DOCSLIB.ORG

Mmps, Adams and Their Natural Inhibitors in Inflammatory Bowel

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Fontani et al. J Clin Gastroenterol Treat 2017, 3:039 Volume 3 | Issue 1 Journal of ISSN: 2469-584X Clinical Gastroenterology and Treatment Review Article: Open Access MMPs, ADAMs and Their Natural Inhibitors in Inflammatory Bowel Disease: Involvement of Oxidative Stress Filippo Fontani1, Vladana Domazetovic1, Tommaso Marcucci2, Maria Teresa Vincenzini1 and Teresa Iantomasi1* 1Department of Biomedical, Experimental and Clinical Sciences “Mario Serio”, University of Florence, Italy 2Santa Maria Annunziata Hospital, Section of General Surgery, Ponte a Niccheri (Florence), Italy *Corresponding author: Teresa Iantomasi, Department of Biomedical, Experimental and Clinical Sciences “Mario Serio”, University of Florence, Viale Morgagni, 50, 50134 Firenze, Italy, Tel: 00390552751200, E-mail: [email protected] that these parameters are more prevalent in highly industrialized Abstract nations than in less developed countries [4,5]. The lifestyle and Matrix metalloproteinases (MMPs) are enzymes involved in the dietary factors affect the development of IBD. In fact, the cigarette degradation of extracellular matrix proteins and in several functions smoke enhances the risk for CD and influences negatively the life such as wound repair. The regulation of MMPs occurs at various quality of patients [6,7]. The excessive consumption of milk, animal levels including expression and inhibition by tissue specific inhibitors proteins, carbohydrates and polyunsaturated fatty acids (PUFAs) of MMPs (TIMPs). An alteration of intracellular redox state can modulate the activation and/or expression of MMPs. The increased can enhance the risk for IBD. In particular, starch, generally present expression and activity of MMPs are related to inflammatory in human diet, can promote development of microbic species state and pathogenesis of inflammatory bowel disease (IBD). In involved in the induction of autoimmunological reaction in IBD particular, an imbalance between MMPs and TIMPs is present at [8]. It has been observed that the imbalance in the consumption intestinal level in IBD, and this can be responsible of alterations of of Omega 6 PUFAs and Omega 3 PUFAs is very important in different processes such as repair of damaged mucosa, function the development of IBD. In fact, Omega 3 PUFAs, differently and migration of immune cells and mucosal ulceration. A disintegrin from Omega 6 PUFAs, do not alter parameters, such as intestinal and metalloproteinase 17 (ADAM17), belonging to ADAM family, microbic flora and intestinal permeability, which contribute to IBD plays an important role in the intestinal inflammation and increases in human colonic mucosa of IBD patients. In this review we report pathogenesis [9]. In the development of IBD, an important role is the effects of MMP, ADAM17 and TIMP altered levels on damage attributed to oxidative stress, due to altered balance between reactive amplification caused by inflammation and oxidative stress in IBD. oxygen species (ROS) and antioxidant activity [10]. In particular, Moreover, the review evidences the role of the intracellular redox the increased oxidative state in intestinal mucosa of CD patients is state and antioxidants on regulation of expression and activity of involved in the chronicization of this pathology [11,12]. Recently, some MMPs in condition of oxidative stress in IBD. it has been demonstrated that the compounds with antioxidant Keywords capacity, associated or not to the traditional therapy for IBD, such as sulfasalazine, azatriopine, corticosteroids, 5-aminosalicylic acid MMPs, ADAM17, IBD, Oxidative stress, Antioxidants and infliximab, can be beneficial for IBD treatment [13,14]. The Table 1: Highest annual percent of incidence and prevalence of ulcerative colitis Introduction (UC) and Crohn’s disease (CD) in the principal areas of the world. The inflammatory bowel disease (IBD) includes two major forms Continent Incidence Prevalence of chronic intestinal disorders, Crohn’s disease (CD) and ulcerative 0.243 (UC) 5.05 (UC) Europe1 colitis (UC). The exact aetiology of IBD is not well known. There are 0.127 (CD) 3.22 (CD) several factors involved in development of this group of diseases, 0.192 (UC) 2.486 (UC) which include changes in the immune system, bacterial infection North America1 and genetic variations [1]. CD is characterized by discontinuous 0.202 (CD) 3.18 (CD) transmural inflammation that, although can occur in any region of 0.063 (UC) 1.683 (UC) Asia and Middle East1 gastrointestinal tract, strikes mostly the ileum and the colon. On 0.05 (CD) 0.679 (CD) the contrary, in UC the inflammatory state, typically limited to the 0.174 (UC)1 0.16 (UC)2 mucosa, involves the rectum and may affect a part