CHAPTER-IV Results and Discussion

4.1 Standardization of genomic DNA extraction from fish tissue The fishes under study viz., Badis badis and Amblyceps mangois have been classified as threatened in category as reported by NBFGR. Therefore it would be unethical to standardize the genomic DNA (gDNA) isolation and RAPD PCR experiments with these fish samples. For this reason closely related fish samples (Labeo bata related to Badis badis and Heteropneustes fossilis related to Amblyceps mangois) were chosen for the standardization of sufficient amount of genomic DNA extractraction from minute quantity of tissue samples from these fishes. The DNA isolation method employed in this study showed that sufficient amounts of high molecular weight gDNAs could be purified from fish scales/fins (Figure 12). While the integrity of the isolated gDNAs appeared satisfactory ample amount of RNAs were present in the isolated gDNA samples (Figure 12 A–C). The figure showed that the yields of high molecular weight gDNAs from live scale and fin samples were substantially higher than that from frozen samples. However the gDNAs isolated from different quantities of fin clips of both live and frozen Heteropneustes (scaleless species) were more degraded than that from scales or fins of Labeo (Figure 12 C).

Live Frozen Live Frozen Live Frozen

A. Labeo bata (Scale) B. Labeo bata (Fin) C. Heteropneustes fossilis (Fin) Figure 12. 0.7 % agarose gel electrophoreses of genomic DNAs (gDNAs) isolated from Live and Frozen scale and fin samples of L. bata and H. fossilis. A. Lane 1 Lambda DNA/Hind III Digest DNA size marker (kb), lanes 2–6: 5, 10, 20, 30, 50 pieces of scale gDNA preparations from live L. bata, lanes 8–12: 5, 10, 20, 30, 50 pieces of scale gDNA preparations from frozen L. bata. B. Lane 1 Lambda DNA/Hind III Digest DNA size marker (kb), lanes 2–6: 1, 5, 10, 20, 30 mg of fin gDNA preparations from live L. bata, lanes 8–12: 1, 5, 10, 20, 30 mg of fin gDNA preparations from frozen L. bata. C. Lane 1 lambda DNA/Hind III Digest DNA size marker (kb), lanes 2–6: 1 mg, 5, 10, 20, 30 mg of fin gDNA preparations from live H. fossilis, lanes 8–12: 1, 5, 10, 20, 30 mg of fin gDNA preparations from frozen H. fossilis. Quantification of gDNA yields was done after treating each isolate with RNase A. The total yield of gDNAs from 5 and 50 pieces of scales were 8.40 and 80.0 µg respectively

Page | 131 and from 1 and 30 mg fin were 4.65 and 123.50 µg respectively in live L. bata. In live H. fossilis the total yield were 14.60 and 132.60 µg from 1 and 30 mg fin respectively. However, the yield of gDNAs from frozen samples of both L. bata and H. fossilis were relatively low in comparison to that from the live ones (Table 10).

Table 10. Spectrophotometric assessment of gDNA yields and purity in both live and frozen tissues from a carp (Labeo bata) and a catfish (Heteropneustes fossilis) after treatment with RNase A. Specimen Tissue Sample OD260 OD280 OD260/ Concentration Total type OD280 (µg/ll) yield (µg) 5 pieces 0.0056 0.0032 1.75 0.084 8.40 Scale Labeo bata 50 pieces 0.0530 0.0243 2.18 0.800 80.0 (live) 1 mg 0.0031 0.0016 1.94 0.0465 4.65 Fin 30 mg 0.0823 0.0446 1.85 1.235 123.50 5 pieces 0.0021 0.0011 1.91 0.032 3.20 Scale Labeo bata 50 pieces 0.0190 0.0102 1.86 0.285 28.5 (frozen) 1 mg 0.0009 0.0005 1.80 0.0135 1.35 Fin 30 mg 0.0240 0.0137 1.75 0.36 36.0 Heteropneustes 1 mg 0.0097 0.0049 1.98 0.146 14.60 Fin fossilis (live) 30 mg 0.0884 0.0463 1.86 1.326 132.60 Heteropneustes 1 mg 0.0011 0.0006 1.83 0.0165 1.65 Fin fossilis (frozen) 30 mg 0.0165 0.0093 1.77 0.2475 24.75

The gDNAs isolated from lowest (5 pieces) and highest (50 pieces) numbers of scales of L. bata and that from lowest (1 mg) and highest (30 mg) amounts of fin tissues of the fishes were used as templates in RAPD-PCR analyses (Figure. 13). In live L. bata scale and fin, OPA02 primer produced nine bands and OPA 07 produced seven bands respectively [Figure. 13 A (lanes 2, 3, 6, 7), 2B (lanes 2, 3, 6, 7)]. But in frozen L. bata scale and fin the result was different, the bands appeared faint, OPA02 primer produced three bands and OPA07 primer produced four bands [Figure 13 A (lanes 4, 5, 8, 9), b (lanes 4, 5, 8, 9)]. In live H. fossilis fin OPA 02 gives eight bands and OPA07 gives four bands (Figure 13 C lanes 2, 3, 6, 7) whereas in frozen sample the numbers of bands were relatively less, both OPA 02 produced six bands and OPA07 produced three bands (Figure 13 C lanes 4, 5, 8, 9).

Page | 132

A. Labeo bata (Scale) B. Labeo bata (Fin) C. Heteropneustes fossilis (Fin)

Figure 13. RAPD banding patterns in 1.4 % agarose gels from L. bata and H. fossilis using decamer primers OPA02 and OPA07. A Lane 1 100 bp DNA ladder (kb), lanes 2–3, 6–7 RAPD profile from 5 and 50 pieces of scale respectively from live L. bata, lanes 4–5, 8–9 RAPD profile from 5 and 50 pieces of scale respectively from frozen L. bata. B Lane 1 100 bp DNA ladder (kb), lanes 2–3, 6–7 RAPD profile from 1 and 30 mg of fins respectively from live L. bata, lanes 4–5, 8–9 RAPD profile from 1 and 30 mg of fin respectively from frozen L. bata. C Lane 1 100 bp DNA ladder (kb), lanes 2– 3, 6–7 RAPD profile from 1 and 30 mg of fin respectively from live H. fossilis, lanes 4–5, 8–9 RAPD profile from 1 and 30 mg of fin respectively from frozen H. fossilis.

Page | 133

4.2 Genetic diversity study of Badis badis

A detailed survey was carried out in the Mahananda (Terai region), Teesta and Jaldhaka (Dooars region) river systems for the collection of Badis badis samples. Total seventeen spots were selected for collection purpose (Figure 14) and samples were collected from the selected sites with the help of scoop net. The fourteen collection spots were as follows, viz., Mahananda Barrage, Fulbari (BTR-1), Mahananda-Panchanoi River Junction (BTR-2), Balason River, Palpara, Matigara (BTR-3), Panchanoi River (BTR-4), Mahananda River, Champasari (BTR-5), Balason River, Tarabari (BTR-6) from Mahananda river system; Sevoke (BDR-1), Ghish river (BDR-2), Gajoldoba-Teesta Barrage (BDR-3), Chel river (BDR-4), Neora river (BDR-5), Dharla river (BDR-6), Jalpaiguri (BDR-7) from Teesta river system; and Jaldhaka River (BDR-8), Murti River (BDR-9), Ghotia River (BDR-10), Diana River (BDR-11) from Jaldhaka river system. See the map below for detail:

BDR-2 BDR-5 BDR-1 BDR-4 BDR-11 BDR-10 BDR-9

BTR-5 BTR-6 BTR-4 Teesta River System Jaldhaka River System Mahananda River System BDR-3 BTR-3

BTR-2 Water channel BDR-6 BTR-1

N sampling site BDR-8 BDR-7 10 Km Figure 14. Badis badis collection sites. Also refer to Table 2 for the geographic coordinates of the collection spots for Badis badis.

Page | 134

4.2.1 Findings based on RAPD based analyses 4.2.1.1 Intra-Population Genetic Diversity Study 4.2.1.1.1 Mahananda River System Table 11. Intra-population genetic diversity indices based on RAPD analyses of Badis badis of Mahananda-Balason river system. Populations RAPD Markers Diversity Indices H´ H´ Np Nper S H H´ or I E= e /S EHeip=(e - 1/S-1) Mahananda Barrage, 40 28.37% 1.2837± 0.1061± 0.1562± 0.910696 0.595911 Fulbari (BTR-1) 0.4524 0.1841 0.2637 Mahananda-Panchanoi 35 24.82% 1.2482± 0.0898± 0.1330± 0.915118 0.573127 River Junction (BTR-2) 0.4335 0.1718 0.2471 Balason River, Palpara, 34 24.11% 1.2411± 0.0865± 0.1283± 0.916037 0.567789 Matigara 0.4293 0.1690 0.2433 (BTR-3) Panchanoi River 36 25.53% 1.2553± 0.0946± 0.1395± 0.915876 0.586364 (BTR-4) 0.4376 0.1766 0.2533 Mahananda River, 37 26.24% 1.2624± 0.0953± 0.1409± 0.912001 0.576637 Champasari 0.4415 0.1764 0.2531 (BTR-5) Balason River, Tarabari 44 31.21% 1.3121± 0.1166± 0.1717± 0.904902 0.600197 (BTR-6) 0.4650 0.1890 0.2709 Mahananda river 53 37.59% 1.3759± 0.1207± 0.1836± 0.873272 0.53614 system 0.4861 0.1789 0.2600 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index.

Based on the RAPD profile of Badis badis from Mahananda-Balason river the number of polymorphic loci and the percentage of polymorphic loci vary across six populations (BTR-1 to BTR-6) (Table 11 and Figure 15 A). The highest number of polymorphic loci was observed in BTR-6 population (44 numbers) and the percentage of polymorphism was 31.21. The lowest number of polymorphic loci was observed in BTR-3 population (34 numbers) and the percentage of polymorphism was 24.11. The observed number of alleles or allelic richness (S) varies from 1.2411 ± 0.4293 in BTR-3 population to 1.3121 ± 0.4650 in BTR-6 population (Table 11). The Nei’s genetic diversity (H) was highest (0.1166 ± 0.1890) in BTR-6 population and lowest (0.0865 ± 0.1690) in BTR-3 population (Table 11). The Shannon’s information index (H´ or I) was highest (0.1717 ± 0.2709) in BTR-6 population and lowest (0.1283 ± 0.2433) in BTR-3 population (Table 11). However, the measure of evenness (E) was highest (0.916037) in BTR-3 population and lowest (0.904902) in BTR-6 population (Table 11). The Heip’s measure of evenness was highest (0.600197) in BTR-6 population and lowest (0.567789) in BTR-3 population (Table 11).

Page | 135

4.2.1.1.2 Teesta River System Table 12. Intra-population genetic diversity indices based on RAPD analyses of Badis badis of Teesta river system. RAPD Markers Diversity Indices Populations E =(e N N S H H´ or I E= e H´/S Heip p per H´-1/S-1) Sevoke 1.3333± 0.1191± 0.1756± (Teesta River) 47 33.33% 0.893993 0.575941 0.4731 0.1925 0.2735 (BDR-1) Ghish River 1.2553± 0.0984± 0.1442± 36 25.53% 0.92019 0.60758 (BDR-2) 0.4376 0.1800 0.2584 Gajoldoba (Teesta River 1.2128± 0.0762± 0.1130± 30 21.28% 0.923179 0.562181 Barrage) 0.4107 0.1611 0.2322 (BDR-3) Chel River 1.3475± 0.1291± 0.1897± 49 34.75% 0.897133 0.601113 (BDR-4) 0.4779 0.1964 0.2802 Neora River 1.2411± 0.0820± 0.1223± 34 24.11% 0.910558 0.539581 (BDR-5) 0.4293 0.1655 0.2378 Dharla River 1.2199± 0.0801± 0.1187± 31 21.99% 0.923053 0.573134 (BDR-6) 0.4156 0.1641 0.2366 Jalpaiguri 1.2411± 0.0932± 0.1355± (Teesta River) 34 24.11% 0.922657 0.601863 0.4293 0.1805 0.2566 (BDR-7) Teesta river 1.8227± 0.2929 ± 0.4361± 116 82.27% 0.848556 0.664475 system 0.3833 0.1825 0.2514 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index.

The RAPD analyses of Badis badis of Teesta river showed that the diversity indices were varied across populations from BDR-1 to BDR-7 collected from the Teesta River (Table 12 and Figure 15B). The highest number of polymorphic loci (49) was observed in BDR-4 population and the percentages of polymorphism were found to be 34.75 in RAPD. The lowest number of polymorphic loci (30) was observed in BDR-3 population and the percentages of polymorphism were found to be 21.28. The observed number of alleles or allelic richness (S) varied from 1.2128 ± 0.4107 in BDR-3 population to 1.3475 ± 0.4779 in BDR-4 population (Table 12). The Nei’s genetic diversity (H) was highest (0.1291 ± 0.1964) in BDR-4 population and lowest (0.0762 ± 0.1611) in BDR-3 population in RAPD (Table 12). The Shannon’s information index (H´ or I) was highest (0.1897 ± 0.2802) in BDR-4 population and lowest (0.1130 ± 0.2322) in BDR-3 population (Table 12). Whereas, the measure of evenness (E) was highest (0.923179) in BDR-3 population; and lowest (0.897133) in BDR-4 population after RAPD analyses (Table 12). The Heip’s measure of evenness was highest (0.607581) in BDR-2 population and lowest (0.539581) in BDR-5 population (Table 12).

Page | 136

4.2.1.1.3 Jaldhaka River System Table 13. Intra-population genetic diversity indices based on RAPD analyses of Badis badis of Jaldhaka river system. RAPD Markers Diversity Indices Populations H´ Np Nper S H H´ or I E= e /S EHeip= (e H´-1/S-1) Jaldhaka River 1.3171 ± 0.1048 ± 0.1652 ± 0.895626 0.566474 51 36.17 % (BDR-8) 0.4811 0.1855 0.2788 Murti River 1.3972 ± 0.1378 ± 0.2052 ± 56 39.72 % 0.878736 0.573441 (BDR-9) 0.4911 0.1955 0.2791 Ghotia River 1.3471 ± 0.1068 ± 0.1756 ± 52 36.88 % 0.884835 0.553043 (BDR-10) 0.4656 0.1756 0.2588 Diana River 1.4326± 0.1436 ± 0.2150± 61 43.26 % 0.865463 0.554466 (BDR-11) 0.4972 0.1963 0.2794 Jaldhaka river 1.4965 ± 0.1471 0.2247± 70 49.65% 0.836583 0.507446 system 0.5018 ±0.5018 0.5018

Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index.

The RAPD analyses showed that the polymorphism varied across four populations of Badis badis from Jaldhaka river system (Table 13 and Figure 15C). The highest number of polymorphic loci (61) was observed in BDR-11 population and the percentages of polymorphism were found to be 43.26. The lowest number of polymorphic loci (51) was observed in BDR-8 population and the percentages of polymorphism were found to be 36.17. The observed number of alleles or allelic richness (S) varied from 1.3171 ± 0.4811 in BDR-8 population to 1.4326 ± 0.4972 in BDR-11 population (Table 13). The Nei’s genetic diversity (H) was highest (0.1436 ± 0.1963) in BDR-11 population and lowest (0.1048 ± 0.1855) in BDR-8 population (Table 13). The Shannon’s information index (H´ or I) was highest (0.2150 ± 0.2794) in BDR-11 population and lowest (0.1652 ± 0.2788) in BDR-8 population (Table 13). Whereas, the measure of evenness (E) was highest (0.895626) in BDR-8 population and lowest (0.865463) in BDR-11 population after RAPD analyses (Table 13). The Heip’s measure of evenness was highest (0.573441) in BDR-9 population and lowest (0.553043) in BDR-10 population (Table 13).

Page | 137

4.2.2 Findings based on ISSR based analyses 4.2.2.1 Intra-Population Genetic Diversity Study 4.2.2.1.1 Mahananda River System Table 14. Intra-population genetic diversity indices based on ISSR analyses of Badis badis of Mahananda-Balason river system. ISSR Markers Diversity Indices

Populations EHeip= S H´ H´ Np Nper H H´ or I E= e /S (e -1/ S-1) Mahananda Barrage, Fulbari 1.2931± 0.1024± 0.1534± 34 29.31% 0.910696 0.595911 (BTR-1) 0.4572 0.1751 0.2540 Mahananda-Panchanoi River 1.2328± 0.0806± 0.1204± Junction 27 23.28% 0.915118 0.573127 0.4244 0.1629 0.2354 (BTR-2) Balason River, Palpara, 1.2241± 0.0767± 0.1149± 26 22.41% 0.916037 0.567789 Matigara (BTR-3) 0.4188 0.1593 0.2305 Panchanoi River 1.2586± 0.0924± 0.1372± 30 25.86% 0.915876 0.586364 (BTR-4) 0.4398 0.1733 0.2493 Mahananda River, 1.259 ± 0.0959± 0.1428± 32 27.59% 0.912001 0.576637 Champasari (BTR-5) 0.4489 0.1749 0.2513 Balason River, Tarabari 1.3276± 0.1136± 0.1704± 38 32.76% 0.904902 0.600197 (BTR-6) 0.4714 0.1806 0.2619 1.3793 ± 0.1092± 0.1685± Mahananda river system 44 37.93% 0.4873 0.1718 0.2490 0.858064 0.48386

Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness,

EHeip= Heip’s evenness index.

In the ISSR-based analysis, the highest number of polymorphic loci in Badis badis from Mahananda-Balason river system was observed in BTR-6 population (38 numbers) and the percentage of polymorphism was 32.76 (Table 14 and Figure 15D). The lowest number of polymorphic loci was observed in BTR-3 population (26 numbers) and the percentage of polymorphism was 22.41. The observed number of alleles or allelic richness (S) varies from 1.2241 ± 0.4188 in BTR-3 population to 1.3276 ± 0.4714 in BTR-6 population (Table 14). The Nei’s genetic diversity (H) was highest (0.1136 ± 0.1806) in BTR-6 population and lowest (0.0767 ± 0.1593) in BTR-3 population (Table 14). The Shannon’s information index (H´ or I) was highest (0.1704 ± 0.2619) in BTR-6 population and lowest (0.1149 ± 0.230) in BTR-3 population (Table 14). However, the measure of evenness (E) was highest (0.916037) in BTR-3 population and lowest (0.904902) in BTR-6 population (Table 14). The Heip’s measure of evenness was highest (0.600197) in BTR-6 population and lowest (0.567789) in BTR-3 population (Table 14).

Page | 138

4.2.2.1.2 Teesta River System Table 15. Intra-population genetic diversity indices based on ISSR analyses of Badis badis of Teesta river system. ISSR Markers Diversity Indices Populations E =(e H´- N N S H H´ or I E= e H´/S Heip p per 1/S-1) Sevoke 1.3448 ± 0.1207 ± 0.1785 ± (Teesta River) 40 34.48% 0.888922 0.566772 0.4774 0.1924 0.2734 (BDR-1) Ghish River 1.2672 ± 0.0999 ± 0.1472 ± 31 26.72 % 0.914288 0.593509 (BDR-2) 0.4444 0.1793 0.2579 Gajoldoba (Teesta River 1.2155 ± 0.0726 ± 0.1071 ± 25 21.55% 0.917543 0.534914 Barrage) 0.4130 0.1549 0.2248 (BDR-3) Chel River 1.3448 ± 0.1242 ± 0.1838 ± 40 34.48% 0.893646 0.585196 (BDR-4) 0.4774 0.1917 0.2746 Neora River 1.2500 ± 0.0807 ± 0.1214 ± 29 25.00% 0.903261 0.516306 (BDR-5) 0.4349 0.1629 0.2342 Dharla River 1.2256 ± 0.0746 ± 0.1091 ± 26 22.41% 0.908164 0.501088 (BDR-6) 0.4211 0.1649 0.2028 Jalpaiguri (Teesta 1.2376 ± 0.0786 ± 0.1151 ± River) 27 23.27% 0.906582 0.513408 0.4111 0.1675 0.2228 (BDR-7) Teesta river 1.7586 ± 0.2406± 0.3639± 88 75.86% 0.818225 0.578606 system 0.4298 0.1929 0.2680 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness,

EHeip= Heip’s evenness index. The ISSR analyses in Badis badis from Teesta river showed that the diversity indices were varied across populations from BDR-1 to BDR-7 (Table 15 and Figure 15E). The highest number of polymorphic loci (40) was observed in BDR-1 and BDR-4 population, and the percentages of polymorphism were found to be 34.48. The lowest number of polymorphic loci (25) was observed in BDR-3 population and the percentages of polymorphism were found to be 21.55 in ISSR analyses. The observed number of alleles or allelic richness (S) varied from 1.2155 ± 0.4130 in BDR-3 population to 1.3448 ± 0.4774 in BDR-1 and BDR-4 populations (Table 15). The Nei’s genetic diversity (H) was highest (0.1242 ± 0.1917) in BDR-4 population and lowest (0.0726 ± 0.1549) in BDR-3 population (Table 15). The Shannon’s information index (H´ or I) was highest (0.1838 ±0.2746) in BDR-4 population and lowest (0.1071±0.2248) in BDR-3 population (Table 15). Whereas, the measure of evenness (E) was highest (0.917543) in BDR-3 population and lowest (0.888922) in BDR-1 population after ISSR analyses (Table 15). The Heip’s measure of evenness was highest (0.593509) in BDR-2 population and lowest (0.501088) in BDR-6 population (Table 15).

