Effects of Starvation on Energy Metabolism and Crustacean Hyperglycemic Hormone (CHH) of the Atlantic Ghost Crab Ocypode Quadrata (Fabricius, 1787)
Total Page：16
File Type：pdf, Size：1020Kb
Mar Biol (2016) 163:3 DOI 10.1007/s00227-015-2797-3 ORIGINAL PAPER Effects of starvation on energy metabolism and crustacean hyperglycemic hormone (CHH) of the Atlantic ghost crab Ocypode quadrata (Fabricius, 1787) A. S. Vinagre1,2 · J. Sook Chung2 Received: 28 July 2015 / Accepted: 7 December 2015 © Springer-Verlag Berlin Heidelberg 2016 Abstract Ocypode quadrata, a crab species found in OcqCHH cDNA sequence has the typical structure of sandy beaches along the western Atlantic coast, spends CHHs, and its expression did not change by starvation. the winter months underground without feeding. The main Starvation decreased hemolymphatic glucose, muscular objective of this work was to determine whether O. quad- glycogen and hepatopancreatic lipids. This implies that rata is naturally adapted to food deprivation for a period hepatopancreas lipolysis followed by β-oxidation, hepato- of time. The effects of starvation on the energy metabolism pancreas gluconeogenesis and muscular glycogenolysis and the expression levels of crustacean hyperglycemic hor- may be responsible for the energy requirements of O. quad- mone (CHH), known to have an adaptive role in response rata during nutritional stress. Taken together, these results to many types of environmental stresses, were investi- suggest that O. quadrata may be adapted to nutritional dep- gated. First, we isolated the full-length cDNA sequence rivation for an extended period of time. of OcqCHH and localized the cells producing CHH neu- ropeptide in eyestalk ganglia by immunostaining. Second, the levels of OcqCHH transcripts were determined in the Introduction fed and starved (15 days) intermolt crabs using qRT-PCR assay. The concentration of carbohydrate and lipids in the Crabs of the genus Ocypode (Family Ocypodidae), known hemolymph, muscle and hepatopancreas was measured. as ghost crabs, are conspicuous inhabitants of tropical and subtropical sandy beaches worldwide (Schlachter et al. 2013). Ocypode quadrata (Fabricius 1787) is commonly Responsible Editor: H.O. Pörtner. found on sandy beaches along the Western Atlantic coast, Reviewed by undisclosed experts. from the state of Rhode Island in the northeastern USA (42°N and 70°W) to the state of Rio Grande do Sul (30°S Electronic supplementary material The online version of this and 50°W) in Southern Brazil (Melo 1999). article (doi:10.1007/s00227-015-2797-3) contains supplementary Ocypode quadrata is a top carnivore in a simple filter- material, which is available to authorized users. feeding-based food web (Fales 1976; Branco et al. 2010). * A. S. Vinagre As a facultative scavenger, O. quadrata consumes fresh [email protected] beached fish for example, and as an active predator, it feeds on live prey such as the mole crabs Emerita talpoidea, 1 Programa de Pós‑Graduação em Ciências Biológicas: Fisiologia, Laboratório de Metabolismo e Endocrinologia coquina clams Donax variabilis and sea turtles eggs/hatch- Comparada (LAMEC), Department of Physiology, Instituto lings at US sandy beaches (Fales 1976; Wolcott 1978). This de Ciências Básicas da Saúde (ICBS), Universidade Federal flexibility of feeding behavior is also characteristic of other do Rio Grande do Sul (UFRGS), Rua Sarmento Leite, 500, crabs of the genus Ocypode and is influenced by the abun- Porto Alegre, RS CEP 90050‑170, Brazil dance and type of food available at studied sites (Branco 2 Institute of Marine and Environmental Technology, et al. 2010; Schlachter et al. 2013). Columbus Center, University of Maryland Center for Environmental Science, 701 E. Pratt Street, Baltimore, In temperate beaches, the activities of O. quadrata MD 21202, USA are related to the seasonal variations, especially in air 1 3 3 Page 2 of 11 Mar Biol (2016) 163:3 temperature. Whenever the temperature is below 16 °C, the KM052164) was isolated. Then, the levels of OcqCHH crabs remain inside their burrows (Milne and Milne 1946; transcripts in the eyestalk ganglia and the concentrations Haley 1972; Alberto and Fontoura 1999; Antunes et al. of metabolites in hemolymph, muscle and hepatopancreas 2010; Corrêa et al. 2014). Since the winter also affects were measured in starved and fed crabs. food availability, it was suggested that O. quadrata starves during this period (Wolcott 1978). According to McCue (2010), starvation and fasting are distinct physiological Materials and methods conditions: Fasting is a post-absorptive period, when ani- mals are involved in various activities such as avoiding Animals predators, territorial defense and reproduction; while star- vation is also a post-absorptive status, it occurs when the Ocypode quadrata were collected in Wachapreague animal is willing or able to feed; however, there are limita- (37.61°N and 75.69°W, VA, USA) and kept overnight at tions in food resources. In crustaceans, nutritional depriva- the Eastern Shore Laboratory, Virginia Institute of Marine tion can occur in their life for different reasons. They can Sciences (VIMS). The crabs were transported to the Aqua- fast as the result of winter torpor or behavioral modifica- culture Research Center (ARC), Institute of Marine and tions during spawning/mating and ecdysis despite sufficient Environmental Technology, Baltimore, MD, USA. The food supply, or they can face periods of starvation when crabs were kept in aquaria (19 L) filled with sterilized there are limitations in food resources (Vinagre and Da sand (to eliminate possible contamination of microorgan- Silva 1992; Hervant et al. 1999; Hervant and Renault 2002; isms), provided with a bowl containing artificial seawater at Pellegrino et al. 2008, 2013). 