DOCSLIB.ORG

MMP10) Moderates Inflammation by Controlling Macrophage Activation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
MMP10) Moderates Inflammation by Controlling Macrophage Activation Stromelysin-2 (MMP10) Moderates Inflammation by Controlling Macrophage Activation This information is current as Ryan S. McMahan, Timothy P. Birkland, Kate S. Smigiel, of September 27, 2021. Tyler C. Vandivort, Maryam G. Rohani, Anne M. Manicone, John K. McGuire, Sina A. Gharib and William C. Parks J Immunol published online 17 June 2016 http://www.jimmunol.org/content/early/2016/06/16/jimmun ol.1600502 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2016/06/16/jimmunol.160050 Material 2.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published June 17, 2016, doi:10.4049/jimmunol.1600502 The Journal of Immunology Stromelysin-2 (MMP10) Moderates Inflammation by Controlling Macrophage Activation Ryan S. McMahan,*,† Timothy P. Birkland,*,‡ Kate S. Smigiel,x Tyler C. Vandivort,*,†,x Maryam G. Rohani,*,‡,x Anne M. Manicone,*,‡ John K. McGuire,*,{ Sina A. Gharib,*,‡ and William C. Parks*,‡,x Several members of the matrix metalloproteinase (MMP) family control a range of immune processes, such as leukocyte influx and chemokine activity. Stromelysin-2 (MMP10) is expressed by macrophages in numerous tissues after injury; however, little is known of its function. In this study, we report that MMP10 is expressed by macrophages in human lungs from patients with cystic fibrosis and induced in mouse macrophages in response to Pseudomonas aeruginosa infection both in vivo and by isolated resident alveolar and bone marrow–derived macrophages (BMDM). Our data indicates that macrophage MMP10 serves a beneficial function in response to acute infection. Whereas wild-type mice survived infection with minimal morbidity, 50% of Mmp102/2 mice died and Downloaded from all showed sustained weight loss (morbidity). Although bacterial clearance and neutrophil influx did not differ between genotypes, macrophage numbers were ∼3-fold greater in infected Mmp102/2 lungs than in wild-types. Adoptive transfer of wild-type BMDM normalized infection-induced morbidity in Mmp102/2 recipients to wild-type levels, demonstrating that the protective effect of MMP10 was due to its production by macrophages. Both in vivo and in cultured alveolar macrophages and BMDM, expression of several M1 macrophage markers was elevated, whereas M2 markers were reduced in Mmp102/2 tissue and cells. Global gene expression analysis revealed that infection-mediated transcriptional changes persisted in Mmp102/2 BMDM long after they http://www.jimmunol.org/ were downregulated in wild-type cells. These results indicate that MMP10 serves a beneficial role in response to acute infection by moderating the proinflammatory response of resident and infiltrating macrophages. The Journal of Immunology, 2016, 197: 000–000. acrophages are critical effector cells of the immune macrophages are induced by infection and proinflammatory Th1 system and play essential, yet distinct, roles in both cytokines, are effective at killing bacteria, and release proin- M promoting and resolving inflammation and in facili- flammatory cytokines, such as IL-1b, IL-12, and TNF-a.M2 tating tissue repair and contributing to its destruction (1). That a macrophages are induced by the Th2 cytokines IL-4 and IL-13 by guest on September 27, 2021 single cell type can serve opposing functions may seem counter- and other factors, release anti-inflammatory factors, such as IL- intuitive, but dramatic phenotypic changes occur when macro- 10, are weakly microbicidal, and promote repair. We recognize, phages respond to local stimuli (1–4). Based on patterns of gene however, that dividing macrophages into M1 and M2 classes and protein expression and function, macrophages are commonly oversimplifies the complex continuum of functional and revers- classified as classically activated (M1) or alternatively activated ible states in which these cells exist (6–9). (M2) cells, as well as a variety of M2 subtypes (1, 4, 5). M1 Several proteins influence macrophage behavior, including some members of the matrix metalloproteinase (MMP) gene family. For example, MMP12 and MMP28, both macrophage products, *Center for Lung Biology, University of Washington, Seattle, WA 98109; either promote or restrict macrophage influx into lung (10, 11), and †Department of Environmental and Occupational Health Sciences, University of Washington, Seattle, WA 98105; ‡Department of Medicine, University of Washing- MMP8 promotes M2 polarization (12). Additionally, we reported ton, Seattle, WA 98195; xWomen’s Guild Lung Institute, Cedars–Sinai Medical Cen- that MMP28 and TIMP3, an MMP inhibitor, moderate M1 acti- { ter, Los Angeles, CA 90048; and Department of Pediatrics, University of Washington, vation of macrophages in models of lung infection and fibrosis Seattle, WA 98195 (13, 14). As their name implies, MMPs are thought to degrade ORCIDs: 0000-0003-3489-6127 (R.S.M.); 0000-0003-0475-2923 (T.C.V.); 0000- 0001-6106-8349 (J.K.M.). extracellular matrix proteins, a function that is indeed performed Received for publication March 23, 2016. Accepted for publication May 24, 2016. by some members (15–17). However, matrix degradation is nei- ther the shared nor predominant function of these enzymes. This work was supported by National Institutes of Health Grants HL089455, HL128995, and HL098067 (to W.C.P.), HL093022 (to J.K.M.), and HL116514 (to A.M.M.). Rather, individual MMPs have been shown to regulate specific The microarray experiments–compliant data presented in this article have been sub- immune processes, such as leukocyte influx and activation, anti- mitted to the National Institutes of Health Gene Expression Omnibus (http://www. microbial activity, and restoration of barrier function, typically by ncbi.nlm.nih.gov/geo/query/acc.cgi?token=epkvmssmvhmrlmf&acc=GSE78175) un- der accession number GSE78175. processing of a range of non–matrix protein substrates (18–25). MMP10 (stromelysin-2) is not expressed in developing or Address correspondence and reprint requests to Dr. William C. Parks, Women’s Guild Lung Institute, Cedars–Sinai Medical Center, 8700 Beverly Boulevard, Los normal adult tissues, including lung (26, 27). However, in both Angeles, CA 90048. E-mail address: [email protected] human conditions and mouse models, MMP10 is induced in re- The online version of this article contains supplemental material. sponse to injury, infection, or transformation in essentially all Abbreviations used in this article: BAL, bronchoalveolar lavage; BMDM, bone marrow– tissues (28–33). In a meta-analysis of gene array experiments derived macrophage; CF, cystic fibrosis; DAB, 3,39-diaminobenzidine; DIG, digoxigenin; involving numerous different host–pathogen interactions, MMP10 iNOS, inducible NO synthase; MHC II, MHC class II; MMP, matrix metalloproteinase. was identified as a common host response gene (34). The wide- Copyright Ó 2016 by The American Association of Immunologists, Inc. 0022-1767/16/$30.00 spread expression of MMP10 among tissues suggests that this www.jimmunol.org/cgi/doi/10.4049/jimmunol.1600502 2 MMP10 SHAPES MACROPHAGE ACTIVATION proteinase serves critical roles in the host response to environ- Immunostaining and in situ hybridization mental insults. As we show in the present study, MMP10 serves Deidentified human lung specimens were obtained with approval of the a protective role in acute infection by moderating the proinflam- University of Washington Institutional Review Board. Sections (5 mm) matory activity of macrophages. were stained with Abs specific for human MMP10 (Abcam, Cambridge, Recently, we reported that macrophage MMP10 promotes the MA) as described (40). Mouse lungs were perfused-fixed with PBS- ability of M2 macrophages to clear scar tissues in normal skin buffered formalin via the trachea under 25-cm pressure for 5 min, in- cubated in fixative at room temperature for 48 h, dehydrated through wounds by controlling the expression of collagenolytic MMPs, graded ethanol, and embedded in paraffin. Deparaffinized sections (5 particularly MMP13 (35). However, because sterile excision mm) underwent heat-induced (95˚C, 30 min) Ag retrieval in pH 7.0 wounds are not associated with a profound inflammatory re- citrate. Endogenous peroxidase activity was quenched with 3% H2O2 for sponse, the stimulus (i.e., a clean wound) may not have been 10 min. Sections were incubated with 4% normal rabbit serum for 1 h and then overnight at 4˚C with anti-Mac2 Ab (1:500 dilution; clone M3/ sufficiently robust to reveal other MMP10-dependent roles in 38.1.2.8 HL.2, American Type Culture Collection, Manassas VA). Bound macrophage inflammation. Thus, for the present studies, we Ab was detected using a Vectastain Elite ABC (rat IgG) kit (Vector 2 2 challenged Mmp10 / mouse lungs with Pseudomonas aeruginosa,