Page | 139

4.2.2.1.3 Jaldhaka River System Table 16. Intra-population genetic diversity indices based on ISSR analyses of Badis badis of Jaldhaka river system. ISSR Markers Diversity Indices Populations EHeip= H´ H´ Np Nper S H H´ or I E= e /S (e -1/ S-1) 1.3966 0.2017 Jaldhaka River 0.1348 ± 46 39.66% ± ± 0.876042 0.563492 (BDR-8) 0.1927 0.4913 0.2756 1.4138 Murti River 0.1453 ± 0.2169 ± 48 41.38% ± 0.878639 0.585355 (BDR-9) 0.1960 0.2810 0.4946 1.4052 Ghotia River 0.1374 ± 0.2049 ± 47 40.52% ± 0.873472 0.561212 (BDR-10) 0.1962 0.2789 0.4931 1.4224 Diana River 0.1409 ± 0.2109 ± 49 42.24% ± 0.868102 0.555845 (BDR-11) 0.1954 0.2785 0.4961 1.4828 Jaldhaka river 0.1455 ± 0.2219± 56 48.28% ± 0.841952 0.514595 system 0.1892 0.2706 0.5019 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index. The ISSR analyses Badis badis from Jaldhaka river showed that the polymorphism varied across four populations of Jaldhaka river system (Table 16 and Figure 15F). The highest number of polymorphic loci (49) was observed in BDR-11 population and the percentages of polymorphism were found to be 42.24 in ISSR analyses. The lowest number of polymorphic loci (46) was observed in BDR-8 population and the percentages of polymorphism were found to be 39.66. The observed number of alleles or allelic richness (S) varied from 1.3966 ±0.4913 in BDR-8 population to 1.4224 ±0.4961 in BDR-11 population by ISSR analyses (Table 16). The Nei’s genetic diversity (H) was highest (0.1409 ± 0.1954) in BDR-11 population and lowest (0.1348 ± 0.1927) in BDR-8 population (Table 16). The Shannon’s information index (H´ or I) was highest (0.2109 ± 0.2785) in BDR-11 population and lowest (0.2017 ± 0.2756) in BDR-8 population (Table 16). Whereas, the measure of evenness (E) was highest (0.878639) in BDR-9 population and lowest (0.868102) in BDR-11 population after ISSR analyses (Table 16). The Heip’s measure of evenness was highest (0.585355) in BDR-9 population and lowest (0.555845) in BDR-11 population (Table 16).

Page | 140

4.2.3 Findings based on RAPD + ISSR based analyses 4.2.3.1 Intra-Population Genetic Diversity Study 4.2.3.1.1 Mahananda River System Table 17. Intra-population genetic diversity indices based on RAPD+ISSR analyses of Badis badis of Mahananda-Balason river system. RAPD+ISSR Markers Diversity Indices Populations EHeip= H´ H´ Np Nper S H H´ or I E= e /S (e -1/ S-1) Mahananda Barrage, 1.2879± 0.1044± 0.1549± 74 28.79 % 0.906546 0.581942 Fulbari (BTR-1) 0.4537 0.1797 0.2589 Mahananda- 1.2412± 0.0857± 0.1273± Panchanoi River 62 24.12 % 0.915048 0.562843 0.4287 0.1676 0.2415 Junction (BTR-2) Balason River, 1.2335 ± 0.0821± 0.1223± Palpara, Matigara 60 23.35 % 0.916168 0.557144 0.4239 0.1645 0.2372 (BTR-3) Panchanoi River 1.2568± 0.0936± 0.1384± 66 25.68 % 0.913777 0.578017 (BTR-4) 0.4377 0.1748 0.2510 Mahananda River, 1.2724± 0.0973± 0.1442± Champasari 70 27.24 % 0.907824 0.569439 0.4460 0.1765 0.2534 (BTR-5) Balason River, 1.3230 ± 0.1172± 0.1739± 83 32.30 % 0.899423 0.588039 Tarabari (BTR-6) 0.4685 0.1861 0.2680 Mahananda river 1.3813 ± 0.1163 ± 0.1782± 98 38.13 % 0.865174 0.511577 system 0.4867 0.1755 0.2547 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index. Based on the RAPD+ISSR profile the number of polymorphic loci and the percentage of polymorphic loci vary across six populations (BTR-1 to BTR-6) in the Mahananda- Balason river system (Table 17). The highest number of polymorphic loci was observed in BTR-6 population (83 numbers) and the percentage of polymorphism was 32.30. The lowest number of polymorphic loci was observed in BTR-3 population (60 numbers) and the percentage of polymorphism was 23.35. The observed number of alleles or allelic richness (S) varies from 1.2335 ± 0.4239 in BTR-3 population to 1.3230 ± 0.4685 in BTR-6 population (Table 17). The Nei’s genetic diversity (H) was highest (0.1172 ± 0.1861) in BTR-6 population and lowest (0.0821 ± 0.1645) in BTR-3 population (Table 17). The Shannon’s information index (H´ or I) was highest (0.1739 ± 0.2680) in BTR-6 population and lowest (0.1223 ± 0.2372) in BTR-3 population (Table 17). However, the measure of evenness (E) was highest (0.916168) in BTR-3 population and lowest (0.899423) in BTR-6 population (Table 17). The Heip’s measure of evenness was highest (0.588039) in BTR-6 population and lowest (0.557144) in BTR-3 population (Table 17).

Page | 141

4.2.3.1.2 Teesta River System Table 18. Intra-population genetic diversity indices based on RAPD+ISSR analyses of Badis badis of Teesta river system. RAPD+ISSR Markers Diversity Indices Populations E =(e H´- N N S H H´ or I E= e H´/S Heip p per 1/S-1) Sevoke 34.24 1.3424± 0.1218± 0.1797± (Teesta River) 88 0.891581 0.574936 % 0.4754 0.1931 0.2745 (BDR-1) Ghish River 26.07 1.2607 ± 0.0991 ± 0.1456± 67 0.917533 0.601202 (BDR-2) % 0.4399 0.1793 0.2577 Gajoldoba 1.2179 (Teesta River 21.79 0.0765± 0.1140 ± 56 ± 0.920233 0.554163 Barrage) % 0.1600 0.2311 0.4136 (BDR-3) Chel River 34.63 1.3463 ± 0.1269± 0.1870± 89 0.895512 0.593784 (BDR-4) % 0.4767 0.1939 0.2772 Neora River 24.51 1.2451± 0.0814± 0.1219± 63 0.907269 0.528932 (BDR-5) % 0.4310 0.1640 0.2357 Dharla River 30.74 1.3074± 0.1144 ± 0.1685± 79 0.905253 0.597034 (BDR-6) % 0.4623 0.1880 0.2694 Jalpaiguri 26.46 1.2646 ± 0.0962± 0.1415 ± (Teesta River) 68 0.91096 0.574454 % 0.4420 0.1791 0.2554 (BDR-7) Teesta river 1.7977 ± 0.2700 ± 0.4047 ± 205 79.77 0.833761 0.625364 system 0.4025 0.1881 0.2599 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index. The RAPD+ISSR analyses of Badis badis from Teesta river showed that the diversity indices were varied across populations from BDR-1 to BDR-7 (Table 18). The highest number of polymorphic loci (89) was observed in BDR-4 population, and the percentages of polymorphism were found to be 34.63. The lowest number of polymorphic loci (56) was observed in BDR-3 population and the percentages of polymorphism were found to be 21.79 in RAPD+ISSR analyses. The observed number of alleles or allelic richness (S) varied from 1.2179 ± 0.4136 in BDR-3 population to 1.3463 ± 0.4767 in BDR-4 population (Table 18). The Nei’s genetic diversity (H) was highest (0.1269 ± 0.1939) in BDR-4 population and lowest (0.0765 ± 0.1600) in BDR-3 population (Table 18). The Shannon’s information index (H´ or I) was highest (0.1870 ± 0.2772) in BDR-4 population and lowest (0.1140 ± 0.2311) in BDR-3 population (Table 18). Whereas, the measure of evenness (E) was highest (0.920233) in BDR-3 population and lowest (0.891581) in BDR-1 population after RAPD+ISSR analyses (Table 18). The Heip’s measure of evenness was highest (0.601202) in BDR-2 population and lowest (0.528932) in BDR-5 population (Table 18).

Page | 142

4.2.3.1.3 Jaldhaka River System Table 19. Intra-population genetic diversity indices based on RAPD+ISSR analyses of Badis badis of Jaldhaka river system. RAPD+ISSR Markers Diversity Indices Populations EHeip= H´ H´ Np Nper S H H´ or I E= e /S (e -1/ S-1) Jaldhaka River 1.3969 ± 0.1364 0.2036 ± 102 39.69 % 0.87752 0.568929 (BDR-8) 0.4902 ±0.1939 0.2770 Murti River 1.4047± 0.1438 ± 0.2140± 104 40.47 % 0.88177 0.589629 (BDR-9) 0.4918 0.1962 0.2811 Ghotia River 1.4008± 0.1388± 0.2063± 103 40.08 % 0.877443 0.571661 (BDR-10) 0.4910 0.1972 0.2804 Diana River 1.4280 ± 0.1424 ± 0.2131± 110 42.80 % 0.866603 0.554926 (BDR-11) 0.4958 0.1955 0.2784 Jaldhaka river 1.4903 ± 0.1464 ± 0.2235 ± 126 49.03% 0.839056 0.510801 system 0.5009 0.1887 0.2698 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index.

The RAPD+ISSR analyses in Badis badis showed that the polymorphism varied across four populations of Jaldhaka river system. The highest number of polymorphic loci (110) was observed in BDR-11 population and the percentages of polymorphism were found to be 42.80. The lowest number of polymorphic loci (102) was observed in BDR-8 population and the percentages of polymorphism were found to be 39.69. The observed number of alleles or allelic richness (S) varied from 1.3969 ± 0.4902 in BDR-8 population to 1.4280 ± 0.4958 in BDR-11 population by RAPD+ISSR analyses (Table 19). The Nei’s genetic diversity (H) was highest (0.1424 ± 0.1955) in BDR-11 population and lowest (0.1364 ±0.1939) in BDR-8 population (Table 19). The Shannon’s information index (H´ or I) was highest (0.2131 ± 0.2784) in BDR-11 population and lowest (0.2036 ± 0.2770) in BDR-8 population (Table 19). Whereas, the measure of evenness (E) was highest (0.88177) in BDR-9 population and lowest (0.866603) in BDR-11 population after RAPD+ISSR analyses (Table 19). The Heip’s measure of evenness was highest (0.589629) in BDR-9 population and lowest (0.554926) in BDR-11 population (Table 19).

Page | 143

M BTR1 BTR2 BTR3 BTR4 BTR5 BTR6

M BDR1 BDR2 BDR3 BDR4 BDR5 BDR6 BDR7

M BDR8 BDR9 BDR10 BDR11

Page | 144 C

M BTR1 BTR2 BTR3 BTR4 BTR5 BTR6

M BDR1 BDR2 BDR3 BDR4 BDR5 BDR6 BDR7

M BDR8 BDR9 BDR10 BDR11

F Page | 145

Figure 15: Representative Gel of Badis badis after RAPD (1.4% agarose) and ISSR (1.8% agarose) amplification. RAPD primer OPA16 and ISSR primer ISSR02 primers are used for amplification.

M=100 base pair DNA size marker. A. RAPD gel of Mahananda River system; B. RAPD gel of Teesta river system; C. RAPD gel of Jaldhaka river system; D. ISSR gel of Mahananda River system; E. ISSR gel of Teesta river system; F. ISSR gel of Jaldhaka river system.

BTR1-BTR6 are the populations from Mahananda river system, BDR1-BDR7 are the populations of Teesta river system, BDR8-BDR11 are the populations of Jaldhaka river system. Each population consists of ten individuals. Each lane represents each individual’s RAPD and ISSR banding pattern.

Page | 146

4.2.4 Comparative discussion based on RAPD, ISSR and RAPD+ISSR based analyses

In the study carried out by Mishra et al. (2012) on Barilius barna species in Uttarakhand, India, eight RAPD primers generated total 35 bands of which 14 bands were polymorphic in nature. Maximum polymorphism (50.00%) was observed after amplification with OPB08 and OPB12 primer whereas minimum polymorphism (33.33%) was observed by OPA18, OPB15, OPB18, and OPH03 primers. We have also compared our data with other studies carried out with some other vulnerable species found in geographically related areas. The study carried out by Kader et al. (2013) on three Tilapia species (Oreochromis niloticus, Oreochromis aureus, and Tilapia zilli) in Egypt and by Chandra et al. (2010) on vulnerable Eutropiichthys vacha in India, 15 RAPD primers generated 201 and 45 polymorphic amplified fragments, respectively. In our study we have found total 124 fragments after amplification with ten RAPD decamer primers, out of which 111 fragments were polymorphic in Barilius barna (Paul et al. 2016). In a study carried out Astyanax fasciatus (Teleostei, Characidae), the amplification resulted in 59 RAPD loci showed 88.14% polymorphism. The ISSR amplifications resulted in being 91.43% polymorphism (Pazza et al., 2007). Liu et al., (2006) carried out a study by ISSR marker on Japanese Flounder (Paralichthys olivaceus), they have found total 36 number of polymorphic loci (33.92%) in common population, 27 number (28.15%) in susceptible population and 26 number (27.45%) in resistant population. Another study carried out by Liu et al., (2009) on Cynoglossus semilaevis using ISSR markers the number of bands, number of polymorphic bands and percentage of polymorphic bands varied from 113 to 137, from 47 to 62 and from 0.4159±0.08 to 0.4526±0.07 respectively. Liu et al., (2012) carried out a study on Botia superciliaris of Yangtze river where they found the polymorphic loci varied from 33 to 41. A study carried out on four Tilapia species of Egypt the number of polymorphic bands varied across different populations i.e. in Sarotherodon galilaeus= 27, Oreochromis niloticus =29, Oreochromis aureus=34 and Tilapia zillii=67) (Saad et al., 2012).

In the present study, I have found total 53 (Mahananda river system, Table 11), 116 (Teesta river system, Table 12) and 70 (Jaldhaka river system, Table 13) polymorphic fragments after RAPD amplification; 44 (Mahananda river system, Table 14), 88 (Teesta river system, Table 15) and 56 (Jaldhaka river system, Table 16) polymorphic fragments after ISSR amplification; and 98 (Mahananda river system, Table 17), 205 (Teesta river system,

Page | 147

Table 18), 116 (Jaldhaka river system, Table 19) polymorphic fragments after combining the RAPD and ISSR data. The total number of fragments and polymorphic fragments generated by ISSR amplifications were comparatively lower than that by RAPD primers. This might be because of lower number of priming sites of the ISSR primers or owing to the fact that ISSR primers bind to the genomic DNA comparatively specific site than that by the RAPD primers.

In a different study on Barilius barna isolated from Teesta river we have reported that the Nei’s genetic diversity ranged from 0.172 ± 0.189 to 0.293 ± 0.164 and the Shannon’s information index (I) ranged from 0.265 ± 0.268 to 0.445 ± 0.220 (Paul et al. 2016). In the study carried out on B. barna in Uttarakhand, India, Mishra et al. (2012) reported that the Nei’s genetic diversity of B. barna species was highest (0.4972) at the locus OPB18 while the lowest (0.1339) at the loci OPB12 and the mean value of gene diversity was found to be 0.1606. Mwanja et al. (2008) reported that the genetic diversity of Oreochromis niloticus in Africa ranges from lowest (0.14) to highest (0.27) values. Mishra et al. (2012) found that Shannon’s information index values for all the polymorphic loci in B. barna populations ranged from 0.2592 to 0.6904 with a mean value of 0.2331. Moreover, Kader et al. (2013) reported that the Shannon’s index was higher in Tilapia (0.363) population compared to two species of Oreochromis (0.318 and 0.347) populations. A study carried out by ISSR marker on Japanese Flounder (Paralichthys olivaceus) the Shannon index (I) in common population was 0.1431 which significantly higher than susceptible (0.1192) and resistant (0.1170) populations (P< 0.05) (Liu et al., 2006). Another study carried out by Liu et al., (2009) on Cynoglossus semilaevis using ISSR markers the average heterozygosity ranged from 0.0696±0.01 to 0.0814±0.02 and Shannon’s index ranged from 0.1089±0.02 to 0.1146±0.06. A study carried out by Liu et al., (2012) on Botia superciliaris of Yangtze river China, the heterozygosity and Shannon’s index varied from 0.1328 to 0.1572 and from 0.2069 to 0.2469 respectively. The range of Nei’s genetic diversity ranges from 0 to 1 (Nei 1973) and Shannon’s Information index ranges from 1.5 to 3.5 (Lewontin 1972).

In our present study we have found the Nei’s genetic diversity and Shannon’s information index were 0.1207±0.1789 and 0.1836±0.2600 (in Mahananda river system, Table 11), 0.2929±0.1825 and 0.4361± 0.2514 (in Teesta river system, Table 12), 0.1471±0.5018 and 0.2247±0.5018 (in Jaldhaka river system, Table 13) after RAPD analyses; 0.1092±0.1718 and 0.1685±0.2490 (in Mahananda river system, Table 14), 0.2406± 0.1929 and 0.3639±0.2680 (in Teesta river system, Table 15), 0.1455 ± 0.1892 and 0.2219±0.2706 (in Jaldhaka river system, Table 16) after ISSR analyses; 0.1163 ± 0.1755 and 0.1782±

Page | 148

0.2547 (in Mahananda river system, Table 17), 0.2700 ± 0.1881 and 0.4047 ± 0.2599 (in Teesta river system, Table 18), 0.1464 ± 0.1887 and 0.2235 ±0.2698 (in Jaldhaka river system, Table 19) after RAPD+ISSR analyses.

Therefore, in comparison with other studies, we have found that the genetic diversity was comparatively lower in three river system viz. Mahananda, Teesta and Jaldhaka of the study region. Although the genetic diversity Badis badis was low in the three main riverine system of the Terai and Dooars region of West Bengal but the Teesta population showed a high level of genetic diversity compared to other two river populations.

4.2.5. Comparison of genetic diversity between three river system populations of Badis badis.

The RAPD, ISSR and RAPD+ISSR based analyses showed that the Teesta river system has highest detectable polymorphic loci i.e. 116, 88 and 205 in number respectively (Table 12, 15, 18) in Badis badis. In contrast, the Mahananda river system showed lower number of polymorphic loci i.e., 53, 44 and 98 based on RAPD, ISSR and RAPD+ISSR analyses respectively (Table 11, 14, 17) in Badis badis. The observed number of alleles (S), Nei's gene diversity (H) and Shannon's Information index (H´ or I) showed highest values in the Teesta river system i.e., 1.8227 ± 0.3833, 0.2929 ± 0.1825 and 0.4361 ± 0.2514 respectively by RAPD analysis (Table 12 and Figure 16) in Badis badis ; 1.7586 ± 0.4298, 0.2406 ± 0.1929 and 0.3639 ± 0.2680 respectively by ISSR analysis (Table 15 and Figure 16); 1.7977 ± 0.4025, 0.2700 ± 0.1881 and 0.4047 ± 0.2599 respectively by RAPD + ISSR analyses (Table 18 and Figure 16); and lowest in the Mahananda river system i.e., 1.3759±0.4861, 0.1207±0.1789 and 0.1836±0.2600 respectively by RAPD analyses (Table 11 and Figure 16); 1.3793 ± 0.4873, 0.1092±0.1718 and 0.1685±0.2490 respectively by ISSR analyses (Table 14 and Figure 16); 1.3813 ± 0.4867, 0.1163 ± 0.1755 and 0.1782±0.2547 respectively by RAPD + ISSR analyses (Table 17 and Figure 16). The genetic diversity is comparatively high as evident from different diversity indices within the Badis population of Teesta river system, than found in the Mahananada and Jaldhaka river systems, after considering the whole river system as a unit. But when we considered the individual collection spot as a unit to measure the genetic diversity the indices showed higher value in case of Jaldhaka river system than Teesta river system. Whereas, the Mahananda river system

Page | 149 showed constantly lower values for all the diversity indices. This lower level of diversity in Mahananda river system is attributed to different anthropogenic pressures viz., high level of sand and pebbles excavation for building purpose, a large amount of urban and factory effluents wastes are deposited into the river, pesticide and toxic chemicals depositions. Whereas a high level of overall Teesta river system genetic diversity is found because of a number of tributaries joined with the Teesta river (Figure 14), and cause the overall diversity of Teesta river system to rise. But the individual collection spots showed low level of diversity because of high pesticide run-offs, fish catching practices and dam building. Whereas, the Jaldhaka river is relatively free from all those anthropogenic pressures as occurred in Mahananda and Teesta river system, therefore the individual collection spot’s genetic diversity was comparatively higher than other two river system.

