μM while RNAII-1WT (lanes 2-7) and RNAII-1U10 (lanes 8-13) were titrated in. For Rop complexation experiments, Rop was held at 10 μM.

Figure 42: Complexation of RNAI-1U10 and RNAII-1U10 with Rop. A) Kissing complex formation between RNAI-1U10 and RNAII-1U10 with RNAI-1U10 held constant at 500 nM and visualized using a Cy5 fluorescence from Cy5-bPNA. B) Rop complex formation between Rop and U10-U10 kissing complex with kissing complex held constant at 4 μM and visualized with Cy5 fluorescence.

100

Characterization of the various mutant complexes were performed using a gel shift assay (Figure 43 and 44). Literature Kd values for wild type system kissing complex is 200 nM without Rop and 1.5 nM in the presence of 10 μM Rop. We have determined the dissociation constant for the U10-WT kissing complex without Rop to be 3.1 + 3.9 nM at a concentration of 500 nM with a poor fit to our 1:1 binding model using a cyanine labeled bPNA to visualize the gel (Figure 43B and C). This value must be viewed with caution.

The gel shows two clear species in dimer region with a shift to one species at high concentrations of WT RNA. We believe these two bands to be caused by the dye projecting towards and away from the loop region (Figure 43A) based on radiolabeled gel-shift assays which shows only one band with unlabeled bPNA (Figure 43 E and F). Attempts were made to determine the apparent Kd, however the binding constant determination is also problematic at lower concentrations. At 200 nM and 100 nM, the fitting to the gel is still poor (data not shown). When the concentration of U10 RNA is dropped to 50 nM and the titration experiment is repeated with the cyanine labeled bPNA, the complex does not show a clear shift in the gel image but instead shows a concentration dependent decrease in band mobility even though our previous fitting provides a Kd of 3 nM (Figure 43D). It is possible that at the two different concentrations of our assays, the kinetic parameters of complexation differ due to a change in binding mechanism. For example, at high concentrations, the on and off rate of kissing loop complex formation may be compatible with the timescale of our gel shift assay, but the experiment may be too far above the Kd and provide a poor fitting. Conversely, at low concentrations the mechanism of association might change and the time scale of complex formation may be incompatible with the time

101 scale of the gel shift assay. Further kinetic and thermodynamic studies must be completed to decipher these results.

However, characterization of the other complexes was successful with our gel shift assay. The WT-U10 (0.33 + 0.07 nM) and WT-WT (1.5 nM) kissing complex have similar

Figure 43: Dissociation constant of RNAII-1U10 and RNAI-1WT. A) Hypothesized result of binding assay with dye-bPNA producing two complex bands for gel in panel C. B) Fitting of titration experiment at 500 nM in panel C to Equation 1. C) Gel shift of RNAII-1U10 and RNAI-WT visualized with Cy3 fluorescence at 500 nM. D) Gel shift of RNAII-11U10 and RNAI-WT visualized with Cy3 fluorescence at 50 nM. E) Predicted complexation result of binding assay with unlabled bPNA in panel F. F) Radiolabeled RNAI-1WT with RNAIIU10-(EM)10 showing only one complex band.

Kd values in the presence of Rop. Interestingly, the U10-U10 kissing complex formed a tighter kissing complex, with a Kd 4-fold smaller than the wild-type system (40.3 + 3.1 nM), however Rop did not show any stabilizing affect towards U10-U10 kissing complex formation. The 4-fold lower binding affinity was pleasantly surprising given the significant

102 structural differences in the triplex RNA compared to the wild type. Rop appears to recognize the shape of the WT-U10 kissing complex and bind but does not change the Kd value of the kissing complex formation. However, our results agree with Eguchi and

Tomizawa’s findings that stem sequence does not play a large role in the overall stability of the ColE1 kissing complex.46, 48 Our assays yielded dissociation constants for the Rop

Figure 44: Dissociation constants of ColE1 mutants. The figure shows the various dissociation constants for the mutant ColE1 hairpin. Literature values for wild type system were taken from reference 48. The brown bean represents Rop protein. Dissocation constants were obtained via gel shift assay and fitted according to the supporting material.

103 complex with the mutant kissing-loops U10-WT and U10-U10 to be 1.15 nM and 15.1 μM, respectively. We were also gratified to find that Rop was still able to recognize the single mutant kissing complexes with only a modest decrease (5-fold) in affinity for the WT-U10 complex in spite of the non-native triplex structure’s proximity to the protein binding location. The 80-fold decrease in affinity of Rop for the U10-U10 kissing complex could indicates a distortion in the kissing-loop structure in Rop’s binding footprint. As the affinity of the kissing complex did not change with Rop’s presence, the nature of the interaction could be different than mechanism of interaction observed in the wild type system. Alternatively, the mutant kissing complexes may be in a significantly different conformation than the wild type system, and upon the addition of Rop, the complex may reorganize to accommodate protein binding. In either case, the gel shift assay results coupled with Rop’s inability to alter the stability of U10-U10 kissing complex indicate Rop binds poorly when two mutations are introduced. Further structural analysis of the mutant kissing complexes must be performed to determine how Rop binds to the U10 mutant kissing loops.

We again studied the role of bPNA in the kissing complex formation. Without bPNA to refold the U10 mutant, the affinity of the wild type hairpin for the linear sequence was 227.1 nM which is nearly similar to the wild type kissing complex without Rop present. The results from the above experiments with our mutant ColE1 system gave us confidence that we could use the hairpin for fluorescent assays to detect wild type dimerization and kissing complexes between U10 mutants. A discussion of our fluorescent studies will follow in Chapter 3.

104

2.4 DISCUSSION AND CONCLUSIONS:

A quick lesson from these series of experiments is that simple designs yield the best answers. Major redesigns were necessary in order to achieve efficient kissing complex formation. Attempts to keep the loop and stem interface more “native” by closing the loop with a G-C pair to separate bPNA binding site from the loop was an inferior design compared to bringing the bPNA binding site directly into the loop.

From our experiments with the redesigned HIV-DIS we can speculate on the perturbations made to the kissing complex structure. The redesigned HIV-DIS system with tRNA scaffold maintained its reliance on divalent cations in spite of its heavily engineered design. This sensitivity to divalent cations indicates that we have maintained, to some extent, the binding pocket for the cation which is characteristic of kissing-loops. We were not surprised to see a 5-fold decrease in affinity upon insertion of the bPNA triplex in one stem of the kissing complex as the mutation could disrupt intermolecular interactions between RNAs. For example, in the NMR structure of HIV-DIS, the G-C pair at the loop- stem junction are not bp’ed but instead engage in non-canonical interactions with the unpaired adenine bases flanking the binding sequence in the loop and we may be deleting these interactions.70 Similarly, the crystal structure, while having the G-C bp’ed at the terminus of the stem, also has the unpaired adenine bases engaged in non-canonical interactions8 and insertion of the bPNA triplex may abolish these stabilizing interactions.

The bPNA triplex could also cause a misalignment of hydrogen bonds within in the

105 complex due to the larger size of the triplex. Another possibility is that the triplex may destabilize an already structured hairpin, which would lead to a greater entropic cost to form the kissing complex.

The ColE1 system provides a more complex picture to decipher due to its intricate kinetics and interactions with of Rop. The wild type system uses kinetically unstable kissing-loops leading to a 100-fold difference in dissociation constants when Rop is present. While we could determine Kd for insertion of one bPNA triplex in the presence of Rop, we were unable to determine a binding constant for the same kissing complex without Rop with confidence. In our experiments, a binding shift could be observed at 500 nM but not at 50 nM. This leads us to believe that the Kd would be between 500 nM and

50 nM, and that the kinetics of complex formation may not be as simple as duplex formation causing incompatibility with our assay. Interestingly, when a second triplex is substituted into the system, the complex binding appears to be dramatically affected, as stable complexation is observed without the presence of Rop. The U10-U10 triplex forms stable kissing complexes at low concentrations (40 nM) with higher affinity when compared to the wild type system studied by Tomizawa.48 The increase in affinity could be caused by the bPNA triplex re-structuring the loop, priming it for complexation.

Alternatively, the triplex may be affecting the kinetic parameters of the binding such as in the inverted loop mutant which presented superior affinity when compared the wild type loop. Nature evolved the ColE1 system to favor faster kinetics rather than tighter binding87 and future studies will have to be completed to see how the triplex mutants alter the kinetics of the system.

106

Rop has been shown to bind to kissing-loop complexes of various sizes in a sequence independent manner relying more on shape of the kissing complex rather than nucleobase composition.49, 86, 97-100 Rop appears able to recognize the kissing complex of both one and two triplex insertions, though binding is much weaker as the number of mutations increases. The fact that Rop recognizes the kissing complexes could indicate the triplex modified kissing complexes can adopt a conformation at the kissing interface similar to the wild type structure. Exactly how Rop affects kissing complex formation is not known for U10-WT kissing complex. Rop does not affect the formation of the U10-

U10 kissing complex formation and appears to only weakly bind to this mutant system.

However, given the fact that Rop has been shown to interact with the first three bps of the stem immediately after the loop46, binding of the protein with the mutant systems is remarkable. The bPNA triplex structure must be able to achieve a pseudo native-like structure for Rop to bind.

In the experiments presented above, bPNA was shown to promote kissing complex formation in the mutant tRNA system and ColE1 plasmid replication suppression system.

The presence of bPNA in the tRNA system improved the stability of the kissing complex by four-fold. In the case of the U10-U10 tRNA kissing-loop, with two less structured

29mer loop, the Kd is only 2-fold higher. On explanation could be the tRNA bodies provide some preorganization to the system, negating the entropic penalty that the less-structured system would pay during complexation without bPNA. However, kissing loops have been shown to be no more stable than a typical duplex, so a dramatic decrease in complex stability should not be expected when bPNA is omitted from the binding assay with mutant

107 kissing loops. The role of bPNA in the ColE1 system is less clear due to unusual binding observed in our gel assays. While the binding of the wild type hairpin to the unstructured

(no bPNA) U10 compliment approaches the literature value of the kissing-loop complex, bPNA’s effect on U10-WT kissing complex formation cannot be discovered until a Kd is determined. What is clear is that the triplex mutants form a tighter complex than the wild type.

With the work presented above, we have been able to show that bPNA-triplexes are capable of promoting kissing-loop complexes. Incorporation of the bPNA-triplexes influences kissing-loop stability in a case dependent manor as the HIV-DIS system shows a weaker complex but the ColE1 system shows a more stable complex. We have also shown that proteins which recognize kissing-loop complexes, such as Rop, are still able to bind to kissing complexes incorporating one or two bPNA triplexes. Additionally, this is the first example in which bPNA triplexes were incorporated into a protein binding sites without abolishing protein recognition. Based on the dependence of Mg2+ for kissing complex formation and Rop recognition, we have shown that the triplex kissing complexes retain at least some wild-type-like structure. Clearly thermodynamic and kinetic experiments must be performed on both kissing-loop systems to fully ascertain the impact of bPNA-triplexes in the context of kissing-loop complexes. However, with this work in hand, we began to ask the question: Can the bPNA triplex be used in directed chemistry within the context of a kissing-loop? Specifically, we wished to know if bPNA, modified with a fluorophore or fluorogen could be used to fluorescently monitor intermolecular

108

RNA interactions in vitro. We began to explore these concepts and our efforts are discussed in Chapter 3.

109

2.5 SUPPORTING INFORMATION CHAPTER 2

2.5.1 Materials and instrumentation

Chemicals for Fmoc-protected amino acids, peptide, acrylamide solutions and dye synthesis were purchased from Chem-Impex, TCI America, AAPPTec, and VWR and used without further purification. Rink Resin LS (100-200 mesh, 0.28 mmol/g) was purchased from CreoSalus. 40% acrylamide and bis-acrylamide solution (19:1), agarose, and

TEMED were purchased from Amerersco and Bio-Rad. Oligonucleotides were purchased from Integrated DNA technologies. Radioactive material was purchased from Perkin

Elmer. P30 spin columns were purchased from BioRad. SYBR gold was purchased from

Life Technologies. rNTPs were purchased from Sigma Aldrich. T4 PNK kinase was purchased from New England Biolabs. T7 polymerase and Pfu DNA polymerase enzymes were produced in house. Rop was generously donated from the lab of Professor Thomas

Magliery and was produced by Anusha Kumar and Kimberly Stephany from The Ohio

State University.

The concentration of all DNA/RNA oligomers and synthetic peptides was determined by UV absorbance using a Thermo Scientific Nanodrop 200c spectrophotometer. MALDI-TOF Mass spectra were acquired on Bruker Microflex

MALDI-TOF instrument. Electrospray ionization mass spectrometry (ESI) data were acquired on Bruker MicroTOF equipped with an ESI source. NMR spectra were acquired on Bruker Advance DPX 400 instrument. Solid phase peptide synthesis was performed on

AAPPTec Apex 396 peptide synthesizer. All peptides were purified on a Hitachi L-7150 pump, Hitachi D-7000 interface and Hitachi L-7400 UV detector on an AAPPTec RPC18

110 preparative HPLC column and the purity was confirmed on an AAPPTec RP-C18 analytical column. Data and curve fittings were performed on KaleidaGraph 4.0. Gel electrophoresis experiments were at least duplicated, analyzed and results averaged.

RNA and DNA sequences:

Table 2: RNA and DNA templates for kissing-loop forming nucleic acids. Name Sequence HD1Nat 5ˈ-tggcgcccgaacagggacttgaaccctggacccgcggccttgccgtcggggcttcagcaaggccgc tgctctaccgactgagctatccgggctatagtgagtcgtattaatttc -3ˈ HD2Nat 5ˈ-tggcgcccgaacagggacttgaaccctggacccgcggccttgccgtgccccgttcagcaaggccg ctgctctaccgactgagctatccgggctatagtgagtcgtattaatttc -3ˈ HD1U10 5ˈ-tggcgcccgaacagggacttgaaccctggacccgcggcaaaaaaaaaatcggggcttaaaaaaaaa agccgctgctctaccgactgagctatccgggctatagtgagtcgtattaatttc -3ˈ HD2U10 5ˈ-tggcgcccgaacagggacttgaaccctggacccgcggcaaaaaaaaaatgccccgttaaaaaaaa aagccgctgctctaccgactgagctatccgggctatagtgagtcgtattaatttc -3ˈ FP 5ˈ- tggcgcccgaacagggac -3ˈ RP 5ˈ- gaaattaatacgactcactatagcccg -3ˈ RNAI- 5ˈ- GCACCGUUGGUAGCGGUGC -3ˈ 1WT RNAI- 5ˈ- GGUUUUUUUUUUUUGGUAGUUUUUUUUUUCC -3ˈ 1U10 RNAII- 5ˈ- GCACCGCUACCAACGGUGC -3ˈ 1WT RNAII- 5ˈ- UUUUUUUUUUCUACCAAUUUUUUUUUU -3ˈ 1U10 RNA is in capital letters. DNA is in lowercase letters. Underlined bases are T7 primer and not present in final RNA. Loop sequences in DNA are highlighted in bold, red letters.

111

Templates for failed designs:

Table 3: DNA templates for HIV-DIS mutants HIV DIS RP 5ˈ-CCCCTCGCCTAAAAAAAAAAG-3ˈ FP 5ˈ-GAAATTAATACGACTCACTATAGG-3ˈ Wild type 5ˈ-CCCCTCGCCTCTTGCCGTGCGCGCTTCAGCAAGCCGAGTCCC TATAGTGAGTCGTATTAATTTC-3ˈ US 5ˈ-CCCCTCGCCTAAAAAAAAAAGTGCGCGCTTCAAAAAAAAAA CCGAGTCCCTATAGTGAGTCGTATTAATTTC-3ˈ LS 5ˈ-CCCAAAAAAAAAAGCCTCTTGCCGTGCGCGCTTCAGCAAGC CAAAAAAAAAATCCCTATAGTGAGTCGTATTAATTTC-3ˈ NC 5ˈ-CCCCTCGCCTAAAAAAAAAAGTGTGTGTTTCAAAAAAAAAA CCGAGTCCCTATAGTGAGTCGTATTAATTTC-3ˈ PC 5ˈ-AAAAAAAAAAGTGTGTAAAAAAAAAACCCCTCGCCTCTTGC CGTGCGCGCTTCAGCAAGCCGAGTCCCTATAGTGAGTCGTATT AATTTC-3ˈ HIV-DIS Heterodimers HD1 5ˈ-CCCCTCGCCTAAAAAAAAAAGTGTGCGCTTCAAAAAAAAAA CCGAGTCCCTATAGTGAGTCGTATTAATTTC-3ˈ HD2 5ˈ-CCCCTCGCCTAAAAAAAAAAGTGCGCACTTCAAAAAAAAAA CCGAGTCCCTATAGTGAGTCGTATTAATTTC-3ˈ HD3 5ˈ-CCCCTCGCCTAAAAAAAAAAGTGTCCACTTCAAAAAAAAAA CCGAGTCCCTATAGTGAGTCGTATTAATTTC-3ˈ HD4 5ˈ-CCCCTCGCCTAAAAAAAAAAGTGTGGACTTCAAAAAAAAAA CCGAGTCCCTATAGTGAGTCGTATTAATTTC-3ˈ HD5 5ˈ-CCCCTCGCCTAAAAAAAAAAGTGCCTGCTTCAAAAAAAAAA CCGAGTCCCTATAGTGAGTCGTATTAATTTC-3ˈ HD6 5ˈCCCCTCGCCTAAAAAAAAAAGTGCTGGCTTCAAAAAAAAAA CCGAGTCCCTATAGTGAGTCGTATTAATTTC-3ˈ HD7 5ˈ-CCCCTCGCCTAAAAAAAAAAGTCGGAGGTTCAAAAAAAAA ACCGAGTCCCTATAGTGAGTCGTATTAATTTC-3ˈ HD8 5ˈ-CCCCTCGCCTAAAAAAAAAAGTCCTCCGTTCAAAAAAAAAA CCGAGTCCCTATAGTGAGTCGTATTAATTTC-3ˈ HD9 5ˈ-CCCCTCGCCTAAAAAAAAAAGTGAAGCGTTCAAAAAAAAA ACCGAGTCCCTATAGTGAGTCGTATTAATTTC-3ˈ HD10 5ˈ-CCCCTCGCCTAAAAAAAAAAGTCGCTTCTTCAAAAAAAAAA CCGAGTCCCTATAGTGAGTCGTATTAATTTC-3ˈ

112

Table 4: DNA templates for tri-stem-loop ColE1 mutants ColE1 ColE1 RP 5ˈ-GAAATTAATACGACTCACTATAGGG-3ˈ RNAI 5ˈ-AACAAAAAAACCACCGCTAC-3ˈ Native FP RNAII 5ˈ-ACAGTATTTGTTATCTGCGC-3ˈ Native FP RNAI 5ˈ-AACAAAAAAACCACCGCTACCAACGGTGGTTTGTTTGCCGG Native ATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAG CAAAGCGCAGATACCAAATACTGTCCCTATAGTGAGTCGTATT AATTTC-3ˈ RNAII 5ˈ-ACAGTATTTGTTATCTGCGCTCTGCTGAAGCCAGTTAACTTC Native GGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACC GTTGGTAGCGGTGGTTTTTTTGTTTGCTACTGTCCCTATAGTGA GTCGTATTAATTTC-3ˈ RNAI CL 5ˈ-AACTAAAAAAAAAACGCTACCAACG-3ˈ FP RNAII CL 5ˈ-ACAGTATTTGTTATCTGCGC-3ˈ FP RNAI CL 5ˈ-AACTAAAAAAAAAACGCTACCAACGAAAAAAAAAATGCCG GATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCA GCAAAGCGCAGATACCAAATACTGTCCCTATAGTGAGTCGTAT TAATTTC-3ˈ RNAII CL 5ˈ-ACAGTATTTGTTATCTGCGCTCTGCTGAAGCCAGTTAACTTC GGAAAAAGAGTTGGTAGCTCTTGATCCGGCTAAAAAAAAAAC GTTGGTAGCGAAAAAAAAAATGTTTGCTACTGTCCCTATAGTG AGTCGTATTAATTTC-3ˈ RNAI 5ˈ-AACGAAAAAAAAAATCTACCAATAAAAAAAAAACGC-3ˈ OL FP RNAI OL 5ˈ-GAAATTAATACGACTCACTATAGGGACAGTAT-3ˈ RP RNAI OL 5ˈ-AACGAAAAAAAAAATCTACCAATAAAAAAAAAACGCCGGA TCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGC AAAGCGCAGATACCAAATACTGTCCCTATAGTGAGTCGTATTA ATTTC-3ˈ RNAII 5ˈ-ACAGTATTTGTTATCTGCGCTCTGCTGAAGCCAGTTAACTTC OL GGAAAAAGAGTTGGTAGCTCTTGATCCGGCGAAAAAAAAAAT TTGGTAGTAAAAAAAAAACGTTTGCTACTGTCCCTATAGTGAG TCGTATTAATTTC-3ˈ FP and RP are forward primer and reverse primer, respectively. The underlined portion of each template is the T7 promoter region and does not appear in the transcript RNA.