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Intestinal Tumorigenesis Is Suppressed in Mice Lacking the Metalloproteinase Matrilysin (Knockout͞min͞colon Cancer͞extracellular Matrix͞apc)
    Proc. Natl. Acad. Sci. USA Vol. 94, pp. 1402–1407, February 1997 Medical Sciences Intestinal tumorigenesis is suppressed in mice lacking the metalloproteinase matrilysin (knockoutyMinycolon canceryextracellular matrixyAPC) CAROLE L. WILSON*†,KATHLEEN J. HEPPNER*†,PATRICIA A. LABOSKY*‡,BRIGID L. M. HOGAN*‡, AND LYNN M. MATRISIAN*§ *Department of Cell Biology and ‡Howard Hughes Medical Institute, Vanderbilt University, Nashville, TN 37232 Communicated by Ruth Sager, Dana–Farber Cancer Institute, Boston, MA, December 12, 1996 (received for review June 27, 1996) ABSTRACT Matrix metalloproteinases (MMPs) classi- The Min (multiple intestinal neoplasia) mouse has proven to cally have been implicated in basement membrane destruction be a powerful model system to study molecules involved in the associated with late-stage tumor cell invasion and metastasis. progression of intestinal adenomas. It has been determined However, recent studies have demonstrated that one MMP that a nonsense autosomal dominant germline mutation in the family member, matrilysin, is expressed in a high percentage adenomatous polyposis coli (Apc) gene (the ApcMin allele) of early-stage human colorectal tumors. We analyzed matri- induces spontaneous intestinal tumors in these mice, providing lysin expression in benign intestinal tumors from mice het- a model that closely mimics the human hereditary colon cancer erozygous for the ApcMin allele (Miny1) and found that the syndrome, familial adenomatous polyposis (13, 14). Congenic mRNA was induced in the majority (88%) of these adenomas. C57BLy6-Min mice heterozygous for this mutant allele Protein was detected in the tumor cells, where, surprisingly, (Miny1) develop numerous benign tumors throughout the it was predominantly immunolocalized to the lumenal surface intestinal tract, although with less frequency in the large bowel, of dysplastic glands rather than the basement membrane or and have an average life span of 119 days (13, 15).
    [Show full text]
  • Inflammation-Mediated Skin Tumorigenesis Induced by Epidermal C-Fos
    Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Inflammation-mediated skin tumorigenesis induced by epidermal c-Fos Eva M. Briso,1 Juan Guinea-Viniegra,1 Latifa Bakiri,1 Zbigniew Rogon,2 Peter Petzelbauer,3 Roland Eils,2 Ronald Wolf,4 Mercedes Rinco´ n,5 Peter Angel,6 and Erwin F. Wagner1,7 1BBVA Foundation-Spanish National Cancer Research Center (CNIO) Cancer Cell Biology Program, CNIO, 28029 Madrid, Spain; 2Division of Theoretical Bioinformatics, German Cancer Research Center (DKFZ), 69120 Heidelberg, Germany; 3Skin and Endothelium Research Division (SERD), Department of Dermatology, Medical University of Vienna, A-1090 Vienna, Austria; 4Department of Dermatology and Allergology, Ludwig-Maximilian University, Munich, Germany; 5Division of Immunobiology, Department of Medicine, University of Vermont, 05405 Burlington, Vermont, USA; 6Division of Signal Transduction and Growth Control, DKFZ, DKFZ-Center for Molecular Biology of the University of Heidelberg (ZMBH) Alliance, 69120 Heidelberg, Germany Skin squamous cell carcinomas (SCCs) are the second most prevalent skin cancers. Chronic skin inflammation has been associated with the development of SCCs, but the contribution of skin inflammation to SCC development remains largely unknown. In this study, we demonstrate that inducible expression of c-fos in the epidermis of adult mice is sufficient to promote inflammation-mediated epidermal hyperplasia, leading to the development of preneoplastic lesions. Interestingly, c-Fos transcriptionally controls mmp10 and s100a7a15 expression in keratinocytes, subsequently leading to CD4 T-cell recruitment to the skin, thereby promoting epidermal hyperplasia that is likely induced by CD4 T-cell-derived IL-22. Combining inducible c-fos expression in the epidermis with a single dose of the carcinogen 7,12-dimethylbenz(a)anthracene (DMBA) leads to the development of highly invasive SCCs, which are prevented by using the anti-inflammatory drug sulindac.