Heip’s measure of evenness was used for better interpretation of the measure of evenness, since a population having higher diversity may have lower evenness or vice versa. It is expected that when Heip’s measure of evenness is low evenness is low. Smith and Wilson (1996) showed that the minimum value of Heip’s measure is 0 and that it registered 0.006 when an extremely uneven population structure is found. We have found that the Teesta river system was more even in genetic diversity distribution than other populations (Figure 16).

Page | 150

2 8

2 .

6 9

1.8 9

1 3

1.6 .

1 2

1.4 6 3

7 S

8 5

1.2 6

4 7

3 H

0 0

1 4

4 6

6 I

0 0

0.8 6

9 0

4 E

9 0

0.6 4

2 4

0 EHeip

2 .

0.4 1

. 0 0.2 0 0 Mahananda Teesta Jaldhaka

6 B

1 8

1.8 2

7 1

1.6 3

. 1

1.4

2 0

9 S 2

1.2 8

0 .

5 H 0

1 0

4 3

5 I

0.8 1

6 0

0.6 9 E

1 0

0.4 0 EHeip

. 0 0.2 0 0 Mahananda Teesta Jaldhaka

Page | 151

7 C

1 3

1.8 0

8 1

1.6 3

. 1

1.4

1 0

1.2 7 S

6 .

. H 0

1 3

1 0

0.8 . I

0 0

4 E 5

0.6 .

7 2

6 EHeip

4 0

0.4 1

. 0 0.2 0 0 Mahananda Teesta Jaldhaka

Figure 16: Comparison of genetic diversity between three river system populations of Badis badis by A. RAPD; B. ISSR and C. RAPD + ISSR based analyses. S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index.

Page | 152

4.2.6. Genetic relationship between populations of Badis badis:

Table 20. Matrix showing values of Nei's (1978) unbiased measures of genetic similarity (above diagonal) and genetic distances (below diagonal). The square boxes indicate the highest (blue box) and lowest (orange box) genetic similarity and genetic distance between two pair of population.

======pop ID BTR- 1 BTR- 2 BTR- 3 BTR- 4 BTR- 5 BTR- 6 BDR-1 BDR-2 BDR-3 BDR-4 BDR-5 BDR-6 BDR-7 BDR-8 BDR-9 BDR-10 BDR-11 ======BTR-1 **** 0.9590 0.9566 0.9569 0.9609 0.9511 0.7553 0.9439 0.9536 0.7677 0.7426 0.7151 0.7068 0.6230 0.6223 0.6325 0.6287 BTR-2 0.0419 **** 0.9957 0.9878 0.9953 0.9697 0.7737 0.9775 0.9884 0.7745 0.7423 0.7038 0.6871 0.6104 0.6098 0.6171 0.6193 BTR-3 0.0444 0.0043 **** 0.9837 0.9938 0.9710 0.7772 0.9837 0.9945 0.7777 0.7439 0.7066 0.6889 0.6026 0.6022 0.6101 0.6132 BTR-4 0.0440 0.0122 0.0164 **** 0.9887 0.9654 0.7787 0.9683 0.9786 0.7660 0.7463 0.7022 0.6909 0.6171 0.6155 0.6242 0.6251 BTR-5 0.0399 0.0047 0.0062 0.0114 **** 0.9732 0.7778 0.9789 0.9911 0.7777 0.7438 0.7095 0.6884 0.6133 0.6128 0.6207 0.6228 BTR-6 0.0502 0.0307 0.0294 0.0352 0.0272 **** 0.7704 0.9542 0.9669 0.7681 0.7307 0.7085 0.6947 0.6074 0.6062 0.6144 0.6141 BDR-1 0.2806 0.2566 0.2521 0.2502 0.2513 0.2608 **** 0.7754 0.7738 0.8382 0.8480 0.7443 0.7784 0.6712 0.6771 0.6758 0.6779 BDR-2 0.0577 0.0227 0.0164 0.0322 0.0213 0.0469 0.2544 **** 0.9882 0.7809 0.7372 0.7099 0.6909 0.6070 0.6075 0.6155 0.6210 BDR-3 0.0475 0.0117 0.0055 0.0216 0.0089 0.0337 0.2565 0.0118 **** 0.7829 0.7397 0.7029 0.6895 0.5927 0.5931 0.6011 0.6064 BDR-4 0.2644 0.2556 0.2515 0.2665 0.2514 0.2639 0.1765 0.2473 0.2447 **** 0.8611 0.8263 0.7915 0.7586 0.7584 0.7667 0.7613 BDR-5 0.2976 0.2981 0.2958 0.2926 0.2959 0.3137 0.1649 0.3049 0.3015 0.1495 **** 0.8057 0.8165 0.7204 0.7208 0.7254 0.7197 BDR-6 0.3353 0.3513 0.3473 0.3535 0.3432 0.3446 0.2953 0.3426 0.3526 0.1908 0.2160 **** 0.7457 0.6896 0.6912 0.6948 0.6923 BDR-7 0.3470 0.3753 0.3727 0.3697 0.3735 0.3642 0.2506 0.3697 0.3718 0.2338 0.2028 0.2935 **** 0.6315 0.6357 0.6349 0.6326 BDR-8 0.4732 0.4937 0.5066 0.4828 0.4890 0.4986 0.3987 0.4992 0.5231 0.2763 0.3280 0.3717 0.4597 **** 0.9959 0.9914 0.9873 BDR-9 0.4743 0.4946 0.5071 0.4853 0.4897 0.5005 0.3900 0.4983 0.5224 0.2765 0.3274 0.3694 0.4530 0.0041 **** 0.9898 0.9862 BDR-10 0.4580 0.4828 0.4941 0.4713 0.4769 0.4871 0.3918 0.4854 0.5090 0.2656 0.3210 0.3642 0.4543 0.0086 0.0102 **** 0.9933 BDR-11 0.4641 0.4792 0.4891 0.4698 0.4735 0.4876 0.3887 0.4764 0.5002 0.2727 0.3289 0.3678 0.4579 0.0128 0.0139 0.0068 **** ======

Page | 153

BTR-1

BTR-2

BTR-3

BTR-5

BDR-3

BTR-4

BDR-2

BTR-6

BDR-1

BDR-4

BDR-5

BDR-7

BDR-6

BDR-8

BDR-9

BDR-10

BDR-11

3.0

Figure 17. UPGMA dendrogram based on Nei’s (1978) unbiased genetic distance matrix. The Green and Brown square box indicates the clustering of Terai and Dooars region Badis badis populations. BDR-Badis badis from Dooars; BTR-Badis from Terai region. The shaded area represent two different clade i.e., blue portion represent Mahananada-Balasan river system and Teesta river system; pink portion represent the Jaldhaka river system.

Page | 154

Principal Coordinates (PCoA)

BDR-7

BDR-5

BDR-6 BDR-1 BDR-4

BTR-6 BDR-2 Coordinate 2 (20.45 (20.45 2 %) Coordinate BTR-2 BTR-1 BTR-5 BTR-4 BDR-3 BTR-3

BDR-10 BDR-9 BDR-11 BDR-8

Co-ordinate 1 (57.12 %)

Figure 18: Principal Component Analysis based on covariance matrix without data standardization of Badis badis populations of three river system based on RAPD and ISSR analyses. Blue, Brown and Green circles represent clustering of Mahananda, Teesta and Jaldhaka river populations. Coordinates 1 and 2 explain 48.97 % and 23.61 % of the variations respectively.

Page | 155

Based on the RAPD and ISSR analyses, the Nei’s genetic distance was highest between BDR-3 and BDR-8 populations (0.5231) and lowest between BDR-8 and BDR-9 population (0.0041) (Table 20). The genetic identity was highest between BDR-8 and BDR-9 (0.9959) and lowest between BDR-3 and BDR-8 populations (0.5927) (Table 17). The UPGMA-based dendrogram, based on the Nei’s unbiased genetic distance and identity matrix after RAPD and ISSR analyses, showed clear representation of genetic relationship of seventeen populations of Badis badis from the three major riverine systems (Mahananda, Teesta and Jaldhaka of the sub-Himalayan West Bengal. The dendrogram based on RAPD and ISSR analyses showed that the Mahananda and Teesta river populations (BTR-1 to BTR- 6 and BDR-1 to BDR-7) formed a distinct group from the remaining Jaldhaka river population (BDR-8 to BDR-11) (Figure 17). Moreover, BDR-2 and BDR-3 population of Dooars region formed cluster with Terai region populations group. The close association of Mahananda river population with the Teesta river population especially with the BDR-2 and BDR-3 population was mainly because of the connection of Mahananda riverine system with the Teesta river system by a water channel (Figure 14). The Mahananda river system has converged to the Fulbari Barrage (BTR-1 sample collection site) and this Barrage connects to the Teesta river system at the Teesta Barrage (BDR-3 sample collection site) via narrow channel (Figure 14). This channel causes admixture of Mahananda river population with the Teesta river population (Figure 17). The principal component analyses clearly showed the clustering of seventeen populations into distinct three groups; two groups for Mahananda and Teesta river populations and separate group for Jaldhaka river population (Figure 18). In this case also the two Teesta river population BRD-2 and BDR-3 form a close association with Mahananda river populations.

Page | 156

4.2.7 SHE Analyses

Table 21: SHE analyses based on RAPD + ISSR analyses. Population lnS H´ lnE Mahananda Barrage, Fulbari 0.253013 0.1044 -0.09811 (BTR-1) Mahananda-Panchanoi River 0.216079 0.0857 -0.08878 Junction (BTR-2) Balason River, Palpara, Matigara 0.209856 0.0821 -0.08756 (BTR-3) Panchanoi River (BTR-4) 0.228569 0.0936 -0.09017 Mahananda River, Champasari 0.240905 0.0973 -0.09670 (BTR-5) Balason River, Tarabari (BTR-6) 0.279902 0.1172 -0.10600 Sevoke (Teesta River), (BDR-1) 0.294459 0.1218 -0.11476 Ghish River, (BDR-2) 0.231667 0.0991 -0.08607 Gajoldoba (Teesta River Barrage), 0.197128 0.0765 -0.08313 (BDR-3) Chel River, (BDR-4) 0.297360 0.1269 -0.11036 Neora River, (BDR-5) 0.219216 0.0814 -0.09732 Dharla River, (BDR-6) 0.268040 0.1144 -0.09954 Jalpaiguri (Teesta River), (BDR-7) 0.234756 0.0962 -0.09326 Jaldhaka River, (BDR-8) 0.334255 0.1364 -0.13066 Murti River, (BDR-9) 0.339824 0.1438 -0.12582 Ghotia River, (BDR-10) 0.337044 0.1388 -0.13074 Diana River, (BDR-11) 0.356275 0.1424 -0.14317 [ lnS= natural logarithm of richness (allelic richness); H´= Shannon's Information index; lnE= natural logarithm of evenness]

Page | 157

0.3 0.3 0.25 0.25 0.2 0.2 0.15 0.15 0.1 0.1 0.05 0.05 BTR-6 BTR-3 BTR-1 BTR-4 BTR-2 BTR-1 0 0 -0.05 0 1 2 3 4 -0.05 0 1 2 3 4 -0.1 -0.1 -0.15 -0.15 A B

0.3 0.25 0.2 0.15 0.1 0.05 BTR-5 BTR-2 BTR-1 0 -0.05 0 1 2 3 4 -0.1 -0.15 C

Page | 158

0.35 0.3 0.3 0.25 0.25 0.2 0.2 0.15 0.15 0.1 0.1 0.05 0.05 BDR-1 BDR-3 BDR-7 BDR-2 BDR-3 BDR-7 0 0 0 1 2 3 4 -0.05 0 1 2 3 4 -0.05 -0.1 -0.1 -0.15 D -0.15 E

0.35 0.3 0.3 0.25 0.25 0.2 0.2 0.15 0.15 0.1 0.1 0.05 0.05 BDR-5 BDR-6 BDR-7 BDR-4 BDR-6 BDR-7 0 0 0 1 2 3 4 -0.05 0 1 2 3 4 -0.05 -0.1 -0.1 -0.15 F -0.15 G

Page | 159

0.4 0.4

0.3 0.3

0.2 0.2

0.1 0.1 BDR-11 BDR-8 BDR-10 BDR-8 0 0 0 1 2 3 4 0 1 2 3 4 -0.1 -0.1

-0.2 H -0.2 I

0.4

0.3

0.2

0.1 BDR-9 BDR-8 0 0 1 2 3 4 -0.1

-0.2 J

Figure 19: SHE analyses showing observed patterns of diversity changes of Badis badis in three the river system populations based on RAPD and ISSR markers. Plot A, B, C represents the Mahananda river system; Plot D, E, F, G represents Teesta river system and Plot H, I, J represents Jaldhaka river system. ( = lnS, =H´, = lnE )

SHE analyses revealed a clear distribution of three biodiversity components richness (S), diversity (H´) and evenness (E) of the Badis badis gene pool into seventeen different riverine populations of the Terai and Dooars regions. We found that the lnS and H´ components were highest in BDR-11 population (lnS=0.356275) and BDR-9 population (H´=0.1438) respectively and lowest in BDR-3 population (lnS=0.197128) and BDR-5 population (H´=0.0814) respectively (Table 21). The lnE value was highest in BDR-11 population (-0.14317) and lowest in BDR-3 population (-0.08313) (Table 21). The SHE analysis plot revealed the observed pattern for distribution of three components viz., S

Page | 160

(richness), H´ (Shannon's Information index) and E (evenness) in relation to seventeen different populations.

We had divided the seventeen riverine populations into ten groups according to the continuity of the water flow through the river from upstream to downstream viz., BTR-6, BTR-3 and BTR-1 constituting first group (Plot A); BTR-4, BTR-2 and BTR-1 constituting second group (Plot B); BTR-5, BTR-2 and BTR-1 constituting third group (Plot-C); BDR-1, BDR-3 and BDR-7 constituting fourth group (Plot-D); BDR-2, BDR-3 and BDR-7 constituting fifth group (Plot-E); BDR-4, BDR-6 and BDR-7 constituting sixth group (Plot- F); BDR-5, BDR-6 and BDR-7 constituting seventh group (Plot-G); BDR-11 and BDR-8 constituting eighth group (Plot-H); BDR-10 and ADR-8 constituting ninth group (Plot-I) and BDR-9 and BDR-8 constituting tenth group (Plot-J) (Figure 19).

We have found that as the river flows downward, in most of the cases the diversity has decreased but evenness increased (Plot- D, F, H); or diversity and evenness both increased (Plot-G); or diversity and evenness both decreased (Plot-J); or diversity increased and evenness decreased (Plot-A, B,C, E); or remain same (Plot-I) (Figure 19). This fluctuation in genetic diversity in attributed to different degree of anthropogenic and natural pressures that acted upon the river stream as the river flows downward. The Terai region river i.e. the Mahananada and Balasan river is heavily exploited for sand and pebbles excavation for concrete building purposes and nearby city and urban domestic and factory sewage runoffs are responsible most of the river pollution. This may cause the break in the diversity pattern of the Badis population in this river streams. Moreover, the major farming practices of the Dooars region is tea plantation, so the most of the foothills of this regions is utilized for tea plantation. Additionally this region has a perfect climatic and geographic infrastructure for tea farming. Therefore lots of pesticides are also used for developing better quality and quantity of tea. This causes a huge amount of pesticide run-off to the nearby rivers during the monsoon season. This may cause the fluctuation of the diversity of aquatic life including the studied ichthyofauna. Moreover, due to the construction of Dams for hydroelectric power project the course of the river is also changed and over fishing practices in the rivers also affects the genetic structure of the fishes. Finally as all the rivers are hill streams so an altitudinal variation of river flow may be an important factor that also affects the genetic diversity of the studied fishes.

Page | 161

4.2.8. Genetic Hierarchical Structure based on RAPD + ISSR analyses

BTR-4 BTR-5 BTR-6

BTR-3 BTR-2

Water flow

BTR-1

Mahananda River System (hypothetical map)

=Collection spots, = River streams AMOVA Hierarchic Source of variation between Among Within al FST Nm PhiPT populations population population Structure (p value) (%) (%) 0.118 1st Order BTR-6 # BTR-4 0.1281 3.4021 1.802(12) 13.528(88) (0.001) 11.983 -0.002 1st Order BTR-4 # BTR-5 0.0509 9.3287 0.000(0) (100) (0.497) 11.681 0.015 2nd Order BTR-4, BTR-5 # BTR-2 0.0582 8.0982 0.000(0) (100) (0.677) 0.104 3rd Order BTR-4, BTR-5, BTR-2 # BTR-1 0.1522 2.7856 1.416(10) 12.147(90) (0.001) 0.149 3rd Order BTR-6, BTR-3 # BTR-1 0.1934 2.0851 2.287(15) 13.380(85) (0.001) BTR-6, BTR-3, BTR-4, BTR-5, 0.088 4th Order 0.1685 2.4673 1.196(9) 12.387(91) BTR-2 # BTR-1 (0.001)

Page | 162

BDR-2 BDR-4 BDR-5 BDR-1

BDR-6 BDR-3

Water flow

BDR-7

Teesta River System (hypothetical map) =Collection spots, = River streams AMOVA Hierarchic Source of variation between Among Within al FST Nm PhiPT populations population populatio Structure (p value) (%) n (%) 0.643 1st Order BDR-1 # BDR-2 0.4749 0.5527 24.097(64) 13.480(36) (0.001) 0.635 1st Order BDR-2 # BDR-4 0.4625 0.5810 24.320(64) 13.950(36) (0.001) 0.543 1st Order BDR-4 # BDR-5 0.3744 0.8353 16.107(54) 13.533(46) (0.002) 0.566 2nd Order BDR-1, BDR-2 # BDR-3 0.4817 0.5380 15.785(57) 12.081(43) (0.001) 0.568 2nd Order BDR-4, BDR-5 # BDR-6 0.4833 0.5345 18.155(57) 13.819(43) (0.001) BDR-1, BDR-2, BDR-3 # BDR-4, 0.635 3rd Order 0.5980 0.3361 22.497(63) 12.950(37) BDR-5, BDR-6 (0.001) 0.672 4th Order BDR-1, BDR-2, BDR-3 # BDR-7 0.5987 0.3351 24.471(67) 11.964(33) (0.001) 0.613 4th Order BDR-4, BDR-5, BDR-6 # BDR-7 0.5521 0.4056 21.028(61) 13.267(39) (0.001) BDR-1, BDR-2, BDR-3, BDR-4, 0.655 5th Order 0.6210 0.3052 24.220(65) 12.759(35) BDR-5, BDR-6 # BDR-7 (0.001)

Page | 163

BDR-9 BDR-11 BDR-10

Water flow

BDR-8

Jaldhaka River System (hypothetical map)

=Collection spots, = River streams AMOVA Hierarchic Source of variation between Among Within al FST Nm PhiPT populations population population Structure (p value) (%) (%) -0.090 1st Order BDR-11 # BDR-10 0.0202 24.2831 0.000(0) 18.494(100) (1.000) -0.066 1st Order BDR-10 # BDR-9 0.0300 16.1782 0.000(0 18.700(100) (1.000) -0.081 2nd Order BDR-11, BDR-10 # BDR-8 0.0370 12.9981 0.000(0 18.489(100) (1.000) -0.092 2nd Order BDR-9 # BDR-8 0.0130 39.3991 0.000(0 18.800(100) (1000) BDR-11, BDR-10, BDR-9 # -0.079 3rd Order 0.0412 11.6381 0.000(0 18.647(100) BDR-8 (1.000)

Figure 20: Genetic hierarchical model of seventeen different populations of Badis badis based on RAPD + ISSR analyses. The populations are arranged in hierarchical orders as first, second, third, fourth, fifth order populations. FST = Population genetic differentiation, Nm= Estimated gene flow, AMOVA= Analysis of molecular variance, PhiPT= Estimated variance among population/( Estimated variance within population + Estimated variance among population), probability values based on 999 permutations. # indicates the comparison between populations or groups of populations.