113

2.5.2 Methods and Procedures.

DNA amplification.

DNA was used as received and PCR amplified using a Personal Eppendorf

Mastercycler. Pfu PCR 10x buffer contained 200 mM Tris-Cl pH 8.8, 100 mM KCl, 100 mM (NH4)2SO4, 20 mM MgSO4, 1 mg/ml nuclease free BSA, 1% v/v triton X-100. PCR was performed using the following components reported as final concentrations: 1x of Pfu

PCR buffer, 500 nM forward and reverse primer, 6 nM DNA template, 200 μM dNTP, 1.35

μl of stock Pfu DNA polymerase per 100 μl reaction solution. Thermocycling was performed as follows: Denature (95°C, 2 min), 25x [ Denature (95°C, 30 s), Anneal (55°C,

30 s), Elongation (72°C, 60 s)], Polish (72°C, 4 min), and hold at 4°C. DNA was purified using a Qiagen MinElute PCR purification kit and eluted from purification column with water.

RNA transcription. tRNAs were made using T7 runoff transcription by T7 RNA polymerase. RNA transcription buffer 10x: 1M HEPES-KOH pH 7.5, 100 mM MgCl2, 20 mM Spermidine-

HCl, 400 mM DTT. Transcription was performed in the following concentrations: 1x

Buffer with the addition of 10 mM DTT, 20 mM MgCl2, 20 mM rNTP, 7.5% v/v glycerol,

350 nM DNA template from PCR, and 1.9 μl of T7 polymerase stock (100000 units/mL)

(per 100 μl of transcription reaction solution). Transcription took place at 37°C for 3-4 h at which point 1.5 equivalents of EDTA was added to quench the reaction and 2x TBE/urea loading buffer was added. Samples were heated at 95°C for 10 min, cooled to room

114 temperature, centrifuged at 13200 pm, and loaded onto 15% w/v acrylamide (19:1 acrylamide:bisacrylamide) denaturing gel (8.3 cm X 7.3 cm X 1.5 mm) with 8M urea as the denaturant. The denaturing gel was electrophoresed for 3 h. at 250 volts. The RNA was visualized using UV shadowing, excised from the gel, the gel piece pushed through the end of a 1 ml syringe, and soaked in water overnight at room temperature with agitation. The sample was then centrifuged and the supernatant removed, discarding the gel pieces. The RNA was precipitated from the supernatant by the addition of 5 M

NH4OAc pH 5.2 to a concentration of 450 mM and 2.5 volume equivalents of 200-proof ethanol followed by incubation at -20°C overnight and centrifugation at 13200 rpm for 30 min at 4°C. The RNA pellet was washed with 150 μl of ice-cold 30% v/v water in ethanol and centrifuged again at high speed for 10 min at 4°C. RNA pellets were then dried in a speed-vac at room temperature for 20 min and suspended in filtered water and stored in a freezer at -20°C. Stock concentrations were determined by UV-vis spectroscopy, measuring absorbance at 260 nm. RNA purity was checked on a 15% w/v denaturing gel as described above except gels were electrophoresed at 250 V for 1 h. and visualized using

SYBR gold staining. To obtain radiolabeled RNAs, 5μl of 3000 uCi/mmol Alpha-[P32]-

GTP was incorporated during transcription and normal procedure was followed.

5ˈ-end labeling of ColE1 RNA.

End labeling was performed as described in the protocol provided by New England

Biolabs. 400 pmoles of RNA, 40 pmoles of [γ-32P] ATP (250 μCi, 3000 Ci/mmol 10 mCi/ml), 760 pmole ATP, and 5 μl of T4 PNK kinase (10,000 units/ml) were mixed in 40

115

μl of 1X T4 Polynucleotide Kinase Reaction Buffer (70 mM Tris-HCl pH 7.6, 10 mM

MgCl2, 5 mM DTT). Reaction was incubated for 1.5 h at 37°C and then heated at 72°C for 20 min. Excess radiolabel was removed using a P30 spin column. RNA’s were purified on a denaturing 20% acrylamide gel (19:1) with urea in 1X TBE. RNAs were excised from the gel, the gel slab pushed through a syringe to crush it, and soaked overnight in water at room temperature. The soaked gel was then centrifuged and the supernatant removed, discarding the gel pieces. The RNA was precipitated by the addition of 5 M NH4OAc pH

5.2 to a concentration of 450 mM and 2.5 volume equivalents of 200-proof ethanol followed by incubation at -20°C overnight and centrifugation at 13200 rpm for 30 min at

4°C. The RNA pellet was washed with 150 μl of ice-cold 30% v/v water in ethanol and centrifuged again at high speed for 10 min at 4°C. RNA pellets were then dried at room temperature for 20 min and suspended in water and stored at -20°C. Stock concentrations were determined by UV-vis spectroscopy, measuring absorbance at 260 nm.

tRNA EMSA gel assay.

A parent RNA stock solution was diluted into 1x kissing buffer (20 mM Tris-Cl pH 7.6,

10 mM MgCl2, and 100 mM NaCl), glycerol (final concentration 10% v/v), and, if necessary, bPNA to a final RNA concentration 3-fold greater than desired for the gel assay. A separate stock was created diluting the complementary RNA in 1x buffer, with or without bPNA, to concentrations appropriate for titration. Stock solutions were annealed at 90°C for 5 min and then snap cooled for 5 min on ice. 10 μl of parent RNA stock was added to each tube and the complementary RNA was added in increasing

116 concentrations using 1x kissing buffer to bring the final reaction solution to 30 μl. RNAs were then mixed and incubated for 30 min on ice prior to loading. The kissing complex was visualized on a 2.5% w/v agarose gel in 1x TBM1 (89 mM Tris, 89 mM boric acid,

° and 0.1 mM MgCl2). Gels were electrophoresed at 120 volts for 2 h at 4 C. Gels were imaged on a GE Healthcare Typhoon FLA 9500 using the phosphorimager or cyanine dye fluorescence. Alternatively, a 4-15% gradient acrylamide gel (70:1) was used electrophoresing at 120 V for 3 h. Gels with intrinsic P32-labeling were dried using a temperature gradient for 2.5 h. holding at 65°C. Gels were quantified using ImageQuant

5.0 and binding curves fitted using KaleidaGraph 4.0 using a 1:1 binding model using

90, 101 Equation 1. For Rop binding, [RNA2] was replaced by [Rop] in Equation 1.

Experiments in most cases were performed in triplicate and results after work up were averaged.

Equation 1: 퐾 + [푅푁퐴 ] + [푅푁퐴 ] [푐표푚푝푙푒푥] = 푑 1 2 2 − (√(퐾푑 + [푅푁퐴1] + [푅푁퐴2]) − (4 ∗ [푅푁퐴1] ∗ [푅푁퐴2]))/2

ColE1 EMSA gel assay.

Samples were prepared in the same manner as described above in section tRNA EMSA gel assay. Assays ran in the presence of Rop used 10x Rop Buffer: 200 mM Tris-Cl pH

7.6, 3M NaCl, 100 mM MgCl2, 50 mM DTT, which was diluted to 1x in assay. Rop was added as necessary after RNA was annealed to the Parent RNA stock solution. Rop concentrations are reported as monomer concentration unless otherwise stated. After incubation on ice for 30 min, samples were loaded onto a 15% w/v acrylamide gel (8.3 cm

117

X 7.3 cm X 1.5 mm) composed of 70:1 acrylamide to bis-acrylamide which had be pre-run for 2 h at 120 volts. Gels were electrophoresed for 4-6 h at 120 volts in 1x TBM2 (89 mM

Tris, 89 mM boric acid, and 10 mM MgCl2). Experiments to determine binding affinity were performed with a cyanine dye labeled bPNA or radiolabeled RNA and directly imaged as described in tRNA EMSA gel assay. If unlabeled bPNA was used, RNA was stained with SYBR gold and then imaged as described in the section tRNA EMSA gel assay. Gels were quantified using ImageQuant 5.0 and binding curves fitted in

KaleidaGraph 4.0 using a 1:1 binding model using Equation 1. Experiments were performed in triplicate and results after work up were averaged.

2.5.3 Synthetic Procedures and compound characterization.

Dye Synthesis: Dye synthesis was completed by modifying a previously reported procedure.102

Synthesis of 1-(5-carboxypentyl)-2,3,3-trimethyl-3H-indol-1-ium bromide (1): In a round bottom flask was added 18.8 mmol (3 g) of 1,3,3-Trimethyl-2-methyleneindoline in

10 ml of nitromethane. To this was added 21 mmol (4.13 g) of 6-bromohexanoic acid and 118 the solution was refluxed for 36 h. Upon completion, the reaction was cooled to room temperature and slowly added to 150 ml of ethyl acetate with vigorous stirring. The product was collected by vacuum filtration and washed with 3 x 50 ml of ethyl acetate to yield 15.3 mmol (5.39 grams, 81% yield) of 1 as a purple powder. Calculated [M+]:

274.1802 Found: 274.1803

Figure 45: Proton NMR of compound 1. 1H NMR (400 MHz, DMSO-D6) of 1-(5-carboxypentyl)-2,3,3-trimethyl-3H-indol-1-ium bromide (1)

Synthesis of Cy3 1-(5-carboxypentyl)-3,3-dimethyl-2-((E)-3-((Z)-1,3,3- trimethylindolin-2-ylidene)prop-1-en-1-yl)-3H-indol-1-ium (2): To a round bottom flask was added 0.5 grams of 1 (1.4 mmol), 340 mg of N,N′-diphenylformamidine, and 7.5 ml of acetic anhydride. This solution was heated at 120°C for 0.5 h. The solution was then 119 cooled to room temperature followed by the addition of 310 mg of 1,3,3-Trimethyl-2- methyleneindoline and 7.5 ml of pyridine. The solution was stirred overnight at room temperature. The following day, 200 ml of ethyl ether was added and the product precipitated overnight at -20°C. The precipitate was collected by centrifugation at 3500 rpm for 10 min, dried with a nitrogen stream, and purified by flash column chromatography using 100% EtOAc, then a gradient of methanol/dichloromethane gradient of 2%-5%-7% yielding 358 mg of 2 as a dark red foam. Rf = 0.3 (10% MeOH in DCM). Calculated

[M+]: 457.2850 Found: 457.2853

Figure 46: Proton NMR of Cy3. 1H NMR (400 MHz, CDCl3) Cy3 1-(5-carboxypentyl)-3,3-dimethyl-2-((E)-3-((Z)-1,3,3- trimethylindolin-2-ylidene)prop-1-en-1-yl)-3H-indol-1-ium (2)

120

Synthesis of Cy5 1-(5-carboxypentyl)-3,3-dimethyl-2-((1E,3Z)-5-((E)-1,3,3- trimethylindolin-2-ylidene)penta-1,3-dien-1-yl)-3H-indol-1-ium (3): To a round bottom flask was added 0.5 grams of 1 (1.4 mmol), 450 mg of N-(3-(phenylamino)-2- propenylidene)aniline hydrochloride, and 7.5 ml of acetic anhydride. This solution was heated at 120°C for 0.5 h. The solution was then cooled to room temperature followed by the addition of 310 mg of 1,3,3-Trimethyl-2-methyleneindoline and 7.5 ml of pyridine. The solution was stirred overnight at room temperature. The following day, 200 ml of diethyl ether was added and the product precipitated overnight at -20°C. The precipitate was collected by centrifugation, dried with a nitrogen stream, and purified by flash column chromatography using 100% EtOAc, then a gradient of methanol/dichloromethane gradient of 2%-5%-7% yielding 413 mg of 3 as a dark blue foam. Rf = 0.3 (10% MeOH in DCM). Calculated [M+]: 483.3006 Found: 483.3002

121

Figure 47: Proton NMR of Cy5. 1H NMR (400 MHz, CDCl3) Cy5 1-(5-carboxypentyl)-3,3-dimethyl-2-((1E,3Z)-5-((E)- 1,3,3-trimethylindolin-2-ylidene)penta-1,3-dien-1-yl)-3H-indol-1-ium (3)

Peptide Synthesis: Fmoc-Lys(Mel)-OH and NH2-(EM)10G-CONH2 was synthesized as previously reported.90 Peptides were synthesized on an AAPPTec Apex 396 peptide synthesizer using standard solid phase Fmoc chemistry on Rink Resin LS with 0.28 mmol/g loading. 0.25 M of Amino acids were coupled with 0.25 M of HOBt and 0.25 M DIC in 2 ml DMF. The coupling reactions were mixed for 1.5 h at which point they were rinsed with 3 x 2 ml DMF. Fmoc protecting groups were cleaved by subjecting resin to 2 x 2 ml of 20% v/v piperidine solution in DMF for ten min followed by another rinse cycle. Cyanine dyes were coupled using three equivalents of dye, 3.3 equivalents of

122

HBTU, and 3.3 equivalents of DIEA in 2 ml DMF. Dye and coupling reagents were allowed to react for fifteen min before addition to resin. Peptides were cleaved from the resin using 95:5 v/v TFA:water solution for 4 h (beads will lose dye color due to solvatochromic effect, but dye does survive cleavage). Cleaved peptide solutions were filtered through cotton to remove the beads, peptide crashed out in cold diethyl ether, centrifuged to collect the solid peptide, washed 3 times with cold ether, and dried using a nitrogen gas stream to remove excess ether and TFA. Peptides were purified by HPLC with a preparatory C18 column and water/acetonitrile gradient containing 0.1% v/v

TFA. The purification used solvent A (water, 0.1% v/v TFA) and solvent B (80% v/v acetonitrile, 0.1% v/v TFA) gradient as follows: 0-5 min 10% B, 5-20 min increase to 40%

B, 40% B for 20 min, then 100% B for 5 min. Cyanine dye conjugated peptide purity was checked on an analytical C18 HPLC column using an isocratic gradient starting at 10% B for 0-5 min, 5-20 min reaching 35% B, holding at 35% solvent B for 20 min, and 100% wash.

123

Figure 48: HPLC trace and MALDI-TOF of Cy5-(EM)10. A) HPLC trace of Cy5(EM)10G-CONH2. Cy5(EM)10G-CONH2 on a RP-C18 analytical column monitored with UV-Vis detector at 220 nm. B) MALDI-TOF spectra of Cy5(EM)10G-CONH2: Calculated [M+]: 4201.102 Found: 4198.010.

124

Figure 49: HPLC trace and MALDI-TOF of Cy3-(EM)10. A) HPLC trace of Cy3(EM)10G-CONH2. Cy3(EM)10G-CONH2 on a RP-C18 analytical column monitored with UV-Vis detector at 220 nm. B) MALDI-TOF spectra of Cy3(EM)10G-CONH2: Calculated [M+]: 4175.0864 Found: 4172.451

125

2.5.4 tRNA mutant EMSA gel results and dissociation constant determination:

Figure 50: Negative control for non-specific dimerization of HD1U10 and HD1Nat. The gel above is the negative control agarose gel for tRNA kissing. Imaged by Cy5 fluorescence. HD1U10-Cy5(EM)10 complex is held constant at 200 nM while HD1Nat is titrating in with a range 0-1000 nM.

Figure 51: Negative control for non-specific dimerization of HD2U10 and HD2Nat. The gel above is the negative control agarose gel for tRNA kissing. Imaged by Cy5 fluorescence. HD2U10-Cy5(EM)10 complex is held constant at 200 nM while HD2Nat is titrating in with a range 0-1000 nM.

126

Figure 52: Mg2+ dependence of HD1U10-bPNA triplex and HD2Nat complexation. The gel above displays kissing complex formation of HD1U10-Cy5(EM)10 triplex and HD2Nat without Mg2+ in the reaction buffer or gel running buffer. HD2Nat was titrated from 0-1000 nM into a HD1U10-Cy5(EM)10 held constant at 200 nM. Gel ran in TBE (89 mM Tris, 89 mM boric acid, and 2 mM EDTA). Imaged by Cy5 fluorescence. Lower band is free HD1U10. Upper band is kissing complex.

Figure 53: Mg2+ dependence of HD1U10-bPNA triplex and HD2U10-bPNA triplex complexation. The gel above looks at kissing complex formation of HD1U10-Cy5(EM)10 triplex and 2+ HD2U10-(EM)10 without Mg in the reaction buffer or gel running buffer. HD2U10- (EM)10 was titrated from 0-2000 nM into a HD1U10-Cy5(EM)10 held constant at 500 nM. Gel ran in TBE (89 mM Tris, 89 mM boric acid, and 2 mM EDTA). Imaged by Cy5 fluorescence.

127

Average Kd = 9.3 + 2.0 nM B)

Figure 54: Kd determination of HD1Nat and HD2U10-bPNA triplex. A) Gel image of HD1Nat and HD2U10-bPNA kissing complex formation. B) The graph above represents the Kd determination of HD1Nat with HD2U10 triplex (bound to (EM)10). This was determined by gel shift assay with radiolabeled HD1Nat held constant at 50 nM with HD2U10 bound to bPNA (structured anticodon loop) titrated in from 0-800 nM

128

Average Kd = 18.5 + 3.2 nM B)

Figure 55: Kd determination of HD1U10-EM10 and HD2U10-EM10. A) Gel image of HD1U10-bPNA and HD2U10-bPNA kissing complex formation. B) The graph above represents the Kd determination of HD1U10 triplex (bound to (EM)10) with HD2U10 triplex (bound to (EM)10). This was determined by gel shift assay with radiolabeled HD1Nat held constant at 50 nM with HD2U10 bound to bPNA (structured anticodon loop) titrated in from 0-800 nM.

129

Average Kd = 2.4 + 0.6 nM B)

Figure 56: Kd determination of HD1Nat and HD2Nat. A) Gel image of HD1Nat and HD2Nat kissing complex formation. B) The graph above shows the Kd determination of HD1Nat and HD2Nat. Gel experiments using a radiolabeled HD1Nat held constant at 20 nM and titrating in HD2Nat from 0-320 nM.

130

Average Kd = 30.3 + 10.1 nM B)

Figure 57: Kd determination of HD1Nat and unstructured HD2U10. A) Gel image of HD1Nat and HD2U10 kissing complex formation. B) The graph above represents the Kd determination of HD1Nat with HD2U10 (no bPNA). This was determined by gel shift assay with radiolabeled HD1Nat held constant at 50 nM with HD2U10 without bPNA (unstructured anticodon loop) titrated in from 0-800 nM.

131

Average Kd = 38.4 + 7.0 B)

Figure 58: Kd determination unstructured HD1U10 and unstructured HD2U10. A) Gel image of HD1U10 and HD2U10 without bPNA kissing complex formation. B) The graph above represents the Kd determination of unstructured HD1U10 with unstructured HD2U10 (no bPNA). This was determined by gel shift assay with radiolabeled HD1U10 held constant at 1 μM with HD2U10 titrated in from 0-6 μM, both without bPNA (unstructured anticodon loop). Raw data does not show a complete gel shift.

132

Average Kd = 14.4 + 3.7 nM B)

Figure 59: Kd determination unstructured HD1U10 probe and unstructured HD2U10 probe A) Gel image of HD1U10 probe and HD2U10 probe without bPNA kissing complex formation. B) The graph above represents the Kd determination of unstructured HD1U10 probe with HD2U10 probe (no bPNA). This was determined by gel shift assay with radiolabeled HD1U10 probe held constant at 50 nM with HD2U10 titrated in from 0-800 nM, both without bPNA (unstructured anticodon loop).

133

2.5.5 ColE1 mutant EMSA gel results and dissociation constant determination:

Figure 60: Control for non-specific dimerization of RNAI. RNAI-1U10-Cy5EM10 complex is held constant at 500 nM while RNAI-1WT is titrated in with a range 0-8000 nM. Imaged by Cy5 fluorescence.