or the entire colon Australia in a continuous pattern [2,3]. Table 1 shows the highest incidence 0.293 (CD)1 0.14 (CD)2 and prevalence of IBD in principal areas of the world. It is evident 1Ref. 5; 2Data from the final IBD report of Australian crohn’s and colitis association (ACCA) 2007. Citation: Fontani F, Domazetovic V, Marcucci T, Vincenzini MT, Iantomasi T (2017) MMPs, ADAMs and Their Natural Inhibitors in Inflammatory Bowel Disease: Involvement of Oxidative Stress. J Clin Gastroenterol Treat 3:039 ClinMed Received: October 26, 2016: Accepted: January 03, 2017: Published: January 05, 2017 International Library Copyright: © 2017 Fontani F, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. compounds used in the antioxidant therapy are polyphenols, such as Metalloproteinases curcumin, resveratrol, quercetin, cathechin, present in plants and in food originating from plants [15]. Also food rich in micronutrients MMPs, collectively called matrixins, participate in the with antioxidant properties, such a vitamin E and C, can ameliorate modulation of homeostasis of extracellular matrix (ECM) by ROS-induced symptoms [16]. Proteinases, such as matrix cleaving ECM proteins such as collagen, fibronectin, elastin and metalloproteinases (MMPs), and A disintegrin and metalloproteinase laminin [34]. However, even if MMPs are involved in the normal 17 (ADAM17), belonging to ADAM metalloproteinases, affect the tissue remodelling, they also act on substrates different from ECM intestinal tissue damages and the inflammatory processes which proteins, regulating many physiological functions such as cell characterize IBD [17-19]. In fact, the oxidative stress can play a crucial proliferation, adhesion, migration, growth factor bioavailability, role in the modulation of MMPs activity and expression [20]. MMPs chemotaxis and signalling [34]. Under normal physiological are involved principally in the turnover of extracellular matrix, while conditions, MMPs are present in the latent form and at low ADAM17, a membrane-bound enzyme, cleaves cell surface proteins concentration. They generally present a prodomain, a catalytic such as cytokines and cytokine receptors [21]. Deregulated activity domain, a hinge region and a hemopexin domain [34]. To date 23 and expression of MMPs affect cell adhesion, immune cell migration, MMPs have been found and identified in humans. On the basis of cytokine production and impairs wound healing [22]. The activities substrate specificity, sequence similarity and domain organization, of MMPs are closely regulated at various levels such as transcription, MMPs can be divided into: Collagenases, Gelatinases, Stromelysins, activation of zymogens and inhibition by endogenous inhibitors Matrilysins, Membrane-Type MMPs. These last MMPs distinguish named tissue inhibitors of MMPs (TIMPs) [23,24]. TIMPs reduce in transmembrane or glycosylphosphatidylisositol- (GPI)-anchored MMPs activity, by forming non covalent 1:1 stoichiometric complex, MMPs (Table 2). Seven MMPs are not classified in the above [25] but they also affect, through their specific receptor, cell growth, categories and have been indicated as other MMPs. In particular, apoptosis, differentiation and angiogenesis [26]. The balance between MMP-12 (metalloelastase), mainly expressed in macrophages, is MMPs and TIMPs is very important in the inflammatory response essential for their migration and digests, besides elastin, a number and in the outcome of tissue injury. In fact, an increased MMPs/ of other proteins [35,36]. MMP-19 is identified as T-cell-derived TIMPs ratio has been found in inflamed colon of IBD [27], and an autoantigen from patients with rheumatoid arthritis [37]. MMP-20, enhanced activity of MMPs may amplify intestinal immune response located within newly formed tooth enamel, is also called enamelysin by recruiting the inflammatory cells [28]. Given that, it has been and digests primarily amelogenin [38]. MMP-21 has been detected suggested the potential use of inhibitors of MMPs in IBD treatment in neuronal tissues [39], in cancer and fetal tissue [40], indicating as demonstrated in IBD animal models in which the administration a role in human embryogenesis and tumor progression. MMP-22 of several MMP inhibitors reduces the inflammatory state [29,30]. function is still not known, but its substrates “in vitro” are gelatin Moreover, some data indicate that the antioxidant compounds may and casein [41]. The characterization of MMP-21 and MPP-22 genes have a therapeutic effect by reducing the altered levels of MMPs showed almost identical sequences [42]. MMP-23, mainly expressed detected in intestinal subepithelial myofibroblasts
Recommended publications
  • MATRIX METALLOPROTEINASE REQUIREMENTS for NEUROMUSCULAR SYNAPTOGENESIS by Mary Lynn Dear Dissertation Submitted to the Faculty O