    [Show full text]
  • Single Cell Transcriptome Atlas of Immune Cells in Human Small
    bioRxiv preprint doi: https://doi.org/10.1101/721258; this version posted August 1, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Single cell transcriptome atlas of immune cells in human small 2 intestine and in celiac disease 3 4 Nader Atlasy1,a,4, Anna Bujko2,4, Peter B Brazda1,a, Eva Janssen-Megens1,a , Espen S. 5 Bækkevold2, Jørgen Jahnsen3, Frode L. Jahnsen2, Hendrik G. Stunnenberg1,a,* 6 7 8 1Department of Molecular Biology, Science Faculty, Radboud University, Nijmegen, The 9 Netherlands. 10 2 Department of Pathology, University of Oslo and Oslo University Hospital, Rikshospitalet, 11 Oslo, Norway 12 3 Department of Gastroenterology, Akershus University Hospital and University of Oslo, 13 Oslo, Norway. 14 15 acurrent address: Princess Maxima Centre for Pediatric Oncology, Heidelberglaan 25, 3584 16 CS Utrecht 17 18 19 4These authors contributed equally to this study 20 21 22 *Corresponding author: [email protected] 23 24 25 26 Celiac disease (CeD) is an autoimmune disorder in which ingestion of dietary gluten 27 triggers an immune reaction in the small intestine1,2. The CeD lesion is characterized by 28 crypt hyperplasia, villous atrophy and chronic inflammation with accumulation of 29 leukocytes both in the lamina propria (LP) and in the epithelium3, which eventually 30 leads to destruction of the intestinal epithelium1 and subsequent digestive complications 31 and higher risk of non-hodgkin lymphoma4. A lifetime gluten-free diet is currently the 32 only available treatment5. Gluten-specific LP CD4 T cells and cytotoxic intraepithelial 33 CD8+ T cells are thought to be central in disease pathology1,6-8, however, CeD is a 34 complex immune-mediated disorder and to date the findings are mostly based on 35 analysis of heterogeneous cell populations and on animal models.
    [Show full text]
  • Discovery and Optimization of Selective Inhibitors of Meprin Α (Part II)
    pharmaceuticals Article Discovery and Optimization of Selective Inhibitors of Meprin α (Part II) Chao Wang 1,2, Juan Diez 3, Hajeung Park 1, Christoph Becker-Pauly 4 , Gregg B. Fields 5 , Timothy P. Spicer 1,6, Louis D. Scampavia 1,6, Dmitriy Minond 2,7 and Thomas D. Bannister 1,2,* 1 Department of Molecular Medicine, Scripps Research, Jupiter, FL 33458, USA; [email protected] (C.W.); [email protected] (H.P.); [email protected] (T.P.S.); [email protected] (L.D.S.) 2 Department of Chemistry, Scripps Research, Jupiter, FL 33458, USA; [email protected] 3 Rumbaugh-Goodwin Institute for Cancer Research, Nova Southeastern University, 3321 College Avenue, CCR r.605, Fort Lauderdale, FL 33314, USA; [email protected] 4 The Scripps Research Molecular Screening Center, Scripps Research, Jupiter, FL 33458, USA; [email protected] 5 Unit for Degradomics of the Protease Web, Institute of Biochemistry, University of Kiel, Rudolf-Höber-Str.1, 24118 Kiel, Germany; fi[email protected] 6 Department of Chemistry & Biochemistry and I-HEALTH, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458, USA 7 Dr. Kiran C. Patel College of Allopathic Medicine, Nova Southeastern University, 3301 College Avenue, Fort Lauderdale, FL 33314, USA * Correspondence: [email protected] Abstract: Meprin α is a zinc metalloproteinase (metzincin) that has been implicated in multiple diseases, including fibrosis and cancers. It has proven difficult to find small molecules that are capable Citation: Wang, C.; Diez, J.; Park, H.; of selectively inhibiting meprin α, or its close relative meprin β, over numerous other metzincins Becker-Pauly, C.; Fields, G.B.; Spicer, which, if inhibited, would elicit unwanted effects.
