DOCSLIB.ORG

The Activation-Induced Deaminase Functions in a Postcleavage Step of the Somatic Hypermutation Process

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Activation-Induced Deaminase Functions in a Postcleavage Step of the Somatic Hypermutation Process Brief Definitive Report The Activation-induced Deaminase Functions in a Postcleavage Step of the Somatic Hypermutation Process F. Nina Papavasiliou1 and David G. Schatz2 1Laboratory of Lymphocyte Biology, The Rockefeller University, New York, NY 10021 2Section of Immunobiology, Howard Hughes Medical Institute, Yale University School of Medicine, New Haven, CT 06520 Abstract Activation of B cells by antigen fuels two distinct molecular modifications of immunoglobulin (Ig) genes. Class-switch recombination (CSR) replaces the Ig␮ heavy chain constant region with a downstream constant region gene, thereby altering the effector function of the resulting antibodies. Somatic hypermutation (SHM) introduces point mutations into the variable regions of Ig genes, thereby changing the affinity of antibody for antigen. Mechanistic overlap between the two reactions has been suggested by the finding that both require the activation-induced cytidine deaminase (AID). It has been proposed that AID initiates both CSR and SHM by ac- tivating a common nuclease. Here we provide evidence that cells lacking AID, or expressing a dominant negative form of the protein, are still able to incur DNA lesions in SHM target se- quences. The results indicate that an intact cytidine deaminase motif is required for AID func- tion, and that AID acts downstream of the initial DNA lesions in SHM. Key words: somatic hypermutation • AID • DNA double-strand breaks • B lymphocyte • Ig gene Introduction One of the hallmarks of the immune system is the ability to absolutely dependent on the presence of the Ig enhancers. recognize large numbers of antigens. In the mouse and hu- Because of this reliance on promoter and enhancer elements, man B cell repertoires, diversity is generated by two dis- it is has been suggested that the targeting step of hypermuta- tinct processes; the primary repertoire is generated in the tion is linked to transcription, although whether it is coupled bone marrow by V(D)J recombination (1). Its further di- to the transcription process per se or to a general require- versification involves the antigen-driven introduction of ment for locus accessibility remains unclear (4–6). point mutations into the V regions of Ig genes (1). This SHM was originally hypothesized to be a two-step pro- process of somatic hypermutation (SHM) gives rise to fam- cess, initiated by cleavage of the DNA within the mutating ilies of related mutant antibodies which are then selected region, and subsequently resolved by error-prone repair for their binding affinity to the immunizing antigen (2). (7). There is strong circumstantial evidence to suggest that During hypermutation, the V regions of Ig genes accu- the cleaved DNA intermediate is a DNA double-strand mulate single nucleotide substitutions and occasional inser- break, as V regions of hypermutating cells incur DSBs on tions and deletions. Many of the mutations occur at specific hotspots and at high rates (8, 9). Furthermore, the initiation residues (hotspots), suggesting that the sequence surrounding of DSB formation has been shown to require the same ele- a hotspot might be the target of a putative mutator complex ments which regulate the introduction of mutations (tran- (3). Yet whenever the V gene has been replaced with artifi- scription and the presence of the enhancer) (8, 9). These cial substrates, those substrates hypermutate successfully (3), hypermutation-associated DSBs are abundant in the G2 and so the sequence of the V gene itself does not initiate the (postreplicative) phase of the cell cycle, and thus it has been mutation process. Surprisingly, the specific V region pro- suggested that they are repaired by homologous recombi- moter can be replaced by heterologous promoters without a nation between sister chromatids (8). detrimental effect on hypermutation (3), but the process is Even though it has been extensively studied, little is known about the molecular mechanism of the SHM pro- cess. The only known protein whose loss of function leads Address correspondence to F. Nina Papavasiliou, Laboratory of Lympho- cyte Biology, The Rockefeller University, Box 39, 1230 York Ave., to a significant downregulation (if not total ablation) of hy- New York, NY 10021. Phone: 212-327-7857; Fax: 212-327-7319; permutation is the recently discovered activation-induced E-mail: [email protected] cytidine