    MATRIX METALLOPROTEINASE REQUIREMENTS for NEUROMUSCULAR SYNAPTOGENESIS by Mary Lynn Dear Dissertation Submitted to the Faculty O

    MATRIX METALLOPROTEINASE REQUIREMENTS FOR NEUROMUSCULAR SYNAPTOGENESIS By Mary Lynn Dear Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences January 31, 2018 Nashville, Tennessee Approved: Todd Graham, Ph.D. Kendal Broadie, Ph.D. Katherine Friedman, Ph.D. Barbara Fingleton, Ph.D. Jared Nordman, Ph.D. Copyright © 2018 by Mary Lynn Dear All Rights Reserved ACKNOWLEDGEMENTS I would like to acknowledge my advisor, Kendal Broadie, and the entire Broadie laboratory, both past and present, for their endless support, engaging conversations, thoughtful suggestions and constant encouragement. I would also like to thank my committee members both past and present for playing such a pivotal role in my graduate career and growth as a scientist. I thank the Department of Biological Sciences for fostering my graduate education. I thank the entire protease community for their continued support, helpful suggestions and collaborative efforts that helped my project move forward. I would like to acknowledge Dr. Andrea Page-McCaw and her entire laboratory for helpful suggestions, being engaged in my studies and providing many tools that were invaluable to my project. I thank my parents, Leisa Justus and Raymond Dear, my brother Jake Dear and my best friend Jenna Kaufman. Words cannot describe how grateful I am for your support and encouragement. Most importantly, I would like to thank my husband, Jeffrey Thomas, for always believing in me, your unwavering support and for helping me endure all the ups and downs that come with graduate school.
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Inflammation-Mediated Skin Tumorigenesis Induced by Epidermal C-Fos