    [Show full text]
  • 2335 Roles of Molecules Involved in Epithelial/Mesenchymal Transition
    [Frontiers in Bioscience 13, 2335-2355, January 1, 2008] Roles of molecules involved in epithelial/mesenchymal transition during angiogenesis Giulio Ghersi Dipartimento di Biologia Cellulare e dello Sviluppo, Universita di Palermo, Italy TABLE OF CONTENTS 1. Abstract 2. Introduction 3. Extracellular matrix 3.1. ECM and integrins 3.2. Basal lamina components 4. Cadherins. 4.1. Cadherins in angiogenesis 5. Integrins. 5.1. Integrins in angiogenesis 6. Focal adhesion molecules 7. Proteolytic enzymes 7.1. Proteolytic enzymes inhibitors 7.2. Proteolytic enzymes in angiogenesis 8. Perspective 9. Acknowledgements 10. References 1.ABSTRACT 2. INTRODUCTION Formation of vessels requires “epithelial- Growth of new blood vessels (angiogenesis) mesenchymal” transition of endothelial cells, with several plays a key role in several physiological processes, such modifications at the level of endothelial cell plasma as vascular remodeling during embryogenesis and membranes. These processes are associated with wound healing tissue repair in the adult; as well as redistribution of cell-cell and cell-substrate adhesion pathological processes, including rheumatoid arthritis, molecules, cross talk between external ECM and internal diabetic retinopathy, psoriasis, hemangiomas, and cytoskeleton through focal adhesion molecules and the cancer (1). Vessel formation entails the “epithelial- expression of several proteolytic enzymes, including matrix mesenchymal” transition of endothelial cells (ECs) “in metalloproteases and serine proteases. These enzymes with vivo”; a similar phenotypic exchange can be induced “in their degradative action on ECM components, generate vitro” by growing ECs to low cell density, or in “wound molecules acting as activators and/or inhibitors of healing” experiments or perturbing cell adhesion and angiogenesis. The purpose of this review is to provide an associated molecule functions.
    [Show full text]
  • Human Anogenital Monocyte-Derived Dendritic Cells and Langerin+Cdc2 Are Major HIV Target Cells
    ARTICLE https://doi.org/10.1038/s41467-021-22375-x OPEN Human anogenital monocyte-derived dendritic cells and langerin+cDC2 are major HIV target cells Jake W. Rhodes 1,2,15, Rachel A. Botting 1,2,3,15, Kirstie M. Bertram1,2, Erica E. Vine 1,2, Hafsa Rana1,2, Heeva Baharlou1,2, Peter Vegh 3, Thomas R. O’Neil1,2, Anneliese S. Ashhurst4, James Fletcher3, Grant P. Parnell1,2, J. Dinny Graham1,2, Najla Nasr1,4, Jake J. K. Lim5, Laith Barnouti6, Peter Haertsch7, Martijn P. Gosselink 1,8, Angelina Di Re 1,8, Faizur Reza1,8, Grahame Ctercteko1,8, Gregory J. Jenkins9, Andrew J. Brooks10, Ellis Patrick 1,11, Scott N. Byrne1,4, Eric Hunter 12, Muzlifah A. Haniffa 3,13,14, ✉ Anthony L. Cunningham 1,2,16 & Andrew N. Harman 1,4,16 1234567890():,; Tissue mononuclear phagocytes (MNP) are specialised in pathogen detection and antigen presentation. As such they deliver HIV to its primary target cells; CD4 T cells. Most MNP HIV transmission studies have focused on epithelial MNPs. However, as mucosal trauma and inflammation are now known to be strongly associated with HIV transmission, here we examine the role of sub-epithelial MNPs which are present in a diverse array of subsets. We show that HIV can penetrate the epithelial surface to interact with sub-epithelial resident MNPs in anogenital explants and define the full array of subsets that are present in the human anogenital and colorectal tissues that HIV may encounter during sexual transmission. In doing so we identify two subsets that preferentially take up HIV, become infected and transmit the virus to CD4 T cells; CD14+CD1c+ monocyte-derived dendritic cells and langerin-expressing conventional dendritic cells 2 (cDC2).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Dux4r, Znf384r and PAX5-P80R Mutated B-Cell Precursor Acute