deaminase (AID) (10, 11). Yet, the function of 1193 J. Exp. Med. The Rockefeller University Press • 0022-1007/2002/05/1193/6 $5.00 Volume 195, Number 9, May 6, 2002 1193–1198 http://www.jem.org/cgi/doi/10.1084/jem.20011858 AID in somatic hypermutation is far from clear, and its ef- start Taq (QIAGEN) and combinations of the following primers: fect might not even be direct, as AID is thought to be an human AID, hAID left GTCCGCTGGGCTAAGGGTCGGCG RNA-editing enzyme (12). It has been postulated that AID hAID right GCACCCCGGCGCGGTGCAGCCG; and human edits the mRNA of the endonuclease responsible for the c-myc, c-myc left CCGCCCGCGGCCACAGCGTC c-myc DNA lesions in both CSR and SHM (10). Alternatively, right CGCCTCTTGACATTCTCCTCGGTGTC. Flow Cytometry and Cell Sorting. To purify germinal center B AID might be responsible in editing the mRNA of a factor cells, we pooled spleens from mice at 14 d after immunization (or factors) responsible for orchestrating DSB repair. Here with NP-CGG in alum (Biosearch Technologies, Inc.), and sepa- we report that SHM-associated DSBs are still present in rated the resting and activated lymphocytes on a Percoll gradient cells lacking AID, or expressing a dominant negative form (Amersham Pharmacia Biotech). Cells were stained with the of the protein. Our results indicate that AID acts down- pan-B cell marker B220 (phycoerythrin) and the B/T activated stream of the initial DNA lesions in SHM, possibly by edit- cell marker GL-7 (FITC) (both from BD PharMingen), and ing the RNA of a repair factor. sorted on a Becton Dickinson FACSVantage™. Sorted cells were immediately embedded in agarose for further analysis. For the cell cycle study, standard methods were used (16). All analyses of flow Materials and Methods cytometric data were performed using the FlowJo™ software Plasmid Constructs. The AID cDNA was amplified from Ra- package (Treestar). mos cDNA and the H56R/E58Q mutations in AID were intro- duced with the QuikChange™ kit (Stratagene). To generate the bacterial expression vectors, AID or AID DN were indepen- Results dently cloned into pET3d in frame with GST, to generate the An AID Catalytic Mutant Has No Deaminase Activity. wild-type GST-AID or GST-AID DN fusion gene, respectively. The primary sequence of AID shares highest sequence sim- The proteins were expressed in BL21 ␭DE3 cells and purified with glutathione sepharose 4B resin, according to the manufac- ilarity with Apobec-1 (12) (Fig. 1 A), the prototypic RNA- turer’s instruction (Amersham Pharmacia Biotech). editing cytidine deaminase (14). Cytidine deaminases in To generate the retroviral expression vectors, the AID DN general share a conserved active site motif consisting of a ϩ cDNA was cloned into the pMSCV retroviral expression vector histidine and two cysteines which coordinate Zn2 , and a (CLONTECH), engineered to express either GFP or a puromy- glutamate which serves as a proton donor in the deamina- cin resistance gene from an internal phosphoglycerol kinase (pgk) tion reaction (17). Replacement of any of these four amino promoter. acids results in a catalytic mutant (18). We generated an Ϫ Ϫ Mice and Cell Culture. AID / (10) mice have been de- AID protein mutated in two of these residues (H56R/ scribed previously. The Ramos (RA-1) cell line was obtained E58Q) and expressed both the mutant and wild-type pro- from the American Type Culture Collection and grown as de- teins in Escherichia coli. The wild-type protein was active in scribed previously (13). For retroviral infections, pMSCV or pM- SCV-AID DN, along with the packaging plasmid pkat (14), were an in vitro deamination assay while the catalytic mutant cotransfected into 293T cells by calcium phosphate precipitation was not (Fig. 1 B). and viral supernatants harvested 48 h after transfection were used All except one of the known cytidine deaminases act as to infect cells. homodimers or homotetramers (19), and hence catalytic Deamination Assay. The deamination assay was performed as mutants can have a dominant negative effect (19, 20). A se- described previously (15). Briefly, 100 ␮g of protein was added to ries of leucines in the carboxy terminus of Apobec-1 is a mix containing 25 ␮mol Tris-HCl, pH 7.05, and 1 ␮mole cyti- thought to be important for dimerization (20), and even dine (1 ml final volume). At different times, 100 ␮l samples were though there is low sequence homology between AID and added to 900 ␮l of 0.5 M ice-cold perchloric acid and the mix- Apobec-1 in that region, these leucines are conserved in ture was centrifuged. The absorbance of the supernatant was AID. Furthermore, secondary structure prediction