    Inflammation-Mediated Skin Tumorigenesis Induced by Epidermal C-Fos

    Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Inflammation-mediated skin tumorigenesis induced by epidermal c-Fos Eva M. Briso,1 Juan Guinea-Viniegra,1 Latifa Bakiri,1 Zbigniew Rogon,2 Peter Petzelbauer,3 Roland Eils,2 Ronald Wolf,4 Mercedes Rinco´ n,5 Peter Angel,6 and Erwin F. Wagner1,7 1BBVA Foundation-Spanish National Cancer Research Center (CNIO) Cancer Cell Biology Program, CNIO, 28029 Madrid, Spain; 2Division of Theoretical Bioinformatics, German Cancer Research Center (DKFZ), 69120 Heidelberg, Germany; 3Skin and Endothelium Research Division (SERD), Department of Dermatology, Medical University of Vienna, A-1090 Vienna, Austria; 4Department of Dermatology and Allergology, Ludwig-Maximilian University, Munich, Germany; 5Division of Immunobiology, Department of Medicine, University of Vermont, 05405 Burlington, Vermont, USA; 6Division of Signal Transduction and Growth Control, DKFZ, DKFZ-Center for Molecular Biology of the University of Heidelberg (ZMBH) Alliance, 69120 Heidelberg, Germany Skin squamous cell carcinomas (SCCs) are the second most prevalent skin cancers. Chronic skin inflammation has been associated with the development of SCCs, but the contribution of skin inflammation to SCC development remains largely unknown. In this study, we demonstrate that inducible expression of c-fos in the epidermis of adult mice is sufficient to promote inflammation-mediated epidermal hyperplasia, leading to the development of preneoplastic lesions. Interestingly, c-Fos transcriptionally controls mmp10 and s100a7a15 expression in keratinocytes, subsequently leading to CD4 T-cell recruitment to the skin, thereby promoting epidermal hyperplasia that is likely induced by CD4 T-cell-derived IL-22. Combining inducible c-fos expression in the epidermis with a single dose of the carcinogen 7,12-dimethylbenz(a)anthracene (DMBA) leads to the development of highly invasive SCCs, which are prevented by using the anti-inflammatory drug sulindac.
  • What Are the Roles of Metalloproteinases in Cartilage and Bone Damage? G Murphy, M H Lee

    What Are the Roles of Metalloproteinases in Cartilage and Bone Damage? G Murphy, M H Lee

    iv44 Ann Rheum Dis: first published as 10.1136/ard.2005.042465 on 20 October 2005. Downloaded from REPORT What are the roles of metalloproteinases in cartilage and bone damage? G Murphy, M H Lee ............................................................................................................................... Ann Rheum Dis 2005;64:iv44–iv47. doi: 10.1136/ard.2005.042465 enzyme moiety into an upper and a lower subdomain. A A role for metalloproteinases in the pathological destruction common five stranded beta-sheet and two alpha-helices are in diseases such as rheumatoid arthritis and osteoarthritis, always found in the upper subdomain with a further C- and the irreversible nature of the ensuing cartilage and bone terminal helix in the lower subdomain. The catalytic sites of damage, have been the focus of much investigation for the metalloproteinases, especially the MMPs, have been several decades. This has led to the development of broad targeted for the development of low molecular weight spectrum metalloproteinase inhibitors as potential therapeu- synthetic inhibitors with a zinc chelating moiety. Inhibitors tics. More recently it has been appreciated that several able to fully differentiate between individual enzymes have families of zinc dependent proteinases play significant and not been identified thus far, although a reasonable level of varied roles in the biology of the resident cells in these tissues, discrimination is now being achieved in some cases.7 Each orchestrating development, remodelling, and subsequent family does, however, have other unique domains with pathological processes. They also play key roles in the numerous roles, including the determination of physiological activity of inflammatory cells. The task of elucidating the substrate specificity, ECM, or cell surface localisation (fig 1).
  • Discovery and Optimization of Selective Inhibitors of Meprin Α (Part II)

    Discovery and Optimization of Selective Inhibitors of Meprin Α (Part II)

    pharmaceuticals Article Discovery and Optimization of Selective Inhibitors of Meprin α (Part II) Chao Wang 1,2, Juan Diez 3, Hajeung Park 1, Christoph Becker-Pauly 4 , Gregg B. Fields 5 , Timothy P. Spicer 1,6, Louis D. Scampavia 1,6, Dmitriy Minond 2,7 and Thomas D. Bannister 1,2,* 1 Department of Molecular Medicine, Scripps Research, Jupiter, FL 33458, USA; [email protected] (C.W.); [email protected] (H.P.); [email protected] (T.P.S.); [email protected] (L.D.S.) 2 Department of Chemistry, Scripps Research, Jupiter, FL 33458, USA; [email protected] 3 Rumbaugh-Goodwin Institute for Cancer Research, Nova Southeastern University, 3321 College Avenue, CCR r.605, Fort Lauderdale, FL 33314, USA; [email protected] 4 The Scripps Research Molecular Screening Center, Scripps Research, Jupiter, FL 33458, USA; [email protected] 5 Unit for Degradomics of the Protease Web, Institute of Biochemistry, University of Kiel, Rudolf-Höber-Str.1, 24118 Kiel, Germany; fi[email protected] 6 Department of Chemistry & Biochemistry and I-HEALTH, Florida Atlantic University, 5353 Parkside Drive, Jupiter, FL 33458, USA 7 Dr. Kiran C. Patel College of Allopathic Medicine, Nova Southeastern University, 3301 College Avenue, Fort Lauderdale, FL 33314, USA * Correspondence: [email protected] Abstract: Meprin α is a zinc metalloproteinase (metzincin) that has been implicated in multiple diseases, including fibrosis and cancers. It has proven difficult to find small molecules that are capable Citation: Wang, C.; Diez, J.; Park, H.; of selectively inhibiting meprin α, or its close relative meprin β, over numerous other metzincins Becker-Pauly, C.; Fields, G.B.; Spicer, which, if inhibited, would elicit unwanted effects.
  • 2335 Roles of Molecules Involved in Epithelial/Mesenchymal Transition