Page | 164

The three river system has different natural hierarchical genetic-spatial structure. Therefore, we have divided the three river system into 1st to 4th order (for Mahananda river system), 1st to 5th order (for Teesta river system) and 1st to 3rd order (for Jaldhaka river system) hierarchy. This division helped us to compare the riverine Badis populations constituting the different order of hierarchy sophisticatedly (Figure 20).

In the Mahananda river system, the first order hierarchical group (between population

BTR-4 and BTR-5) showed lower value of genetic differentiation (FST = 0.0509) and higher value of gene flow (Nm = 9.3287) than other hierarchical population (Figure 20). The among population variance component and PhiPT value of first order hierarchical group (between population BTR-4 and BTR-5) were low i.e., 0.000 (0%) and -0.002 (p value = 0.497) respectively than other hierarchical population (Figure 20).

In the Teesta river system the first order hierarchical groups (between population

BDR-4 and BDR-5) showed lower value of genetic differentiation (FST = 0.3744) and higher value of gene flow (Nm = 0.8353) than other hierarchical orders of population (Figure 20). The among-population variance component and PhiPT value of the first order hierarchical groups were also lower i.e., 16.107 (54%) and 0.543 (p value = 0.002) than the other hierarchical orders of populations (Figure 20).

In Jaldhaka river system all three hierarchical groups i.e., first order, second order and third order showed very low genetic differentiation (FST =0.0202, 0.0300, 0.0370, 0.0125 and

0.0412); and high amount of gene flow (Nm =24.2831, 16.1782, 12.9981, 39.3991 and

11.6381) (Fig. 5). Although second order populations (ADR-9 and ADR-8) showed low FST and high gene flow among other hierarchical orders but the there was no among populations variance in any hierarchical orders and there was a significant negative PhiPT values in all hierarchical orders of Jaldhaka populations (Figure 20).

The most appropriate measure for genetic differentiation or divergence among subpopulation is the Fixation index or FST which ranges from 0 (when all subpopulations have equal allele frequencies) to 1 (when all the subpopulations are fixed for different alleles) (Allendorf et al., 2013). In our study we have detected a low to high (0.0130 to 0.6210) level of genetic differentiation (FST) across different populations of Badis badis in three river system in a hierarchical approach and the gene flow was ranged from low to high between different populations. Although a sufficient level of genetic admixture was carried out through narrow channels between different river populations because of the submergence of

Page | 165 the areas during monsoon season and some river streams are connected with man-made irrigation process. A high level of among population variance and genetic differentiation

(FST) was detected in the third order hierarchical population (consisting of populations BTR- 6, BTR-3 and BTR-1) of Mahananda river system (Figure 20) and fifth order hierarchical population (consisting of populations BDR-1, BDR-2, BDR-3, BDR-4, BDR-5, BDR-6 and BDR-7) of Teesta river system, which indicate that these hierarchical group are genetically and reproductively isolated and there was a irregular gene flow occurred (Figure 20). Whereas, in the Jaldhaka river system the observed among population variance was nil and very low amount of genetic differentiation with a high amount of gene flow indicates that the sub-populations of this river system is genetically analogous (Figure 20). The PhiPT is another population genetic statistical tool to detect the population differentiation; the results of PhiPT were also in accordance with the results of FST. Gene flow (Nm) is the most important determinant of the population structure, because it determines to which extent each local population of a species is an independent evolutionary unit (Slatkin, 1993). Therefore,

Nm provides the measures of the number of migrants per generation, also provides an indication of the differentiation among populations. A study carried out to analyze the genetic variability between wild and cultured Tilapia zilli species collected from New Bussa, Niger State through RAPD markers revealed that PhiPT values and data value for wild and cultured T. zilli were 0.302 and 0.001 respectively which shows significant variation among cultured and wild T. zilli (Yisa et al., 2016). Li et al., (2017) studied the genetic diversity of Hemibarbus maculates, a common and economically important species is widely distributed in the rivers and lakes of China through microsatellite marker. They have found the parameters of genetic differentiation among populations, pair-wise FST values, ranged from 0.001 to 0.214, while RST values ranged from

0.001 to 0.709. Pairwise comparisons of RST and FST values among populations reflected identical patterns of genetic differentiation among populations. Results of AMOVA analysis on wild and cultured populations showed that most variations within individuals explained total variance. AMOVA analysis revealed that 77.72% of the total variation was within individuals, 3.28% was among individuals within populations, and 12.81% was among groups (Li et al., 2017). A different study carried out by Garg et al., (2014) on Sperata seenghala from five different reservoirs (hadbada reservoir, Mohinisagar reservoir, Bansagar reservoir, Bargi reservoir and Gandhisagar reservoir) of India through RAPD revealed the estimated relative differentiation (GST) was 0.3993 and Estimate gene flow (Nm) was 0.7523 (Garg et al., 2014). Another study on Brycon hilarii is a migratory fish widely distributed

Page | 166 throughout the Paraguay River Basin, Sanches and Galetti (2007) reported that a significant genetic differentiation was found between populations (ST = 0.034; P < 0.0032). Of the total variation, 3.44% was attributed to interpopulation divergence and 96.56% to the individual differences within populations. A higher genetic differentiation between populations (ST = 0.108; P = 0.0002) was detected in the non-reproductive season and, in contrast to the spawning season, there was a considerable rise in the participation of interpopulation divergences in the total variation (10.81%) and a consequent reduction in intrapopulation variation (89.19%) (Sanches and Galetti, 2007).

Page | 167

4.2.9 mtCOI based findins of Badis badis

4.2.9.1 Amplification and Checking of amplified fragments

The COI gene was amplified with the specific primers from ten different individuals from Terai (three individuals) and Dooars region (seven individuals). After amplification I have found distinct sharp bands with approximately 647bp size. The Hind III digestion produced two distinct bands of approximately 250bp in size and 400bp in size. (Figure 21)

M 1 2 3 4 5 6 7 8 9 10

1000bp -----

650bp ------

500bp------

M 1 2 3 4 5 6 7 8 9 10

1000bp -----

400bp ------

250 bp------

Figure 21: A. Amplification of COI gene of Badis badis by specific primer. B. Hind III digestion of the amplified product. M= 100 base pair DNA sizer marker, Lane No. 1-10= Amplified product of COI gene of Badis badis.

Page | 168

4.2.9.2 Ten Cytochrome oxidase subunit 1 (COI) gene sequences of Badis badis and their NCBI Accession No.

Badis badis COI gene sequences

>DRBB1 (Accn. No. MF774665.1) AATTTTTGGTGCATGAGCCGGGATAGTAGGCACAGCCCTGAGCCTTCTTATTCGA GCCGAACTTAGTCAACCAGGAACCCTCTTAGGCGATGACCAAATTTATAATGTAA TCGTTACGGCACATGCTTTCGTGATAATTTTCTTTATAGTAATACCCATCATGATT GGAGGCTTTGGAAACTGACTGCTCCCGTTGATGATTGGCGCCCCCGATATAGCAT TTCCTCGAATAAACAACATAAGCTTTTGGCTTCTTCCCCCATCCTTCCTGCTTCTT TTGGCTTCTTCTGGAGTAGAAGCAGGAGCCGGAACCGGATGAACAGTATATCCG CCTTTGGCGGGCAATTTAGCGCACGCAGGTGCTTCCGTAGATCTAACCATCTTTT CCCTACACTTGGCAGGAGTATCTTCAATTTTAGGCTCAATCAATTTTATTACCACT ATTCTCAACATAAAACCCCCCGCGCTTTCCCAGTATCAAACCCCACTATTTGTCTG AGCCCTCCTGGTAACTACTGTTCTTCTTTTACTCTCGCTACCTGTTTTAGCCGCCG GCATTACAATACTTCTAACAGATCGAAACCTAAATACCTCCTTTTTTGACCCAGC CGGTGGTGGAGACCCTATTCTTTACCAACACCTGTTTT

>DRBB3 (Accn. No. MF774666.1) AATTTTTGGTGCATGAGCCGGGATAGTGGGTACAGCCCTGAGCCTTCTTATTCGA GCCGAACTTAGTCAACCAGGGACCCTTTTAGGCGATGACCAAATTTATAATGTAA TCGTTACGGCACATGCTTTCGTGATAATTTTCTTTATAGTAATACCCATCATGATT GGAGGCTTTGGAAACTGACTACTCCCGTTGATAATCGGCGCCCCCGATATAGCAT TTCCTCGAATAAACAACATAAGCTTTTGGCTACTTCCCCCATCCTTCCTGCTTCTT TTGGCTTCTTCTGGGGTAGAAGCAGGAGCCGGAACCGGGTGAACAGTATACCCG CCCTTGGCGGGCAATTTGGCGCATGCAGGTGCTTCCGTAGATCTAACCATCTTCT CCCTCCACTTGGCAGGAGTATCTTCAATTTTAGGTTCAATCAATTTCATTACCACC ATTCTAAACATAAAACCCCCCGCGCTTTCCCAGTATCAAACTCCTCTATTTGTCTG AGCCCTCCTGGTAACTACTGTTCTTCTTTTACTTTCTCTACCTGTCTTAGCCGCTGG CATCACAATGCTTCTAACAGATCGAAACCTAAATACCTCCTTTTTTGACCCAGCC GGTGGGGGAGATCCTATTCTTTACCAACACCTGTTTT

>DRBB6 (Accn. No. MF774667.1) AATTTTTGGTGCATGAGCCGGGATAGTAGGTACGGCCCTAAGCCTCCTAATTCGA GCCGAACTCAGTCAGCCAGGAACCCTCTTGGGTGATGATCAGATTTACAATGTAA TTGTTACGGCACACGCTTTTGTAATAATTTTCTTTATAGTAATACCCATCATGATC GGGGGGTTCGGAAACTGATTACTCCCACTAATAATCGGCGCCCCCGACATAGCAT TCCCTCGAATAAACAACATAAGCTTCTGACTCCTCCCCCCATCCTTTCTGCTTCTT CTGGCCTCTTCTGGGGTAGAAGCAGGTGCCGGAACCGGATGAACAGTATATCCC CCTTTAGCGGGTAATCTAGCACACGCAGGCGCATCCGTAGATCTAACCATCTTTT CCCTTCACTTAGCAGGGGTGTCTTCAATTTTGGGCTCTATTAATTTTATTACTACC ATCCTCAACATAAAACCCCCCGCACTCTCTCAGTATCAAACCCCGCTATTTGTTTG AGCCCTCCTGGTAACCACTGTTCTCCTCCTACTTTCCTTACCCGTGCTAGCCGCCG GTATTACAATGCTTCTAACAGATCGAAACCTAAATACCTCCTTTTTTGACCCAGC CGGTGGCGGAGACCCCATTCTTTACCAACACTTGTTTT

>DRBB7 (Accn. No. MF774668.1) AATTTTTGGTGCATGAGCCGGGATAGTAGGTACGGCCCTAAGCCTCCTAATTCGA GCCGAACTCAGTCAGCCAGGAACCCTCTTGGGTGATGATCAGATTTACAATGTAA

Page | 169

TTGTTACGGCACACGCTTTTGTAATAATTTTCTTTATAGTAATACCCATCATGATC GGGGGGTTCGGAAACTGATTACTCCCACTAATAATCGGCGCCCCCGACATAGCAT TCCCTCGAATAAACAACATAAGCTTCTGACTCCTCCCCCCATCCTTTCTGCTTCTT CTGGCCTCTTCTGGGGTAGAAGCAGGTGCCGGAACCGGATGAACAGTATATCCC CCTTTAGCGGGTAATCTAGCACACGCAGGCGCATCCGTAGATCTAACCATCTTTT CCCTTCACTTAGCAGGGGTGTCTTCAATTTTGGGCTCTATTAATTTTATTACTACC ATCCTCAACATAAAACCCCCCGCACTCTCTCAGTATCAAACCCCGCTATTTGTTTG AGCCCTCCTGGTAACCACTGTTCTCCTCCTACTTTCCTTACCCGTGCTAGCCGCCG GTATTACAATGCTTCTAACAGATCGAAACCTAAATACCTCCTTTTTTGACCCAGC CGGTGGCGGAGACCCCATTCTTTACCAACACTTGTTTT

>DRBB8 (Accn. No. MF774669.1) AATTTTTGGTGCATGAGCCGGGATAGTGGGTACAGCCCTGAGCCTTCTTATTCGA GCCGAACTTAGTCAACCAGGGACCCTTTTAGGCGATGACCAAATTTATAATGTAA TCGTTACGGCACATGCTTTCGTGATAATTTTCTTTATAGTAATACCCATCATGATT GGAGGCTTTGGAAACTGACTACTCCCGTTGATAATCGGCGCCCCCGATATAGCAT TTCCTCGAATAAACAACATAAGCTTTTGGCTACTTCCCCCATCCTTCCTGCTTCTT TTGGCTTCTTCTGGGGTAGAAGCAGGAGCCGGAACCGGGTGAACAGTATACCCG CCCTTGGCGGGCAATTTGGCGCATGCAGGTGCTTCCGTAGATCTAACCATCTTCT CCCTCCACTTGGCAGGAGTATCTTCAATTTTAGGTTCAATCAATTTCATTACCACC ATTCTAAACATAAAACCCCCCGCGCTTTCCCAGTATCAAACTCCTCTATTTGTCTG AGCCCTCCTGGTAACTACTGTTCTTCTTTTACTTTCTCTACCTGTCTTAGCCGCTGG CATCACAATGCTTCTAACAGATCGAAACCTAAATACCTCCTTTTTTGACCCAGCC GGTGGGGGAGATCCTATTCTTTACCAACACCTGTTTT

>DRBB9 (Accn. No. MF774670.1) AATTTTTGGTGCATGAGCCGGGATAGTGGGTACAGCCCTGAGCCTTCTTATTCGA GCCGAACTTAGTCAACCAGGGACCCTTTTAGGCGATGACCAAATTTATAATGTAA TCGTTACGGCACATGCTTTCGTGATAATTTTCTTTATAGTAATACCCATCATGATT GGAGGCTTTGGAAACTGACTACTCCCGTTGATAATCGGCGCCCCCGATATAGCAT TTCCTCGAATAAACAACATAAGCTTTTGGCTACTTCCCCCATCCTTCCTGCTTCTT TTGGCTTCTTCTGGGGTAGAAGCAGGAGCCGGAACCGGGTGAACAGTATACCCG CCCTTGGCGGGCAATTTGGCGCATGCAGGTGCTTCCGTAGATCTAACCATCTTCT CCCTCCACTTGGCAGGAGTATCTTCAATTTTAGGTTCAATCAATTTCATTACCACC ATTCTAAACATAAAACCCCCCGCGCTTTCCCAGTATCAAACTCCTCTATTTGTCTG AGCCCTCCTGGTAACTACTGTTCTTCTTTTACTTTCTCTACCTGTCTTAGCCGCTGG CATCACAATGCTTCTAACAGATCGAAACCTAAATACCTCCTTTTTTGACCCAGCC GGTGGGGGAGATCCTATTCTTTACCAACACCTGTTTT

>DRBB11 (Accn. No. MF774671.1) AATTTTTGGTGCATGAGCCGGGATAGTGGGTACAGCCCTGAGCCTTCTTATTCGA GCCGAACTTAGTCAACCAGGGACCCTTTTAGGCGATGACCAAATTTATAATGTAA TCGTTACGGCACATGCTTTCGTGATAATTTTCTTTATAGTAATACCCATCATGATT GGAGGCTTTGGAAACTGACTACTCCCGTTGATAATCGGCGCCCCCGATATAGCAT TTCCTCGAATAAACAACATAAGCTTTTGGCTACTTCCCCCATCCTTCCTGCTTCTT TTGGCTTCTTCTGGGGTAGAAGCAGGAGCCGGAACCGGGTGAACAGTATACCCG CCCTTGGCGGGCAATTTGGCGCATGCAGGTGCTTCCGTAGATCTAACCATCTTCT CCCTCCACTTGGCAGGAGTATCTTCAATTTTAGGTTCAATCAATTTCATTACCACC ATTCTAAACATAAAACCCCCCGCGCTTTCCCAGTATCAAACTCCTCTATTTGTCTG AGCCCTCCTGGTAACTACTGTTCTTCTTTTACTTTCTCTACCTGTCTTAGCCGCTGG

Page | 170

CATCACAATGCTTCTAACAGATCGAAACCTAAATACCTCCTTTTTTGACCCAGCC GGTGGGGGAGATCCTATTCTTTACCAACACCTGTTTT

>TRBB1 (Accn. No. MF774672.1) AATTTTTGGTGCATGAGCCGGGATAGTAGGTACGGCCCTAAGCCTCCTAATTCGA GCCGAACTCAGTCAGCCAGGAACCCTCTTGGGTGATGATCAGATTTACAATGTAA TTGTTACGGCACACGCTTTTGTAATAATTTTCTTTATAGTAATACCCATCATGATC GGGGGGTTCGGAAACTGATTACTCCCACTAATAATCGGCGCCCCCGACATAGCAT TCCCTCGAATAAACAACATAAGCTTCTGACTCCTCCCCCCATCCTTTCTGCTTCTT CTGGCCTCTTCTGGGGTAGAAGCAGGTGCCGGAACCGGATGAACAGTATATCCC CCTTTAGCGGGTAATCTAGCACACGCAGGCGCATCCGTAGATCTAACCATCTTTT CCCTTCACTTAGCAGGGGTGTCTTCAATTTTGGGCTCTATTAATTTTATTACTACC ATCCTCAACATAAAACCCCCCGCACTCTCTCAGTATCAAACCCCGCTATTTGTTTG AGCCCTCCTGGTAACCACTGTTCTCCTCCTACTTTCCTTACCCGTGCTAGCCGCCG GTATTACAATGCTTCTAACAGATCGAAACCTAAATACCTCCTTTTTTGACCCAGC CGGTGGCGGAGACCCCATTCTTTACCAACACTTGTTTT

>TRBB5 (Accn. No. MF774673.1) AATTTTTGGTGCATGAGCCGGGATAGTAGGCACAGCCCTGAGCCTTCTTATTCGA GCCGAACTTAGTCAACCAGGAACCCTCTTAGGCGATGACCAAATTTATAATGTAA TCGTTACGGCACATGCTTTCGTGATAATTTTCTTTATAGTAATACCCATCATGATT GGAGGCTTTGGAAACTGACTGCTCCCGTTGATGATTGGCGCCCCCGATATAGCAT TTCCTCGAATAAACAACATAAGCTTTTGGCTTCTTCCCCCATCCTTCCTGCTTCTT TTGGCTTCTTCTGGAGTAGAAGCAGGAGCCGGAACCGGATGAACAGTATATCCG CCTTTGGCGGGCAATTTAGCGCACGCAGGTGCTTCCGTAGATCTAACCATCTTTT CCCTACACTTGGCAGGAGTATCTTCAATTTTAGGCTCAATCAATTTTATTACCACT ATTCTCAACATAAAACCCCCCGCGCTTTCCCAGTATCAAACCCCACTATTTGTCTG AGCCCTCCTGGTAACTACTGTTCTTCTTTTACTCTCGCTACCTGTTTTAGCCGCCG GCATTACAATACTTCTAACAGATCGAAACCTAAATACCTCCTTTTTTGACCCAGC CGGTGGTGGAGACCCTATTCTTTACCAACACCTGTTTT

>TRBB6 (Accn. No. MF774674.1) AATTTTTGGTGCATGAGCCGGGATAGTAGGCACAGCCCTGAGCCTTCTTATTCGA GCCGAACTTAGTCAACCAGGAACCCTCTTAGGCGATGACCAAATTTATAATGTAA TCGTTACGGCACATGCTTTCGTGATAATTTTCTTTATAGTAATACCCATCATGATT GGAGGCTTTGGAAACTGACTGCTCCCGTTGATGATTGGCGCCCCCGATATAGCAT TTCCTCGAATAAACAACATAAGCTTTTGGCTTCTTCCCCCATCCTTCCTGCTTCTT TTGGCTTCTTCTGGAGTAGAAGCAGGAGCCGGAACCGGATGAACAGTATATCCG CCTTTGGCGGGCAATTTAGCGCACGCAGGTGCTTCCGTAGATCTAACCATCTTTT CCCTACACTTGGCAGGAGTATCTTCAATTTTAGGCTCAATCAATTTTATTACCACT ATTCTCAACATAAAACCCCCCGCGCTTTCCCAGTATCAAACCCCACTATTTGTCTG AGCCCTCCTGGTAACTACTGTTCTTCTTTTACTCTCGCTACCTGTTTTAGCCGCCG GCATTACAATACTTCTAACAGATCGAAACCTAAATACCTCCTTTTTTGACCCAGC CGGTGGTGGAGACCCTATTCTTTACCAACACCTGTTTT

Page | 171

Table 22: Population genetic diversity parameters based on Badis badis mtDNA COI partial coding sequences.