algo- measured at 290 nm. Under these conditions, the difference in rithms (21) model the carboxy terminus as almost entirely the molar extinction coefficient between cytidine and uridine is ␣ 10.1 ϫ 106 cm2 per mol (15). -helical with a potential for coiled coil formation (Fig. 1 LM-PCR and RT-PCR. Cells were embedded in agarose C). Hence the H56R/E58Q mutant AID (henceforth AID and genomic DNA prepared as described previously (8). The DN) might display a dominant negative phenotype. sequences of gene specific primers not described in (8) were as AID DN Interferes with SHM. To determine the effect follows: mouse VH186.2, VH186.2 L1 TTCTTGGCAGCAA- of the putative dominant negative protein on SHM, we ex- CAGCTACAGGTAAGG VH186.2 L2 GCAGGCTTGAG- pressed the protein in the human Burkitt lymphoma cell GTCTGGACATATACATG probe GACATCCACTTTGC- line Ramos, which hypermutates constitutively in culture CTTTCTCTCCACAGGTG; mouse V␭1, V␭1 L1 GTT- (13).
Load more

Recommended publications
  • Faster Growth with Shorter Antigens Explains a VSG Hierarchy During African Trypanosome Infections: a Feint Attack by Parasites
    bioRxiv preprint doi: https://doi.org/10.1101/131029; this version posted April 26, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Faster growth with shorter antigens explains a VSG hierarchy during African trypanosome infections: a feint attack by parasites Dianbo Liu1, Luca Albergante1,2, David Horn1,*, Timothy Newman1,* 1School of Life Sciences, University of Dundee, Dundee, UK 2U900, Institut Curie, 75005, France *These authors contributed equally Correspondence to [email protected] and [email protected] Abstract The parasitic African trypanosome, Trypanosoma brucei, evades the adaptive host immune response by a process of antigenic variation that involves the clonal switching of variant surface glycoproteins (VSGs). The VSGs that periodically come to dominate in vivo display a hierarchy, but how this hierarchy arises is not well-understood. Combining publicly available genetic data with mathematical modelling, we report a VSG-length-dependent hierarchical timing of clonal VSG dominance in a mouse model, revealing an inverse correlation between VSG length and trypanosome growth-rate. Our analysis indicates that, among parasites switching to new VSGs, those expressing shorter VSGs preferentially accumulate to a detectable level that is sufficient to trigger an effective immune response. Subsequent elimination of faster-growing parasites then allows slower parasites with longer VSGs to accumulate. This interaction between the host and parasite is able by itself to explain the temporal distribution of VSGs observed in vivo.
    [Show full text]
  • Analysis of Activation Induced Cytidine Deaminase Using Atomic Force Microscopy by C David J
    Analysis of Activation Induced Cytidine Deaminase using Atomic Force Microscopy by c David J. G. Gale A dissertation submitted to the School of Graduate Studies in partial fulfillment of the requirements for the degree of Master of Science Department of Chemistry Memorial University of Newfoundland April 2021 St. John’s Newfoundland Abstract Activation induced cytidine deaminase (AID) plays a large part within the pathway of immunoresponse. It does so by inserting mutations, during DNA replication, in B cells (immune system cells). This results in a more diverse set of antibodies in each subsequent generation. However, mutations that cause infinite replication with no cellular apoptosis, can lead to cancer. AID has been implicated in cancers which appear independent of the expected environmental causes, such as smoking or UV exposure. The method for AID mutations involves binding to single-strand DNA. Using Atomic Force Microscopy (AFM) we obtained both the geometry or topology, as well as the nanomechanical information about this mutation process and AID. In this thesis, I present the first AFM images of AID, showing direct structural information about the protein. Although the measurements are done in vitro, physiological con- ditions have been approximated in order to get an accurate analysis of the protein system. To allow imaging in buffer, suitable substrates were tested and identified which would bind the protein sufficiently in this high ionic strength environment. Optimized plating and scan conditions for AID in both wet and dry conditions are described, which allow high resolution imaging to be performed that is not often seen in biological systems. Through the many scans and procedural changes it was estab- lished that although difficult it is possible to gain an image of AID through the use ii of AFM.