    2335 Roles of Molecules Involved in Epithelial/Mesenchymal Transition

    [Frontiers in Bioscience 13, 2335-2355, January 1, 2008] Roles of molecules involved in epithelial/mesenchymal transition during angiogenesis Giulio Ghersi Dipartimento di Biologia Cellulare e dello Sviluppo, Universita di Palermo, Italy TABLE OF CONTENTS 1. Abstract 2. Introduction 3. Extracellular matrix 3.1. ECM and integrins 3.2. Basal lamina components 4. Cadherins. 4.1. Cadherins in angiogenesis 5. Integrins. 5.1. Integrins in angiogenesis 6. Focal adhesion molecules 7. Proteolytic enzymes 7.1. Proteolytic enzymes inhibitors 7.2. Proteolytic enzymes in angiogenesis 8. Perspective 9. Acknowledgements 10. References 1.ABSTRACT 2. INTRODUCTION Formation of vessels requires “epithelial- Growth of new blood vessels (angiogenesis) mesenchymal” transition of endothelial cells, with several plays a key role in several physiological processes, such modifications at the level of endothelial cell plasma as vascular remodeling during embryogenesis and membranes. These processes are associated with wound healing tissue repair in the adult; as well as redistribution of cell-cell and cell-substrate adhesion pathological processes, including rheumatoid arthritis, molecules, cross talk between external ECM and internal diabetic retinopathy, psoriasis, hemangiomas, and cytoskeleton through focal adhesion molecules and the cancer (1). Vessel formation entails the “epithelial- expression of several proteolytic enzymes, including matrix mesenchymal” transition of endothelial cells (ECs) “in metalloproteases and serine proteases. These enzymes with vivo”; a similar phenotypic exchange can be induced “in their degradative action on ECM components, generate vitro” by growing ECs to low cell density, or in “wound molecules acting as activators and/or inhibitors of healing” experiments or perturbing cell adhesion and angiogenesis. The purpose of this review is to provide an associated molecule functions.
  • Negatively Regulated by ADAM15 TRIF-Mediated TLR3 and TLR4

    Negatively Regulated by ADAM15 TRIF-Mediated TLR3 and TLR4

    TRIF-Mediated TLR3 and TLR4 Signaling Is Negatively Regulated by ADAM15 Suaad Ahmed, Ashwini Maratha, Aisha Qasim Butt, Enda Shevlin and Sinead M. Miggin This information is current as of September 27, 2021. J Immunol 2013; 190:2217-2228; Prepublished online 30 January 2013; doi: 10.4049/jimmunol.1201630 http://www.jimmunol.org/content/190/5/2217 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/01/30/jimmunol.120163 Material 0.DC1 References This article cites 57 articles, 20 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/190/5/2217.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 27, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology TRIF-Mediated TLR3 and TLR4 Signaling Is Negatively Regulated by ADAM15 Suaad Ahmed, Ashwini Maratha, Aisha Qasim Butt, Enda Shevlin, and Sinead M.
  • ADAM10 Site-Dependent Biology: Keeping Control of a Pervasive Protease