Figure 61: Control for non-specific dimerization of RNAII. RNAII-1U10-Cy5EM10 complex is held constant at 500 nM while RNAII-1WT is titrated in with a range 0-8000 nM. Imaged by Cy5 fluorescence.

Figure 62: Control for Rop binding to bPNA triplex. RNAII-1U10-Cy5EM10 complex is held constant at 100 nM while Rop is titrated in with a range 0-16000 nM. Imaged by Cy5 fluorescence.

134

Average Kd = 0.33 + 0.07 nM B)

Figure 63: Rop complex of RNAII-1U10 and RNAI-1WT. A) The gel above shows the gel shift of RNAII-1U10-Cy5EM10 upon binding to RNAI- 1WT in the presence of Rop. RNAII-1U10-Cy5EM10 is held constant at 10 nM, Rop is held constant at 10 μM, and RNAI is titrating in with a range of 0-160 nM. B) The curve fitting for the gel shift fitted to Equation 1. Lower band is RNAII-1U10. Upper band is Rop complex.

135

Average Kd = 40.3 + 3.1 nM B)

Figure 64: Kissing complex of RNAI-1U10 and RNAII-1U10 without Rop. A) The gel above shows the gel shift of RNAII-1U10-Cy5EM10 upon binding to RNAI- 1U10-Cy5EM10 without Rop. Radiolabeled RNAII-1U10-Cy5EM10 is held constant at 40 nM and RNAI is titrating in with a range of 0-640 nM. B) The curve fitting for the gel shift fitted to Equation 1. Bottom band is RNAII-1U10. Top band is the kissing complex.

136

Average Kd = 40.7 + 4.6 nM B)

Figure 65: Kissing complex of RNAI-1U10 and RNAII-1U10 with Rop. A) The gel above shows the gel shift of RNAII-1U10-Cy5EM10 upon binding to RNAI- 1U10-Cy5M10 with 20 μM Rop. RNAII-1U10-Cy5EM10 is held constant at 40 nM and RNAI is titrating in with a range of 0-640 nM. B) The curve fitting for the gel shift fitted to Equation 1. Bottom band is RNAII-1U10. Top band is the Rop complex.

137

Average Kd = 196.7 + 54.5 nM B)

Figure 66: Complex formation of unstructured RNAII-1U10 and RNAI-WT with Rop. A) The gel above shows the gel shift of RNAII-1U10 upon binding to RNAI-1WT in the presence of Rop. RNAII-1U10 is held constant at 500 nM, Rop is held constant at 10 μM, and RNAI is titrating in with a range of 0-2500 nM. B) The curve fitting for the gel shift fitted to Equation 1. Complex fluorescence was corrected for SYBR gold turn on by multiplying complex intensity by 0.58. 138

Average Kd = 227.1 + 24.3 nM B)

Figure 67: Complex formation of unstructured RNAII-1U10 and RNAI-WT without Rop. A) The gel above shows the gel shift of RNAII-1U10 upon binding to RNAI- 1WT. RNAII-1U10 is held constant at 500 nM and RNAI is titrating in with a range of 0- 2500 nM. B) The curve fitting for the gel shift fitted to Equation 1. Complex fluorescence was corrected for SYBR gold turn on by multiplying complex intensity by 0.8.

139

Average Kd = 1.2 + 0.4 μM

Figure 68: Rop complex formation with preformed U10-WT kissing-loop. A) The gel above shows the gel shift of kissing complex between RNAII-1U10-Cy5EM10 and RNAI-1WT binding to Rop. The kissing complex is held constant at 1 μM and Rop is titrated in with a range of 0-6 μM. B) The curve fitting for the gel shift fitted to Equation 1.

140

Average Kd = 15.1 + 3.1 μM

Figure 69: Rop complex formation with preformed U10-U10 kissing-loop. A) The gel above shows the gel shift of kissing complex between RNAI-1U10-Cy3EM10 and RNAII-1U10-EM10 binding to Rop. The kissing complex is held constant at 4 μM and Rop is titrated in with a range of 0-20 μM. B) The curve fitting for the gel shift fitted to Equation 1. Kd is average of two independent experiments and the above is a representative plot.

141

2.6 REFERENCES CHAPTER 2

1. Bindewald, E.; Hayes, R.; Yingling, Y. G.; Kasprzak, W.; Shapiro, B. A.,

RNAJunction: a database of RNA junctions and kissing loops for three-dimensional structural analysis and nanodesign. Nucleic Acids Research 2008, 36 (s1), D392-D397.

2. Selmer, M.; Dunham, C. M.; Murphy, F. V.; Weixlbaumer, A.; Petry, S.; Kelley,

A. C.; Weir, J. R.; Ramakrishnan, V., Structure of the 70S Ribosome Complexed with mRNA and tRNA. Science 2006, 313 (5795), 1935-1942.

3. Kim, C.-H.; Tinoco, I., A retroviral RNA kissing complex containing only two

G⋅C base pairs. PNAS 2000, 97 (17), 9396-9401.

4. Chen, A. A.; García, A. E., Mechanism of enhanced mechanical stability of a minimal RNA kissing complex elucidated by nonequilibrium molecular dynamics simulations. PNAS 2012, 109 (24), E1530-E1539.

5. Hjalt, T.; Gerhart, E.; Wagner, H., The effect of loop size in antisense and target

RNAs on the efficiency of antisense RNA control. Nucleic Acids Research 1992, 20 (24),

6723-6732.

6. Stephenson, W.; Asare-Okai, P. N.; Chen, A. A.; Keller, S.; Santiago, R.;

Tenenbaum, S. A.; Garcia, A. E.; Fabris, D.; Li, P. T. X., The Essential Role of Stacking

Adenines in a Two-Base-Pair RNA Kissing Complex. J. Am. Chem. Soc. 2013, 135 (15),

5602-5611.

142

7. Li, P. T. X.; Bustamante, C.; Tinoco, I., Unusual mechanical stability of a minimal RNA kissing complex. PNAS 2006, 103 (43), 15847-15852.

8. Ennifar, E.; Walter, P.; Ehresmann, B.; Ehresmann, C.; Dumas, P., Crystal structures of coaxially stacked kissing complexes of the HIV-1 RNA dimerization initiation site. Nat Struct Mol Biol 2001, 8 (12), 1064-1068.

9. Ennifar, E.; Yusupov, M.; Walter, P.; Marquet, R.; Ehresmann, B.; Ehresmann,

C.; Dumas, P., The crystal structure of the dimerization initiation site of genomic HIV-1

RNA reveals an extended duplex with two adenine bulges. Structure 1999, 7 (11), 1439-

1449.

10. Ennifar, E.; Walter, P.; Dumas, P., A crystallographic study of the binding of 13 metal ions to two related RNA duplexes. Nucleic Acids Research 2003, 31 (10), 2671-

2682.

11. Horiya, S.; Li, X.; Kawai, G.; Saito, R.; Katoh, A.; Kobayashi, K.; Harada, K.,

RNA LEGO: Magnesium-Dependent Formation of Specific RNA Assemblies through

Kissing Interactions. Chemistry & Biology 2003, 10 (7), 645-654.

12. Jaeger, J. A.; Zuker, M.; Turner, D. H., Melting and chemical modification of a cyclized self-splicing group I intron: similarity of structures in 1 M sodium, in 10 mM magnesium and in the presence of substrate. Biochemistry 1990, 29 (44), 10147-10158.

13. Laughrea, M.; Jetté, L., Kissing-Loop Model of HIV-1 Genome Dimerization:

HIV-1 RNAs Can Assume Alternative Dimeric Forms, and All Sequences Upstream or

Downstream of Hairpin 248−271 Are Dispensable for Dimer Formation. Biochemistry

1996, 35 (5), 1589-1598.

143

14. Lodmell, J. S.; Paillart, J.-C.; Mignot, D.; Ehresmann, B.; Ehresmann, C.;

Marquet, R., Oligonucleotide-Mediated Inhibition of Genomic RNA Dimerization of

HIV-1 Strains MAL and LAI: A Comparative Analysis. Antisense and Nucleic Acid Drug

Development 1998, 8 (6), 517-529.

15. Takahashi, K. I.; Baba, S.; Chattopadhyay, P.; Koyanagi, Y.; Yamamoto, N.;

Takaku, H.; Kawai, G., Structural requirement for the two-step dimerization of human immunodeficiency virus type 1 genome. RNA 2000, 6 (1), 96-102.

16. Kim, S. H.; Quigley, G. J.; Suddath, F. L.; McPherson, A.; Sneden, D.; Kim, J. J.;

Weinzierl, J.; Rich, A., Three-Dimensional Structure of Yeast Phenylalanine Transfer

RNA: Folding of the Polynucleotide Chain. Science 1973, 179 (4070), 285-288.

17. Melchers, W. J.; Hoenderop, J. G.; Slot, H. J. B.; Pleij, C. W.; Pilipenko, E. V.;

Agol, V. I.; Galama, J. M., Kissing of the two predominant hairpin loops in the coxsackie

B virus 3ˈ untranslated region is the essential structural feature of the origin of replication required for negative-strand RNA synthesis. J. Virol. 1997, 71 (1), 686-696.

18. Pilipenko, E. V.; Poperechny, K. V.; Maslova, S. V.; Melchers, W. J.; Slot, H. J.;

Agol, V. I., Cis-element, oriR, involved in the initiation of (-) strand poliovirus RNA: a quasi-globular multi-domain RNA structure maintained by tertiary ('kissing') interactions.

The EMBO Journal 1996, 15 (19), 5428-5436.

19. Gago, S.; Peña, M. D. L.; Flores, R., A kissing-loop interaction in a hammerhead viroid RNA critical for its in vitro folding and in vivo viability. RNA 2005, 11 (7), 1073-

1083.

144

20. Toor, N.; Keating, K. S.; Taylor, S. D.; Pyle, A. M., Crystal Structure of a Self-

Spliced Group II Intron. Science 2008, 320 (5872), 77-82.

21. Andersen, A. A.; Collins, R. A., Intramolecular secondary structure rearrangement by the kissing interaction of the Neurospora VS ribozyme. PNAS 2001, 98

(14), 7730-7735.

22. DeAbreu, D. M.; Olive, J. E.; Collins, R. A., Additional roles of a peripheral loop–loop interaction in the Neurospora VS ribozyme. Nucleic Acids Research 2011, 39

(14), 6223-6228.

23. Johnson, J. E., Jr.; Reyes, F. E.; Polaski, J. T.; Batey, R. T., B12 cofactors directly stabilize an mRNA regulatory switch. Nature 2012, 492 (7427), 133-137.

24. Allnér, O.; Nilsson, L.; Villa, A., Loop–loop interaction in an adenine-sensing riboswitch: A molecular dynamics study. RNA 2013, 19 (7), 916-926.

25. Serganov, A.; Yuan, Y.-R.; Pikovskaya, O.; Polonskaia, A.; Malinina, L.; Phan,

A. T.; Hobartner, C.; Micura, R.; Breaker, R. R.; Patel, D. J., Structural Basis for

Discriminative Regulation of Gene Expression by Adenine- and Guanine-Sensing mRNAs. Chemistry & Biology 2004, 11 (12), 1729-1741.

26. Serganov, A.; Huang, L.; Patel, D. J., Structural insights into amino acid binding and gene control by a lysine riboswitch. Nature 2008, 455 (7217), 1263-1267.

27. Brunel, C.; Marquet, R.; Romby, P.; Ehresmann, C., RNA loop–loop interactions as dynamic functional motifs. Biochimie 2002, 84 (9), 925-944.

28. Brantl, S., Regulatory mechanisms employed by cis-encoded antisense RNAs.

Current Opinion in Microbiology 2007, 10 (2), 102-109.

145

29. Paillart, J.-C.; Shehu-Xhilaga, M.; Marquet, R.; Mak, J., Dimerization of retroviral RNA genomes: an inseparable pair. Nat Rev Micro 2004, 2 (6), 461-472.

30. Skripkin, E.; Paillart, J. C.; Marquet, R.; Ehresmann, B.; Ehresmann, C.,

Identification of the primary site of the human immunodeficiency virus type 1 RNA dimerization in vitro. PNAS 1994, 91 (11), 4945-4949.

31. Paillart, J. C.; Marquet, R.; Skripkin, E.; Ehresmann, B.; Ehresmann, C.,

Mutational analysis of the bipartite dimer linkage structure of human immunodeficiency virus type 1 genomic RNA. J. Biol. Chem. 1994, 269 (44), 27486-27493.

32. Jossinet, F.; Lodmell, J. S.; Ehresmann, C.; Ehresmann, B.; Marquet, R.,

Identification of the in Vitro HIV-2/SIV RNA Dimerization Site Reveals Striking

Differences with HIV-1. J. Biol. Chem. 2001, 276 (8), 5598-5604.

33. Greatorex, J. S.; Laisse, V.; Dokhelar, M.-C.; Lever, A. M. L., Sequences

Involved in the Dimerisation of Human T Cell Leukaemia Virus Type-1 RNA. Nucleic

Acids Research 1996, 24 (15), 2919-2923.

34. Erlwein, O.; Cain, D.; Fischer, N.; Rethwilm, A.; McClure, M. O., Identification of Sites That Act Together to Direct Dimerization of Human Foamy Virus RNAin Vitro.

Virology 1997, 229 (1), 251-258.

35. Katoh, I.; Yasunaga, T.; Yoshinaka, Y., Bovine leukemia virus RNA sequences involved in dimerization and specific gag protein binding: close relation to the packaging sites of avian, murine, and human retroviruses. J. Virol. 1993, 67 (4), 1830-1839.

146

36. Fossé, P.; Motté, N.; Roumier, A.; Gabus, C.; Muriaux, D.; Darlix, J.-L.; Paoletti,

J., A Short Autocomplementary Sequence Plays an Essential Role in Avian

Sarcoma−Leukosis Virus RNA Dimerization. Biochemistry 1996, 35 (51), 16601-16609.

37. De Tapia, M.; Metzler, V.; Mougel, M.; Ehresmann, B.; Ehresmann, C.,

Dimerization of MoMuLV Genomic RNA: Redefinition of the Role of the Palindromic

Stem−Loop H1 (278−303) and New Roles for Stem−Loops H2 (310−352) and H3

(355−374). Biochemistry 1998, 37 (17), 6077-6085.

38. Ly, H.; Nierlich, D. P.; Olsen, J. C.; Kaplan, A. H., Moloney Murine Sarcoma

Virus Genomic RNAs Dimerize via a Two-Step Process: a Concentration-Dependent

Kissing-Loop Interaction Is Driven by Initial Contact between Consecutive Guanines. J.

Virol. 1999, 73 (9), 7255-7261.

39. Prats, A. C.; Roy, C.; Wang, P. A.; Erard, M.; Housset, V.; Gabus, C.; Paoletti,

C.; Darlix, J. L., cis elements and trans-acting factors involved in dimer formation of murine leukemia virus RNA. J. Virol. 1990, 64 (2), 774-783.

40. Kolb, F. A.; Malmgren, C.; Westhof, E.; Ehresmann, C.; Ehresmann, B.; Wagner,

E. G.; Romby, P., An unusual structure formed by antisense-target RNA binding involves an extended kissing complex with a four-way junction and a side-by-side helical alignment. RNA 2000, 6 (3), 311-324.

41. Kolb, F. A.; Engdahl, H. M.; Slagter‐Jäger, J. G.; Ehresmann, B.; Ehresmann, C.;

Westhof, E.; Wagner, E. G. H.; Romby, P., Progression of a loop–loop complex to a four‐ way junction is crucial for the activity of a regulatory antisense RNA. The EMBO

Journal 2000, 19 (21), 5905-5915.

147

42. Brantl, S.; Birch-Hirschfeld, E.; Behnke, D., RepR protein expression on plasmid pIP501 is controlled by an antisense RNA-mediated transcription attenuation mechanism.

J. Bacteriol. 1993, 175 (13), 4052-4061.

43. Gubbins, M. J.; Arthur, D. C.; Ghetu, A. F.; Glover, J. N. M.; Frost, L. S.,

Characterizing the Structural Features of RNA/RNA Interactions of the F-plasmid FinOP

Fertility Inhibition System. J. Biol. Chem. 2003, 278 (30), 27663-27671.

44. Arthur, D. C.; Ghetu, A. F.; Gubbins, M. J.; Edwards, R. A.; Frost, L. S.; Glover,

J. N. M., FinO is an RNA chaperone that facilitates sense–antisense RNA interactions.

The EMBO Journal 2003, 22 (23), 6346-6355.

45. Tomizawa, J.-i.; Som, T., Control of cole 1 plasmid replication: Enhancement of binding of RNA I to the primer transcript by the rom protein. Cell 1984, 38 (3), 871-878.

46. Eguchi, Y.; Tomizawa, J.-i., Complex formed by complementary RNA stem- loops and its stabilization by a protein: Function of ColE1 Rom protein. Cell 1990, 60

(2), 199-209.

47. Tomizawa, J.-i., Control of ColE1 Plasmid replication. Journal of Molecular

Biology 1990, 212 (4), 695-708.

48. Eguchi, Y.; Tomizawa, J.-i., Complexes formed by complementary RNA stem- loops: Their formations, structures and interaction with ColE1 Rom protein. Journal of

Molecular Biology 1991, 220 (4), 831-842.

49. Eguchi, Y.; Tomizawa, J.-i., Complexes formed by complementary RNA stem- loops. Journal of Molecular Biology 1991, 220 (4), 831-842.

148

50. Scarabino, D., tRNA prefers to kiss. The EMBO Journal 1999, 18 (16), 4571-

4578.

51. Chworos, A.; Severcan, I.; Koyfman, A. Y.; Weinkam, P.; Oroudjev, E.; Hansma,

H. G.; Jaeger, L., Building Programmable Jigsaw Puzzles with RNA. Science 2004, 306

(5704), 2068-2072.

52. Severcan, I.; Geary, C.; Verzemnieks, E.; Chworos, A.; Jaeger, L., Square-Shaped

RNA Particles from Different RNA Folds. Nano Lett. 2009, 9 (3), 1270-1277.

53. Severcan, I.; Geary, C.; Chworos, A.; Voss, N.; Jacovetty, E.; Jaeger, L., A polyhedron made of tRNAs. Nat Chem 2010, 2 (9), 772-779.

54. Guo, P., The emerging field of RNA nanotechnology. Nat Nano 2010, 5 (12),

833-842.

55. Shu, D.; Shu, Y.; Haque, F.; Abdelmawla, S.; Guo, P., Thermodynamically stable

RNA three-way junction for constructing multifunctional nanoparticles for delivery of therapeutics. Nat Nano 2011, 6 (10), 658-667.

56. Shu, Y.; Shu, D.; Haque, F.; Guo, P., Fabrication of pRNA nanoparticles to deliver therapeutic RNAs and bioactive compounds into tumor cells. Nat Protoc 2013, 8,

1635+.

57. Chen, C.; Sheng, S.; Shao, Z.; Guo, P., A Dimer as a Building Block in

Assembling RNA A HEXAMER THAT GEARS BACTERIAL VIRUS phi29 DNA-

TRANSLOCATING MACHINERY. J. Biol. Chem. 2000, 275 (23), 17510-17516.

58. Muriaux, D.; Girard, P.-M.; Bonnet-Mathonière, B.; Paoletti, J., Dimerization of

HIV-1Lai RNA at Low Ionic Strength AN AUTOCOMPLEMENTARY SEQUENCE IN

149

THE 5′ LEADER REGION IS EVIDENCED BY AN ANTISENSE

OLIGONUCLEOTIDE. J. Biol. Chem. 1995, 270 (14), 8209-8216.

59. Lu, K.; Heng, X.; Garyu, L.; Monti, S.; Garcia, E. L.; Kharytonchyk, S.;

Dorjsuren, B.; Kulandaivel, G.; Jones, S.; Hiremath, A.; Divakaruni, S. S.; LaCotti, C.;

Barton, S.; Tummillo, D.; Hosic, A.; Edme, K.; Albrecht, S.; Telesnitsky, A.; Summers,

M. F., NMR Detection of Structures in the HIV-1 5′-Leader RNA That Regulate Genome

Packaging. Science 2011, 334 (6053), 242-245.

60. Kharytonchyk, S.; Monti, S.; Smaldino, P. J.; Van, V.; Bolden, N. C.; Brown, J.

D.; Russo, E.; Swanson, C.; Shuey, A.; Telesnitsky, A.; Summers, M. F., Transcriptional start site heterogeneity modulates the structure and function of the HIV-1 genome. PNAS

2016, 113 (47), 13378-13383.