    [Show full text]
  • A Model for Interclonal Competition in the Germinal Center: Dynamic Selection Processes By-Pass the Affinity Dead-End of Low Affinity Anti-NP Specific B Cells
    A model for interclonal competition in the germinal center: Dynamic selection processes by-pass the affinity dead-end of low affinity anti-NP specific B cells Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer nat. vorgelegt von Andreas Acs aus Timisoara Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg Tag der mündlichen Prüfung: 15. Februar 2019 Vorsitzender des Promotionsorgans: Prof. Dr. Georg Kreimer Gutachter/in: Prof. Dr. Thomas Winkler PD Dr. rer. nat. Dr. habil. med. Dirk Mielenz Table of contents Table of contents 1 Zusammenfassung ............................................................................................................ 1 1 Summary ............................................................................................................................ 2 2 Introduction ....................................................................................................................... 3 2.1 B cell development ........................................................................................................ 3 2.1.1 Stages of B cell development are defined by recombination events of the B cell receptor in the bone marrow ........................................................................................... 3 2.12 GOD – Generation of diversity ................................................................................ 4 2.1.3 Migration of B
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]
  • The David Rockefeller Graduate Program 2011-2012 the David Rockefeller Graduate Program 2011-2012
    THE DAVID ROCKEFELLER GR ADUATE PROGR AM 2011-2012 Published by The Rockefeller University Office of Communications and Public Affairs The david rockefeller graduate program 2011-2012 PRESIDENT’S MESSAGE 2 DEAN’S MESSAGE 5 ACADEMIC PROgrams 6 RESEARCH Areas 12 FACILITIES 17 STUdent LIFE 20 AdmissiONS AND SCHEDULE OF COUrses 25 LIFE AFTER ROCKEFELLER 30 PRESIDENT’S MESSAGE “For MORE THAN A CENTURY, THE ROCKEFELLER UNIVERSITY HAS FUL- FILLED THE MISSION MY GRANDFATHER HAD ENVISIONED, TO PRODUCE DISCOVERIES THAT WOULD BENEFIT HUMANKIND. IT HAS BECOME ONE OF THE world’s GREAT MEDICAL RESEARCH INSTITUTions.” DAVID ROCKEFELLER, LIFE TRUSTEE For me, neuroscience was love at first sight. Understanding the brain and wanting to know how to deconstruct and resolve its complexity fueled my career initially and still motivates me in my lab today. People fall in love with science at differ- ent times in their lives and bring their own perspective to learning and doing science, but the common denominator is an excitement and curiosity to understand the world around them — that’s what The Rockefeller University’s graduate pro- gram is designed to nurture. It is also what fuels Rockefeller’s world-class faculty, who push the boundaries of knowledge with their innovative approaches to scientific discovery. In an environment without departments that supports freedom to explore different areas of science, both students and faculty chart their own paths. For faculty, it enables research that has led to pioneering discoveries with the potential to erad- icate disease and reduce suffering for millions. For students, it provides flexibility to work with more than one professor on their chosen thesis topic.