    Acute Lymphoblastic Leukemia SUPPLEMENTARY APPENDIX DUX4r , ZNF384r and PAX5 -P80R mutated B-cell precursor acute lymphoblastic leukemia frequently undergo monocytic switch Michaela Novakova, 1,2,3* Marketa Zaliova, 1,2,3* Karel Fiser, 1,2* Barbora Vakrmanova, 1,2 Lucie Slamova, 1,2,3 Alena Musilova, 1,2 Monika Brüggemann, 4 Matthias Ritgen, 4 Eva Fronkova, 1,2,3 Tomas Kalina, 1,2,3 Jan Stary, 2,3 Lucie Winkowska, 1,2 Peter Svec, 5 Alexandra Kolenova, 5 Jan Stuchly, 1,2 Jan Zuna, 1,2,3 Jan Trka, 1,2,3 Ondrej Hrusak 1,2,3# and Ester Mejstrikova 1,2,3# 1CLIP - Childhood Leukemia Investigation Praguerague, Czech Republic; 2Department of Paediatric Hematology and Oncology, Second Faculty of Medicine, Charles University, Prague, Czech Republic; 3University Hospital Motol, Prague, Czech Republic; 4Department of In - ternal Medicine II, University Hospital Schleswig-Holstein, Kiel, Germany and 5Comenius University, National Institute of Children’s Dis - eases, Bratislava, Slovakia *MN, MZ and KF contributed equally as co-first authors. #OH and EM contributed equally as co-senior authors. ©2021 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2020.250423 Received: February 18, 2020. Accepted: June 25, 2020. Pre-published: July 9, 2020. Correspondence: ESTER MEJSTRIKOVA - [email protected] Table S1. S1a. List of antibodies used for diagnostic immunophenotyping. Antibody Fluorochrome Clone Catalogue number Manufacturer CD2 PE 39C1.5 A07744 Beckman Coulter CD3 FITC UCHT1 1F-202-T100 Exbio CD4 PE-Cy7
    [Show full text]
  • On and Polymorphisms in Q Fever
    Matrix metalloproteinase expression, produc3on and polymorphisms in Q fever Anne F.M. Jansen1,2, Teske Schoffelen1,2, Julien Textoris3, Jean Louis Mege3, Chantal P. Bleeker-Rovers1,2, Esther van de Vosse4, Hendrik Jan Roest5, Marcel van Deuren1,2 1. Department of Internal Medicine, Division of Experimental Medicine, Radboud university medical center, Nijmegen, The Netherlands 2. Radboud Expert Centre for Q fever, Radboud university medical center, Nijmegen, the Netherlands, 3. URMITE, CNRS UMR 7278, IRD 198, INSERM 1095 Aix-Marseille University, Marseille, France 4. Department of Infec3ous Diseases, Leiden University Medical Center, Leiden, The Netherlands 5. Department of Bacteriology and TSEs, Central Veterinary Instute, part of Wageningen UR, Lelystad, the Netherlands Background C. burnei induces MMP-1 and MMP-9 produc3on in PBMCs Chronic Q fever is a life threatening condi3on caused by the Gram-negave bacterium Coxiella burnei, manifes3ng as an infec3on of aneurysms, aor3c prosthesis or heart valves. Matrix metalloproteinases (MMPs) are proteoly3c enzymes that cleave extracellular matrix and are implicated in the pathology of aneurysms and endocardi3s. Currently, the contribu3on of MMPs to the pathogenesis of chronic Q fever is unknown. Methods We inves3gated the C. burnei specific gene expression of MMPs in PBMCs and protein produc3on by ELISA in chronic Q fever paents (n=6, n=10, respec3vely), cardiovascular paents with a history of Q fever (n=10) and healthy controls (n=4, n=10, respec3vely), in some experiments, the controls had vascular disease (n=10). Circulang MMP levels were assessed with Luminex technology and these groups were also genotyped for 20 SNPs in MMP and Tissue Inhibitor of MMP (TIMP) genes.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]