DOCSLIB.ORG
Explore
Sign Up
Log In
Upload
Search
Home
» Tags
» MMP10
MMP10
Inflammation-Mediated Skin Tumorigenesis Induced by Epidermal C-Fos
Discovery and Optimization of Selective Inhibitors of Meprin Α (Part II)
2335 Roles of Molecules Involved in Epithelial/Mesenchymal Transition
On and Polymorphisms in Q Fever
Effect of Nanoparticles on the Expression and Activity of Matrix Metalloproteinases
Cov-2 Infection in the Small Intestine
Discovery and Optimization of Selective Inhibitors of Meprin Α (Part I)
Expression Profiles Associated with Aggressive Behavior in Merkel Cell Carcinoma
Polymorphisms of Genes Involved in Extracellular Matrix Remodeling And
Serum MMP7, MMP10 and MMP12 Level As Negative Prognostic
Metalloproteinases in Biology and Pathology of the Nervous System
Regional Differences in Gene Expression of Proliferating Human Choroidal Endothelial Cells
Matrix Metalloproteases in Pancreatic Ductal Adenocarcinoma: Key Drivers of Disease Progression?
Genetic Association of MMP10, MMP14, and MMP16 with Dental Caries
Time-Resolved Analysis of the Matrix Metalloproteinase 10 Substrate Degradome
The Role of Matrix Metalloproteinases in Osteoarthritis Pathogenesis An
Mmps, Adams and Their Natural Inhibitors in Inflammatory Bowel
In Situ Gene Expression and Localization of Metalloproteinases MMP1, MMP2, MMP3, MMP9, and Their Inhibitors TIMP1 and TIMP2 in Human Renal Cell Carcinoma
Top View
Key Matrix Remodeling Enzymes: Functions and Targeting in Cancer
Metalloproteinases in Biology and Pathology of the Nervous System
MMP1 and MMP9 Are Potential Prognostic Biomarkers and Targets for Uveal Melanoma
Supplementary Methods: Primers Sequences Used in Real-Time PCR Analyses: Β-Actin F: GACCTCTATGCCAACACAGT Β-Actin [11] R: AGTAC
Genomic Markers for Essential Tremor
An Oncogenic Mechanism for Mutant FGFR3 Erica Di Martino1, Gavin Kelly2, Jo-An Roulson3, and Margaret A
Matrix Metalloproteinase 10) Is Inducible in Lymphoma Cells and Accelerates the Growth of Lymphoid Tumors in Vivo This Information Is Current As of September 28, 2021
MMP10) Moderates Inflammation by Controlling Macrophage Activation
Updating the Role of Matrix Metalloproteinases in Mineralized Tissue and Related Diseases
Matrix Metalloproteinase Genes (MMP1, MMP10, MMP12) on Chromosome 11Q22 and the Risk of Non-Contact Anterior Cruciate Ligament Ruptures
Matrix Metalloproteinases in Diabetic Kidney Disease
The Evolution of the Vertebrate Metzincins; Insights from Ciona Intestinalis and Danio Rerio
Development and Validation of a Protein-Based Risk Score for Cardiovascular Outcomes Among Patients with Stable Coronary Heart Disease
Supplementary Table 4. Copy Number Changes and Regions of LOH in 10
Original Article
Plantar Fasciopathy: a Clinical Review
Differential Expression of Degradome Components in Cutaneous
Supplement Table S1: List of Mammalian Mmps and Their Major Substrates
Five Extracellular Matrix‑Associated Genes Upregulated in Oral Tongue Squamous Cell Carcinoma: an Integrated Bioinformatics Analysis
Matrix Metalloproteinase Expression Patterns in Luminal a Type Breast Carcinomas
Matrix Metalloproteinases As Biomarkers of Atherosclerotic Plaque Instability
Matrix Metalloproteinase 10 (MMP10) LANCE Ultra Detection Kit
MMP-10 Regulates Collagenolytic Activity of Alternatively Activated Resident Macrophages Maryam G
MMP8 and MMP9 Gene Polymorphisms Were Associated with Breast Cancer Risk in a Chinese Han Population
(KLK7) Degradome in Ovarian Cancer Cell Secretome
MMP-1 and Pro-MMP-10 As Potential Urinary Pharmacodynamic Biomarkers of FGFR3-Targeted Therapy in Patients with Bladder Cancer
Pericellular Proteolysis in Cancer