    [Show full text]
  • An Adenosine-To-Inosine Trna-Editing Enzyme That Can Perform C-To-U Deamination of DNA
    An adenosine-to-inosine tRNA-editing enzyme that can perform C-to-U deamination of DNA Mary Anne T. Rubio*, Irena Pastar†, Kirk W. Gaston*, Frank L. Ragone*‡, Christian J. Janzen§, George A. M. Cross§, F. Nina Papavasiliou†¶, and Juan D. Alfonzo*‡ʈ *Department of Microbiology and the Ohio State RNA Group, and the ‡Ohio State Biochemistry Program, Ohio State University, Columbus, OH 43210; and †Laboratory of Lymphocyte Biology and §Laboratory of Molecular Parasitology, The Rockefeller University, New York, NY 10021 Communicated by Norman R. Pace, University of Colorado, Boulder, CO, March 20, 2007 (received for review February 24, 2007) Adenosine-to-inosine editing in the anticodon of tRNAs is essential otide cytidine deaminases (CDAs) acting on RNA (like the for viability. Enzymes mediating tRNA adenosine deamination in APOBEC family of enzymes) or DNA (like AID, the activation- bacteria and yeast contain cytidine deaminase-conserved motifs, induced deaminase). tRNA-editing adenosine deaminases suggesting an evolutionary link between the two reactions. In [adenosine deaminases acting on tRNA (ADATs)] that target trypanosomatids, tRNAs undergo both cytidine-to-uridine and ade- the anticodon belong to the CDA superfamily and harbor its nosine-to-inosine editing, but the relationship between the two characteristic H(C)XE and PCXXC metal-binding signature reactions is unclear. Here we show that down-regulation of the sequences (4, 6–10). Thus, although anticodon-specific ADATs Trypanosoma brucei tRNA-editing enzyme by RNAi leads to a reduc- structurally resemble CDAs, they modify adenosine, suggesting tion in both C-to-U and A-to-I editing of tRNA in vivo.
    [Show full text]
  • Antigens Cell-Independent Or T Cell-Dependent Induced Early In
    Long-Lived Bone Marrow Plasma Cells Are Induced Early in Response to T Cell-Independent or T Cell-Dependent Antigens This information is current as of October 2, 2021. Alexandra Bortnick, Irene Chernova, William J. Quinn III, Monica Mugnier, Michael P. Cancro and David Allman J Immunol 2012; 188:5389-5396; Prepublished online 23 April 2012; doi: 10.4049/jimmunol.1102808 Downloaded from http://www.jimmunol.org/content/188/11/5389 Supplementary http://www.jimmunol.org/content/suppl/2012/04/24/jimmunol.110280 Material 8.DC1 http://www.jimmunol.org/ References This article cites 48 articles, 23 of which you can access for free at: http://www.jimmunol.org/content/188/11/5389.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on October 2, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Long-Lived Bone Marrow Plasma Cells Are Induced Early in Response to T Cell-Independent or T Cell-Dependent Antigens Alexandra Bortnick,* Irene Chernova,* William J.
    [Show full text]
  • Functional Insights from a Surface Antigen Mrna-Bound Proteome
    RESEARCH ARTICLE Functional insights from a surface antigen mRNA-bound proteome Larissa Melo do Nascimento1, Franziska Egler1, Katharina Arnold1, Nina Papavasiliou2, Christine Clayton1, Esteban Erben1,2†* 1Centre for Molecular Biology of Heidelberg University (ZMBH), Heidelberg, Germany; 2Division of Immune Diversity, Deutsche Krebsforschungszentrum (DKFZ), Heidelberg, Germany Abstract Trypanosoma brucei is the causative agent of human sleeping sickness. The parasites’ variant surface glycoprotein (VSG) enables them to evade adaptive immunity via antigenic variation. VSG comprises 10% of total cell protein and the high stability of VSG mRNA is essential for trypanosome survival. To determine how VSG mRNA stability is maintained, we used mRNA affinity purification to identify all its associated proteins. CFB2 (cyclin F-box protein 2), an unconventional RNA-binding protein with an F-box domain, was specifically enriched with VSG mRNA. We demonstrate that CFB2 is essential for VSG mRNA stability, describe cis acting elements within the VSG 3’-untranslated region that regulate the interaction, identify trans-acting factors that are present in the VSG messenger ribonucleoprotein particle, and mechanistically explain how CFB2 stabilizes the mRNA of this key pathogenicity factor. Beyond T. brucei, the mRNP purification approach has the potential to supply detailed biological insight into metabolism of relatively abundant mRNAs in any eukaryote. *For correspondence: [email protected] Present address: †Instituto de Investigaciones Biotecnolo´gicas, Introduction Universidad Nacional de San In the cytosol, eukaryotic mRNAs interact with numerous proteins that influence mRNA folding, Martı´n, Provincia de Buenos Aires, Argentina localization, translation efficiency, and longevity (Khong and Parker, 2020). The resulting messenger ribonucleoprotein (mRNP) contains, on average, about 15 proteins (and sometimes also regulatory Competing interest: See RNAs) which may have competing activities and change during the lifetime of the mRNA page 20 (Khong and Parker, 2020).