No. of Haplotype Nucleotide diversity Avg. No. of Total No. of No. of variable (gene) nucleotide Populations mutations Haplotypes (Pi±SD) Tajima’s D Fu and Li’s D Fu and Li’s F sites (S) diversity differences (Eta) (h) (Hd±SD) (k) 0.667± 0.07728± Terai Region 75 75 2 50.00000 - 0.314 0.03643 0.72029 1.17998 (Not 1.19329 (Not Dooars 0.667± 0.06874± (Not 91 97 3 44.47619 significant, P significant, P region significant, P 0.160 0.01888 > 0.10) > 0.10) > 0.10) Sub- 1.56646 (Not 1.65454 1.84497 Himalayan 0.733± 0.06976± 91 97 3 45.13333 significant, P (significant P (significant P region (Terai 0.076 0.01217 > 0.10) < 0.02) < 0.02) + Dooars)

North India 0.893± 0.00324± 0.33640 (Not 0.12651 (Not 0.19295 (Not 5 5 5 2.07143 significant, P significant, P significant, P 0.086 0.00081 > 0.10) > 0.10) > 0.10) -1.90732 -2.33549 -2.51827 N-E India 95 95 5 0.756±0.130 0.03713±0.02396 20.644 (significant P (significant P (significant P

< 0.05) < 0.02) < 0.02) South India 23 23 3 1.000±0.272 0.02518±0.01136 15.33333 - * COI, Cytochrome oxidase subunit I; SD, standard deviation; Four or more sequences are need to compute Tajima's and Fu and Li's statistics (Terai and South India population have three sequences each).

Page | 172

4.2.9.3 Genetic diversity and population structure of Badis badis: The mtDNA-based genetic diversity analysis was carried out to determine the available genetic diversity in the mitochondrial COI partial CDS of Badis badis of the Mahananda, Teesta and Jaldhaka river system of the Terai and Dooars region of sub- Himalayan West Bengal, India using DnaSP software. The total number of variable sites were 75 and 91 in Terai and Dooars region respectively, and 91 when two regions were considered together i.e., sub-Himalayan region (Table 22). Total numbers of mutations were 75 and 97 in Terai and Dooars region populations respectively (Table 22). Total 3 haplotypes were found in the sub-Himalayan Terai and Dooars region population (Terai region=2 haplotypes and Dooars region=3 haplotypes). Total number of variable sites, mutations and haplotypes in north Indian populations were 5, 5 and 5 ; in north-eastern Indian population were 95, 95 and 5; and south Indian population were 23, 23 and 3 respectively (Table 22). The haplotype diversity and nucleotide diversity of Terai region population were 0.667±0.314 and 0.07728±0.03643; Dooars region populations were 0.667±0.160 and 0.06874±0.01888; and 0.733±0.076 and 0.06976±0.01217 in sub-Himalayan region respectively (Table 22). The haplotype diversity and nucleotide diversity of north Indian, north-eastern Indian and south Indian population were shown in Table 22. The mitochondrial DNA COI gene sequences are highly polymorphic in nature, as reported in many genetic studies of geographically isolated populations of different organisms. In the study of 616 bp COI gene sequences of the Japanese anchovy Engraulis japonicus sampled from the Yellow Sea and East China Sea, Yu et al. (2005) found that 32 haplotypes in 44 specimens and 47 nucleotide positions were variable. Another study by Worheide (2006) reported 3 haplotypes from 55 specimens and 48 polymorphic sites in an analysis of the 479 bp COI genes in Astrosclera willeyana populations collected from the Red Sea to the central Pacific. Inoue et al. (2007) reported that the haplotype diversity was 0.923 ± 0.012 and nucleotide diversity was 0.0090 ± 0.0048 for Panulirus japonicus collected from three locations in Japan. In a study carried out by Thirumaraiselvi et al. (2015) on 614 bp of mtCOI gene of Eleutheronema tetradactylum from south Asian countries, the authors found a total of 18 haplotypes from 30 sequences where, South China population had the lowest number (one) of haplotype and the lowest genetic diversity (haplotype diversity = 0.00±0.000, nucleotide diversity = 0.00000±0.00000), and the Bay of Bengal population showed the highest values for all the indices (number of haplotypes = 6, haplotype diversity = 0.952±0.096, nucleotide diversity =0.01536±0.00312). Therefore, our present study reveals that the genetic diversity (number of haplotypes, haplotype diversity and nucleotide diversity) is diminishing in Badis

Page | 173 badis population as evident from the mitochondrial COI study. The present mtDNA based result is also in accordance with the study on Badis badis, where we have found that the overall genetic diversity (polymorphism, Nei’s genetic diversity and Shannon’s information index) was low as revealed by RAPD and ISSR marker analyses (see Tables 22 and 11 to 19). The observed values of Tajima’s D, Fu and Li’s D and Fu and Li’s F analyses of Dooars region were 0.72029 (Not significant, P > 0.10), 1.17998 (Not significant, P > 0.10) and 1.19329 (Not significant, P > 0.10); and sub-Himalayan region population were 1.56646 (Not significant, P > 0.10), 1.65454 (significant P < 0.02) and 1.84497 (significant P < 0.02) respectively (Table 22). The observed values of Tajima’s D, Fu and Li’s D and Fu and Li’s F analyses of north Indian and north-eastern Indian and south Indian population were shown in Table 22. Tests for neutral evolution were performed to ascertain the evidence of purifying or balancing selections. Both the population i.e., Terai and Dooars gave positive values for Tajima’s D, Fu and Li’s D and Fu and Li’s F test, which indicated that the population showed balancing selection and sudden population contraction. (Tajima 1989; Fu and Li 1993).

Page | 174

4.2.9.4 Phylogenetic relationship of different populations of Badis badis based on mtDNA COI gene.

Page | 175

Figure 22. Molecular Phylogenetic analysis of Badis badis by Maximum Likelihood method. The evolutionary history was inferred by using the Maximum Likelihood method based on the Kimura 2- parameter model (Kimura, 1980). The tree with the highest log likelihood (-1764.8487) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, parameter = 0.4967)). The rate variation model allowed for some sites to be evolutionarily invariable ([+I], 36.5108% sites). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 35 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 556 positions in the final dataset. Evolutionary analyses were conducted in MEGA7 (Kumar et. al., 2016). TRBB-Terai region Badis badis; DRBB-Dooars region Badis badis.

The maximum likelyhood method of phylogenetic analysis showed that four taxa (DRBB3, DRBB8, DRBB9 and DRBB11) from Dooars region form a distinct group, and another group formed by DRBB1, TRBB5 and TRBB6 (Figure 22). Moreover DRBB6, DRBB7 and TRBB1 form a cluster with the north Indian Badis populations (Figure 22). The DRBB1 from Dooars region show a close relation with TRBB5 and TRBB6, this is due to the connection of Dooars region rivers with that of Terai region through narrow man-made canals. Moreover during monsoon season the submergence of nearby river banks cause intermixing of different river populations. This population indicate a significant level of gene flow between the Terai and Dooars region. Interestingly, the phylogenetic analysis showed that a close association exist between the Badis population of Ganges and Yamuna rivers, Uttarakhand with that of few individual of sub-Himalayan Terai and Dooars region (TRBB1, DRBB6 and DRBB7) West Bengal. This phylogenetic association may be attributed to accidental or intentional introduction of some Badis badis species from sub-Himalayan region to Ganga and Yamuna river of Uttarakhand or vice-versa in the past.

Page | 176

4.3 Genetic diversity study of Amblyceps mangois

A detailed survey has been carried out in the Mahananda (Terai region), Teesta and Jaldhaka (Dooars region) river system for the collection of Amblyceps mangois samples. Total seventeen spots were selected for collection purpose (Figure 23; Table 2). Out of seventeen collection spots, the samples finally collected from thirteen spots because of the unavailability of the particular species on the remaining locations. The catch frequency was very low. It takes 3-4hours to collect about 8-10 samples from each collection site with the help of scoop net. The thirteen collection spots were as follows, viz., Mahananda Barrage, Fulbari (ATR-1), Mahananda River, Champasari (ATR-2), Balason River, Tarabari (ATR-3) from Mahananda river system; Sevoke (ADR-1), Ghish river (ADR-2), Gajoldoba-Teesta Barrage (ADR-3), Chel river (ADR-4), Neora river (ADR-5), Dharla river (ADR-6), Jalpaiguri (ADR-7) from Teesta river system; and Jaldhaka River (ADR-8), Murti River (ADR-9), Ghotia River (ADR-10), Diana River (ADR-11) from Jaldhaka river system. See the map below for detail:

Figure 23. Amblyceps mangois collection sites. Also refer to Table 2 for the geographic coordinates of the collection spots for Amblyceps mangois.

Page | 177

4.3.1 RAPD based analyses 4.3.1.1 Intra-Population Genetic Diversity Study 4.3.1.1.1 Mahananda River System

Table 23. Intra-population genetic diversity indices based on RAPD analyses of Amblyceps mangois of Mahananda-Balason river system. RAPD Markers Diversity Indices

Populations E = N N S H H´ or I E= e H´/S Heip p per (e H´-1/ S-1) Mahananda 1.3050± 0.1159± 0.1701± Barrage, Fulbari 43 30.50% 0.90837 0.607946 0.4620 0.1899 0.2718 (ATR-1) Mahananda River, 1.2837± 0.1052± 0.1549± Champasari 40 28.37% 0.909513 0.590558 0.4524 0.1837 0.2629 (ATR-2) Balason River, 1.3404± 0.1290± 0.1896± Tarabari 48 34.04% 0.901795 0.613296 0.4755 0.1954 0.2798 (ATR-3) Mahananda 1.4043± 0.1485± 0.2200± 57 40.43% 0.887329 0.608649 River System 0.4925 0.1988 0.2853 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index. Based on the RAPD profile the number of polymorphic loci and the percentage of polymorphic loci in Amblyceps mangois of Mahananda-Balason rivers vary across three populations (ATR-1 to ATR-3) (Table 23; Figure 24A). The highest number of polymorphic loci was observed in ATR-3 population (48 numbers) and the percentage of polymorphism was 34.04. The lowest number of polymorphic loci was observed in ATR-2 population (40 numbers) and the percentage of polymorphism was 28.37. The observed number of alleles or allelic richness (S) varies from 1.2837 ± 0.4524 in ATR-2 population to 1.3404 ± 0.4755 in ATR-3 population (Table 23). The Nei’s genetic diversity (H) was highest (0.1290 ± 0.1954) in ATR-3 population and lowest (0.1052 ± 0.1837) in ATR-2 population (Table 23). The Shannon’s information index (H´ or I) was highest (0.1896±0.2798) in ATR-3 population and lowest (0.1549 ± 0.2629) in ATR-2 population (Table 23). However, the measure of evenness (E) was highest (0.909513) in ATR-2 population and lowest (0.901795) in ATR-3 population (Table 23). The Heip’s measure of evenness was highest (0.613296) in ATR-3 population and lowest (0.590558) in ATR-2 population (Table 23).

Page | 178

4.3.1.1.2 Teesta River System Table 24. Intra-population genetic diversity indices based on RAPD analyses of Amblyceps mangois of Teesta river system. RAPD Markers Populations Diversity Indices E =(e N N S H H´ or I E= e H´/S Heip p per H´-1/S-1) Sevoke 1.3404± 0.1224± 0.1802± (Teesta River) 48 34.04% 0.893358 0.580073 0.4755 0.1944 0.2761 (ADR-1) Ghish River 1.2695± 1.1050± 0.1535± 38 26.95% 0.918399 0.615613 (ADR-2) 0.4453 0.1848 0.2648 Gajoldoba (Teesta River 1.2340± 0.0861± 0.1271± 33 23.40% 0.920203 0.579190 Barrage) 0.4249 0.1704 0.2447 (ADR-3) Chel River 1.2411± 0.0884± 0.1308± 34 24.11% 0.91833 0.579593 (ADR-4) 0.4293 0.1710 0.2460 Neora River 1.2553± 0.08070± 0.1299± 36 25.53% 0.907125 0.543339 (ADR-5) 0.4376 0.1685 0.2425 Dharla River 1.3546± 0.1326± 0.1946± 50 35.46% 0.896815 0.605823 (ADR-6) 0.4801 0.1984 0.2829 Jalpaiguri (Teesta 1.2553± 0.0998± 0.1448± River) 36 25.53% 0.920743 0.610295 0.4376 0.1855 0.2634 (ADR-7) Teesta River 1.8369± 0.2991± 0.4457± 118 83.69% 0.850119 0.671028 System 0.3708 0.1780 0.2441 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index. Based on the RAPD profile the number of polymorphic loci and the percentage of polymorphic loci in Amblyceps mangois of Teesta river vary across three populations (ADR- 1 to ADR-7) (Table 24; Figure 24B). The highest number of polymorphic loci was observed in ADR-6 population (50 numbers) and the percentage of polymorphism was 35.46. The lowest number of polymorphic loci was observed in ADR-3 population (33 numbers) and the percentage of polymorphism was 23.40. The observed number of alleles or allelic richness (S) varies from 1.2340±0.4249 in ADR-3 population to 1.3546 ± 0.4801 in ADR-6 population (Table 24). The Nei’s genetic diversity (H) was highest (0.1326 ± 0.1984) in ADR-6 population and lowest (0.0861±0.1704) in ADR-3 population (Table 24). The Shannon’s information index (H´ or I) was highest (0.1946 ± 0.2829) in ADR-6 population and lowest (0.1271 ± 0.2447) in ADR-3 population (Table 24). However, the measure of evenness (E) was highest (0.920743) in ADR-7 population and lowest (0.893358) in ADR-1 population (Table 24). The Heip’s measure of evenness was highest (0.615613) in ADR-2 population and lowest (0.579190) in ADR-3 population (Table 24).

Page | 179

4.3.1.1.3 Jaldhaka River System

Table 25. Intra-population genetic diversity indices based on RAPD analyses of Amblyceps mangois of Jaldhaka river system. RAPD Markers Diversity Indices Populations E = E= e Heip N N S H H´ or I (e H´-1/ p per H´/S S-1) Jaldhaka 1.3972± 0.1378± 0.2052± River 56 39.72% 0.878736 0.573441 0.4911 0.1955 0.2791 (ADR-8) Murti River 1.3992± 0.1426± 0.2117± 57 40.72% 0.884467 0.593598 (ADR-9) 0.4927 0.1972 0.2822 Ghotia River 1.4032± 0.1430± 0.2075± 58 40.79% 0.88076 0.580558 (ADR-10) 0.4952 0.1987 0.2856 Diana River 1.4326± 0.1436± 0.2150± 61 43.26% 0.865463 0.554466 (ADR-11) 0.4972 0.1963 0.2794 Jaldhaka 1.4965± 0.1471± 0.2247± River 70 49.65% 0.836583 0.507446 0.5018 0.1891 0.2701 System Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index. Based on the RAPD profile the number of polymorphic loci and the percentage of polymorphic loci in Amblyceps mangois of Jaldhaka river vary across three populations (ADR-8 to ADR-11) (Table 25; Figure 24C). The highest number of polymorphic loci was observed in ADR-11 population (61 numbers) and the percentage of polymorphism was 43.26. The lowest number of polymorphic loci was observed in ADR-8 population (56 numbers) and the percentage of polymorphism was 39.72. The observed number of alleles or allelic richness (S) varies from 1.3972±0.4911 in ADR-8 population to in 1.4326 ± 0.4972 ADR-11 population (Table 25). The Nei’s genetic diversity (H) was highest (0.1436 ± 0.1963) in ADR-11 population and lowest (0.1378 ± 0.1955) in ADR-8 population (Table 25). The Shannon’s information index (H´ or I) was highest (0.2150 ± 0.2794) in ADR-11 population and lowest (0.2052 ± 0.2791) in ADR-8 population (Table 25). However, the measure of evenness (E) was highest (0.884467) in ADR-9 population and lowest (0.865463) in ADR-11 population (Table 25). The Heip’s measure of evenness was highest (0.593598) in ADR-9 population and lowest (0.554466) in ADR-11 population (Table 25).

Page | 180

4.3.2 ISSR based analyses 4.3.2.1 Intra-Population Genetic Diversity Study 4.3.2.1.1 Mahananda River System Table 26. Intra-population genetic diversity indices based on ISSR analyses of Amblyceps mangois of Mahananda-Balason river system. ISSR Markers Diversity Indices Populations EHeip= H´ H´ Np Nper S H H´ or I E= e /S (e -1/ S-1) Mahananda Barrage, 1.3043± 0.1055± 0.1580± 28 30.43% 0.897927 0.562492 Fulbari 0.4627 0.1775 0.2568 (ATR-1) Mahananda River, 1.2826± 0.0992± 0.1474± 26 28.26% 0.903491 0.561987 Champasari 0.4527 0.1783 0.2554 (ATR-2) Balason River, 1.3370± 0.1186± 0.1773± Tarabari 31 33.70% 0.893036 0.575636 0.4753 0.1844 0.2667 (ATR-3)

1.3913± 0.1239± 0.1891± Mahananda 36 39.13% 0.868369 0.531975 0.4907 0.1794 0.2609 River System Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index. The highest number of polymorphic loci in Amblyceps mangois of Mahananda- Balason rivers was observed in ATR-3 population (31 numbers) and the percentage of polymorphism was 33.70. The lowest number of polymorphic loci was observed in ATR-2 population (26 numbers) and the percentage of polymorphism was 28.26 (Table 26, Figure 24D). The observed number of alleles or allelic richness (S) varies from 1.2826 ± 0.4527 in ATR-2 population to 1.3370±0.4753 in ATR-3 population (Table 26; Figure 24D). The Nei’s genetic diversity (H) was highest (0.1186 ± 0.1844) in ATR-3 population and lowest (0.0992 ± 0.1783) in ATR-2 population (Table 26). The Shannon’s information index (H´ or I) was highest (0.1773 ± 0.2667) in ATR-3 population and lowest (0.1474 ± 0.2554) in ATR-2 population (Table 26). However, the measure of evenness (E) was highest (0.903491) in ATR-2 population and lowest (0.893036) in ATR-3 population (Table 26). The Heip’s measure of evenness was highest (0.575636) in ATR-3 population and lowest (0.561987) in ATR-2 population (Table 26).

Page | 181

4.3.2.1.2 Teesta River System Table 27. Intra-population genetic diversity indices based on ISSR analyses of Amblyceps mangois of Teesta river system. ISSR Markers Diversity Indices Populations EHeip=(e H´ H´ Np Nper S H H´ or I E= e /S -1/ S-1) Sevoke 1.3804± 0.1382± 0.2035± (Teesta River) 35 38.08% 0.88792 0.593284 0.4882 0.2009 0.2855 (ADR-1) Ghish River 1.2500± 0.0978± 0.1433± 23 25% 0.923261 0.616304 (ADR-2) 0.4354 0.1795 0.2583 Gajoldoba (Teesta River 1.2065± 0.0699± 0.1048± 19 20.65% 0.920421 0.535053 Barrage) 0.4070 0.1533 0.2221 (ADR-3) Chel River 1.3261± 0.1148± 0.1700± 30 32.61% 0.893828 0.568245 (ADR-4) 0.4713 0.1880 0.2688 Neora River 1.2391± 0.0774± 0.1164± 22 23.91% 0.906662 0.516291 (ADR-5) 0.4289 0.1602 0.2307 Dharla River 1.4130± 0.1551± 0.2271± 38 41.30% 0.888150 0.617325 (ADR-6) 0.4951 0.2082 0.2954 Jalpaiguri (Teesta 1.2391± 0.0774± 0.1164± River) 22 23.91% 0.906662 0.516291 0.4289 0.1602 0.2307 (ADR-7) Teesta River 1.7174± 0.2295± 0.3461± 66 71.74% 0.823072 0.576448 System 0.4527 0.1965 0.2759 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index. The diversity indices based on the ISSR analyses in Amblyceps mangois of Teesta river were also in accordance with the RAPD data. The highest number of polymorphic loci was observed in ADR-6 population (38 numbers) and the percentage of polymorphism was 41.30 (Table 27, Figure 24E). The lowest number of polymorphic loci was observed in ADR- 3 population (19 numbers) and the percentage of polymorphism was 20.65. The observed number of alleles or allelic richness (S) varies from 1.2065 ± 0.4070 in ADR-3 population to 1.4130 ± 0.4951 in ADR-6 population (Table 27). The Nei’s genetic diversity (H) was highest (0.1551 ± 0.2082) in ADR-6 population and lowest (0.0699 ± 0.1533) in ADR-3 population (Table 27). The Shannon’s information index (H´ or I) was highest (0.2271 ± 0.2954) in ADR-6 population and lowest (0.1048 ± 0.2221) in ADR-3 population (Table 27). However, the measure of evenness (E) was highest (0.923261) in ADR-2 population and lowest (0.88792) in ADR-1 population (Table 27). The Heip’s measure of evenness was highest (0.617325) in ADR-6 population and lowest (0.516291) in ADR-5 and ADR-7 populations (Table 27).