61. Jossinet, F.; Paillart, J. C.; Westhof, E.; Hermann, T.; Skripkin, E.; Lodmell, J. S.;

Ehresmann, C.; Ehresmann, B.; Marquet, R., Dimerization of HIV-1 genomic RNA of subtypes A and B: RNA loop structure and magnesium binding. RNA 1999, 5 (9), 1222-

1234.

62. Paillart, J. C.; Skripkin, E.; Ehresmann, B.; Ehresmann, C.; Marquet, R., A loop- loop "kissing" complex is the essential part of the dimer linkage of genomic HIV-1 RNA.

PNAS 1996, 93 (11), 5572-5577.

63. Clever, J. L.; Wong, M. L.; Parslow, T. G., Requirements for kissing-loop- mediated dimerization of human immunodeficiency virus RNA. J. Virol. 1996, 70 (9),

5902-8.

150

64. Lorenz, C.; Piganeau, N.; Schroeder, R., Stabilities of HIV-1 DIS type RNA loop–loop interactions in vitro and in vivo. Nucleic Acids Research 2006, 34 (1), 334-

342.

65. Mujeeb, A.; Ulyanov, N. B.; Georgantis, S.; Smirnov, I.; Chung, J.; Parslow, T.

G.; James, T. L., Nucleocapsid protein-mediated maturation of dimer initiation complex of full-length SL1 stemloop of HIV-1: sequence effects and mechanism of RNA refolding. Nucleic Acids Research 2007, 35 (6), 2026-2034.

66. Lodmell, J. S.; Ehresmann, C.; Ehresmann, B.; Marquet, R., Convergence of natural and artificial evolution on an RNA loop-loop interaction: the HIV-1 dimerization initiation site. RNA 2000, 6 (9), 1267-1276.

67. Lodmell, J. S.; Ehresmann, C.; Ehresmann, B.; Marquet, R., Structure and dimerization of HIV-1 kissing loop aptamers1. Journal of Molecular Biology 2001, 311

(3), 475-490.

68. Havrila, M.; Zgarbová, M.; Jurečka, P.; Banáš, P.; Krepl, M.; Otyepka, M.;

Šponer, J., Microsecond-Scale MD Simulations of HIV-1 DIS Kissing-Loop Complexes

Predict Bulged-In Conformation of the Bulged Bases and Reveal Interesting Differences between Available Variants of the AMBER RNA Force Fields. J. Phys. Chem. B 2015,

119 (49), 15176-15190.

69. Paillart, J.-C.; Westhof, E.; Ehresmann, C.; Ehresmann, B.; Marquet, R., Non- canonical interactions in a kissing loop complex: the dimerization initiation site of HIV-1 genomic RNA1. Journal of Molecular Biology 1997, 270 (1), 36-49.

151

70. Mujeeb, A.; Clever, J. L.; Billeci, T. M.; James, T. L.; Parslow, T. G., Structure of the dimer a initiation complex of HIV-1 genomic RNA. Nat Struct Mol Biol 1998, 5 (6),

432-436.

71. Ennifar, E.; Dumas, P., Polymorphism of Bulged-out Residues in HIV-1 RNA

DIS Kissing Complex and Structure Comparison with Solution Studies. Journal of

Molecular Biology 2006, 356 (3), 771-782.

72. Weixlbaumer, A.; Werner, A.; Flamm, C.; Westhof, E.; Schroeder, R.,

Determination of thermodynamic parameters for HIV DIS type loop–loop kissing complexes. Nucleic Acids Research 2004, 32 (17), 5126-5133.

73. Mundigala, H.; Michaux, J. B.; Feig, A. L.; Ennifar, E.; Rueda, D., HIV-1 DIS stem loop forms an obligatory bent kissing intermediate in the dimerization pathway.

Nucleic Acids Research 2014, 42 (11), 7281-7289.

74. Ennifar, E.; Paillart, J.-C.; Bodlenner, A.; Walter, P.; Weibel, J.-M.; Aubertin, A.-

M.; Pale, P.; Dumas, P.; Marquet, R., Targeting the dimerization initiation site of HIV-1

RNA with aminoglycosides: from crystal to cell. Nucleic Acids Research 2006, 34 (8),

2328-2339.

75. Bernacchi, S.; Freisz, S.; Maechling, C.; Spiess, B.; Marquet, R.; Dumas, P.;

Ennifar, E., Aminoglycoside binding to the HIV-1 RNA dimerization initiation site: thermodynamics and effect on the kissing-loop to duplex conversion. Nucleic Acids

Research 2007, 35 (21), 7128-7139.

152

76. Bodlenner, A.; Alix, A.; Weibel, J.-M.; Pale, P.; Ennifar, E.; Paillart, J.-C.;

Walter, P.; Marquet, R.; Dumas, P., Synthesis of a Neamine Dimer Targeting the

Dimerization Initiation Site of HIV-1 RNA. Organic Letters 2007, 9 (22), 4415-4418.

77. Ennifar, E.; Paillart, J.-C.; Bernacchi, S.; Walter, P.; Pale, P.; Decout, J.-L.;

Marquet, R.; Dumas, P., A structure-based approach for targeting the HIV-1 genomic

RNA dimerization initiation site. Biochimie 2007, 89 (10), 1195-1203.

78. Ennifar, E.; Aslam, M. W.; Strasser, P.; Hoffmann, G.; Dumas, P.; van Delft, F.

L., Structure-Guided Discovery of a Novel Aminoglycoside Conjugate Targeting HIV-1

RNA Viral Genome. ACS Chem. Biol. 2013, 8 (11), 2509-2517.

79. Tomizawa, J.-i., Control of cole1 plasmid replication: Initial interaction of RNA I and the primer transcript is reversible. Cell 1985, 40 (3), 527-535.

80. Itoh, T.; Tomizawa, J., Formation of an RNA primer for initiation of replication of ColE1 DNA by ribonuclease H. PNAS 1980, 77 (5), 2450-2454.

81. Tomizawa, J.; Itoh, T., Plasmid ColE1 incompatibility determined by interaction of RNA I with primer transcript. PNAS 1981, 78 (10), 6096-6100.

82. Selzer, G.; Tomizawa, J. I., Specific cleavage of the p15A primer precursor by ribonuclease H at the origin of DNA replication. PNAS 1982, 79 (23), 7082-7086.

83. Tomizawa, J.-i., Control of cole 1 plasmid replication: The process of binding of

RNA I to the primer transcript. Cell 1984, 38 (3), 861-870.

84. Banner, D. W.; Kokkinidis, M.; Tsernoglou, D., Structure of the ColE1 Rop protein at 1.7 Å resolution. Journal of Molecular Biology 1987, 196 (3), 657-675.

153

85. Helmer-Citterich, M.; Anceschi, M. M.; Banner, D. W.; Cesareni, G., Control of

ColE1 replication: low affinity specific binding of Rop (Rom) to RNAI and RNAII. The

EMBO Journal 1988, 7 (2), 557-566.

86. Predki, P. F.; Mike Nayak, L.; Gottlieb, M. B. C.; Regan, L., Dissecting RNA- protein interactions: RNA-RNA recognition by Rop. Cell 1995, 80 (1), 41-50.

87. Gregorian Jr, R. S.; Crothers, D. M., Determinants of RNA Hairpin Loop-Loop

Complex Stability. Journal of Molecular Biology 1995, 248 (5), 968-984.

88. Marino, J. P.; Gregorian, R. S.; Csankovszki, G.; Crothers, D. M., Bent Helix

Formation Between RNA Hairpins with Complementary Loops. Science 1995, 268

(5216), 1448-1454.

89. Lee, A. J.; Crothers, D. M., The solution structure of an RNA loop–loop complex: the ColE1 inverted loop sequence. Structure 1998, 6 (8), 993-1007.

90. Zeng, Y.; Pratumyot, Y.; Piao, X.; Bong, D., Discrete Assembly of Synthetic

Peptide–DNA Triplex Structures from Polyvalent Melamine–Thymine Bifacial

Recognition. J. Am. Chem. Soc. 2012, 134 (2), 832-835.

91. Piao, X.; Xia, X.; Bong, D., Bifacial Peptide Nucleic Acid Directs Cooperative

Folding and Assembly of Binary, Ternary, and Quaternary DNA Complexes.

Biochemistry 2013, 52 (37), 6313-6323.

92. Xia, X.; Piao, X.; Bong, D., Bifacial Peptide Nucleic Acid as an Allosteric Switch for Aptamer and Ribozyme Function. J. Am. Chem. Soc. 2014, 136 (20), 7265-7268.

93. Xia, X.; Piao, X.; Fredrick, K.; Bong, D., Bifacial PNA Complexation Inhibits

Enzymatic Access to DNA and RNA. ChemBioChem 2014, 15 (1), 31-36.

154

94. Piao, X.; Xia, X.; Mao, J.; Bong, D., Peptide Ligation and RNA Cleavage via an

Abiotic Template Interface. J. Am. Chem. Soc. 2015, 137 (11), 3751-3754.

95. Ponchon, L.; Dardel, F., Recombinant RNA technology: the tRNA scaffold. Nat

Meth 2007, 4 (7), 571-576.

96. Bouchard, P.; Legault, P., A remarkably stable kissing-loop interaction defines substrate recognition by the Neurospora Varkud Satellite ribozyme. RNA 2014, 20 (9),

1451-1464.

97. Lebars, I.; Legrand, P.; Aimé, A.; Pinaud, N.; Fribourg, S.; Primo, C. D.,

Exploring TAR–RNA aptamer loop–loop interaction by X-ray crystallography, UV spectroscopy and surface plasmon resonance. Nucleic Acids Research 2008, 36 (22),

7146-7156.

98. Comolli, L. R.; Pelton, J. G.; Tinoco, I., Mapping of a protein-RNA kissing hairpin interface: Rom and Tar-Tar*. Nucleic Acids Research 1998, 26 (20), 4688-4695.

99. Chang, K.-Y.; Tinoco Jr, I., The structure of an RNA “kissing” hairpin complex of the HIV TAR hairpin loop and its complement1. Journal of Molecular Biology 1997,

269 (1), 52-66.

100. Darfeuille, F.; Cazenave, C.; Gryaznov, S.; Ducongé, F.; Di Primo, C.; Toulmé,

J.-J., RNA AND N3′ → P5′ KISSING APTAMERS TARGETED TO THE TRANS-

ACTIVATION RESPONSIVE (TAR) RNA OF THE HUMAN IMMUNODEFICIENCY

VIRUS-1. Nucleosides, Nucleotides and Nucleic Acids 2001, 20 (4-7), 441-449.

155

101. Lundblad, J. R.; Laurance, M.; Goodman, R. H., Fluorescence polarization analysis of protein-DNA and protein-protein interactions. Molecular Endocrinology

1996, 10 (6), 607-612.

102. Kvach, M. V.; Ustinov, A. V.; Stepanova, I. A.; Malakhov, A. D.; Skorobogatyi,

M. V.; Shmanai, V. V.; Korshun, V. A., A Convenient Synthesis of Cyanine Dyes:

Reagents for the Labeling of Biomolecules. European Journal of Organic Chemistry

2008, 2008 (12), 2107-2117.

156

Chapter 3: Directed Chemistry with bPNA

3.1 INTRODUCTION TO FLUORESCENTLY LABELING RNA:

Key advances in the understanding of cellular processes on a molecular level have been made possible through the plethora of biological and chemical tools available to researchers. Through the ligation of chemical probes, researchers have been able study molecules of interest to determine their production, function, and life time. Interactions of molecules can be studied in vitro and in vivo through fluorescent techniques which allows the observation of specific interactions, probe binding sites, and track the transit of materials in a cell. Fluorescent experiments require various labeling techniques in order to specifically tag the molecule of interest. A vast amount of resources has been devoted to development of methodology in order to fluorescently label a target either covalently or non-covalently. Below is a discussion, with a few examples, of various techniques for labeling of RNA and DNA through both chemical and genetic tagging.

The simplest technique involves covalent attachment of a fluorescent molecule to a nucleic acid during solid phase synthesis and enzymatically catalyzed post synthetic modifications. The advantages of these strategies include: 1) site-specific labeling, 2)

157 enzymes can target a specific molecule in complex mixtures, 3) only the nucleic acid introduced into the system will be tagged, 4) immediate fluorescence without need for binding event/turn-on event, 5) tag is covalently bound and will not dissociate, and 6) can image low-abundance nucleic acids. The disadvantages associated with covalent labeling include: 1) size limitations achievable via solid-phase synthesis limits targets choices, 2) enzymes and substrates must be engineered and not every position on a nucleic acid has an enzyme that can modify it, 3) nucleic acid degradation during handling, 4) synthetic nucleic acids may lack nuclear factors important for localization, 5) nucleic acids may need to be injected into cells which perturbs the natural physiological state, and 6) probes are at higher concentrations than physiologically relevant. Fluorescent tags can be introduced via solid phase synthesis by incorporation of chemically modified nucleobases or fluorescent nucleobase mimics. Constructs can be labeled internally with a modified base1-4 or on the termini5-6 through standard phosphoramidite chemistry or click chemistry. Various groups have also been able to introduce fluorescent tags into the polymeric backbone through modifications to the phosphodiester7 and ribose moieties8-10 or other unique scaffolds.10-11

Ranjit and coworkers went so far as to directly incorporate a cyanine dye directly into the backbone.12 The Kool lab used a templated reaction to catalyze covalent attachment of two nucleic acid probes which upon reaction released a quencher molecule to turn-on the probe’s fluorescence.13

For constructs that cannot be synthesized chemically, some researchers have been able to create nucleotides which are site selectively incorporated by naturally occurring enzymes or mutant enzymes which can site selectively alkylate nucleobases. Native

158 enzymes which selectively alkylate specific nucleobases14, such as trimethylguanosinesynthases15 and tRNAIle2-agmatidine synthetase16, or mutated enzymes, such as methyltransferase17, have been used to install reactive groups for further modifications with fluorophores via biorthogonal reactions. Other groups have designed unnatural nucleotide triphosphates, modified typically with click reactive moieties, which are permittable for incorporation by polymerases. T7 RNA polymerase has been found to incorporate alkyne-modified dinucleotides18, norbornene guanosine19, 2ˈ and 3ˈ azide substituted ribose20, and furan-modified uracil.21 Incorporation of unnatural bps designed to expand the genetic alphabet can also be modified for later click chemistry reactions to attach reporting molecules.22 Riedl and coworkers were able to polymerize a DFHBI- modified cytidine (DFHBI is a small molecule mimic of the green fluorescent protein chromophore23) using KOD XL DNA polymerase to detect protein binding.24

Site-specific incorporation of a fluorescent reporter on a synthetic nucleic acid allows for the study of injected/transfected species but does not allow observation of RNA or DNA produced within a cell. To study the transient production of specific sequences of

RNA and DNA, chemists have developed reporting molecules which bind to their target.

These binding probes come in two forms: one being hybridization probes which bind specific sequences and the other being small molecules which recognize a specific sequence or structure. Hybridization probes, composed of fluorescently labeled DNA,

RNA, PNA, or LNA, form duplexes or triplexes with their targets. The advantages of these probes include: 1) no cellular or enzymatic engineering, 2) small size of probes which are less sterically demanding, 3) high-multiplexing potential to reduce background noise, and

159

4) sorting of cells based on mRNA expression. As with any method, there are disadvantages to this strategy such as: 1) prior knowledge of target sequence and structure,

2) may need to microinject probes, 3) low sensitivity, 4) degradation of probe within cell,

5) accumulation of probes in nucleus, 6) hybridization delay, and 7) non-specific binding cannot be completely avoided. DNA probes, which are stable in the cellular environment, have been adorned with fluorogens such as thiazole orange which become brighter upon binding to target due to intercalation of the dye.2, 25 The use of fluorogens improves background noise as only hybridized probes are “turned on” or able to emit light due to an interaction, such as intercalation, with the target. DNA probes to study oligo(dA) have been used with caged fluorochrome reporters which emit only after a stimulant, such as light, uncages the fluorophore.26 G-quadruplex formation was studied using pyrene labeled oligo(dG) which forms an eximer between the G-quartet and the pyrene small molecule.27

Levels of mRNA have also been studied with multiply labeled or binding of multiple DNA probes which reduces background as the mRNA concentrates the probes in one location within the cell after hybridization.28-29 RNA, usually stabilized by modification of the 2ˈ position, has been used as a hybridization probe to study cellar levels of RNAs and during in vitro studies.30-32 Peptide nucleic acids, which have superior complex stabilities and nuclease resistance compared to RNA and DNA, have been used as hybridization probes.

Efforts to reduce background signal with PNA probes include the use of fluorogens and duel reporter systems. Most designs used the fluorogen thiazole orange which is either appended to the end of the probe33-34 or used as a base surrogate35-39 that turns on upon hybridization. In dual reporter system, two different probes which bind to sequences

160 which are very close to one another are introduced and bind to their targets. Upon binding, two reactive end groups are brought near one another and they interact to produce a fluorescent signal. Two examples of dual reporters include incorporation of a FRET pair40 or the use of a Staudinger reaction to release a quenching molecule to restore fluorescence.41

Locked nucleic acids have successfully been used to measure nucleic acid levels in both in vivo and in vitro studies. Steroid labeled LNA were used to study microRNA levels and localization in zebrafish during the specimen’s life time via northern blot analysis.42

Pyrene is a popular reporting molecule which remains dark when probe is free due to nucleobase quenching.43 Upon hybridization, the pyrene probes become fluorescent as pyrene is excluded from the duplex structure.

Triplex hybrids have also been used as a way of fluorescently tagging a RNA or

DNA sequence of interest. The fluorogen 5-(3-methylbenzofuran-2-yl)uracil was incorporated into a triplex-forming oligonucleotide, which upon hybridization to a DNA target induced rotational restriction and increased fluorescence more than 10 times.44

Fluorescent cytosine mimic 4-amino-1H-benzo[g]quinazoline-2-one was used to probe protonation sites in triplex forming oligonucleotides.45

A popular hybridization probe is the molecular beacon.46 Molecular beacons are pseudo stable, single stranded hairpin motifs which are functionalized with a fluorophore and quencher on the 5ˈ and 3ˈ termini. Upon hybridization, the hairpin unfolds moving the quencher and fluorophore away from one another, restoring fluorescence. Molecular beacons have been successfully used to image mRNA in cells.47 There has been a large

161 effort to improve molecular beacon specificity, stability, and reduce background noise.

Stability has been achieved using LNA molecular beacons48 and γ-substituted PNAs49 which are resistant to nucleases. Specificity has been enhanced through various avenues.

FRET systems using two independently binding molecular beacons which recognize two spatially close sequences adorned with complementary fluorophores have been developed.50-51 Similarly, chemical reactions between two individual molecular beacons in a template-catalyzed reaction results in unquenching of the fluorophore. Reactions such as reductions52-53 and autoligation54 have been used to turn on fluorophores through chemical modification of the fluorophore itself or by release of a quencher. Ratiometric bimolecular beacons use a reference dye which is always on and a quenched dye in order to determine the difference between undesired localization of the probe and hybridization to target.55 Triplex molecular beacons have also been developed.56 Triplex molecular beacons allow for the tuning of specificity and sensitivity by controlling stability of the triplex through sequence choice. Furthermore, background noise can be reduced by adding quenching moieties on the TFO.

Small molecules offer a different avenue for structure recognition as they do not rely on sequence and thus are not prone to binding to similar sequences. Examples include the work by Baranger and Zimmerman which employs melamine bound to an acridine system which becomes quenched upon binding to U-U and T-T mismatches.57 Derivatives of DFHBI which intercalate have been used as sensors of double stranded DNA.58 G- quadruplexes have become popular targets for small dyes by researchers exploring their biological relevance. NapthoTASQ is a small molecule with a four guanosine bases

162 attached to naphthalene core which binds to quadruplexes. UV excitation of the quadruplexes sensitizes naphthalene fluorescence. A large body of work on staining G- quadruplexes has been completed by Shankar Balasubramanian and coworkers using pyridostatin type small molecules.59-64 Fluorogens such as thiazole orange65 and malachite green66 have been used as stains selective for quadruplexes. Xie and coworkers used an emissive uracil surrogate and a dye labeled aminoglycoside in a FRET system to measure sugar binding and subsequent expulsion of the free fluorescent uracil mimic.67

A major issue with hybridization probes is the need to get the probe into a living cell which may not be feasible depending on the design of the probe, the cost and amount of time needed to make synthetic probes, and need for prior knowledge of target strand.