    ADAM10 Site-Dependent Biology: Keeping Control of a Pervasive Protease

    International Journal of Molecular Sciences Review ADAM10 Site-Dependent Biology: Keeping Control of a Pervasive Protease Francesca Tosetti 1,* , Massimo Alessio 2, Alessandro Poggi 1,† and Maria Raffaella Zocchi 3,† 1 Molecular Oncology and Angiogenesis Unit, IRCCS Ospedale Policlinico S. Martino Largo R. Benzi 10, 16132 Genoa, Italy; [email protected] 2 Proteome Biochemistry, IRCCS San Raffaele Scientific Institute, 20132 Milan, Italy; [email protected] 3 Division of Immunology, Transplants and Infectious Diseases, IRCCS San Raffaele Scientific Institute, 20132 Milan, Italy; [email protected] * Correspondence: [email protected] † These authors contributed equally to this work as last author. Abstract: Enzymes, once considered static molecular machines acting in defined spatial patterns and sites of action, move to different intra- and extracellular locations, changing their function. This topological regulation revealed a close cross-talk between proteases and signaling events involving post-translational modifications, membrane tyrosine kinase receptors and G-protein coupled recep- tors, motor proteins shuttling cargos in intracellular vesicles, and small-molecule messengers. Here, we highlight recent advances in our knowledge of regulation and function of A Disintegrin And Metalloproteinase (ADAM) endopeptidases at specific subcellular sites, or in multimolecular com- plexes, with a special focus on ADAM10, and tumor necrosis factor-α convertase (TACE/ADAM17), since these two enzymes belong to the same family, share selected substrates and bioactivity. We will discuss some examples of ADAM10 activity modulated by changing partners and subcellular compartmentalization, with the underlying hypothesis that restraining protease activity by spatial Citation: Tosetti, F.; Alessio, M.; segregation is a complex and powerful regulatory tool.
  • Expression of the Disintegrin Metalloprotease, ADAM-10, In

    Expression of the Disintegrin Metalloprotease, ADAM-10, In

    314 Vol. 10, 314–323, January 1, 2004 Clinical Cancer Research Expression of the Disintegrin Metalloprotease, ADAM-10, in Prostate Cancer and Its Regulation by Dihydrotestosterone, Insulin-Like Growth Factor I, and Epidermal Growth Factor in the Prostate Cancer Cell Model LNCaP Daniel R. McCulloch,1 Pascal Akl,1 Conclusions: This study describes for the first time Hemamali Samaratunga,2 Adrian C. Herington,1 the expression, regulation, and cellular localization of and Dimitri M. Odorico1 ADAM-10 protein in PCa. The regulation and membrane 1 localization of ADAM-10 support our hypothesis that Hormone-Dependent Cancer Program, School of Life Sciences, ADAM-10 has a role in extracellular matrix maintenance Queensland University of Technology, Brisbane, Queensland, Australia, and 2Sullivan Nicolaides Pathology, Brisbane, Queensland, and cell invasion, although the potential role of nuclear Australia ADAM-10 is not yet known. INTRODUCTION ABSTRACT The disintegrin metalloproteases ADAMs, like the matrix Purpose: The disintegrin metalloprotease ADAM-10 is metalloproteinases (MMPs), are members of the metzincin a multidomain metalloprotease that is potentially significant (zinc-dependent metalloprotease) superfamily. To date, more in tumor progression due to its extracellular matrix-degrad- than 30 ADAMs have been characterized (1), some of which are ing properties. Previously, ADAM-10 mRNA was detected involved in diverse biological functions such as fertilization, in prostate cancer (PCa) cell lines; however, the presence of neurogenesis (2, 3), and the ectodomain shedding of growth ADAM-10 protein and its cellular localization, regulation, factors such as amyloid precursor protein and tumor necrosis and role have yet to be described. We hypothesized that factor ␣ (4, 5).
  • ADAM17 Targets MMP-2 and MMP-9 Via EGFR-MEK-ERK Pathway Activation to Promote Prostate Cancer Cell Invasion