Page | 182

4.3.2.1.3 Jaldhaka River System

Table 28. Intra-population genetic diversity indices based on ISSR analyses of Amblyceps mangois of Jaldhaka river system. ISSR Markers Diversity Indices Populations EHeip= H´ H´ Np Nper S H H´ or I E= e /S (e -1/ S-1) Jaldhaka River 1.3913± 0.1290± 0.1935± 36 39.13% 0.872198 0.54559 (ADR-8) 0.4907 0.1913 0.2725 Murti River 1.4022± 0.1314± 0.2058± 37 40.22% 0.876129 0.568144 (ADR-9) 0.4930 0.1940 0.2772 Ghotia River 1.4022± 0.1314± 0.2058± 37 40.28% 0.868105 0.540172 (ADR-10) 0.4930 0.1944 0.2772 Diana River 1.4130± 0.1320± 0.2102± 38 41.30% 0.861901 0.52752 (ADR-11) 0.4951 0.1910 0.2716 Jaldhaka 1.4783± 0.1383± 0.2117± 44 47.83% 0.835945 0.492948 River System 0.5023 0.1875 0.2674 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index.

The highest number of polymorphic loci in Amblyceps mangois of Jaldhaka river was observed in ADR-11 population (38 numbers) and the percentage of polymorphism was 41.30 (Table 28, Figure 24F). The lowest number of polymorphic loci was observed in ADR- 8 population (36 numbers) and the percentage of polymorphism was 39.13. The observed number of alleles or allelic richness (S) varies from 1.3913 ± 0.4907 in ADR-8 population to 1.4130 ± 0.4951 in ADR-11 population (Table 28). The Nei’s genetic diversity (H) was highest (0.1320 ± 0.1910) in ADR-11 population and lowest (0.1290 ± 0.1913) in ADR-8 population (Table 28). The Shannon’s information index (H´ or I) was highest (0.2102 ± 0.2716) in ADR-11 population and lowest (0.1935 ± 0.2725) in ADR-8 population (Table 28). However, the measure of evenness (E) was highest (0.876129) in ADR-9 population and lowest (0.861901) in ADR-11 population (Table 28). The Heip’s measure of evenness was highest (0.568144) in ADR-9 population and lowest (0.52752) in ADR-11 population (Table 28).

Page | 183

4.3.3 RAPD + ISSR based analyses 4.3.3.1 Intra-Population Genetic Diversity Study 4.3.3.1.1 Mahananda River System Table 29. Intra-population genetic diversity indices based on RAPD + ISSR analyses of Amblyceps mangois of Mahananda-Balason river system. RAPD + ISSR Markers Diversity Indices Populations E = E= e Heip N N S H H´ or I (e H´-1/ p per H´/S S-1) Mahananda 1.3047± 1.1960± 0.1653± Barrage, Fulbari 71 30.47% 0.904229 0.589915 0.4613 0.3417 0.2655 (ATR-1) Mahananda River, 1.2833± 1.1821± 0.1519± 66 28.33 % 0.907071 0.579046 Champasari 0.4516 0.3378 0.2595 (ATR-2) Balason River, 1.3391± 1.2186± 0.1847± Tarabari 79 33.91 % 0.898258 0.598223 0.4744 0.3523 0.2742 (ATR-3) Mahananda 1.3991± 0.1388± 0.2078± 93 39.91% 0.879828 0.578719 River System 0.4908 0.1914 0.2758 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index. The highest number of polymorphic loci in Amblyceps mangois of Mahananda- Balason river was observed in ATR-3 population (79 numbers) and the percentage of polymorphism was 33.91 (Table 29). The lowest number of polymorphic loci was observed in ATR-2 population (66 numbers) and the percentage of polymorphism was 28.33. The observed number of alleles or allelic richness (S) varies from 1.2833 ± 0.4516 in ATR-2 population to 1.3391 ± 0.4744 in ATR-3 population (Table 29). The Nei’s genetic diversity (H) was highest (1.2186 ± 0.3523) in ATR-3 population and lowest (1.1821 ± 0.3378) in ATR-2 population (Table 29). The Shannon’s information index (H´ or I) was highest (0.1847 ± 0.2742) in ATR-3 population and lowest (0.1519 ± 0.2595) in ATR-2 population (Table 29). However, the measure of evenness (E) was highest (0.907071) in ATR-2 population and lowest (0.898258) in ATR-3 population (Table 29). The Heip’s measure of evenness was highest (0.598223) in ATR-3 population and lowest (0.579046) in ATR-2 population (Table 29).

Page | 184

4.3.3.1.2 Teesta River System Table 30. Intra-population genetic diversity indices based on RAPD + ISSR analyses of Amblyceps mangois of Teesta river system. RAPD + ISSR Markers Diversity Indices Populations H´ H´ Np Nper S H H´ or I E= e /S EHeip=(e - 1/S-1) Sevoke 1.3562± 1.2303± 0.1894± (Teesta River) 83 35.62 % 0.891111 0.585413 0.4799 0.3695 0.2795 (ADR-1) Ghish River 1.2618± 1.1813± 0.1495± 61 26.18 % 0.920315 0.615941 (ADR-2) 0.4406 0.3355 0.2618 Gajoldoba (Teesta River 1.2232± 1.1396± 0.1183± 52 22.32 % 0.920194 0.562642 Barrage) 0.4173 0.3013 0.2358 (ADR-3) Chel River 1.2747± 1.1741± 0.1463± 64 27.47 % 0.908091 0.573511 (ADR-4) 0.4473 0.3299 0.2554 Neora River 1.2489± 1.1449± 0.1246± 58 24.89 % 0.906954 0.533127 (ADR-5) 0.4333 0.3041 0.2375 Dharla River 1.3777± 1.2529± 0.2074± 88 37.77 % 0.893137 0.610206 (ADR-6) 0.4859 0.3778 0.2877 Jalpaiguri (Teesta 1.2489± 1.1631± 0.1336± River) 58 24.89 % 0.915154 0.574269 0.4333 0.3287 0.2509 (ADR-7) Teesta River 1.7897± 0.2716± 0.4064± 184 78.97% 0.838913 0.634928 System 0.4084 0.1883 0.2611 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index. The highest number of polymorphic loci in Amblyceps mangois of Teesta river was observed in ADR-6 population (88 numbers) and the percentage of polymorphism was 37.77 (Table 30). The lowest number of polymorphic loci was observed in ADR-3 population (52 numbers) and the percentage of polymorphism was 22.32. The observed number of alleles or allelic richness (S) varies from 1.2232 ± 0.4173 in ADR-3 population to 1.3777 ± 0.4859 in ADR-6 population (Table 30). The Nei’s genetic diversity (H) was highest (1.2529 ± 0.3778) in ADR-6 population and lowest (1.1396 ± 0.3013) in ADR-3 population (Table 30). The Shannon’s information index (H´ or I) was highest (0.2074 ± 0.2877) in ADR-6 population and lowest (0.1183 ± 0.2358) in ADR-3 population (Table 30). However, the measure of evenness (E) was highest (0.920315) in ADR-2 population and lowest (0.891111) in ADR-1 population (Table 30). The Heip’s measure of evenness was highest (0.615941) in ADR-2 population and lowest (0.533127) in ADR-5 populations (Table 30).

Page | 185

4.3.3.1.3 Jaldhakaa River System Table 31. Intra-population genetic diversity indices based on RAPD + ISSR analyses of Amblyceps mangois of Jaldhaka river system. RAPD + ISSR Markers Diversity Indices Populations EHeip= H´ H´ Np Nper S H H´ or I E= e /S (e -1/ S-1) Jaldhaka River 1.3948± 1.2354± 0.2006± 92 39.48 % 0.876209 0.562654 (ADR-8) 0.4899 0.3636 0.2760 Murti River 1.3991± 1.2417± 0.2079± 93 39.91 % 0.881237 0.583658 (ADR-9) 0.4908 0.36371 0.27590 Ghotia River 1.3991± 1.2419± 0.2032± 93 39.91 % 0.87579 0.564564 (ADR-10) 0.4908 0.3717 0.2792 Diana River 1.4249± 1.2457± .0.2094± 99 42.49 % 0.863983 0.543869 (ADR-11) 0.4954 0.3657 0.2797 Jaldhaka 1.4893± 0.1436± 0.2196± 114 48.93% 0.836352 0.501897 River System 0.5010 0.1881 0.2685 Note: Np=number of polymorphic loci, Nper=percentage of polymorphic loci, S=observed number of alleles, H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index. The highest number of polymorphic loci in Amblyceps mangois of Jaldhaka river was observed in ADR-11 population (99 numbers) and the percentage of polymorphism was 42.49 (Table 31). The lowest number of polymorphic loci was observed in ADR-8 population (92 numbers) and the percentage of polymorphism was 39.48. The observed number of alleles or allelic richness (S) varies from 1.3948 ± 0.4899 in ADR-8 population to 1.4249 ± 0.4954 in ADR-11 population (Table 31). The Nei’s genetic diversity (H) was highest (1.2457 ± 0.3657) in ADR-11 population and lowest (1.2354 ± 0.3636) in ADR-8 population (Table 31). The Shannon’s information index (H´ or I) was highest (0.2094 ± 0.2797) in ADR-11 population and lowest (0.2006 ± 0.2760) in ADR-8 population (Table 31). However, the measure of evenness (E) was highest (0.881237) in ADR-9 population and lowest (0.863983) in ADR-11 population (Table 31). The Heip’s measure of evenness was highest (0.583658) in ADR-9 population and lowest (0.543869) in ADR-11 population (Table 31).

Page | 186

M ATR1 ATR2 ATR3

M ADR1 ADR2 ADR3 ADR4 ADR5 ADR6 ADR7

M ADR8 ADR9 ADR10 ADR11

C Page | 187

M ATR1 ATR2 ATR3

M ADR1 ADR2 ADR3 ADR4 ADR5 ADR6 ADR7

M ADR8 ADR9 ADR10 ADR11

Page | 188 F

Figure 24: Representative Gel of Amblyceps mangois after RAPD (1.4% agarose) and ISSR (1.8% agarose) amplification. RAPD primer OPA16 and ISSR primer ISSR04 primers are used for amplification.

ATR1-ATR3 are the populations from Mahananda river system, ADR1-ADR7 are the populations of Teesta river system, ADR8-ADR11 are the populations of Jaldhaka river system. Each population consists of ten individuals. Each lane represents each individual’s RAPD and ISSR banding pattern.

Page | 189

4.3.4 Comparative discussion based on RAPD, ISSR and RAPD+ISSR based analyses To our knowledge, the present study is the first endeavour to explore the present status of population categorical genetic background of this threatened fish fauna in the major river streams in the Terai and Dooars region of this sub-Himalayan hotspot of North Eastern India. The data obtained after amplification revealed the level of genetic diversity was dwindling within fourteen populations of Amblyceps mangois of the major river streams of the study region. RAPD and ISSR technique-based estimations of genetic diversity may be suitable for assessing the impact of different stresses upon a population as well as wide range of ecosystems. Since other popular sophisticated markers are not available in this fish species, we have used both RAPD and ISSR techniques for the estimation of genetic diversity of Amblyceps mangois species to increase the robustness of the study protocol. Both the techniques have advantages but ISSR is more robust than RAPD.

The study carried out in Bangladesh with two species of vulnerable Mud eel (Alam et al. 2010; Miah et al. 2013), endemic yellow catfish Horabagrus brachysoma (Muneer et al. 2009) and Clarias batrachus (Khedkar et al. 2010) the proportion of polymorphism was 76.92%, 32.87%, 60.48% and 77.49% respectively. Another study carried out in Bangladesh in catfish Mystus vittatus the polymorphism observed were 88.64% (Chalan beel), 84.09% (Mohanganj haor) and 90.91% (Kangsha river) (Tamanna et al, 2012). A study carried out in Brazil on Pimelodus maculatus the proportions of polymorphic loci estimated for the lower, middle and the upper Tietê river were 60.19%, 51.94%, and 52.43%, respectively; and 56.49%, 54.81%, and 61.51% for the lower, middle and upper Paranapanema, respectively (Almeida et al , 2003). In our earlier study with Badis badis the the proportion of polymorphic loci varies from 0.4371 (43.71%) in overall population to 0.6733 (67.33%) in between populations (Mukhopadhyay and Bhattacharjee, 2014a). In the present study we have found that the individual population polymorphism was lower to moderate in Teesta river system (23.40% in ADR-3 to 35.46% in ADR-6), moderate in Mahananda river system (28.37% in ATR-2 to 34.04% in ATR-3 population) and moderate in Jaldhaka river system (39.72% in ADR-8 to 43.26% in ADR-11 population). Therefore our present study revealed that a substantial decline of genetic variability within Amblyceps mangois population of the sub-Himalayan Terai and Dooars region.

Page | 190

Our present study revealed that the Nei’s genetic diversity, Shannon’s information index varied across three river system (Table 23 to 31 and Figure 25). Although considering the intra population genetic variation the Jaldhaka river system population showed high level of genetic variation than the Mahananda and Teesta river system populations (Table 24, 27, 30). In the study carried out on vulnerable Monopterus cuchia in Bangladesh (Alam et al. 2010) and on endemic species Horabagrus brachysoma in India (Muneer et al. 2009) the Nei’s genetic diversity was 0.285 and 0.222, respectively. These results are in accordance with the findings of Chandra et al. (2010) on Eutropiichthys vacha, where the Shannon’s Information Index was 0.280 and 0.300 in two different geographical populations. In two different studies carried out by Alam et al. (2010) and Miah et al. (2013) on mud eel Monopterus cuchia in Bangladesh, the Shannon’s indices were 0.423 and 0.213, respectively. Another study carried out in Bangladesh in catfish Mystus vittatus the genetic diversity were found to be 0.259±0.163, 0.198±0.136 and 0.216±0.138; and Shannon’s Information Index were 0.403±0.03, 0.327±0.03 and 0.354±0.02 in Chalan beel, Mohanganj haor and Kangsha river respectively (Tamanna et al, 2012). Another separate study of ours revealed that the Nei’s genetic diversity (퐻) of Badis badis Mahananda and Balason river population was 0.1654 and 0.1983, respectively and the Shannon’s information index (퐻´) was calculated to be 0.2450 ± 0.2907 in Mahananda river and 0.2901 ± 0.3037 in Balason river (Mukhopadhyay and Bhattacharjee, 2014a) ; and the Shannon’s information index ranged from 0.1648 ± 0.2691 to 0.2205 ± 0.2950 in the Terai region of West Bengal India. In a different study on Barilius barna isolated from Teesta river we have found that the Nei’s genetic diversity ranged from 0.172 ± 0.189 to 0.293 ± 0.164 and the Shannon’s information index (I) ranged from 0.265 ± 0.268 to 0.445 ± 0.220 (Paul et al. 2016). The range of Nei’s genetic diversity ranges from 0 to 1 (Nei 1973) and Shannon’s Information index ranges from 1.5 to 3.5 (Lewontin 1972). Therefore, in comparison with other studies, we have found that the genetic diversity was comparatively lower in three river system viz. Mahananda, Teesta and Jaldhaka of the study region.

Page | 191

4.3.5. Comparison of genetic diversity between three river system populations.

The RAPD, ISSR and RAPD+ISSR based analyses showed that the Teesta river system have highest detectable polymorphic loci i.e. 118, 66 and 184 in number respectively (Table 24, 27, 30). In contrast, the Mahananda river system showed lower number of polymorphic loci i.e., 57, 36 and 93 based on RAPD and ISSR analyses respectively (Table 23, 26, 29). The observed number of alleles (S), Nei's gene diversity (H) and Shannon's Information index (H´ or I) showed highest values in the Teesta river system i.e., 1.8369±0.3708, 0.2991±0.1780 and 0.4457± 0.2441 by RAPD analysis; and 1.7174±0.4527, 0.2295±0.1965 and 0.3461±0.2759 by ISSR analysis respectively (Table 24, 27, 30 and Figure 25) and lowest in the Mahananda river system i.e.,1.4043±0.4925, 0.1485±0.1988 and 0.2200±0.2853 by RAPD analysis; and 1.3913±0.4907, 0.1239±0.1794 and 0.1891±0.2609 by ISSR analysis respectively (Table 23, 26, 29 and Figure 25). Heip’s measure of evenness was used for better interpretation of the measure of evenness. We have found that the Teesta river system was more even in genetic diversity distribution than other populations (Figure 19).

The genetic diversity is comparatively high as evident from different diversity indices within the Amblyceps population of Teesta river system, than those of Mahananada and Jaldhaka river system, after considering the whole river system as a unit. But when we consider the individual collection spot as a unit to measure the genetic diversity the indices showed higher value in case of Jaldhaka river system than that of Teesta river system. Whereas, the Mahananda river system showed constantly lower values for all the diversity indices after RAPD, ISSR and RAPD+ISSR analyses. This lower level of diversity in Mahananda river system is attributed to different anthropogenic activities viz., high level of sand and pebbles excavation for house building purpose, a significant amount of city and factory wastes are deposited into the river, pesticide run-off and toxic chemicals depositions into the river from nearby tea gardens. Whereas a high level of overall genetic diversity of Teesta river system is found because of a number of tributaries viz. Chel, Neora etc joined with the Teesta river (Figure 23), and cause the overall diversity of Teesta river system to increase. But the individual collection spots showed low level of diversity because of high pesticide run-offs, fish catching practices and hydroelectric dam building. Whereas, the Jaldhaka river is comparatively free from all those anthropogenic pressures as occurred in

Page | 192

Mahananda and Teesta river system, therefore the individual collection spot’s genetic diversity was comparatively higher than other two river system.

Heip’s measure of evenness was used for better interpretation of the measure of evenness. It does on the other hand satisfy the probability of attaining a low value when evenness in low. Smith and Wilson (1996) showed that the minimum value of Heip’s measure is 0 and that it registered 0.006 when an extremely uneven population structure is found. We have found that the Teesta river system was more even in genetic diversity distribution than other populations with respect to Amblyceps mangois (Figure 25).

2 1.8369 1.8

1.6 1.4965 1.4043 1.4 S

1.2 H

0.887329 0.850119 1 0.836583 I

0.8 0.671028 0.608649

0.507446 E

0.6 0.4457

0.2991 EHeip 0.2247

0.4 0.22 0.1485 0.2 0.1471 0 Mahananda Teesta Jaldhaka

Page | 193

1 8

1.8 3

1 3

1.6 . 1

1.4 9

7 3

9 S

0 8

1.2 5

4 .

0 H

7 0

1 4

2 3

5 I 9

0.8 .

5 7

0.6 1 E

. 2

0.4 . 0

1 EHeip

. 0 0.2 0 0 Mahananda Teesta Jaldhaka

9 C

3 9

1.8 1

1 3

1.6 . 1

1.4 8

8 9 3 S

1.2 9

9 1

0 H

7 0

1 0

1 .

5 I 4

0.8 0

1 .