Another way of tagging a molecule to measure it levels of production and localization is to add a genetically encoded tag. The most popular genetically encoded tag so far has been green fluorescent protein (GFP).68 When labeling a nucleic acid with GFP, the most common way of bringing the two components togethers is through an aptamer system.

Typically, the GFP molecule is modified with a small protein sequence for which is the target of a known aptamer. The aptamer is mutated into the desired nucleic acid with multiple repeating aptamers appended in order to reduce background noise. Thanks to the development of fluorescent proteins with different colors and orthogonal aptamers systems, it is now possible to label more than one nucleic acid so that imaging of multiple targets is possible.69-70 One of the major issues with GFP tags is the fact that the protein’s fluorescence creates large background signals. Efforts to address this problem include incorporation of nuclear localization signals onto the GFP so that unbound protein is

163 shuttled to a predetermined location such as the nucleus.71 Another interesting technique is the that of split GFP which requires two targeting domains to guide the halves of GFP together which then refold and restores fluorescence.72-73 The pros of using a GFP tag include: 1) engineered cells can be used repeatedly, 2) no need to inject or transfect probe,

3) high affinity and specificity, and 4) track mRNA from nucleus to cytoplasm. Some of the problems associated with GFP tags include: 1) high background noise, 2) GFP is a large molecule and the need of multiple tags on a target greatly increases the its size and may impact cellular processes, 3) knowledge of target is essential to ensure the large tag will not interfere, and 4) relies on two signal outputs due to the protein and aptamer system.

Based on the above problems associated with GFP tags, there has been considerable effort to improve genetically tagged systems. Aptamers which bind small fluorescent molecules, including fluorogens have been devised. The small dyes are typically membrane permeable and aptamer size is considerably smaller than GFP + aptamer systems. Aptamers for malachite green74-75, Hoechst 3325876, dimethylindole red77, the fluorogen thiazole orange78, and dyes which interact with quenchers via photoinduced electron transfer79 has been developed. Pei and coworkers found a general system for any small molecule aptamers by attaching the target small molecule to a fluorogen.80 The most successful aptamer small molecule system is the spinach and broccoli systems which shows and extremely high turn-on when bound its target fluorogen. Spinach is an aptamer developed through SELEX to bind a small molecule mimic of the GFP chromophore

DFHBI.23 Spinach and its successors have relatively strong binding affinities for the dye and very high turn-on to reduce background. Spinach has a G-quadruplex on which DFHBI

164 binds, turning on the fluorogen81. The system has been improved to include fluorogens of various wavelengths82, brighter turn-on (spinach2)83, and smaller size (broccoli).84 Similar strategies to improve the signal-to-noise ratio include a split aptamer85-86 and a secondary binding site for metabolites which refold the aptamer, allowing DFHBI to bind.87-88 As with all tagging methods, there are both pros and cons to aptamer-dye system deployment in studies. The positive attributes of aptamer-dye systems include: 1) the use of fluorogens to reduce background noise, 2) relatively small size, 3) only relies on RNA expression, and

4) faster maturation of fluorescent complex than GFP. The drawbacks of dye-aptamer systems include: 1) low affinity of aptamers for dyes, 2) dyes must be membrane permeable, 3) requirement for repeated units of aptamer on target, 4) dyes may sensitize radical production, and 5) engineering of RNA construct.

The labeling of RNA with a probe with some form of readout has been critical in deciphering the roles of various nucleic acid species in cells. The methods discussed above have their various merits and pit falls. All of the methods require altering the cells natural state; that cannot be avoided with the current technology. Solid-phase synthesis of nucleic acids is limited in size therefore it is difficult to study large sequences. Furthermore, synthetic nucleic acid probes often require injection, transfection, or the use of fixed cell samples. A major drawback of synthetic probes is the need for prior knowledge of sequence and structure which are critical for labeling success. Site specific enzymatic labeling of a recombinantly produced nucleic acids requires either mutation of a native enzyme or an enzyme that already modifies a particular site. Mutation of an enzyme could be very time consuming and there is no general enzyme for site selective labeling. The use

165 of genetically encoded tags allows for visualization of RNA without having to know the exact structure. However, the most common tag, GFP is large and requires multiple binding events to reduce background fluorescence. Encoded aptamer tags are smaller and require a small molecule that is able to diffuse into the cell. However, aptamers are still rather large and cannot be placed within a construct.

We believe that the bPNA triplex offers a unique genetically encoded labeling moiety capable of being positioned at a terminus, such as traditional fluorescent tags, or internally in place of known duplexes regions. In this way, bPNA could be used to study both localization of RNA in a cell or monitor interactions of the RNA both in vitro and in vivo. Our lab has shown in previous publications that bPNA triplexes can be inserted into

RNA constructs as duplex substitutes89-91, and we have also shown in Chapter 2 of this dissertation that bPNA triplexes can support kissing-loop interactions. Furthermore, we have shown that bPNA triplexes are tolerated at protein-nucleic acid interfaces by proteins such as Rop yet stable enough to inhibit certain enzymatic processes.92 bPNA also displays superior specificity for long stretches of U-U and T-T mismatches with nanomole affinity.

With this knowledge, we decided to test the hypothesis that bPNA triplexes could be used to site selectively modify a nucleic acid as a way of probing the mutant’s interactions in fluorescent assays. The mutant’s interactions with another nucleic acid or other U10 mutant could be monitored via Forster resonance energy transfer (FRET) or fluorogen turn on (Figure 68). The systems we chose to use in this study were the ColE1 and tRNA kissing-loops developed in Chapter 2. In the U10-U10 complexation study, we proposed to use two bPNAs labeled with dyes Cy3 and Cy5 as reporting molecules which when

166 bound to the U10 mutants would interact via FRET. To study kissing-loop formation with a native hairpin, the fluorogen thiazole orange would be appended to the terminus of bPNA which, upon loop-loop hybridization with the U10-triplex mutant would intercalate and fluoresce.

Figure 70: Fluorescent kissing-loop probes. A) Dye labeled bPNA FRET reporters of mutant U10 kissing-loops. B) Fluorogen thiazole orange turn on as a reporter of hairpin via kissing-loop formation.

3.2 bPNA AS A FRET BASED PROBE: EXPERIMENTAL DESIGN AND

RESULTS:

The FRET experiment would be performed in both the ColE1 mutants and the

U10 tRNA due to the different characteristics of their respective kissing complexes. The synthesis of the bPNA labeled with Cy3 (Cy3EM10) and Cy5 (Cy5EM10) is shown in the appendix accompanying this chapter. First, the individual RNA constructs would be

167 hybridized separately with Cy3 and Cy5 labeled (EM)10 in separate stock solutions. After complexation of the bPNA, the triplex hairpins would be mixed together in the presence of Mg2+ and incubated to allow for kissing-loop complex formation. At this point, solutions would be analyzed on a fluorimeter by exciting Cy3 at 550 nM and monitoring both Cy3 and Cy5 emission at 570 nM and 670 nM, respectively. The experimental design is shown in Figure 71.

Figure 71: Experimental design of U10-U10 kissing-loop FRET experiment. Individual U10 mutants are mixed with either cyanine dye labeled bPNA to form a hairpin. Triplex hybrids are mixed and fluorescence measured for FRET. X and Y are nucleobases which are complementary in non-identical loop sequences.

We first ran control experiments with Cy3-(EM)10 in the assay in which the Cy5- bPNA was substituted with unlabeled (EM)10 and found that Cy3 fluorescence did not 168 decrease with kissing complex formation (Supporting information, Figure 78). The results for the FRET experiments are shown in Figure 72. A FRET type signal is observed when

Figure 72: FRET experiments with U10 mutants. A) FRET experiment results of mutant tRNA. Mutant bound to Cy5-bPNA is titrated into Cy3-bPNA bound mutant and solution incubated 30 minutes on ice. Cy3-mutant complex held constant at 2 μM B) FRET experiment results in mutant ColE1 stem 1. Mutant bound to Cy5-bPNA is titrated into Cy3-bPNA bound mutant and solution incubated 30 minutes on ice. Cy3-mutant complex held constant at 500 nM. Blue line is emission intensity at 670 nm and the black line is emission intensity at 570 nm in both A and B. In all experiments, U10 mutants were annealed separately with either Cy3 or Cy5 labeled bPNA.

the Cy5EM10-HD2U10 is titrated into Cy3EM10-HD1U10 where the Cy3 signal at 570 nM decreases and Cy5 signal at 670 nM increases until a 1:1 solution is obtained at

169 which point both signals plateau (Figure 72A). The same FRET signal is detectable when bPNAs are switched between tRNA constructs. A similar significant FRET signal was observed in the ColE1 system no matter the combination of dye-bPNA and U10 triplex formed (Figure 72B).

Excited with these results, we then began to look at competition experiments with the constructs and their duplex counterparts as a means of detecting unlabeled hairpins.

The competition experiments were performed taking into account dissociation constants determined in the previous chapter; meaning the more stable kissing complex was expected to form. We therefore expected the FRET pair in the tRNA system to be broken up by the addition of duplex tRNA. For the tRNA system, a preformed kissing complex between the complementary U10 mutants bound to Cy3 and Cy5 labeled bPNA would be formed followed by the addition of duplex tRNA and incubation at 37°C for 1 h. As expected, the

FRET interaction decreases as duplex tRNA was titrated into the solution due to displacement of a U10 tRNA (Figure 73). The duplex displaced the U10 mutant with complete displacement appearing to occur at a 1:1 ratio.

We hypothesized the FRET pair to form in the ColE1 system by displacing a wild type stem in a WT-U10 kissing complex. Competition assays with the ColE1 system were first performed in the presence of Rop. The ColE1 competition assay was performed by incubating a wild type hairpin with the complementary U10-mutant bound to a Cy3-(EM)10 to form the kissing complex in the presence of 10 μM Rop. The U10-mutant with the same loop sequence as the wild type was then added and the reaction was incubated 3h on ice.

Displacement was observed as fluorescence emission at 570 nm decreased and emission at

170

Figure 73: tRNA competition assay. The tRNA duplex is expected to displace the U10-tRNA with the same loop sequence in the kissing complex (top). The graphs show the fluorescent read out of the assay (bottom panels). The duplex tRNA is able to displace the U10-tRNA with the sequence and this is observed by a decrease in emission at 670 nm and an increase of emission at 570 nm. Kissing complex is 500 nm and reaction incubated at 37 °C for 1 h. Blue line is fluorescence emission at 670 nm and black line is emission at 570 nm.

670 nm increased as the FRET capable kissing complex was formed (Figure 74). The

ColE1displacement appears to be complete at a slightly greater than 1:1 ratio. The fact that 171 displacement of the wild type by a triplex mutant occurred in the presence of Rop was surprising, as we assumed Rop would favor a wild type duplex hairpin and repress exchange. Like the tRNA system, the ColE1 displacement assay appears to favor the thermodynamically stronger kissing complex, in this case the U10-U10 complex.

Figure 74: ColE1 competition assay. Top: A kissing complex between a wild type stem-loop would be pre-formed and the wild type construct displaced by a U10 mutant with the same loop sequence. Brown bean is Rop. Bottom: Results of competition assay were blue line is fluorescence emission at 670 nm and black line is emission at 570 nm. Wildtype-U10 kissing complex held at 500 nM and U10 mutant with same loop sequence as the wild type construct is titrated in the presence of 10 μM Rop. Incubate 2 h on ice.

The ColE1 system, due to the effect Rop has on complex kinetics was further studied in the competition assays. Specifically, we sought to determine if the presence Rop protein made a difference in the equilibrium of the exchange. Previous experiments 172 revealed that Rop did not have a preference for the WT-U10 kissing complex as U10-U10 kissing complex was readily formed. The assay was repeated as described above but this time Rop was omitted from the reaction solution. The results indicated that Rop did make a significant difference in the displacement assay: displacement assays ran without Rop see only 50-70% of the fluorescence decrease at 570 nm compared to assays with Rop present in the reaction (Figure 73). In the assays without Rop, displacement was inefficient and did not appear to take place until after the addition of more than one equivalent of the competitive U10. There also appeared to be a sequence dependent affect in the displacement when Rop was not present. In the presence of Rop, the displacement was efficient and nearly complete after the addition of one equivalence of the triplex hybrid.

The reason for the Rop dependence exchange could be for one of the following reasons:

1) Rop prefers the U10-U10 kissing complex 2) Rop has no preference but accelerates the exchange 3) A combination of 1 and 2. Our Rop binding experiment in chapter 2 and reported literature values indicate that Rop binds more tightly to the wild type kissing complex. It appears Rop has a kinetic affect and catalyzes the exchange of the triplex and duplex hairpins to the more stable kissing complex. Further studies are required to determine the cause of this phenomena.

From this work, we have successfully used bPNA triplexes to monitor intermolecular interactions between two RNAs. Furthermore, we have used a competition assay to measure displacement of a dye labeled, bPNA triplex mutant. In general, the thermodynamically stable kissing-loop formed. However, in the case of the ColE1 system, exchange was very slow and appeared to be accelerated by Rop.

173

Comparing Rop vs no Rop for ColE1 FRET competition

RNAI-1U10-Cy5 with Rop RNAI-1U10-Cy5 without Rop RNAII-1U10-Cy5 with Rop RNAII-1U10-Cy5 without Rop 1.1

0.9

0.8

0.7

0.6

Normalizedfluorescence emissionat 570 nm 0.5

0.4 0 2000 4000 6000 8000 1 104

Concentration of U10-Cy5EM10 (nM)

Figure 75: Rop dependence on displacement in ColE1 FRET competition assay. Kissing complexes were preformed between wild type and U10-Cy3EM10 complex at 500 nM. A U10 mutant with the same loop sequence as the wild type construct hybridized with Cy5EM10 was titrated into the reaction. Rop when present was at 10 μM. When Rop is absent, displacement of the wild type hairpin is slow (Black Xs and Blue □). When Rop is present, displacement of the wildtype hairpin is readily observed (Black ♦ and Green ◊).

3.3 bPNA-THIAZOLE ORANGE CONJUGATES AS TURN ON PROBES:

3.3.1 EXPERIMENTAL DESIGN AND RESULTS:

174

Having shown that we can use dye-labeled bPNA triplexes as a way to monitor kissing-loop interactions through FRET assays, we next wanted to develop a probe capable of identifying the presence of a hairpin target (Figure 76). The probe itself would be a small hairpin with a bPNA-binding site. The bPNA design would be a base (EM)10 or

(ME)10 with a linker to covalently bind the peptide to a fluorescent molecule (Figure 76A).

The fluorescent molecule would be the fluorogen called thiazole orange which would help to reduce background noise as it would “turn-on” via intercalation when the kissing complex was formed. Thiazole orange when unbound, relaxes via bond rotation after excitation but when bound to nucleic acids by an intercalation mechanism, is forced to relax via fluorescence as rotation is restricted.93 The designs for peptides and U10 probe

RNA is shown in Tables 5 and 6 and briefly described below.

The linker between the peptide and fluorogen would be varied including no linker, a floppy linker, and a rigid turn linker in an effort to maximize fluorescence turn-on while minimizing background. The floppy linker would be composed of one to three β-alanine amino acids and one or two of a more hydrophilic 2-(2-(2-aminoethoxy)ethoxy)acetic acid linker. The rigid linker would be designed as a turn sequence based on the D-Pro-Gly β- turn motif developed by Gellman and coworkers.94 The turn linker was designed using the solution phase structures developed for the kissing-loops of HIV-DIS95 and ColE196 which shows a bend in the kissing-loop complex. We hypothesized that if the fluorogen was projected out of the hairpin structure that upon kissing complex formation, the newly formed duplex would fold around the fluorogen (Figure 74B and D) and turn on the

175

Figure 76: Kissing-loop turn on probe design. A) Basic structure of (EM)10 and (ME)10 peptide-thiazole orange conjugates. B) The rigid linker design based on the bent structure observed in NMR solution structure of kissing- loops. C) Floppy linker design for TO probe. D) Rigid turn linker design for TO probe. Fluorogen would be projected out of the triplex construct and kissing-loop would fold around the dye and turn on the fluorescence.

fluorescence. The synthetic β-turn would be flanked on either side by glycine in order to create turns of different lengths. A small molecule turn was also designed using 3-

176 aminobenzoic acid, however synthesis and purification of the designed peptides proved difficult due to aggregation (supporting information Figure 84).

Probe design was based on a small hairpin as initial studies with the tRNA mutants showed max turn-on when TO-bPNA conjugate was hybridized, presumptively through intercalation into the tRNA body (data not shown). Loops in the hairpin probes were designed to be as unstructured as possible in the monomeric form in an effort to turn off the background fluorescence observed in design 5 (Table 4). Unstructuring of the loop was accomplished via substitution of abasic propyl linkers (Pr) and triethylene glycol linker

[(EG)3] in place of the flanking adenosine nucleobases in the HIV-DIS mutant loop sequence and the substitution of unlocked nucleic acids (Gu) in positions one and six of the hexanucleotide hybridization sequence. Probes 1 and 3 maintained the backbone length of a nine-nucleotide loop by replacing the flanking dA in the loop region with a propyl linker.

Probe 2 was designed to make a symmetric loop and the backbone length resembled a ten- nucleotide loop by adding Pr at positions 1, 2, 9, and 10 of the loop. Probe 4 which incorporated the triethylene glycol linker was designed to provide a side loop design creating the greatest asymmetry in loop of all our probes. The seven-nucleotide loop U10 mutants of the ColE1 system did not show turn on in our previous experiments (data not shown) so shorter loop sequences were used in designs 6 and 7.

All probes were first tested by native gel electrophoresis to ensure they were capable of forming kissing complexes (supporting information Figure 80-84). The fluorescence turn-on experimental results are shown in Table 5 and 6. An example of the observed fluorescence turn-on is shown in Figure 77. The five-nucleotide loop of the

177

ColE1 probes showed minimal improvement in fluorogen turn-on with most peptides, the exception being the combination of probe 7 with TO-bAla-(EM)10 which showed a turn- on of 1.8-fold. There appears to be a sequence-specific effect with turn-on of the thiazole

Figure 77: TO-bPNA kissing-loop detection. This figure shows the difference in TO fluorescence between the unbound TO-bPNA-probe triplex hybrid and kissing-loop complex. The top red spectrum indicates TO fluorescence for the kissing complex and bottom black spectrum indicates free TO-bound probe.

orange as the complementary sequence in probe 6 did not show the same level of TO turn on. Probes to detect complexation with the tRNA mutants also showed somewhat weak turn-on factors. The best results of about 2.3-fold turn-on were from probe 1 in which positions 1, 2 and 9 of the loop sequence were abasic propyl linkers and peptides TO-

(bAla)2(ME)10 and TO-PEG(ME)10 whose linkers are roughly the same size. The rigid linker did not appear to make a significant difference in reducing background turn-on

178 fluorescence. In general, the less structured the loop, the less turn-on was observed upon kissing complex formation.

Table 5: Turn-on factor of hybridized TO-bPNA conjugates and 9-membered loop probes. 1 2 3 4 5

TO-(ME)10 1.3 1.1 1.7 1.1 1.1

TO-G(ME)10 1.5 1.1 2 1.2 1.1

TO-PEG(ME)10 2.3 1.4 1.4 1.6 1.2

TO-(PEG)2(ME)10 1.7 1.4 1.1 1.3 1.6

TO-bAla(EM)10 1.6 1.6 1.8 1.6 1.1

TO-(bAla)2(ME)10 2.25 1.7 1.8 1.6 1.2

TO-(bAla)3(ME)10 1.9 1.5 1.9 1.3 N/A

D TO- PG-(ME)10 1.6 1.5 1.9 1.3 1.1

D TO-G PG(ME)10 1.7 1.6 1.5 1.3 1.3

Table is reported as number of fold fluorescence turn-on of probe upon kissing loop complex formation. Peptides: TO is thiazole orange represented as an orange ciricle. PEG in peptide design is 2-(2-(2- aminoethoxy)ethoxy)acetic acid. bAla is β-Alanine. DP is D-Proline. Probes: Designs 1-5 were tested against HD2Nat tRNA mutant. Pr in probe sequence indicates an abasic propyl linker. Gu is an unlocked nucleic acid. (EG)3 is an abasic triethylene glycol linker.