    [Show full text]
  • The David Rockefeller Graduate Program Non-Departmental Campus Promotes In- 2Alumni Have Teractions Between Won the Nobel Fields Prize
    2012–2013 THE DAVID ROCKEFELLER GRADUATE PROGRAM NON-DEPARTMENTAL CAMPUS PROMOTES IN- 2ALUMNI HAVE TERACTIONS BETWEEN WON THE NOBEL FIELDS PRIZE LIVE ON BEAUTIFUL, LUSH 37 CAMPUS IN THE HEART COUNTRIES OF NEW YORK CITY REPRESENTED BY STUDENTS 10 HEADS OF LAB ARE ALUMNI FULL FELLOWSHIP FUNDING FOR ALL STUDENTS PRESIDENT’S MESSAGE 2 DEAN’S MESSAGE 4 1 ACADEMIC PROGRAMS 6 FACULTY AND RESEARCH 12 STUDENT LIFE 20 ADMISSIONS AND SCHEDULE OF COURSES 26 PRESIDENT’S MESSAGE For me, neuroscience was love at first sight. Understanding the brain and wanting to know how to deconstruct and resolve its complexity fueled my career ini- tially and still motivates me in my lab today. People fall in love with science at different times in their lives and for dif- ferent reasons, but the common denominator is an excite- ment and curiosity to understand the world around them — that’s what The Rockefeller University’s graduate program is designed to nurture. It is also what drives Rockefeller’s world-class faculty, who push the boundaries of knowledge with their innovative approaches to scientific discovery. In an environment that aims to foster independence and freedom, both students and faculty chart their own paths. For faculty, this culture has led to pioneering discoveries with the potential to eradicate disease and reduce suffering for millions. For students, it provides flexibility to work with more than one professor on their chosen thesis topic. For both, it enables collaboration and interdisciplin- ary research, which are the university’s hallmarks. Rockefeller is truly unique, as it exists solely to support science; thus, every aspect of the administration is dedicated to the success of our scientists.
    [Show full text]
  • APOBEC2 Is a Transcriptional Repressor Required for Proper Myoblast Differentiation 2 3 Jose Paulo Lorenzo1a, Linda Molla2a, Ignacio L
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.29.223594; this version posted May 13, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 APOBEC2 is a Transcriptional Repressor required for proper Myoblast Differentiation 2 3 Jose Paulo Lorenzo1a, Linda Molla2a, Ignacio L. Ibarra3,4, Sandra Ruf1, Jana Ridani5,6, 4 Poorani Ganesh Subramani5,6, Jonathan Boulais5, Dewi Harjanto2, Alin Vonica7, Javier M. Di 5 Noia5,6,8, Christoph Dieterich9, Judith B. Zaugg3, F. Nina Papavasiliou*1,2 6 7 Affiliations: 8 1 Division of Immune Diversity, German Cancer Research Center (DKFZ), 69120 9 Heidelberg, Germany 10 Faculty of Biosciences, Heidelberg University, 69117 Heidelberg, Germany 11 2 Laboratory of Lymphocyte Biology, The Rockefeller University, New York, NY 10065, USA 12 3 Structural and Computational Biology Unit, European Molecular Biology Laboratory, 13 Heidelberg, Germany 14 4 Institute of Computational Biology, Helmholtz Zentrum München, German Research Center 15 for Environmental Health, Neuherberg, Germany 16 5 Institut de Recherches Cliniques de Montréal, 110 av. des Pins Ouest, Montréal, QC, 17 Canada H2W 1R7 18 6 Department of Medicine, Division of Experimental Medicine, McGill University, 1001 boul 19 Decarie, Montréal, QC, Canada H4A 3J1 20 7 Department of Biology, The Nazareth College, Rochester, NY 14618, USA 21 8 Department of Medicine, Université de Montréal, C.P. 6128, succ. Centre-ville, Montréal, 22 QC, Canada, H3C 3J7 23 9 Klaus Tschira Institute for Integrative Computational Cardiology, University Hospital 24 Heidelberg, Heidelberg, Germany 25 26 aThese authors contributed equally to the work 27 *Corresponding Author: F.