0.6 8 E

. 0

0.4 . EHeip

. 0 0.2 0 0 Mahananda Teesta Jaldhaka

Figure 25: Comparison of genetic diversity between three river system populations of Amblyceps mangois by A. RAPD; B. ISSR and C. RAPD + ISSR based analyses. S=observed number of alleles,

H= Nei's gene diversity, H´ or I= Shannon's Information index, E= measure of evenness, EHeip= Heip’s evenness index

Page | 194

4.3.6. Genetic relationship between populations based on RAPD and ISSR analyses Table 32: Matrix showing values of Nei's (1978) unbiased measures of genetic similarity (above diagonal) and genetic distances (below diagonal). The square boxes indicate the highest (green box) and lowest (blue box) genetic similarity and genetic distance between two pair of population. ======pop ID ADR-1 ADR-2 ADR- 3 ADR-4 ADR-5 ADR- 6 ADR-7 ADR-8 ADR-9 ADR-10 ADR-11 ATR-1 ATR-2 ATR-3 ======ADR-1 **** 0.7524 0.7524 0.7530 0.8622 0.8601 0.7923 0.6897 0.6971 0.6949 0.6941 0.7325 0.7543 0.7536 ADR-2 0.2845 **** 0.9874 0.7281 0.7490 0.7884 0.6906 0.6196 0.6212 0.6293 0.6323 0.9371 0.9768 0.9504 ADR-3 0.2845 0.0126 **** 0.7210 0.7539 0.7929 0.6906 0.6078 0.6090 0.6170 0.6197 0.9483 0.9890 0.9634 ADR-4 0.2837 0.3173 0.3271 **** 0.7755 0.8062 0.7238 0.6526 0.6556 0.6600 0.6575 0.7304 0.7252 0.7324 ADR-5 0.1483 0.2891 0.2825 0.2542 **** 0.8533 0.8044 0.7115 0.7126 0.7163 0.7116 0.7553 0.7565 0.7386 ADR-6 0.1507 0.2377 0.2321 0.2155 0.1586 **** 0.7779 0.7660 0.7660 0.7743 0.7708 0.7820 0.7855 0.7744 ADR-7 0.2328 0.3702 0.3702 0.3232 0.2176 0.2512 **** 0.6151 0.6202 0.6178 0.6170 0.7092 0.6897 0.6957 ADR-8 0.3715 0.4786 0.4979 0.4268 0.3404 0.2666 0.4861 **** 0.9960 0.9907 0.9871 0.6290 0.6200 0.6173 ADR-9 0.3608 0.4762 0.4960 0.4222 0.3388 0.2666 0.4778 0.0041 **** 0.9894 0.9863 0.6295 0.6208 0.6173 ADR-10 0.3641 0.4631 0.4828 0.4154 0.3337 0.2558 0.4816 0.0093 0.0106 **** 0.9936 0.6401 0.6289 0.6258 ADR-11 0.3651 0.4584 0.4785 0.4193 0.3403 0.2604 0.4829 0.0130 0.0138 0.0064 **** 0.6334 0.6281 0.6230 ATR-1 0.3112 0.0650 0.0531 0.3142 0.2807 0.2459 0.3436 0.4637 0.4629 0.4461 0.4566 **** 0.9571 0.9441 ATR-2 0.2820 0.0235 0.0111 0.3213 0.2790 0.2415 0.3715 0.4780 0.4768 0.4639 0.4650 0.0439 **** 0.9688 ATR-3 0.2829 0.0509 0.0372 0.3114 0.3029 0.2557 0.3629 0.4824 0.4824 0.4688 0.4733 0.0576 0.0317 ****

Page | 195

ADR-1

ADR-5

ADR-6

ADR-7

ADR-4

ADR-2

ADR-3

ATR-2

ATR-3

ATR-1

ADR-8

ADR-9

ADR-10

ADR-11

Figure 26. UPGMA dendrogram based on Nei’s (1978) unbiased genetic distance matrix. The Green and Brown square box indicates the clustering of Terai and Dooars region populations. ADR- Amblyceps mangois from Dooars; ATR- Amblyceps mangois from Terai region. The shaded area represent two different clade i.e., pink portion represent Mahananada-Balasan river system and Teesta river system; purple portion represent the Jaldhaka river system.

Page | 196

Principal Coordinates (PCoA)

ADR-7

ADR-5 ) ADR-4

.61% ADR-1 2 (23 2

ADR-6

d Coor ATR-1 ATR-2 ADR-11 ATR-3 ADR-10 ADR-8 ADR-2 ADR-3 ADR-9 Coordinate 1 (48.97%)

Figure 27: Principal Component Analysis based on covariance matrix without data standardization of Amblyceps mangois populations of three river system based on RAPD and ISSR analyses. Blue, Brown and Green circles represent clustering of Mahananda, Teesta and Jaldhaka river populations. Coordinates 1 and 2 explain 48.97 % and 23.61 % of the variations respectively.

Page | 197

Based on the RAPD and ISSR analyses, the Nei’s genetic distance was highest between ADR-3 and ADR-8 populations (0.4979) and lowest between ADR-8 and ADR-9 population (0.0041) (Table 32). The genetic identity was highest between ADR-8 and ADR-9 (0.9960) and lowest between ADR-3 and ADR-8 populations (0.6078) (Table 32). The UPGMA based dendrogram based on the Nei’s unbiased genetic distance and identity matrix after RAPD and ISSR analyses showed clear representation of genetic relationship of fourteen populations of Amblyceps mangois of the three major riverine systems (Mahananda, Teesta and Jaldhaka of the sub-Himalayan West Bengal. The dendrogram based on RAPD and ISSR analyses showed that the Mahananda and Teesta river populations (ATR-1 to ATR- 3 and ADR-1 to ADR-7) formed a distinct group from the remaining Jaldhaka river population (ADR-8 to ADR-11) (Figure 26). The principal component analyses clearly showed the clustering of fourteen populations into distinct three groups; two groups for Mahananda and Teesta river populations and separate group for Jaldhaka river population (Figure 27). The ADR-2 and ADR-3 population of Teesta river system form cluster with the Mahananda river populations i.e., ATR-1, ATR-2 and ATR-3. This clustering seems to be obvious because there is situated a man-made water-canal that joins this two (Mahanada and Teesta) river system. This canal was mainly constructed for irrigation purpose in the nearby agricultural fields and to channelize the extra water when there is a flood condition in the rivers during monsoon season. This canal causes the admixture of Amblyceps gene pool of this two river system i.e., Mahananda and Teesta and grouping of the populations into a single cluster (Figure 23). Whereas the Jaldhaka river system is allopatrically isolated from the other two neighbouring river systems, therefore the Jaldhaka river populations formed a distinct cluster separated from Mahananda and Teesta river system cluster.

Page | 198

4.3.7. SHE analyses

Table 33: SHE analyses based on RAPD + ISSR analyses Population lnS H´ lnE Mahananda Barrage, Fulbari, (ATR-1) 0.265973129 0.1653 -0.100673129 Mahananda River, Champasari, (ATR-2) 0.249434885 0.1519 -0.097534885 Balason River, Tarabari, (ATR-3) 0.291997747 0.1847 -0.107297747 Sevoke(Teesta River), (ADR-1) 0.304686671 0.1894 -0.115286671 Ghish River, (ADR-2) 0.232539273 0.1495 -0.083039273 Gajoldoba(Teesta River Barrage), (ADR-3) 0.201470376 0.1183 -0.083170376 Chel River, (ADR-4) 0.242710857 0.1463 -0.096410857 Neora River, (ADR-5) 0.222263164 0.1246 -0.097663164 Dharla River, (ADR-6) 0.320415442 0.2074 -0.113015442 Jalpaiguri (Teesta River), (ADR-7) 0.222263164 0.1336 -0.088663164 Jaldhaka River, (ADR-8) 0.332751036 0.2006 -0.132151036 Murti River, (ADR-9) 0.335829173 0.2094 -0.126429173 Ghotia River, (ADR-10) 0.335829173 0.2032 -0.132629173 Diana River, (ADR-11) 0.354101636 0.2079 -0.146201636 [ lnS= natural logarithm of richness (allelic richness); H´= Shannon's Information index; lnE= natural logarithm of evenness]

Page | 199

0.35 0.3 0.3 0.25 0.25 0.2 0.2 0.15 0.15 0.1 0.1 0.05 ATR-2 ATR-1 0.05 ATR-3 ATR-1 0 0 -0.05 -0.05 -0.1 -0.1 -0.15 A -0.15 B

0.35 0.25 0.3 0.2 0.25 0.15 0.2 0.15 0.1 0.1 0.05 ADR-2 ADR-3 ADR-7 0.05 ADR-1 ADR-3 ADR-7 0 0 -0.05 -0.05 -0.1 -0.1 -0.15 C -0.15 D

0.35 0.35 0.3 0.3 0.25 0.25 0.2 0.2 0.15 0.15 0.1 0.1 0.05 ADR-4 ADR-6 ADR-7 0.05 ADR-5 ADR-6 ADR-7 0 0 -0.05 -0.05 -0.1 -0.1 -0.15 -0.15 E F

Page | 200

0.4 0.4

0.3 0.3

0.2 0.2

0.1 0.1 ADR-11 ADR-8 ADR-10 ADR-8 0 0

-0.1 -0.1

-0.2 G -0.2 H

0.4

0.3

0.2

0.1 ADR-9 ADR-8 0

-0.1

-0.2 I

Figure 28: SHE analyses showing observed patterns of diversity changes of Amblyceps mangois in three the river system populations based on RAPD and ISSR marker. Plot A and B represents the Mahananda river system; Plot C, D, E, F represents Teesta river system and Plot G, H, I represents Jaldhaka river system. ( = lnS, =H´, = lnE )

SHE analyses revealed a clear distribution of three biodiversity components richness (S), diversity (H´) and evenness (E) of the Amblyceps mangois gene pool into fourteen different riverine populations of the Terai and Dooars regions. We found that the lnS and H´ components were highest in ADR-9 population (0.335829173 and 0.2094 respectively) and lowest in ADR-3 population (0.201470376 and 0.1183 respectively) (Table 33). The lnE value was highest in ADR-11 population (-0.146201636) and lowest in ADR-2 population (- 0.083039273) (Table 33). The SHE analysis plot revealed the observed pattern for

Page | 201 distribution of three components viz., S (richness), H´ (Shannon's Information index) and E (evenness) in relation to fourteen different populations.

We had divided the fourteen riverine populations into nine groups according to the continuity of the water flow through the river from upstream to downstream viz., ATR-3 and ATR-1 constituting first group (Plot A); ATR-2 and ATR-1 constituting second group (Plot B); ADR-1, ADR-3 and ADR-7 constituting third group (Plot-C); ADR-2, ADR-3 and ADR- 7 constituting fourth group (Plot-D); ADR-4, ADR-6 and ADR-7 constituting fifth group (Plot-E); ADR-5, ADR-6 and ADR-7 constituting sixth group (Plot-F); ADR-11 and ADR-8 constituting seventh group (Plot-G); ADR-10 and ADR-8 constituting eighth group (Plot-H); and ADR-9 and ADR-8 constituting ninth group (Plot-I) (Figure 28 upper panel).

We have found that as the river flows downward, in most of the cases the diversity has decreased but evenness increased (Plot- A, C, E, I); or diversity and evenness both increased (Plot-F); or diversity and evenness both decreased (Plot-D, G); or diversity increased and evenness decreased (Plot-B); or remain same (Plot-H) (Figure 28 upper panel). The flow pattern disturbance and human interferences (such as fishing and pesticide run-offs) as the river streams flow from higher to lower altitudes may cause the overall fluctuation and break in diversity and richness pattern within the gene pool of the Amblyceps population. The Terai region rivers viz. Mahananda and Balasan are exploited for sand excavation, and polluted by the nearby urban effluents and sewage run-off. Whereas, Dooars regions rivers viz., Jaldhaka, Teesta and its tributaries are greatly polluted by pesticides surplus from nearby tea gardens during monsoon season. Moreover hydroelectric Dam construction and over fishing also affect the diversity pattern of this fish species. All of these causes can culminate in to the observed decline, modification and change in diversity pattern and richness in Amblyceps mangois populations across the river stream along the altitudinal gradient.

Page | 202

4.3.8. Genetic Hierarchical Structure

ATR-2 ATR-3

Water flow

ATR-1

Mahananda River System (hypothetical map)

=Collection spots, = River streams AMOVA

Hierarchical Source of variation Among Within FST Nm PhiPT Structure between populations population population (p value) (%) (%) 13.217 0.069 1st Order ATR-3 # ATR-2 0.1084 4.1117 0.983 (7) (93) (0.006)

ATR-3, ATR-2 # 13.259 0.141 2nd Order 0.1847 2.2068 2.181 (14) ATR-1 (86) (0.001)

Page | 203

ADR-2 ADR-4 ADR-5 ADR-1

ADR-6 ADR-3

Water flow

ADR-7

Teesta River System (hypothetical map) =Collection spots, = River streams AMOVA Hierarchic Source of variation between Among Within al FST Nm PhiPT populations populatio populatio Structure (p value) n (%) n (%) 0.487 0.526 0.595 1st Order ADR-1 # ADR-2 18.36 (63) 12.65 (37) 0 8 (0.001) 0.618 0.410 0.717 1st Order ADR-2 # ADR-4 28.70 (72) 11.31 (28) 7 9 (0.001) 0.528 0.446 0.668 1st Order ADR-4 # ADR-5 22.17 (67) 11.02 (33) 5 1 (0.001) 0.492 0.514 0.580 2nd Order ADR-1, ADR-2 # ADR-3 15.82 (58) 11.47 (42) 8 5 (0.001) 0.510 0.480 0.657 2nd Order ADR-4, ADR-5 # ADR-6 24.30 (66) 12.48 (40) 2 1 (0.001) ADR-1, ADR-2, ADR-3 # ADR-4, 0.590 0.346 0.628 3rd Order 20.20 (63) 11.98 (38) ADR-5, ADR-6 7 5 (0.001) 0.599 0.334 0.669 4th Order ADR-1, ADR-2, ADR-3 # ADR-7 22.65 (67) 11.20 (33) 2 5 (0.001) 0.577 0.366 0.637 4th Order ADR-4, ADR-5, ADR-6 # ADR-7 21.02 (64) 11.96 (36) 0 6 (0.001) ADR-1, ADR-2, ADR-3, ADR-4, 0.548 0.308 0.652 5th Order 22.02 (65) 11.74 (35) ADR-5, ADR-6 # ADR-7 9 1 (0.001)

Page | 204

ADR-9 ADR-11 ADR-10

Water flow

ADR-8

Jaldhaka River System (hypothetical map)

=Collection spots, = River streams AMOVA Hierarchic Source of variation between Among Within al FST Nm PhiPT populations populatio populatio Structure (p value) n (%) n (%) 0.019 25.024 16.35 -0.088 1st Order ADR-11 # ADR-10 0.0 (0) 6 7 (100) (1.000) 0.031 15.236 16.59 -0.062 1st Order ADR-10 # ADR-9 0.0 (0) 8 5 (100) (0.991) 0.038 12.433 16.37 -0.079 2nd Order ADR-11, ADR-10 # ADR-8 0.0 (0) 7 0 (100) (1.000) 0.012 39.344 16.67 -0.090 2nd Order ADR-9 # ADR-8 0.0 (0) 5 7 (100) (0.999) 0.042 11.213 16.51 -0.077 3rd Order ADR-11, ADR-10, ADR-9 # ADR-8 0.0 (0) 7 6 (100) (1.000)

Figure 29: Genetic hierarchical model of fourteen different populations of Amblyceps mangois. The populations are arranged in hierarchical orders as first, second, third, fourth, fifth order populations. FST = Population genetic differentiation, Nm= Estimated gene flow, AMOVA= Analysis of molecular variance, PhiPT= Estimated variance among population/ (Estimated variance within population + Estimated variance among population), probability values based on 999 permutations. # indicates the comparison between populations or groups of populations.

Page | 205

The three river system has different natural hierarchical genetic-spatial structure. Therefore, we have divided the three river system into 1st and 2nd order (for Mahananda river system), 1st to 5th order (for Teesta river system) and 1st to 3rd order (for Jaldhaka river system) hierarchy. This division helped us to compare the riverine populations constituting the different order of hierarchy sophisticatedly (Figure 29).

In the Mahananda river system the first order hierarchical group (between population

ATR-3 and ATR-2); showed lower value of genetic differentiation (FST = 0.1084) and higher nd value of gene flow (Nm = 4.1117) than the 2 order hierarchical population (Figure 29). The among population variance component and PhiPT value of first order hierarchical group were also lower i.e., 0.983 (7%) and 0.069 (p value = 0.006) respectively than the 2nd order hierarchical population (Figure 29).

In the Teesta river system the first order hierarchical group (between population ADR-1 and ADR-2) and the second order hierarchical group (between population ADR-1,

ADR-2 and ADR-3); showed lower value of genetic differentiation (FST = 0.4870 and 0.4928 respectively) and higher value of gene flow (Nm = 0.5268 and 0.5145) than other hierarchical orders of population (Figure 29). The among population variance component and PhiPT value of first order hierarchical group (between population ADR-1 and ADR-2) and the second order hierarchical group (between population ADR-1, ADR-2 and ADR-3) were also lower i.e., 18.36 (63%) and 15.82 (58%); and 0.595 (p value = 0.001) and 0.580 (p value = 0.001) respectively than the other hierarchical orders of populations (Figure 29).

In Jaldhaka river system all three hierarchical groups i.e., first order, second order and third order showed very low genetic differentiation (FST = 0.0196, 0.0318, 0.0387, 0.0125,

0.0427); and high amount of gene flow (Nm = 25.0247, 15.2365, 12.4330, 39.3447 and 11.2136) (Figure 29). Although second order populations (ADR-9 and ADR-8) showed low

FST and high gene flow among other hierarchical orders but the there was no among populations variance in any hierarchical orders and there was a significant negative PhiPT values in all hierarchical orders of Jaldhaka populations (Figure 29). .

Fixation index or FST is a measure of genetic divergence among subpopulations that ranges from 0 (when all subpopulations have equal allele frequencies) to 1 (when all the subpopulations are fixed for different alleles) (Allendorf et al., 2013). In our study we have detected a low to high (0.0125 to 0.6187) level of genetic differentiation (FST) across different populations of Amblyceps mangois in three river system in a hierarchical manner and the

Page | 206 gene flow was low to high between different populations. Although a residual level of genetic admixture was occurred through narrow channels between different populations because of the submergence of the channels during monsoon season. A direct evidence of population differentiation was revealed by the AMOVA, which detected significant differentiation of populations in each hierarchical order among the populations. A high level of among population variance and genetic differentiation (FST) was detected in the second order hierarchical population (consisting of populations ATR-3, ATR-2 and ATR-1) of Mahananda river system and second order hierarchical population (consisting of populations ADR-2 and ADR-4) of Teesta river system, which indicate that these hierarchical group are genetically and reproductively isolated and there was a sporadic gene flow occurred (Figure 29). Moreover the Jaldhaka river system the observed among population variance was nil and very low amount of genetic differentiation with a high amount of gene flow indicates that this river system is made up of genetically similar sub populations (Figure 29). The PhiPT is another population genetic statistical tool to detect the population differentiation; the results of PhiPT were also congruent with the results of FST. The population genetic parameter Nm, which measures the number of migrants per generation, also provides an indication of the differentiation among populations. A study carried out in Bangladesh in catfish Mystus vittatus in Chalan beel, Mohanganj haor and Kangsha river population differentiation (PhiPT) values were found to be insignificant indicating that there were no significant differentiation among three studied populations of Mystus vittatus (Tamanna et al, 2012). Another study carried out in Brazil on Pimelodus maculatus there was a significant genetic differentiation between the upper Paranapanema subpopulation and those of the lower and middle parts, and a greater similarity between the lower and middle Paranapanema subpopulations. The gene flow estimates for P. maculatus in the Paranapanema river were 4.4646, 2.1732, and 1.8776 between the lower and middle, lower and upper, and middle and upper parts, respectively (Almeida et al , 2003). According to Wright (1978), genetic differentiation estimates with probabilities between 0.05 and 0.15 are considered indicative of moderate population structuring, and with probabilities between 0.15 and 0.25 of high population structuring. Structured populations usually show a dynamic equilibrium between factors which favor differentiation (mutation, drift, and directional or disruptive natural selection, differing in each area) and homogenizing factors (migration, purifying natural selection, and balanced or differential natural selection, uniform in each area) (Solé-Cava, 2001). The study carried out in Bangladesh with endemic yellow catfish Horabagrus brachysoma the maximum value of

FST (0.219), was shown between Meenachil and Nethravathi populations and the minimum value of FST (0.045) between Meenachil and Chalakkudi populations (Muneer et al, 2009).

Page | 207

4.3.9 mtCOI based findings of Amblyceps mangois

4.3.9.1 Amplification and Checking of amplified fragments

The COI gene was amplified with the specific primers from ten different individuals from Terai (two individuals) and Dooars region (eight individuals). After amplification I have found distinct sharp bands with approximately 687bp size. The HINDIII digestion gave two distinct bands of approximately 270bp in size and 420bp in size (Figure 30).

M 1 2 3 4 5 6 7 8 9 10

1000bp -----

650bp ------

500bp------

M 1 2 3 4 5 6 7 8 9 10

1000bp -----

400bp ------

250bp------

Figure 30: A. Amplification of COI gene of Amblyceps mangois by specific primer. B. Hind III digestion of the amplified product. M= 100 base pair DNA sizer marker, Lane No. 1-10= Amplified product of COI gene of Amblyceps mangois.