179

Table 6: Turn-on factor of hybridized TO-bPNA conjugates and 7-membered loop probes. 6 7

TO-(ME)10 1.2 0.85

TO-G(ME)10 0.9 1.2

TO-PEG(ME)10 1.3 1.3

TO-(PEG)2(ME)10 1.15 1.3

TO-bAla(EM)10 1.16 1.8

TO-(bAla)2(ME)10 0.9 1.2

TO-(bAla)3(ME)10 1.15 0.9

D TO- PG-(ME)10 0.9 0.8

D TO-G PG(ME)10 0.8 1

Table is reported as number of fold fluorescence turn-on of probe upon kissing loop complex formation. Peptides: TO is thiazole orange represented as an orange ciricle. PEG in peptide design is 2-(2-(2- aminoethoxy)ethoxy)acetic acid. bAla is β-Alanine. DP is D-Proline. Probes: 6 and 7 were tested against RNAI-1WT and RNAII-1WT, respectively.

In general, we were able to detect kissing complex formation through turn-on making this approach a viable option for in vitro detection. If a fluorogen-based bPNA triplex system is to be used in vivo, improvements must be made to reduce background turn on. The TO-bPNA conjugates already show a turn-on without hybridization to the U10 probe and further turn-on upon triplex formation is also a problem. Decreased background could be realized by changing the fluorogen, alternative probe redesigns, or the use of a small-molecule quencher whose affects are removed upon kissing-loop formation.

180

3.3.2 DISCUSSION AND CONCLUSIONS:

The specificity of bPNAs for sequential U-U mismatches offers a new approach to site specifically label a nucleic acid by mutating a duplex region to a bPNA binding site.

We have successfully utilized bPNA as a fluorescent probe to monitor kissing-loop formation through both FRET competition assays and turn on probes. The tRNA mutant system in the competition assay successfully showed that hairpins with higher affinity can displace a weaker binding triplex mutant and the displacement could be monitored with

FRET. This strategy could be used to monitor the expression of any sequence or as a structural probe with the target sequence displacing a FRET contributor. The strength of the complex can be tailored using common strategies such as UNAs and LNAs to adjust the stringency of the probe.

FRET competitions assays in the ColE1 system was less straight forward than the tRNA system. We expected the triplex hairpin to displace the wild type hairpin with the same loop sequence in a kissing complex with a complementary U10 mutant. Interestingly, at stoichiometric amounts, the displacement was not observed until an excess of competitor was added. However, when 10 μM of Rop was present, displacement of the wild type was efficient at sub-stochiometric amounts. These results point to a catalytic role for Rop in the displacement assay. We were able to realize this unique interaction using two bPNAs functionalized with a pair of FRET dyes with which we could then site selectively label two different, interacting RNAs.

181

In our final study, we successfully utilized bPNA as a turn-on probe for complexation. Using a fluorogen probe, we could monitor kissing-loop formation with only one bPNA binding mutation in the system. While further work is required to achieve acceptable background levels for use of bPNA as an in vivo probe, fluorogen labeled bPNA such as the ones present above could be readily used for in vitro experiments. Fluorogen- bound bPNA could readily be used to measure nucleic acid interactions provided the bPNA triplex could be placed near the region of interest via duplex mutation. Strategic placement of the probe-functionalized bPNA triplexes near a site of interaction or in a region which undergoes a conformational change could potentially be observed as the probe environment changes, resulting in a change of the fluorescence signal of the probe. In summary, we have shown that bPNA triplexes could be used as site specific labels for nucleic acids.

182

3.4 SUPPORTING INFORMATION CHAPTER 3

3.4.1 Materials and instrumentation:

Chemicals for Fmoc-protected amino acids, peptide, acrylamide solutions and dye synthesis were purchased from Chem-Impex, TCI America, AAPPTec, and VWR and used without further purification. Oligonucleotides were purchased from Integrated DNA technologies. HD2Nat was synthesized as described in Chapter 2 of this document. rNTPs were purchased from Sigma Aldrich. T7 RNA polymerase and Pfu DNA polymerase enzymes were produced in house

The concentration of all DNA oligomers and synthetic peptides was determined by

UV absorbance using a Thermo Scientific Nanodrop 200c spectrophotometer. The concentration of thiazole orange peptides were determined by measuring the absorbance at

501 nm and using the molar extinction coefficient of 63,000 M-1 cm-1. Fluorescence experiment was performed on a Thermo Scientific NanoDrop 3300 fluorospectrometer.

MALDI-TOF Mass spectra were acquired on Bruker Microflex MALDI-TOF instrument.

Electrospray ionization mass spectrometry (ESI) was acquired on Bruker MicroTOF equipped with an electrospray ionization source. NMR spectra were acquired on Bruker

Advance DPX 400 instrument. Solid phase peptide synthesis was performed on AAPPTec

Apex 396 peptide synthesizer. All peptides were purified on a Hitachi L-7150 pump,

Hitachi D-7000 interface and Hitachi L-7400 UV detector on an AAPPTec RPC18 preparative HPLC column and the purity was confirmed on an AAPPTec RP-C18 analytical column. Data was plotted on KaleidaGraph 4.0.

183

3.4.2 Fluorescence experiments procedure:

FRET experiment: U10-RNA and Cy3(EM)10G-CONH2 stock solutions at 3x concentrations were prepared in 1x buffer. Complementary U10-RNA and Cy5(EM)10G-

CONH2 were diluted in a separate vial in 1x buffer. RNA/bPNA solutions were annealed at 90 °C for 5 min, and snap cooled on ice for 5 min. Rop was added if necessary to bring stock concentration to 30 μM of Rop (10μM final concentration after dilution with FRET partner and 1x buffer). Reaction solutions were made by aliquoting 10 μl of RNA/Cy3 stock into multiple tubes and adding an increasing amount of RNA/Cy5 to separate tubes, using 1x buffer to bring the total volume to 30 μl. The final concentration of U10-

RNA/Cy3 was 2μM or 0.5 μM for the tRNA and ColE1 systems, respectively. U10-

RNA/Cy5 ranged from 0 μM to 4 μM. For control experiments, an unlabeled bPNA was used in place of the Cy5-bPNA. RNAs were mixed and incubated at least 30 min on ice. The fluorescence experiment was performed on a Thermo Scientific NanoDrop 3300 fluorospectrometer by exciting Cy3 at 550 nm and monitoring at 570 nm and 670 nm.

FRET competition experiments procedure. tRNA: HD1U10 was snap annealed with Cy3(EM)10G-CONH2 and HD2U10 was snap annealed with Cy5(EM)10G-CONH2 as described above in 1x kissing buffer. The triplex containing RNA’s were mixed with one another to give a complex concentration of 500 nM (500 nM of each RNA triplex) and incubated 20 min on ice. Varying amounts of

HD1Nat or HD2Nat was titrated into the samples with a concentration ranging from 0-

2000 nM and the samples brought up to 20 μl with 1x buffer. The samples were incubated

184 at 37oC for 1 h and then analyzed. Fluorescence was measured by exciting system at 550 nM and monitoring at 570 nM and 670 nM.

ColE1: RNA-1U10 and Cy3(EM)10G-CONH2 were snap annealed in 1x kissing buffer.

RNA-1WT was snap annealed in 1x buffer. RNA-1U10-Cy3EM10 and RNA-1WT with complementary loop sequences were mixed 1:1 to produce a stock solution 3x greater than assay concentrations and incubated 20 min on ice. 10 μl of stock U10-WT kissing complex is added to multiple tubes. At the same time, the U10 mutant with the same loop sequence as RNA-1WT was mixed with Cy5(EM)10G-CONH2 and snap annealed in 1x buffer. To the tubes with kissing complex was added various amounts of RNA-Cy5EM10 triplex using 1x buffer to bring the volume to 30 μl. The final concentration of preformed kissing complex was 500 nM and competitor concentration ranged from 0-10 μM. The reaction was incubated for 2 h on ice and fluorescence measured by exciting at 550 nm and observing the emission at 570 nm and 670 nm. When Rop was present, the stock solution of kissing complex had Rop added at a concentration of 30 μM. Final Rop concentration was 10 μM.

TO-probe turn on experiments: U10-probe was mixed with TO-bPNA at 2 μM concentration in 1x kissing buffer and snap annealed. HD2Nat or ColE1 RNA-WT was diluted into 1x kissing buffer at a concentration of 3 μM and snap annealed. An equal volume of both solutions was mixed and incubated 30 min on ice. Fluorescence was then measured by exciting at 501 nm and measuring emission at 530 nm.

185

Figure 78: Fluorescent controls for FRET with Cy3-bPNA and unlabeled bPNA in tRNA kissing-loop. The above graph shows the fluorescence change in triplex-tRNA HD1U10 bound to EM10 is titrated into a solution containing a constant 500 nM of triplex-tRNA HD2U10 bound to Cy3-EM10 in 1:1 ratio.

Figure 79: Effect of kissing loop complex formation on Cy3 fluorescence in ColE1 system. This is a control experiment for Cy3 fluorescence when forming kissing complex in ColE1 system. The above graph shows the fluorescence change in triplex-RNAI-1U10 bound to EM10 is titrated into a solution containing a constant 500 nM of triplex-RNAII-1U10 bound to Cy3-EM10. RNAs and bPNA were mixed 1:1 and incubated separately on ice for 5 minutes. RNA-bPNA triplexes were titrated in and samples incubated 30 min on ice. Cy3 was excited at 550 nm and fluorescence monitored at 570 nm.

186

3.4.3 EMSA gels of probes with targets.

Gel experiments were performed as described in Chapter 2 of this document.

Figure 80: EMSA gel of kissing complex formation with probe 4. The gel above shows the gel shift of probe 4 -Cy5bPNA triplex upon binding to HD2Nat. Probe 4 is held constant at 1 μM and HD2Nat is titrating in with a range of 0-8 μM. Gel is imaged by Cy5 fluorescence. Top band is kissing complex. Bottom band is free probe 4.

Figure 81: EMSA gel of kissing complex formation with probe 3. The gel above shows the gel shift of probe 3 -Cy5bPNA triplex upon binding to HD2Nat. Probe 3 is held constant at 100 nM and HD2Nat is titrating in with a range of 0-1600 nM. Gel is imaged by Cy5 fluorescence. Top band is kissing complex. Bottom band is free probe 3.

Figure 82: EMSA gel of kissing complex formation with probe 2. The gel above shows the gel shift of probe 2 -Cy5bPNA triplex upon binding to HD2Nat. Probe 2 is held constant at 100 nM and HD2Nat is titrating in with a range of 0-200 nM.

187

Gel is imaged by Cy5 fluorescence. Top band is kissing complex. Bottom band is free probe 2.

Figure 83: EMSA gel of kissing complex formation with probe 1. The gel above shows the gel shift of probe 1 -Cy5bPNA triplex upon binding to HD2Nat. Probe 1 is held constant at 100 nM and HD2Nat is titrating in with a range of 0-200 nM. Gel is imaged by Cy5 fluorescence. Top band is kissing complex. Bottom band is free probe 1.

Figure 84: EMSA gel of kissing complex formation with probe 6 and 7. The gel above shows the gels shift of probe 6-Cy5(EM)10 and probe 7--(EM)10 kissing complex. Probe 7- Cy5(EM)10 is held constant at 500 nM and probe 6-(EM)10 is titrated in with a range of 0-2.5 μM. Gel is imaged by Cy5 fluorescence. Excess Probe 6 may be stained by excess Cy5(EM)10.

3.4.4 Synthetic Procedures and compound characterization.

Thiazole orange acetate synthesis:

Synthesis of thiazole orange acetate was performed as reported.97 Yield was 164 mg

(2.8%) of a bright orange powder.

188

Figure 85: Proton NMR of thiazole orange acetate. 1H NMR (400 MHz, MeOD-D4) of thiazole orange acetate.

Peptide Synthesis: Fmoc-Lys(Mel)-OH and NH2-(EM)10G-CONH2 was synthesized as previously reported.98 Peptides were synthesized on an AAPPTec Apex 396 peptide synthesizer using standard solid phase Fmoc chemistry on Rink Resin LS with 0.28 mmol/g loading. 0.5 mmol of Amino acids were coupled with 0.5 mmol of HOBt and 0.5 mmol DIC in 2 ml DMF. The coupling reactions were mixed for 1.5 h at which point they were rinsed with 3 x 2 ml DMF. Fmoc protecting groups were cleaved by subjecting resin to 2 x 2 ml of 20% v/v piperidine solution in DMF for ten min followed by another rinse cycle. Peptides were cleaved from the resin using 95:5 v/v TFA:water solution for 4 h. Cleaved peptide solutions were filtered through cotton to remove the beads, peptide

189 crashed out in cold diethyl ether, centrifuged to collect the solid peptide, washed 3 times with cold ether, and dried using a nitrogen gas stream to remove excess ether and

TFA. Peptides were purified using preparatory HPLC using a C18 column and water/acetonitrile gradient containing 0.1% v/v TFA. The purification used solvent A

(water, 0.1% v/v TFA) and solvent B (80% v/v acetonitrile, 0.1% v/v TFA) gradient as follows: 0-5 min 10% B, 5-20 min increase to 38% B, 30% B for 15 min, then 100% B for

5 min.

Thiazole Orange conjugation: Thirty mg of thiazole orange and 23 mg of pyridinium p-toluenesulfonate (PPTS) were dissolved in 3 ml of DMF. To this mixture was added

172.5 μM N-hydroxysuccinimide and 172.5 μM N,N'-diisopropylcarbodiimide and the reaction is incubated 2 h at 38°C. The activated thiazole orange is then added to the peptide resin and reaction is incubated at 70°C for 2 h. Reaction was monitored using

Kaiser test and looking at beads under microscope to examine color.

190

Figure 86: Attempted TO-peptides that could not be purified.

191

Figure 87: HPLC trace and MALDI-TOF of TO-(PEG)2(ME)10G-CONH2 A) MALDI-TOF spectra of TO-(PEG)2(ME)10G-CONH2: Calculated [M+]: 4357.050 Found: 4355.796. B) HPLC trace of TO-(PEG)2(ME)10G-CONH2 on a RP-C18 analytical column monitored with UV-Vis detector at 220 nm.

192

Figure 88: HPLC trace and MALDI-TOF of TO-(PEG)(ME)10G-CONH2 A) MALDI-TOF spectra of TO-(PEG)(ME)10G-CONH2: Calculated [M+]: 4211.976 Found: 4209.825. B) HPLC trace of TO-(PEG)(ME)10G-CONH2 on a RP-C18 analytical column monitored with UV-Vis detector at 220 nm.

193

Absorbance at 220 nm B) HPLC of TO-(bAla)2-EM10 2000

1500

1000 Absorbance at 220 nm 500

0 0 5 10 15 20 25 30 35 40

Time (minutes)

Figure 89: HPLC trace and MALDI-TOF of TO-(bAla)2(EM)10G-CONH2 A) MALDI-TOF spectra of TO-(bAla)2(EM)10G-CONH2: Calculated [M+]: 4208.976 Found: 4204.906. B) HPLC trace of TO-(bAla)2(EM)10G-CONH2 on a RP-C18 analytical column monitored with UV-Vis detector at 220 nm.

194

Absorbance at 220 nm B) HPLC of TO-bAla-EM10 1200

1000

800

600

400 Absorbance at 220 nm

200

0 0 5 10 15 20 25 30 35 40

Time (minutes)

Figure 90: HPLC trace and MALDI-TOF of TO-(bAla)(EM)10G-CONH2 A) MALDI-TOF spectra of TO-(bAla)(EM)10G-CONH2: Calculated [M+]: 4137.939 Found: 4134.006. B) HPLC trace of TO-(bAla)(EM)10G-CONH2 on a RP-C18 analytical column monitored with UV-Vis detector at 220 nm.

195

Absorbance at 220 nm B) HPLC of TO-dP-G-EM10 1600

1400

1200

1000

800

600

Absorbance at 220 nm 400

200

0 5 10 15 20 25 30 35 40

Time (minutes)

Figure 91: HPLC trace and MALDI-TOF of TO-dP-G-(EM)10G-CONH2 A) MALDI-TOF spectra of TO-dP-G-(EM)10G-CONH2: Calculated [M+]: 4220.976 Found: 4219.422. B) HPLC trace of TO-dP-G-(EM)10G-CONH2 on a RP-C18 analytical column monitored with UV-Vis detector at 220 nm.

196

Absorbance at 220 nm B) HPLC of TO-G-dP-G-EM10 2500

2000

1500

1000 Absorbance at 220 nm

500

0 5 10 15 20 25 30 35 40

Time (minutes)

Figure 92: HPLC trace and MALDI-TOF of TO-G-dP-G-(EM)10G-CONH2 A) MALDI-TOF spectra of TO-G-dP-G-(EM)10G-CONH2: Calculated [M+]: 4277.998 Found: 4274.353. B) HPLC trace of TO-G-dP-G-(EM)10G-CONH2 on a RP-C18 analytical column monitored with UV-Vis detector at 220 nm.

197

Absorbance at 220 nm B) HPLC of TO-G-ME10 1200

1000

800

600

400 Absorbance at 220 nm

200

0 0 5 10 15 20 25 30 35 40

Time (minutes)

Figure 93: HPLC trace and MALDI-TOF of TO-G-(ME)10G-CONH2 A) MALDI-TOF spectra of TO-G-(ME)10G-CONH2: Calculated [M+]: 4123.923 Found: 4121.694. B) HPLC trace of TO-G-(ME)10G-CONH2 on a RP-C18 analytical column monitored with UV-Vis detector at 220 nm.

198

Absorbance at 220 nm B) HPLC of TO-ME10 500

400

300

200

100 Absorbance at 220 nm

-100 0 5 10 15 20 25 30 35 40

Time (minutes)

Figure 94: HPLC trace and MALDI-TOF of TO-(ME)10G-CONH2 A) MALDI-TOF spectra of TO-(ME)10G-CONH2: Calculated [M+]: 4066.902 Found: 4061.909. B) HPLC trace of TO-(ME)10G-CONH2 on a RP-C18 analytical column monitored with UV-Vis detector at 220 nm.

199

Absorbance at 220 nm

HPLC of TO-(bAla)3-EM10 1200

1000

800

600

400 Absorbance at 220 nm

200

0 0 5 10 15 20 25 30 35 40

Time (minutes)

Figure 95: HPLC trace and MALDI-TOF of TO-(bAla)3-(EM)10G-CONH2 HPLC trace of TO-(bAla)3-(EM)10G-CONH2 on a RP-C18 analytical column monitored with UV-Vis detector at 220 nm.

200

3.5 REFERENCES CHAPTER 3

1. Shin, D.; Sinkeldam, R. W.; Tor, Y., Emissive RNA Alphabet. J. Am. Chem. Soc.

2011, 133 (38), 14912-14915.

2. Kubota, T.; Ikeda, S.; Yanagisawa, H.; Yuki, M.; Okamoto, A., Sets of RNA

Repeated Tags and Hybridization-Sensitive Fluorescent Probes for Distinct Images of

RNA in a Living Cell. PLOS ONE 2010, 5 (9), e13003.

3. Wilson, J. N.; Teo, Y. N.; Kool, E. T., Efficient Quenching of Oligomeric

Fluorophores on a DNA Backbone. J. Am. Chem. Soc. 2007, 129 (50), 15426-15427.

4. Stadler, A. L.; Delos Santos, J. O.; Stensrud, E. S.; Dembska, A.; Silva, G. L.;

Liu, S.; Shank, N. I.; Kunttas-Tatli, E.; Sobers, C. J.; Gramlich, P. M. E.; Carell, T.;

Peteanu, L. A.; McCartney, B. M.; Armitage, B. A., Fluorescent DNA Nanotags

Featuring Covalently Attached Intercalating Dyes: Synthesis, Antibody Conjugation, and

Intracellular Imaging. Bioconjugate Chem. 2011, 22 (8), 1491-1502.

5. Wang, X.; Krull, U. J., Synthesis and fluorescence studies of thiazole orange tethered onto oligonucleotide: development of a self-contained DNA biosensor on a fiber optic surface. Bioorganic & Medicinal Chemistry Letters 2005, 15 (6), 1725-1729.

6. van Delft, P.; Meeuwenoord, N. J.; Hoogendoorn, S.; Dinkelaar, J.; Overkleeft, H.