30 ppt salinity, 12L/12D photoperiod, 25 2 °C. In order ± In decapod crustaceans, the main hormone responsible to mimic their natural diet, the crabs were fed with clams, for glucose homeostasis is the crustacean hyperglycemic krill, shrimp or silversides (Table 1) every other day around hormone (CHH). This hormone is mainly secreted from 6 p.m. (Weinstein and Full 1998; Tullis and Andrus 2011). the eyestalk X-organ-sinus gland system, particularly in response to stress conditions such as hypoxia, hypo- and Molecular isolation of the full-length OcqCHH hyperthermia, hyper- and hypo-salinity, infection, exer- (Ocypode quadrata crustacean hyperglycemic hormone) cise or walking (Chang et al. 1998; Stentiford et al. 2001; Chung and Webster 2005; Chung et al. 2010; Morris et al. Molecular cloning and sequencing 2010; Webster et al. 2012). The increase in the circulating levels of CHH is followed by hyperglycemia possibly via Eyestalk ganglia were microscopically dissected from glycogenolysis in muscle and hepatopancreas (Chung et al. ice-chilled crabs and frozen immediately on dry ice. Total 2010; Nagai et al. 2011; Webster et al. 2012; Katayama RNAs were extracted using Qiazol Reagent (Qiagen), and et al. 2013). This adaptive role of CHH in response to these their integrity and quantity were evaluated using a Nan- environmental stresses is well described, whereas few stud- oDrop spectrophotometer (Thermo Scientific). One to ies have been carried out to define the role of CHH during three micrograms of total RNAs was subject to 5′ and 3′ starvation. RACE cDNA syntheses using SMART™ cDNA Amplifi- Given that O. quadrata has been considered as a star- cation kit (BD Bioscience) by following the manufacturer’s vation-adapted (tolerant) species, we aimed to investigate instructions. A two-step PCR assay was carried out using the effects of starvation on energy metabolism and the three CHH degenerate primers described in Chung et al. expression levels of CHH. Therefore full-length cDNA (2009, 2015) (Table 2) by following the procedures as of O. quadrata CHH (OcqCHH, GenBank accession no. stated (Chung et al. 2009, 2015). In the first step, touch- down (TD) PCR, the annealing temperatures ranged from 54 to 50 °C for eight cycles and 30 cycles at 55 °C, exten- Table 1 Composition of the diet fed to O. quadrata (adapted from sion temperature 68 °C. In the second step, nested PCR, the manufactures’ information) the annealing temperature was 59 °C and extension tem- Name Brand Protein% Fat% Fiber% Moisture% perature 72 °C for 35 cycles. The identified PCR band was subject for sequencing as described (Chung et al. 2009, Krill PROSACT 13.9 3.3 0.3 83.6 2015). Based on the initial sequence of OcqCHH, gene- Silversides PROSACT 13.9 2.8 0.2 78.5 specific primers for obtaining the full-length cDNA were Mysis shrimp HIKARI 10.5 1.0 2.0 85.0 generated (Table 2) and amplified using the procedures Clam on a half HIKARI 12.8 1.8 1.6 88.7 described in Chung et al. (2009, 2015), except the anneal- shell ing temperature (59 °C). The remaining cloning procedures Average 12.9 2.2 1.0 83.9 were as stated (Chung et al. 2009, 2015). The putative open 1 3 Mar Biol (2016) 163:3 Page 3 of 11 3 Table 2 Primer sequences used for isolating the full-length CHH temperature. Subsequently, these ganglia were washed, cDNA sequence of O. quadrata and qRT-PCR assay incubated with the goat-antirabbit-IgG labeled with Alexa Primer sequences (5′–3′) 448 (Invitrogen) at a 1:100 dilution. The samples were examined using a confocal microscope (Bio-Rad), and CHH dF1 TGYAARGGNGTNTAYGA images were collected using Z projections (Chung and CHH dF2 CATRCAYTGNCKRAANAC Zmora 2008; Chung et al. 2012). CHH dR1 GAYTTYATHGCNGCNGGNAT Ocq CHH 3F1 CCTCTTCAGCAAACTGGAACACGTTTG Effects of starvation on the metabolism of O. quadrata Ocq CHH 3F2 ACTGGAACACGTTTGCGACGACT Ocq CHH 3F3 CGTACCTCATATGTGGCCAGCGC Experimental setup Ocq CHH 3F4 (start) ATGACTTCCAGAATGACCTCCG- TAGCAGT The crabs were individually housed in same size aquaria Ocq CHH 5R1 AGGTTGCTGTAGCAGTTTGACCTG (19 L) partially filled with sterilized sand as described Ocq CHH 5R2 CTGCATGCGCTGGCCACATATGAGGT above (Supplementary Figure 1). During an acclimation Ocq CHH 5R3 CAAACGTGTTCCAGTTTGCTGAAGAGG period of 10 days, the crabs were fed with clams, krill, Ocq CHH 5R4 (end) TTACTTCTTCCTGCCGACGACTTGTATAG shrimp or silversides (Table 1) every other day around Ocq RL10 3F1 ACGTGCGGGTGCGCCTTCACCCATTC- 6 p.m.