Page | 208

4.3.9.2 Ten Cytochrome oxidase subunit 1 (COI) gene sequences of Amblyceps mangois and their NCBI.

>TRAM1 (Accn. No.MK012251) CCCAAAGACATTGGCACCCTTTATTTAGTCTTTGGTGCTTGAGCCGGAATAGTTG GTACAGCCCTTAGCCTGCTAATTCGGGCGGAGCTGGCCCAACCTGGCGCTCTCTT AGGAGACGACCAAATTTATAATGTTATTGTTACTGCCCATGCTTTTATTATAATTT TCTTTATAGTAATACCAATCATAATTGGCGGGTTCGGAAACTGACTTGTCCCTTTA ATGATCGGGGCTCCTGATATGGCATTCCCCCGAATAAACAACATAAGCTTCTGAC TTCTCCCCCCTTCTTTCCTGTTGCTACTTGCCTCTTCTGGGGTCGAAGCAGGCGCA GGAACCGGGTGAACTGTCTACCCCCCTCTTGCTGGTAACTTAGCACATGCCGGGG CCTCCGTAGACTTAACTATCTTTTCACTTCACCTTGCTGGTGTCTCCTCAATTTTA GGTGCCATTAACTTTATCACAACTATCATTAACATGAAACCCCCTGCAATTTCAC AGTATCAAACTCCACTCTTTGTCTGAGCAGTACTAATTACAGCCGTGCTCCTTCTA CTATCTCTGCCCGTACTGGCTGCCGGCATCACAATACTACTAACAGACCGAAACT TAAATACCACCTTCTTTGACCCAGCAGGGGGAGGGGATCCCATCCTCTACCAACA CCTGTTTTGATTCTTTGGCCAC

>TRAM2 (Accn. No.MK012252) CCCAAAGACATTGGCACCCTTTATTTAGTCTTTGGTGCTTGAGCCGGAATAGTTG GTACAGCCCTTAGCCTGCTAATTCGGGCGGAGCTGGCCCAACCTGGCGCTCTCTT AGGAGACGACCAAATTTATAATGTTATTGTTACTGCCCATGCTTTTATTATAATTT TCTTTATAGTAATACCAATCATAATTGGCGGGTTCGGAAACTGACTTGTCCCTTTA ATGATCGGGGCTCCTGATATGGCATTCCCCCGAATAAACAACATAAGCTTCTGAC TTCTCCCCCCTTCTTTCCTGTTGCTACTTGCCTCTTCTGGGGTCGAAGCAGGCGCA GGAACCGGGTGAACTGTCTACCCCCCTCTTGCTGGTAACTTAGCACATGCCGGGG CCTCCGTAGACTTAACTATCTTTTCACTTCACCTTGCTGGTGTCTCCTCAATTTTA GGTGCCATTAACTTTATCACAACTATCATTAACATGAAACCCCCTGCAATTTCAC AGTATCAAACTCCACTCTTTGTCTGAGCAGTACTAATTACAGCCGTGCTCCTTCTA CTATCTCTGCCCGTACTGGCTGCCGGCATCACAATACTACTAACAGACCGAAACT TAAATACCACCTTCTTTGACCCAGCGGGGGGAGGGGATCCCATCCTCTACCAACA CCTGTTTTGATTCTTTGGCCAC

>DRAM4 (Accn. No.MK012253) CCCAAAGACATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTTG GTACAGCCCTTAGCCTGCTAATTCGGGCGGAGCTGGCCCAACCTGGCGCTCTCTT AGGAGACGACCAAATTTATAATGTTATTGTTACTGCCCATGCTTTTATTATAATTT TCTTTATAGTAATACCAATCATAATTGGTGGGTTCGGAAACTGACTTGTCCCTTTA ATGATCGGGGCTCCTGATATGGCATTCCCCCGAATAAACAACATAAGCTTCTGAC TTCTTCCCCCTTCTTTCCTGTTGCTACTTGCCTCTTCTGGGGTCGAAGCAGGCGCA GGAACCGGGTGAACTGTCTACCCCCCTCTTGCTGGTAACTTAGCACATGCCGGGG CCTCCGTAGACTTAACTATCTTTTCACTTCACCTTGCTGGTGTCTCCTCAATTTTA GGCGCCATTAACTTTATCACAACTATCATTAACATGAAGCCCCCTGCAATTTCAC AGTATCAAACTCCACTCTTTGTCTGAGCAGTACTAATTACAGCCGTGCTCCTTCTA CTATCTCTGCCCGTACTGGCTGCCGGCATCACAATACTACTAACAGACCGAAACT TAAATACTACCTTCTTTGACCCAGCAGGGGGAGGAGATCCCATCCTCTACCAACA CCTGTTTTGATTCTTTGGCCAC

Page | 209

>DRAM6 (Accn. No.MK012254) CCCAAAGACATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTTG GTACAGCCCTTAGCCTGCTAATTCGGGCGGAGCTGGCCCAACCTGGCGCTCTCTT AGGAGACGACCAAATTTATAATGTTATTGTTACTGCCCATGCTTTTATTATAATTT TCTTTATAGTAATACCAATCATAATTGGCGGGTTCGGAAACTGACTTGTCCCTTTA ATGATCGGGGCTCCTGATATGGCATTCCCCCGAATAAACAACATAAGCTTCTGAC TTCTCCCCCCTTCTTTCCTGTTGCTACTTGCCTCTTCTGGGGTCGAAGCAGGCGCA GGAACCGGGTGAACTGTCTACCCCCCTCTTGCTGGTAACTTAGCACATGCCGGGG CCTCCGTAGACTTAACTATCTTTTCACTTCACCTTGCTGGTGTCTCCTCAATTTTA GGTGCCATTAACTTTATCACAACTATCATTAACATGAAACCCCCTGCAATTTCAC AGTATCAAACTCCACTCTTTGTCTGAGCAGTACTAATTACAGCCGTGCTCCTTCTA CTATCTCTGCCCGTACTGGCTGCCGGCATCACAATACTACTAACAGACCGAAACT TAAATACCACCTTCTTTGACCCAGCAGGGGGAGGGGATCCCATCCTCTACCAACA CCTGTTTTGATTCTTTGGCCAC

>DRAM7 (Accn. No.MK012255) CCCAAAGACATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTTG GTACAGCCCTTAGCCTGCTAATTCGGGCGGAGCTGGCCCAACCTGGCGCTCTCTT AGGAGACGACCAAATTTATAATGTTATTGTTACTGCCCATGCTTTTATTATAATTT TCTTTATAGTAATACCAATCATAATTGGTGGGTTCGGAAACTGACTTGTCCCTTTA ATGATCGGGGCTCCTGATATGGCATTCCCCCGAATAAACAACATAAGCTTCTGAC TTCTTCCCCCTTCTTTCCTGTTGCTACTTGCCTCTTCTGGGGTCGAAGCAGGCGCA GGAACCGGGTGAACTGTCTACCCCCCTCTTGCTGGTAACTTAGCACATGCCGGGG CCTCCGTAGACTTAACTATCTTTTCACTTCACCTTGCTGGTGTCTCCTCAATTTTA GGCGCCATTAACTTTATCACAACTATCATTAACATGAAGCCCCCTGCAATTTCAC AGTATCAAACTCCACTCTTTGTCTGAGCAGTACTAATTACAGCCGTGCTCCTTCTA CTATCTCTGCCCGTACTGGCTGCCGGCATCACAATACTACTAACAGACCGAAACT TAAATACTACCTTCTTTGACCCAGCAGGGGGAGGAGATCCCATCCTCTACCAACA CCTGTTTTGATTCTTTGGCCCC

>DRAM8 (Accn. No.MK012256) CCCAAAGACATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTTG GTACAGCCCTTAGCCTGCTAATTCGGGCGGAGCTGGCCCAACCTGGCGCTCTCTT AGGAGACGACCAAATTTATAATGTTATTGTTACTGCCCATGCTTTTATTATAATTT TCTTTATAGTAATACCAATCATAATTGGTGGGTTCGGAAACTGACTTGTCCCTTTA ATGATCGGGGCTCCTGATATGGCATTCCCCCGAATAAACAACATAAGCTTCTGAC TTCTTCCCCCTTCTTTCCTGTTGCTACTTGCCTCTTCTGGGGTCGAAGCAGGCGCA GGAACCGGGTGAACTGTCTACCCCCCTCTTGCTGGTAACTTAGCACATGCCGGGG CCTCCGTAGACTTAACTATCTTTTCACTTCACCTTGCTGGTGTCTCCTCAATTTTA GGCGCCATTAACTTTATCACAACTATCATTAACATGAAGCCCCCTGCAATTTCAC AGTATCAAACTCCACTCTTTGTCTGAGCAGTACTAATTACAGCCGTGCTCCTTCTA CTATCTCTGCCCGTACTGGCTGCCGGCATCACAATACTACTAACAGACCGAAACT TAAATACTACCTTCTTTGACCCAGCAGGGGGAGGAGATCCCATCCTCTACCAACA CCTGTTTTGATTCTTTGGCCAC

>DRAM9 (Accn. No.MK012257) CACAAAGACATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTTG GTACAGCCCTTAGCCTGCTAATTCGGGCGGAGCTGGCCCAACCTGGCGCTCTCTT AGGAGACGACCAAATTTATAATGTTATTGTTACTGCCCATGCTTTTATTATAATTT TCTTTATAGTAATACCAATCATAATTGGTGGGTTCGGAAACTGACTTGTCCCTTTA

Page | 210

ATGATCGGGGCTCCTGATATGGCATTCCCCCGAATAAACAACATAAGCTTCTGAC TTCTTCCCCCTTCTTTCCTGTTGCTACTTGCCTCTTCTGGGGTCGAAGCAGGCGCA GGAACCGGGTGAACTGTCTACCCCCCTCTTGCTGGTAACTTAGCACATGCCGGGG CCTCCGTAGACTTAACTATCTTTTCACTTCACCTTGCTGGTGTCTCCTCAATTTTA GGCGCCATTAACTTTATCACAACTATCATTAACATGAAGCCCCCTGCAATTTCAC AGTATCAAACTCCACTCTTTGTCTGAGCAGTACTAATTACAGCCGTGCTCCTTCTA CTATCTCTGCCCGTACTGGCTGCCGGCATCACAATACTACTAACAGACCGAAACT TAAATACTACCTTCTTTGACCCAGCAGGGGGAGGAGATCCCATCCTCTACCAACA CCTGTTTTGATTCTTTGGCCAC

>DRAM10 (Accn. No.MK012258) CCCAAAGACATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTTG GTACAGCCCTTAGCCTGCTAATTCGGGCGGAGCTGGCCCAACCTGGCGCTCTCTT AGGAGACGACCAAATTTATAATGTTATTGTTACTGCCCATGCTTTTATTATAATTT TCTTTATAGTAATACCAATCATAATTGGTGGGTTCGGAAACTGACTTGTCCCTTTA ATGATCGGGGCTCCTGATATGGCATTCCCCCGAATAAACAACATAAGCTTCTGAC TTCTTCCCCCTTCTTTCCTGTTGCTACTTGCCTCTTCTGGGGTCGAAGCAGGCGCA GGAACCGGGTGAACTGTCTACCCCCCTCTTGCTGGTAACTTAGCACATGCCGGGG CCTCCGTAGACTTAACTATCTTTTCACTTCACCTTGCTGGTGTCTCCTCAATTTTA GGCGCCATTAACTTTATCACAACTATCATTAACATGAAGCCCCCTGCAATTTCAC AGTATCAAACTCCACTCTTTGTCTGAGCAGTACTAATTACAGCCGTGCTCCTTCTA CTATCTCTGCCCGTACTGGCTGCCGGCATCACAATACTACTAACAGACCGAAACT TAAATACTACCTTCTTTGACCCAGCAGGGGGAGGAGATCCCATCCTCTACCAACA CCTGTTTTGATTCTTTGGCCAC

>DRAM12 (Accn. No.MK012259) CACAAAGACATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTTG GTACAGCCCTTAGCCTGCTAATTCGGGCGGAGCTGGCCCAACCTGGCGCTCTCTT AGGAGACGACCAAATTTATAATGTTATTGTTACTGCCCATGCTTTTATTATAATTT TCTTTATAGTAATACCAATCATAATTGGTGGGTTCGGAAACTGACTTGTCCCTTTA ATGATCGGGGCTCCTGATATGGCATTCCCCCGAATAAACAACATAAGCTTCTGAC TTCTTCCCCCTTCTTTCCTGTTGCTACTTGCCTCTTCTGGGGTCGAAGCAGGCGCA GGAACCGGGTGAACTGTCTACCCCCCTCTTGCTGGTAACTTAGCACATGCCGGGG CCTCCGTAGACTTAACTATCTTTTCACTTCACCTTGCTGGTGTCTCCTCAATTTTA GGCGCCATTAACTTTATCACAACTATCATTAACATGAAGCCCCCTGCAATTTCAC AGTATCAAACTCCACTCTTTGTCTGAGCAGTACTAATTACAGCCGTGCTCCTTCTA CTATCTCTGCCCGTACTGGCTGCCGGCATCACAATACTACTAACAGACCGAAACT TAAATACTACCTTCTTTGACCCAGCAGGGGGAGGAGATCCCATCCTCTACCAACA CCTGTTTTGATTCTTTGGCCAC

>DRAM14 (Accn. No.MK012260) CCCAAAGACATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTTG GTACAGCCCTTAGCCTGCTAATTTTGGCGGAGTTGGCCCAACCTGGCGCTCTTTT AGGAGACGACCAAATTTATAATGTAATTGTTACTGTCCATGCTTTTATTATAATTT TGTTTATAGTAATACCAATCATAATTGGTGGGTTCGGAAACTGACTTGTCCCTTTA ATGATGGGGGCTCCTGATATGGCATTCCCCCGAATAAACAACATAAGCTTGTGAC TTCTCCCCCCTTCTTTCCTGTTGTTACTTGCCTTTTGGGGGGTGGAAGCAGGCGCA GGAACCGGGTGAACCGTCTACCCCCCTCTGGCTGGTAACTTAGCACATGCCGGGG CCTCCGTAGACTTAACTATCTTTTCACTTCACCTTGATGGTGTCTCCTCAATTTTA GGCGCCATTAACTTTATCACAACTATCATTAACATGAAGCCCCCTGCAATTTCAC

Page | 211

AGTATCAAACTCCAGTCTTTGTGTGAGCAGTACTAATTACAGCCGTGCTCCTTGT ACTAAGAATGCCCGTACTGGCTGCCGGCATCACAATAGTATTAACAGACCGAAA CTTAAATACTACCTTCTTTGACCCAGCAGGGGGAGGGGATCCCATCCTCTACCAA CACCTGTTTTGATTCTTTGGCCAC

Page | 212

Table 34. Population genetic diversity parameters based on Amblyceps mangois mtDNA COI partial coding sequences. Number Total Average Haplotype Nucleotide of number Number of number of (gene) diversity Tajima’s Fu and Fu and Populations variable of Haplotypes nucleotide diversity (Pi±SD) D Li’s D Li’s F sites (S) mutations (h) differences (Hd±SD) (Eta) (k) Terai Region 1 1 2 1.000±0.500 0.00146±0.00073 1.00000 - -1.62915 -1.70051 -1.87606 Not Not Not Dooars region 31 31 5 0.857±0.108 0.01206±0.00626 8.28571 significant, significant, significant, 0.10 > P > 0.10 > P > 0.10 > P > 0.05 0.05 0.05 Sub- -1.24832 -1.48896 -1.61277 Himalayan Not Not Not 33 33 7 0.911±0.077 0.01258±0.00512 8.64444 region (Terai + significant, significant, significant, Dooars) P > 0.10 P > 0.10 P > 0.10 N-E India 4 4 2 1.000±0.500 0.00657±0.00328 4.00000 - * COI, Cytochrome oxidase subunit I; SD, standard deviation; Four or more sequences are need to compute Tajima's and Fu and Li's statistics (Terai and North-East India population has two sequences each).

Page | 213

4.3.9.3 Genetic diversity and population structure of Amblyceps mangois The genetic diversity analysis was undertaken to determine the available genetic diversity in the mitochondrial COI partial CDS of Amblyceps mangois of the major river system of the Terai and Dooars region of sub-Himalayan West Bengal, India. The total number of variable sites were 1 and 31 in Terai and Dooars region respectively, and 33 when two regions were considered together i.e., sub-Himalayan region (Table 34). Total numbers of mutations were 1 and 31 in Terai and Dooars region populations respectively (Table 34). Total 7 haplotypes were found in the sub-Himalayan Terai and Dooars region population (Terai region=2 haplotypes and Dooars region=5 haplotypes). Total number of variable sites, mutations and haplotypes in north-east Indian populations were 4, 4 and 2. (Table 34). The haplotype diversity and nucleotide diversity of Terai region population were 1.000±0.500 and 0.00146±0.00073; Dooars region population were 0.857±0.108 and 0.01206±0.00626; and 0.911±0.077 and 0.01258±0.00512 in sub-Himalayan region respectively (Table 34). The haplotype diversity and nucleotide diversity of north-east Indian population were shown in Table 34. A study carried out by Boonkusol et al. (2016) on snakehead fish from Thailand and they have found total 33 haplotypes among 60 individuals and 14 haplotypes were shared by multiple populations and 19 haplotypes have been found to be population specific. They also found that haplotype and nucleotide diversity ranged from 0.750±0.096 to 1.000±0.052 and 0.00442±0.00083 to 0.2672±0.00216. In the study carried out by Du et al. (2009) on COI gene sequences of Sipunculus nudus sampled from three ecological regions along the southern coast of China, 16 haplotypes were defined for 26 individuals, and 71 polymorphic sites were observed. They also found the mean haplotype diversity and nucleotide diversity of the three populations of Sipunculus nudus analyzed were 0.9754 ± 0.0168 and 0.0035 ± 0.0018, respectively. Therefore, our present study reveals that the genetic diversity (number of haplotypes, haplotype diversity and nucleotide diversity) was dwindling in Amblyceps mangois population as evident from the mitochondrial COI study. The present findings is also in accordance with our previous study on Amblyceps mangois, where we have found that the overall genetic diversity (polymorphism, Nei’s genetic diversity and Shannon’s information index) was low as revealed by RAPD and ISSR marker analyses. The observed values of Tajima’s D, Fu and Li’s D and Fu and Li’s F analyses of Dooars region were -1.62915 (Not significant, 0.10 > P > 0.05), -1.70051 (Not significant, 0.10 > P > 0.05) and -1.87606 (Not significant, 0.10 > P > 0.05) and in sub-Himalayan region population were -1.24832 (Not significant, P > 0.10), -1.48896 (Not significant, P > 0.10) and

Page | 214

-1.61277 (Not significant, P > 0.10) respectively (Table 34). The neutral test was performed to ascertain the evidence of purifying or balancing selction. All the population gave negative values for Tajima’s D, Fu and Li’s D and Fu and Li’s F test, which indicated that the recent selective sweep, population expansion after a recent bottleneck (Tajima 1989; Fu and Li 1993). Thirumaraiselvi and Thangaraj (2015) studied six Eleutheronema tetradactylum populations from South Asian countries, and they found negative values for the tests and this indicated sudden population expansion of the Eleutheronema tetradactylum population.

Page | 215

4.3.9.4 Phylogenetic relationship of different populations of Amblyceps mangois based on COI gene.

Page | 216

Figure 31. Molecular Phylogenetic analysis of Amblyceps mangois by Maximum Likelihood method. The evolutionary history was inferred by using the Maximum Likelihood method based on the Jukes-Cantor model (Jukes and Cantor, 1969). The tree with the highest log likelihood (- 1086.2810) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 14 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated. There were a total of 609 positions in the final dataset. Evolutionary analyses were conducted in MEGA7. (Kumar et. al., 2016).

The maximum likelyhood method of phylogenetic analysis showed that six taxa (DRAM4, DRAM7, DRAM8, DRAM9, DRAM10 and DRAM12) from Dooars region form a distinct group (Figure 31). Whereas, DRAM14 appeared as an outlier individual completely isolated from others. Moreover, DRAM6, TRAM1 and TRAM2 form a cluster with the Bangladesh Amblyceps mangois sequence (i.e., DUZM140) and north-east Indian Amblyceps mangois populations (i.e., SGBK-OF31F and BCF11) make one distinct cluster (Figure 31). Interestingly, the phylogenetic analysis showed that a close association exist between the Amblyceps mangois population of Bangladesh with that of sub-Himalayan Terai region (TRAM1 and TRAM2), West Bengal. This phylogenetic association may be attributed to introduction of some Amblyceps mangois species from sub-Himalayan region to Bangladesh or vice-versa during past years.

Page | 217