S.; van der Marel, G. A.; Filippov, D. V., Synthesis of Oligoribonucleic Acid Conjugates

Using a Cyclooctyne Phosphoramidite. Organic Letters 2010, 12 (23), 5486-5489.

201

7. Ishiguro, T.; Saitoh, J.; Yawata, H.; Otsuka, M.; Inoue, T.; Sugiura, Y.,

Fluorescence detection of specific sequence of nucleic acids by oxazole yellow-linked oligonucleotides. Homogeneous quantitative monitoring of in vitro transcription. Nucleic

Acids Research 1996, 24 (24), 4992-4997.

8. Hrdlicka, P. J.; Babu, B. R.; Sørensen, M. D.; Harrit, N.; Wengel, J., Multilabeled

Pyrene-Functionalized 2‘-Amino-LNA Probes for Nucleic Acid Detection in

Homogeneous Fluorescence Assays. J. Am. Chem. Soc. 2005, 127 (38), 13293-13299.

9. Yamana, K.; Iwase, R.; Furutani, S.; Tsuchida, H.; Zako, H.; Yamaoka, T.;

Murakami, A., 2′-Pyrene modified oligonucleotide provides a highly sensitive fluorescent probe of RNA. Nucleic Acids Research 1999, 27 (11), 2387-2392.

10. Proudnikov, D.; Mirzabekov, A., Chemical Methods of DNA and RNA

Fluorescent Labeling. Nucleic Acids Research 1996, 24 (22), 4535-4542.

11. Yamane, A., MagiProbe: a novel fluorescence quenching‐based oligonucleotide probe carrying a fluorophore and an intercalator. Nucleic Acids Research 2002, 30 (19), e97-e97.

12. Ranjit, S.; Gurunathan, K.; Levitus, M., Photophysics of Backbone Fluorescent

DNA Modifications: Reducing Uncertainties in FRET. J. Phys. Chem. B 2009, 113 (22),

7861-7866.

13. Abe, H.; Kool, E. T., Destabilizing Universal Linkers for Signal Amplification in

Self-Ligating Probes for RNA. J. Am. Chem. Soc. 2004, 126 (43), 13980-13986.

202

14. Tomkuvienė, M.; Clouet-d’Orval, B.; Černiauskas, I.; Weinhold, E.;

Klimašauskas, S., Programmable sequence-specific click-labeling of RNA using archaeal box C/D RNP methyltransferases. Nucleic Acids Research 2012, 40 (14), 6765-6773.

15. Schulz, D.; Holstein, J. M.; Rentmeister, A., A Chemo-Enzymatic Approach for

Site-Specific Modification of the RNA Cap. Angewandte Chemie International Edition

2013, 52 (30), 7874-7878.

16. Li, F.; Dong, J.; Hu, X.; Gong, W.; Li, J.; Shen, J.; Tian, H.; Wang, J., A Covalent

Approach for Site-Specific RNA Labeling in Mammalian Cells. Angewandte Chemie

International Edition 2015, 54 (15), 4597-4602.

17. Marie Holstein, J.; Stummer, D.; Rentmeister, A., Enzymatic modification of 5′- capped RNA with a 4-vinylbenzyl group provides a platform for photoclick and inverse electron-demand Diels–Alder reaction. Chemical Science 2015, 6 (2), 1362-1369.

18. Samanta, A.; Krause, A.; Jäschke, A., A modified dinucleotide for site-specific

RNA-labelling by transcription priming and click chemistry. Chemical Communications

2014, 50 (11), 1313-1316.

19. Schoch, J.; Ameta, S.; Jäschke, A., Inverse electron-demand Diels–Alder reactions for the selective and efficient labeling of RNA. Chemical Communications

2011, 47 (46), 12536-12537.

20. Winz, M.-L.; Samanta, A.; Benzinger, D.; Jäschke, A., Site-specific terminal and internal labeling of RNA by poly(A) polymerase tailing and copper-catalyzed or copper- free strain-promoted click chemistry. Nucleic Acids Research 2012, 40 (10), e78-e78.

203

21. Srivatsan, S. G.; Tor, Y., Fluorescent Pyrimidine Ribonucleotide: Synthesis,

Enzymatic Incorporation, and Utilization. J. Am. Chem. Soc. 2007, 129 (7), 2044-2053.

22. Domnick, C.; Eggert, F.; Kath-Schorr, S., Site-specific enzymatic introduction of a norbornene modified unnatural base into RNA and application in post-transcriptional labeling. Chemical Communications 2015, 51 (39), 8253-8256.

23. Paige, J. S.; Wu, K. Y.; Jaffrey, S. R., RNA Mimics of Green Fluorescent Protein.

Science 2011, 333 (6042), 642-646.

24. Riedl, J.; Ménová, P.; Pohl, R.; Orság, P.; Fojta, M.; Hocek, M., GFP-like

Fluorophores as DNA Labels for Studying DNA–Protein Interactions. J. Org. Chem.

2012, 77 (18), 8287-8293.

25. Synthesis and Binding Properties of Oligo-2‘-deoxyribonucleotides Covalently

Linked to a Thiazole Orange Derivative - Bioconjugate Chemistry (ACS Publications).

26. Politz, J. C.; Tuft, R. A.; Pederson, T.; Singer, R. H., Movement of nuclear poly(A) RNA throughout the interchromatin space in living cells. Current Biology 1999,

9 (6), 285-291.

27. Zhu, H.; Lewis, F. D., Pyrene Excimer Fluorescence as a Probe for Parallel G-

Quadruplex Formation. Bioconjugate Chem. 2007, 18 (4), 1213-1217.

28. Raj, A.; van den Bogaard, P.; Rifkin, S. A.; van Oudenaarden, A.; Tyagi, S.,

Imaging individual mRNA molecules using multiple singly labeled probes. Nat Meth

2008, 5 (10), 877-879.

29. Raj, A.; Peskin, C. S.; Tranchina, D.; Vargas, D. Y.; Tyagi, S., Stochastic mRNA

Synthesis in Mammalian Cells. PLoS Biol 2006, 4 (10), e309.

204

30. Lifland, A. W.; Zurla, C.; Santangelo, P. J., Single molecule sensitive multivalent polyethylene glycol probes for RNA imaging. Bioconjugate Chem. 2010, 21 (3), 483-

488.

31. Molenaar, C.; Marras, S. A.; Slats, J. C. M.; Truffert, J. C.; Lemaître, M.; Raap,

A. K.; Dirks, R. W.; Tanke, H. J., Linear 2′ O-Methyl RNA probes for the visualization of RNA in living cells. Nucleic Acids Research 2001, 29 (17), e89-e89.

32. Rist, M.; Marino, J., Association of an RNA kissing complex analyzed using 2- aminopurine fluorescence. Nucleic Acids Research 2001, 29 (11), 2401-2408.

33. Svanvik, N.; Westman, G.; Wang, D.; Kubista, M., Light-Up Probes: Thiazole

Orange-Conjugated Peptide Nucleic Acid for Detection of Target Nucleic Acid in

Homogeneous Solution. Analytical Biochemistry 2000, 281 (1), 26-35.

34. Free-Probe Fluorescence of Light-up Probes - Journal of the American Chemical

Society (ACS Publications).

35. Köhler, O.; Jarikote, D. V.; Seitz, O., Forced Intercalation Probes (FIT Probes):

Thiazole Orange as a Fluorescent Base in Peptide Nucleic Acids for Homogeneous

Single-Nucleotide-Polymorphism Detection. ChemBioChem 2005, 6 (1), 69-77.

36. Socher, E.; Jarikote, D. V.; Knoll, A.; Röglin, L.; Burmeister, J.; Seitz, O., FIT probes: Peptide nucleic acid probes with a fluorescent base surrogate enable real-time

DNA quantification and single nucleotide polymorphism discovery. Analytical

Biochemistry 2008, 375 (2), 318-330.

37. Kummer, S.; Knoll, A.; Socher, E.; Bethge, L.; Herrmann, A.; Seitz, O.,

Fluorescence Imaging of Influenza H1N1 mRNA in Living Infected Cells Using Single-

205

Chromophore FIT-PNA. Angewandte Chemie International Edition 2011, 50 (8), 1931-

1934.

38. Hövelmann, F.; Gaspar, I.; Loibl, S.; Ermilov, E. A.; Röder, B.; Wengel, J.;

Ephrussi, A.; Seitz, O., Brightness through Local Constraint—LNA-Enhanced FIT

Hybridization Probes for In Vivo Ribonucleotide Particle Tracking. Angewandte Chemie

International Edition 2014, 53 (42), 11370-11375.

39. Hövelmann, F.; Gaspar, I.; Chamiolo, J.; Kasper, M.; Steffen, J.; Ephrussi, A.;

Seitz, O., LNA-enhanced DNA FIT-probes for multicolour RNA imaging. Chemical

Science 2015, 7 (1), 128-135.

40. Robertson, K. L.; Yu, L.; Armitage, B. A.; Lopez, A. J.; Peteanu, L. A.,

Fluorescent PNA Probes as Hybridization Labels for Biological RNA†. Biochemistry

2006, 45 (19), 6066-6074.

41. Cai, J.; Li, X.; Yue, X.; Taylor, J. S., Nucleic Acid-Triggered Fluorescent Probe

Activation by the Staudinger Reaction. J. Am. Chem. Soc. 2004, 126 (50), 16324-16325.

42. Wienholds, E.; Kloosterman, W. P.; Miska, E.; Alvarez-Saavedra, E.; Berezikov,

E.; Bruijn, E. d.; Horvitz, H. R.; Kauppinen, S.; Plasterk, R. H. A., MicroRNA

Expression in Zebrafish Embryonic Development. Science 2005, 309 (5732), 310-311.

43. Østergaard, M. E.; Cheguru, P.; Papasani, M. R.; Hill, R. A.; Hrdlicka, P. J.,

Glowing Locked Nucleic Acids: Brightly Fluorescent Probes for Detection of Nucleic

Acids in Cells. J. Am. Chem. Soc. 2010, 132 (40), 14221-14228.

44. Kanamori, T.; Ohzeki, H.; Masaki, Y.; Ohkubo, A.; Takahashi, M.; Tsuda, K.;

Ito, T.; Shirouzu, M.; Kuwasako, K.; Muto, Y.; Sekine, M.; Seio, K., Controlling the

206

Fluorescence of Benzofuran-Modified Uracil Residues in Oligonucleotides by Triple-

Helix Formation. ChemBioChem 2015, 16 (1), 167-176.

45. Godde, F.; Toulmé, J.-J.; Moreau, S., 4-amino-1H-benzo[g]quinazoline-2-one: a fluorescent analog of cytosine to probe protonation sites in triplex forming oligonucleotides. Nucleic Acids Research 2000, 28 (15), 2977-2985.

46. Tyagi, S.; Kramer, F. R., Molecular Beacons: Probes that Fluoresce upon

Hybridization. Nat Biotech 1996, 14 (3), 303-308.

47. Simon, B.; Sandhu, M.; Myhr, K. L., Live FISH: Imaging mRNA in living neurons. J. Neurosci. Res. 2010, 88 (1), 55-63.

48. Wang, L.; Yang, C. J.; Medley, C. D.; Benner, S. A.; Tan, W., Locked Nucleic

Acid Molecular Beacons. J. Am. Chem. Soc. 2005, 127 (45), 15664-15665.

49. Englund, E. A.; Appella, D. H., Synthesis of γ-Substituted Peptide Nucleic Acids:

A New Place to Attach Fluorophores without Affecting DNA Binding. Organic Letters

2005, 7 (16), 3465-3467.

50. Bratu, D. P.; Cha, B.-J.; Mhlanga, M. M.; Kramer, F. R.; Tyagi, S., Visualizing the distribution and transport of mRNAs in living cells. PNAS 2003, 100 (23), 13308-

13313.

51. Santangelo, P. J.; Nix, B.; Tsourkas, A.; Bao, G., Dual FRET molecular beacons for mRNA detection in living cells. Nucleic Acids Research 2004, 32 (6), e57-e57.

52. Pianowski, Z.; Gorska, K.; Oswald, L.; Merten, C. A.; Winssinger, N., Imaging of mRNA in Live Cells Using Nucleic Acid-Templated Reduction of Azidorhodamine

Probes. J. Am. Chem. Soc. 2009, 131 (18), 6492-6497.

207

53. Furukawa, K.; Abe, H.; Hibino, K.; Sako, Y.; Tsuneda, S.; Ito, Y., Reduction-

Triggered Fluorescent Amplification Probe for the Detection of Endogenous RNAs in

Living Human Cells. Bioconjugate Chem. 2009, 20 (5), 1026-1036.

54. Abe, H.; Kool, E. T., Flow cytometric detection of specific RNAs in native human cells with quenched autoligating FRET probes. Proceedings of the National

Academy of Sciences of the United States of America 2006, 103 (2), 263-268.

55. Chen, A. K.; Davydenko, O.; Behlke, M. A.; Tsourkas, A., Ratiometric bimolecular beacons for the sensitive detection of RNA in single living cells. Nucleic

Acids Research 2010, gkq436.

56. Grossmann, T. N.; Röglin, L.; Seitz, O., Triplex Molecular Beacons as Modular

Probes for DNA Detection. Angewandte Chemie International Edition 2007, 46 (27),

5223-5225.

57. Arambula, J. F.; Ramisetty, S. R.; Baranger, A. M.; Zimmerman, S. C., A simple ligand that selectively targets CUG trinucleotide repeats and inhibits MBNL protein binding. Proceedings of the National Academy of Sciences of the United States of

America 2009, 106 (38), 16068-16073.

58. Ikejiri, M.; Tsuchino, M.; Chihara, Y.; Yamaguchi, T.; Imanishi, T.; Obika, S.;

Miyashita, K., Design and Concise Synthesis of a Novel Type of Green Fluorescent

Protein Chromophore Analogue. Organic Letters 2012, 14 (17), 4406-4409.

59. Bugaut, A.; Balasubramanian, S., 5′-UTR RNA G-quadruplexes: translation regulation and targeting. Nucleic Acids Research 2012, 40 (11), 4727-4741.

208

60. Bugaut, A.; Murat, P.; Balasubramanian, S., An RNA Hairpin to G-Quadruplex

Conformational Transition. J. Am. Chem. Soc. 2012, 134 (49), 19953-19956.

61. Di Antonio, M.; Biffi, G.; Mariani, A.; Raiber, E.-A.; Rodriguez, R.;

Balasubramanian, S., Selective RNA Versus DNA G-Quadruplex Targeting by In Situ

Click Chemistry. Angewandte Chemie International Edition 2012, 51 (44), 11073-11078.

62. Biffi, G.; Tannahill, D.; McCafferty, J.; Balasubramanian, S., Quantitative visualization of DNA G-quadruplex structures in human cells. Nat Chem 2013, 5 (3),

182-186.

63. Lam, E. Y. N.; Beraldi, D.; Tannahill, D.; Balasubramanian, S., G-quadruplex structures are stable and detectable in human genomic DNA. Nature Communications

2013, 4, 1796.

64. Biffi, G.; Di Antonio, M.; Tannahill, D.; Balasubramanian, S., Visualization and selective chemical targeting of RNA G-quadruplex structures in the cytoplasm of human cells. Nat Chem 2014, 6 (1), 75-80.

65. Lubitz, I.; Zikich, D.; Kotlyar, A., Specific High-Affinity Binding of Thiazole

Orange to Triplex and G-Quadruplex DNA. Biochemistry 2010, 49 (17), 3567-3574.

66. Bhasikuttan, A. C.; Mohanty, J.; Pal, H., Interaction of Malachite Green with

Guanine-Rich Single-Stranded DNA: Preferential Binding to a G-Quadruplex.

Angewandte Chemie International Edition 2007, 46 (48), 9305-9307.

67. Xie, Y.; Dix, A. V.; Tor, Y., FRET Enabled Real Time Detection of RNA-Small

Molecule Binding. J. Am. Chem. Soc. 2009, 131 (48), 17605-17614.

209

68. Tyagi, S., Imaging intracellular RNA distribution and dynamics in living cells.

Nat Meth 2009, 6 (5), 331-338.

69. Bertrand, E.; Chartrand, P.; Schaefer, M.; Shenoy, S. M.; Singer, R. H.; Long, R.

M., Localization of ASH1 mRNA Particles in Living Yeast. Molecular Cell 1998, 2 (4),

437-445.

70. Lange, S.; Katayama, Y.; Schmid, M.; Burkacky, O.; Bräuchle, C.; Lamb, D. C.;

Jansen, R.-P., Simultaneous Transport of Different Localized mRNA Species Revealed by Live-Cell Imaging. Traffic 2008, 9 (8), 1256-1267.

71. Fusco, D.; Accornero, N.; Lavoie, B.; Shenoy, S. M.; Blanchard, J.-M.; Singer, R.

H.; Bertrand, E., Single mRNA Molecules Demonstrate Probabilistic Movement in

Living Mammalian Cells. Current Biology 2003, 13 (2), 161-167.

72. Ozawa, T.; Natori, Y.; Sato, M.; Umezawa, Y., Imaging dynamics of endogenous mitochondrial RNA in single living cells. Nat Meth 2007, 4 (5), 413-419.

73. Rackham, O.; Brown, C. M., Visualization of RNA–protein interactions in living cells: FMRP and IMP1 interact on mRNAs. The EMBO Journal 2004, 23 (16), 3346-

3355.

74. Babendure, J. R.; Adams, S. R.; Tsien, R. Y., Aptamers Switch on Fluorescence of Triphenylmethane Dyes. J. Am. Chem. Soc. 2003, 125 (48), 14716-14717.

75. Grate, D.; Wilson, C., Laser-mediated, site-specific inactivation of RNA transcripts. PNAS 1999, 96 (11), 6131-6136.

210

76. Sando, S.; Narita, A.; Hayami, M.; Aoyama, Y., Transcription monitoring using fused RNA with a dye-binding light-up aptamer as a tag: a blue fluorescent RNA.

Chemical Communications 2008, 2008 (33), 3858-3860.

77. Constantin, T. P.; Silva, G. L.; Robertson, K. L.; Hamilton, T. P.; Fague, K.;

Waggoner, A. S.; Armitage, B. A., Synthesis of New Fluorogenic Cyanine Dyes and

Incorporation into RNA Fluoromodules. Organic Letters 2008, 10 (8), 1561-1564.

78. Dolgosheina, E. V.; Jeng, S. C. Y.; Panchapakesan, S. S. S.; Cojocaru, R.; Chen,

P. S. K.; Wilson, P. D.; Hawkins, N.; Wiggins, P. A.; Unrau, P. J., RNA Mango

Aptamer-Fluorophore: A Bright, High-Affinity Complex for RNA Labeling and

Tracking. ACS Chem. Biol. 2014, 9 (10), 2412-2420.

79. Sparano, B. A.; Koide, K., Fluorescent Sensors for Specific RNA: A General

Paradigm Using Chemistry and Combinatorial Biology. J. Am. Chem. Soc. 2007, 129

(15), 4785-4794.

80. Pei, R.; Rothman, J.; Xie, Y.; Stojanovic, M. N., Light-up properties of complexes between thiazole orange-small molecule conjugates and aptamers. Nucleic Acids

Research 2009, 37 (8), e59-e59.

81. Warner, K. D.; Chen, M. C.; Song, W.; Strack, R. L.; Thorn, A.; Jaffrey, S. R.;

Ferré-D'Amaré, A. R., Structural basis for activity of highly efficient RNA mimics of green fluorescent protein. Nat Struct Mol Biol 2014, 21 (8), 658-663.

82. Song, W.; Strack, R. L.; Svensen, N.; Jaffrey, S. R., Plug-and-Play Fluorophores

Extend the Spectral Properties of Spinach. J. Am. Chem. Soc. 2014, 136 (4), 1198-1201.

211

83. Strack, R. L.; Disney, M. D.; Jaffrey, S. R., A superfolding Spinach2 reveals the dynamic nature of trinucleotide repeat-containing RNA. Nat Meth 2013, 10 (12), 1219-

1224.

84. Filonov, G. S.; Moon, J. D.; Svensen, N.; Jaffrey, S. R., Broccoli: Rapid Selection of an RNA Mimic of Green Fluorescent Protein by Fluorescence-Based Selection and

Directed Evolution. J. Am. Chem. Soc. 2014, 136 (46), 16299-16308.