    ADAM17 Targets MMP-2 and MMP-9 Via EGFR-MEK-ERK Pathway Activation to Promote Prostate Cancer Cell Invasion

    1714 INTERNATIONAL JOURNAL OF ONCOLOGY 40: 1714-1724, 2012 ADAM17 targets MMP-2 and MMP-9 via EGFR-MEK-ERK pathway activation to promote prostate cancer cell invasion LI-JIE XIAO1,2*, PING LIN1*, FENG LIN1*, XIN LIU1, WEI QIN1, HAI-FENG ZOU1, LIANG GUO1, WEI LIU1, SHU-JUAN WANG1 and XIAO-GUANG YU1 1Department of Biochemistry and Molecular Biology, College of Basic Medical Science, Harbin Medical University, 194 Xuefu Road, Harbin 150081, Heilongjiang; 2College of Life Science and Technology, Heilongjiang Bayi Agricultural University, 2 Xinyang Road, Daqing 163319, Heilongjiang, P.R. China Received September 8, 2011; Accepted November 18, 2011 DOI: 10.3892/ijo.2011.1320 Abstract. ADAM17, also known as tumor necrosis factor-α released and down-regulation of MMP-2, MMP-9. However, converting enzyme (TACE), is involved in proteolytic ectodo- these effects could be reversed by simultaneous addition of main shedding of cell surface molecules and cytokines. TGF-α. These data demonstrated that ADAM17 contributes to Although aberrant expression of ADAM17 has been shown androgen-independent prostate cancer cell invasion by shed- in various malignancies, the function of ADAM17 in prostate ding of EGFR ligand TGF-α, which subsequently activates the cancer has not been clarified. In the present study, we sought EGFR-MEK-ERK signaling pathway, leading finally to over- to elucidate whether ADAM17 contributes to prostate cancer expression of MMP-2 and MMP-9. This study suggests that the cell invasion, as well as the mechanism involved in the process. ADAM17 expression level may be a new predictive biomarker The expression pattern of ADAM17 was investigated in human of invasion and metastasis of prostate cancer, and ADAM17 prostate cancer cells.
  • Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
  • On and Polymorphisms in Q Fever

    On and Polymorphisms in Q Fever

    Matrix metalloproteinase expression, produc3on and polymorphisms in Q fever Anne F.M. Jansen1,2, Teske Schoffelen1,2, Julien Textoris3, Jean Louis Mege3, Chantal P. Bleeker-Rovers1,2, Esther van de Vosse4, Hendrik Jan Roest5, Marcel van Deuren1,2 1. Department of Internal Medicine, Division of Experimental Medicine, Radboud university medical center, Nijmegen, The Netherlands 2. Radboud Expert Centre for Q fever, Radboud university medical center, Nijmegen, the Netherlands, 3. URMITE, CNRS UMR 7278, IRD 198, INSERM 1095 Aix-Marseille University, Marseille, France 4. Department of Infec3ous Diseases, Leiden University Medical Center, Leiden, The Netherlands 5. Department of Bacteriology and TSEs, Central Veterinary Instute, part of Wageningen UR, Lelystad, the Netherlands Background C. burnei induces MMP-1 and MMP-9 produc3on in PBMCs Chronic Q fever is a life threatening condi3on caused by the Gram-negave bacterium Coxiella burnei, manifes3ng as an infec3on of aneurysms, aor3c prosthesis or heart valves. Matrix metalloproteinases (MMPs) are proteoly3c enzymes that cleave extracellular matrix and are implicated in the pathology of aneurysms and endocardi3s. Currently, the contribu3on of MMPs to the pathogenesis of chronic Q fever is unknown. Methods We inves3gated the C. burnei specific gene expression of MMPs in PBMCs and protein produc3on by ELISA in chronic Q fever paents (n=6, n=10, respec3vely), cardiovascular paents with a history of Q fever (n=10) and healthy controls (n=4, n=10, respec3vely), in some experiments, the controls had vascular disease (n=10). Circulang MMP levels were assessed with Luminex technology and these groups were also genotyped for 20 SNPs in MMP and Tissue Inhibitor of MMP (TIMP) genes.