85. Kikuchi, N.; Kolpashchikov, D. M., Split Spinach Aptamer for Highly Selective

Recognition of DNA and RNA at Ambient Temperatures. ChemBioChem 2016, n/a-n/a.

86. Rogers, T. A.; Andrews, G. E.; Jaeger, L.; Grabow, W. W., Fluorescent

Monitoring of RNA Assembly and Processing Using the Split-Spinach Aptamer. ACS

Synth. Biol. 2015, 4 (2), 162-166.

87. Paige, J. S.; Nguyen-Duc, T.; Song, W.; Jaffrey, S. R., Fluorescence Imaging of

Cellular Metabolites with RNA. Science 2012, 335 (6073), 1194-1194.

88. Strack, R. L.; Song, W.; Jaffrey, S. R., Using Spinach-based sensors for fluorescence imaging of intracellular metabolites and proteins in living bacteria. Nat

Protoc 2014, 9 (1), 146-155.

89. Piao, X.; Xia, X.; Bong, D., Bifacial Peptide Nucleic Acid Directs Cooperative

Folding and Assembly of Binary, Ternary, and Quaternary DNA Complexes.

Biochemistry 2013, 52 (37), 6313-6323.

90. Xia, X.; Piao, X.; Bong, D., Bifacial Peptide Nucleic Acid as an Allosteric Switch for Aptamer and Ribozyme Function. J. Am. Chem. Soc. 2014, 136 (20), 7265-7268.

212

91. Piao, X.; Xia, X.; Mao, J.; Bong, D., Peptide Ligation and RNA Cleavage via an

Abiotic Template Interface. J. Am. Chem. Soc. 2015, 137 (11), 3751-3754.

92. Xia, X.; Piao, X.; Fredrick, K.; Bong, D., Bifacial PNA Complexation Inhibits

Enzymatic Access to DNA and RNA. ChemBioChem 2014, 15 (1), 31-36.

93. Lee, L. G.; Chen, C.-H.; Chiu, L. A., Thiazole orange: A new dye for reticulocyte analysis. Cytometry 1986, 7 (6), 508-517.

94. Haque, T. S.; Gellman, S. H., Insights on β-Hairpin Stability in Aqueous Solution from Peptides with Enforced Type I‘ and Type II‘ β-Turns. J. Am. Chem. Soc. 1997, 119

(9), 2303-2304.

95. Mujeeb, A.; Clever, J. L.; Billeci, T. M.; James, T. L.; Parslow, T. G., Structure of the dimer a initiation complex of HIV-1 genomic RNA. Nat Struct Mol Biol 1998, 5 (6),

432-436.

96. Marino, J. P.; Gregorian, R. S.; Csankovszki, G.; Crothers, D. M., Bent Helix

Formation Between RNA Hairpins with Complementary Loops. Science 1995, 268

(5216), 1448-1454.

97. Menacher, F.; Rubner, M.; Berndl, S.; Wagenknecht, H.-A., Thiazole Orange and

Cy3: Improvement of Fluorescent DNA Probes with Use of Short Range Electron

Transfer. J. Org. Chem. 2008, 73 (11), 4263-4266.

98. Zeng, Y.; Pratumyot, Y.; Piao, X.; Bong, D., Discrete Assembly of Synthetic

Peptide–DNA Triplex Structures from Polyvalent Melamine–Thymine Bifacial

Recognition. J. Am. Chem. Soc. 2012, 134 (2), 832-835.

213

Complete Reference list

CHAPTER 1 REFERENCES:

1. Chawla, M.; Oliva, R.; Bujnicki, J. M.; Cavallo, L., An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies. Nucleic

Acids Research 2015, 43 (14), 6714-6729.

2. Gill, S. J.; Downing, M.; Sheats, G. F., The Enthalpy of Self-Association of

Purine Derivatives in Water*. Biochemistry 1967, 6 (1), 272-276.

3. Farquhar, E. L.; Downing, M.; Gill, S. J., Enthalpy of self-association of pyrimidine derivatives in water. Biochemistry 1968, 7 (3), 1224-1225.

4. Dado, G. P.; Gellman, S. H., Intramolecular Hydrogen Bonding in Derivatives of

.beta.-Alanine and .gamma.-Amino Butyric Acid; Model Studies for the Folding of

Unnatural Polypeptide Backbones. J. Am. Chem. Soc. 1994, 116 (3), 1054-1062.

5. Mak, C. H., Unraveling Base Stacking Driving Forces in DNA. J. Phys. Chem. B

2016, 120 (26), 6010-6020.

6. Watson, J. D.; Crick, F. H. C., Molecular Structure of Nucleic Acids: A Structure for Deoxyribose Nucleic Acid. Nature 1953, 171 (4356), 737-738.

214

7. Kool, E. T., Hydrogen Bonding, Base Stacking, and Steric Effects in Dna

Replication. Annual Review of Biophysics and Biomolecular Structure 2001, 30 (1), 1-22.

8. Rich, A., The double helix: a tale of two puckers. Nat Struct Mol Biol 2003, 10

(4), 247-249.

9. Hightower, L. Structure of Nucleic Acids. http://web.uconn.edu/mcb201/lecture03.html (accessed July 7, 2017).

10. Leontis, N. B.; Westhof, E., Geometric nomenclature and classification of RNA base pairs. RNA 2001, 7 (4), 499-512.

11. Hoogsteen, K., The crystal and molecular structure of a hydrogen-bonded complex between 1-methylthymine and 9-methyladenine. Acta Cryst, Acta Crystallogr

1963, 16 (9), 907-916.

12. Kitayner, M.; Rozenberg, H.; Rohs, R.; Suad, O.; Rabinovich, D.; Honig, B.;

Shakked, Z., Diversity in DNA recognition by p53 revealed by crystal structures with

Hoogsteen base pairs. Nat Struct Mol Biol 2010, 17 (4), 423-429.

13. Patikoglou, G. A.; Kim, J. L.; Sun, L.; Yang, S.-H.; Kodadek, T.; Burley, S. K.,

TATA element recognition by the TATA box-binding protein has been conserved throughout evolution. Genes Dev. 1999, 13 (24), 3217-3230.

14. Gessner, R. V.; Quigley, G. J.; Wang, A. H. J.; Van der Marel, G. A.; Van Boom,

J. H.; Rich, A., Structural basis for stabilization of Z-DNA by cobalt hexaammine and magnesium cations. Biochemistry 1985, 24 (2), 237-240.

215

15. Seaman, F. C.; Hurley, L., Interstrand cross-linking by bizelesin produces a

Watson-Crick to Hoogsteen base-pairing transition region in d(CGTAATTACG)2.

Biochemistry 1993, 32 (47), 12577-12585.

16. Nissen, P.; Ippolito, J. A.; Ban, N.; Moore, P. B.; Steitz, T. A., RNA tertiary interactions in the large ribosomal subunit: The A-minor motif. PNAS 2001, 98 (9), 4899-

4903.

17. Theimer, C. A.; Blois, C. A.; Feigon, J., Structure of the Human Telomerase RNA

Pseudoknot Reveals Conserved Tertiary Interactions Essential for Function. Molecular

Cell 2005, 17 (5), 671-682.

18. Abrescia, N. G. A.; Thompson, A.; Huynh-Dinh, T.; Subirana, J. A., Crystal structure of an antiparallel DNA fragment with Hoogsteen base pairing. PNAS 2002, 99

(5), 2806-2811.

19. Yang, H.; Zhan, Y.; Fenn, D.; Chi, L. M.; Lam, S. L., Effect of 1-methyladenine on double-helical DNA structures. FEBS Letters 2008, 582 (11), 1629-1633.

20. Shanmugam, G.; Kozekov, I. D.; Guengerich, F. P.; Rizzo, C. J.; Stone, M. P.,

Structure of the 1,N2-Ethenodeoxyguanosine Adduct Opposite Cytosine in Duplex DNA:

Hoogsteen Base Pairing at pH 5.2. Chem. Res. Toxicol. 2008, 21 (9), 1795-1805.

21. Nikolova, E. N.; Kim, E.; Wise, A. A.; O’Brien, P. J.; Andricioaei, I.; Al-

Hashimi, H. M., Transient Hoogsteen base pairs in canonical duplex DNA. Nature 2011,

470 (7335), 498-502.

216

22. Nair, D. T.; Johnson, R. E.; Prakash, S.; Prakash, L.; Aggarwal, A. K.,

Replication by human DNA polymerase-ι occurs by Hoogsteen base-pairing. Nature

2004, 430 (6997), 377-380.

24. Roy, S.; Redfield, A. G., Nuclear Overhauser effect study and assignment of D stem and reverse-Hoogsteen base pair proton resonances in yeast tRNA Asp. Nucleic

Acids Research 1981, 9 (24), 7073-7083.

25. Wimberly, B.; Varani, G.; Tinoco, I., The conformation of loop E of eukaryotic

5S ribosomal RNA. Biochemistry 1993, 32 (4), 1078-1087.

26. Kennard, O., Structural Studies of DNA Fragments: The G·T Wobble Base Pair in A, B and Z DNA; The G·A Base Pair in B-DNA. Journal of Biomolecular Structure and Dynamics 1985, 3 (2), 205-226.

27. Martin, F. H.; Castro, M. M.; Aboul-ela, F.; Tinoco, I., Base pairing involving deoxyinosine: implications for probe design. Nucleic Acids Research 1985, 13 (24),

8927-8938.

28. Varani, G.; McClain, W. H., The G·U wobble base pair. EMBO reports 2000, 1

(1), 18-23.

29. Topal, M. D.; Fresco, J. R., Base pairing and fidelity in codon–anticodon interaction. Nature 1976, 263 (5575), 289-293.

217

30. Murphy, F. V.; Ramakrishnan, V., Structure of a purine-purine wobble base pair in the decoding center of the ribosome. Nat Struct Mol Biol 2004, 11 (12), 1251-1252.

31. Lemieux, S.; Major, F., RNA canonical and non‐canonical base pairing types: a recognition method and complete repertoire. Nucleic Acids Research 2002, 30 (19),

4250-4263.

32. Biotechnology, I. o. M. Nucleic Acid Nomenclature and Structure. http://jenalib.leibniz-fli.de/ImgLibDoc/nana/IMAGE_NANA.htm (accessed July 7,

2017).

33. Seeman, N. C.; Rosenberg, J. M.; Rich, A., Sequence-specific recognition of double helical nucleic acids by proteins. PNAS 1976, 73 (3), 804-808.

34. Kielkopf, C. L.; White, S.; Szewczyk, J. W.; Turner, J. M.; Baird, E. E.; Dervan,

P. B.; Rees, D. C., A Structural Basis for Recognition of A·T and T·A Base Pairs in the

Minor Groove of B-DNA. Science 1998, 282 (5386), 111-115.

35. Hendrix, D. K.; Brenner, S. E.; Holbrook, S. R., RNA structural motifs: building blocks of a modular biomolecule. Quarterly Reviews of Biophysics 2005, 38 (03), 221.

36. Laing, C.; Wen, D.; Wang, J. T. L.; Schlick, T., Predicting coaxial helical stacking in RNA junctions. Nucleic Acids Research 2012, 40 (2), 487-498.

37. Lescoute, A.; Westhof, E., Riboswitch Structures: Purine Ligands Replace

Tertiary Contacts. Chemistry & Biology 2005, 12 (1), 10-13.

38. Kim, J.; Walter, A. E.; Turner, D. H., Thermodynamics of Coaxially Stacked

Helixes with GA and CC Mismatches. Biochemistry 1996, 35 (43), 13753-13761.

218

39. Schwille, P.; Oehlenschläger, F.; Walter, N. G., Quantitative Hybridization

Kinetics of DNA Probes to RNA in Solution Followed by Diffusional Fluorescence

Correlation Analysis. Biochemistry 1996, 35 (31), 10182-10193.

40. Gellert, M.; Lipsett, M. N.; Davies, D. R., Helix Formation by Guanylic Acid.

PNAS 1962, 48 (12), 2013-2018.

41. Williamson, J. R.; Raghuraman, M. K.; Cech, T. R., Monovalent cation-induced structure of telomeric DNA: The G-quartet model. Cell 1989, 59 (5), 871-880.

42. Neidle, S., Quadruplex Nucleic Acids as Novel Therapeutic Targets. J. Med.

Chem. 2016, 59 (13), 5987-6011.

43. Bugaut, A.; Balasubramanian, S., 5′-UTR RNA G-quadruplexes: translation regulation and targeting. Nucleic Acids Research 2012, 40 (11), 4727-4741.

44. Paige, J. S.; Wu, K. Y.; Jaffrey, S. R., RNA Mimics of Green Fluorescent Protein.

Science 2011, 333 (6042), 642-646.

45. Warner, K. D.; Chen, M. C.; Song, W.; Strack, R. L.; Thorn, A.; Jaffrey, S. R.;

Ferré-D'Amaré, A. R., Structural basis for activity of highly efficient RNA mimics of green fluorescent protein. Nat Struct Mol Biol 2014, 21 (8), 658-663.

46. Dolgosheina, E. V.; Jeng, S. C. Y.; Panchapakesan, S. S. S.; Cojocaru, R.; Chen,

P. S. K.; Wilson, P. D.; Hawkins, N.; Wiggins, P. A.; Unrau, P. J., RNA Mango

Aptamer-Fluorophore: A Bright, High-Affinity Complex for RNA Labeling and

Tracking. ACS Chem. Biol. 2014, 9 (10), 2412-2420.

47. Bochman, M. L.; Paeschke, K.; Zakian, V. A., DNA secondary structures: stability and function of G-quadruplex structures. Nat Rev Genet 2012, 13 (11), 770-780.

219

48. Butcher, S. E.; Pyle, A. M., The Molecular Interactions That Stabilize RNA

Tertiary Structure: RNA Motifs, Patterns, and Networks. Acc. Chem. Res. 2011, 44 (12),

1302-1311.

49. Batey, R. T.; Rambo, R. P.; Doudna, J. A., Tertiary Motifs in RNA Structure and

Folding. Angewandte Chemie International Edition 1999, 38 (16), 2326-2343.

50. Bailor, M. H.; Sun, X.; Al-Hashimi, H. M., Topology Links RNA Secondary

Structure with Global Conformation, Dynamics, and Adaptation. Science 2010, 327

(5962), 202-206.

51. Walter, A. E.; Turner, D. H., Sequence dependence of stability for coaxial stacking of RNA helixes with Watson-Crick base paired interfaces. Biochemistry 1994,

33 (42), 12715-12719.

52. Walter, A. E.; Turner, D. H.; Kim, J.; Lyttle, M. H.; Müller, P.; Mathews, D. H.;

Zuker, M., Coaxial stacking of helixes enhances binding of oligoribonucleotides and improves predictions of RNA folding. PNAS 1994, 91 (20), 9218-9222.

53. Tyagi, R.; Mathews, D. H., Predicting helical coaxial stacking in RNA multibranch loops. RNA 2007, 13 (7), 939-951.

54. Kim, S. H.; Quigley, G. J.; Suddath, F. L.; McPherson, A.; Sneden, D.; Kim, J. J.;

Weinzierl, J.; Rich, A., Three-Dimensional Structure of Yeast Phenylalanine Transfer

RNA: Folding of the Polynucleotide Chain. Science 1973, 179 (4070), 285-288.

55. Lafontaine, D. A.; Norman, D. G.; Lilley, D. M. J., Structure, folding and activity of the VS ribozyme: importance of the 2‐3‐6 helical junction. The EMBO Journal 2001,

20 (6), 1415-1424.

220

56. Al-Hashimi, H. M.; Pitt, S. W.; Majumdar, A.; Xu, W.; Patel, D. J., Mg2+- induced Variations in the Conformation and Dynamics of HIV-1 TAR RNA Probed

Using NMR Residual Dipolar Couplings. Journal of Molecular Biology 2003, 329 (5),

867-873.

57. Lescoute, A.; Westhof, E., Topology of three-way junctions in folded RNAs. RNA

2006, 12 (1), 83-93.

58. Selmer, M.; Dunham, C. M.; Murphy, F. V.; Weixlbaumer, A.; Petry, S.; Kelley,

A. C.; Weir, J. R.; Ramakrishnan, V., Structure of the 70S Ribosome Complexed with mRNA and tRNA. Science 2006, 313 (5795), 1935-1942.

59. Puglisi, J. D.; Wyatt, J. R.; Tinoco, I., Conformation of an RNA pseudoknot.

Journal of Molecular Biology 1990, 214 (2), 437-453.

60. Wyatt, J. R.; Puglisi, J. D.; Tinoco, I., RNA pseudoknots. Journal of Molecular

Biology 1990, 214 (2), 455-470.

61. Staple, D. W.; Butcher, S. E., Pseudoknots: RNA Structures with Diverse

Functions. PLOS Biology 2005, 3 (6), e213.

62. Ferré-D'Amaré, A. R.; Zhou, K.; Doudna, J. A., Crystal structure of a hepatitis delta virus ribozyme. Nature 1998, 395 (6702), 567-574.

63. Almakarem, A.; S, A.; Petrov, A. I.; Stombaugh, J.; Zirbel, C. L.; Leontis, N. B.,

Comprehensive survey and geometric classification of base triples in RNA structures.

Nucleic Acids Research 2012, 40 (4), 1407-1423.

221

64. Firdaus-Raih, M.; Harrison, A.-M.; Willett, P.; Artymiuk, P. J., Novel base triples in RNA structures revealed by graph theoretical searching methods. BMC Bioinformatics

2011, 12 (13), S2.

65. Robertus, J. D.; Ladner, J. E.; Finch, J. T.; Rhodes, D.; Brown, R. S.; Clark, B. F.

C.; Klug, A., Structure of yeast phenylalanine tRNA at 3 |[angst]| resolution. Nature

1974, 250 (5467), 546-551.

66. Jack, A.; Ladner, J. E.; Klug, A., Crystallographic refinement of yeast phenylalanine transfer RNA at 2·5Å resolution. Journal of Molecular Biology 1976, 108

(4), 619-649.

67. Tuerk, C.; Gauss, P.; Thermes, C.; Groebe, D. R.; Gayle, M.; Guild, N.; Stormo,

G.; d'Aubenton-Carafa, Y.; Uhlenbeck, O. C.; Tinoco, I., CUUCGG hairpins: extraordinarily stable RNA secondary structures associated with various biochemical processes. PNAS 1988, 85 (5), 1364-1368.

68. Molinaro, M.; Tinoco, I., Use of ultra stable UNCG tetraloop hairpins to fold

RNA structures: thermodynamic and spectroscopic applications. Nucleic Acids Research

1995, 23 (15), 3056-3063.

69. Heus, H. A.; Pardi, A., Structural features that give rise to the unusual stability of

RNA hairpins containing GNRA loops. Science 1991, 253 (5016), 191-194.

70. Jaeger, L.; Michel, F.; Westhof, E., Involvement of a GNRA tetraloop in long- range RNA tertiary interactions. Journal of Molecular Biology 1994, 236 (5), 1271-1276.

222

71. Murphy, F. L.; Cech, T. R., GAAA Tetraloop and Conserved Bulge Stabilize

Tertiary Structure of a Group I Intron Domain. Journal of Molecular Biology 1994, 236

(1), 49-63.

72. Cate, J. H.; Gooding, A. R.; Podell, E.; Zhou, K.; Golden, B. L.; Kundrot, C. E.;

Cech, T. R.; Doudna, J. A., Crystal Structure of a Group I Ribozyme Domain: Principles of RNA Packing. Science 1996, 273 (5282), 1678-1685.

74. Fiore, J. L.; Nesbitt, D. J., An RNA folding motif: GNRA tetraloop–receptor interactions. Quarterly Reviews of Biophysics 2013, 46 (3), 223-264.

75. Felsenfeld, G.; Davies, D. R.; Rich, A., FORMATION OF A THREE-

STRANDED POLYNUCLEOTIDE MOLECULE. J. Am. Chem. Soc. 1957, 79 (8),

2023-2024.

77. Riley, M.; Maling, B.; Chamberlin, M. J., Physical and chemical characterization of two- and three-stranded adenine-thymine and adenine-uracil homopolymer complexes.

Journal of Molecular Biology 1966, 20 (2), 359-389.

78. Howard, F. B.; Frazier, J.; Lipsett, M. N.; Miles, H. T., Infrared demonstration of two- and three-strand helix formation between poly C and guanosine mononucleotides

223 and oligonucleotides. Biochemical and Biophysical Research Communications 1964, 17