    [Show full text]
  • An Overview of the C-To-U RNA Editing Machinery and Its Implication in Human Disease
    G C A T T A C G G C A T genes Review RNA Editors, Cofactors, and mRNA Targets: An Overview of the C-to-U RNA Editing Machinery and Its Implication in Human Disease Taga Lerner 1,2, F. Nina Papavasiliou 1,* and Riccardo Pecori 1,* 1 Division of Immune Diversity, Program in Cancer Immunology, German Cancer Research Centre, 69120 Heidelberg, Germany; [email protected] 2 Division of Biosciences, Uni Heidelberg, 69120 Heidelberg, Germany * Correspondence: [email protected] (F.N.P.); [email protected] (R.P.); Tel.: +49-6221-42-1399 (R.P.) Received: 1 November 2018; Accepted: 20 December 2018; Published: 27 December 2018 Abstract: One of the most prevalent epitranscriptomic modifications is RNA editing. In higher eukaryotes, RNA editing is catalyzed by one of two classes of deaminases: ADAR family enzymes that catalyze A-to-I (read as G) editing, and AID/APOBEC family enzymes that catalyze C-to-U. ADAR-catalyzed deamination has been studied extensively. Here we focus on AID/APOBEC- catalyzed editing, and review the emergent knowledge regarding C-to-U editing consequences in the context of human disease. Keywords: RNA editing; epitranscriptome; neurological disorders; AID/APOBEC 1. Introduction Epitranscriptomics is a recently coined term that refers to the study of RNA modifications and their effects on the transcriptome. Included under this umbrella is everything from RNA tertiary structure, to processing, stability, localization, and translational efficiency. To date, more than 150 distinct types of RNA modifications have been identified, primarily in ribosomal RNA (rRNA) and transfer RNA (tRNA) [1].
    [Show full text]
  • Deutsches Krebsforschungszentrum German Cancer Research Center Foundation Under Public
    Deutsches Krebsforschungszentrum BOARD OF TRUSTEES German Cancer Research Center Helmholtz Programs and VICE CHAIRWOMAN CHAIRWOMAN CHAIRMAN OF THE Foundation under public law SCIENTIFIC COMMITTEE Private Research Funding Data Protection Officer Compliance Monitoring Internal Auditing Ministerialdirigentin Ministerialdirektorin Prof. Dr. rer. pol. Michael Westermann N. N. Dr. rer. nat. Tim Rudelitz Im Neuenheimer Feld 280 Dr. Simone Schwanitz Prof. Dr. Prof. Dr. Josef Puchta Sigrun Mink 69120 Heidelberg Ministry of Science, Veronika von Messling Raymond N. DuBois 5444 1673 1675 2169 2659 Research and the Arts Federal Ministry of Strategic Communication Helmholtz International Equal Opportunities Baden-Württemberg Education and Research Tel. 06221 42-0 and Public Relations Cancer Prevention Graduate School for Cancer Representative Fax 06221 42-2995 Research SCIENTIFIC COUNCIL Dr. rer. pol. Dr. rer. nat. Dr. Lorenza Alice D'Alessandro www.dkfz.de MANAGEMENT BOARD Katharina Gudd Katrin Schaller (in ch.) Dr. rer. nat. Lindsay Murrells 2854 3016 2141 4485 Chairman and Chairwoman Scientific Director Administrative Director Radiation Protection August 2020 Staff Representative and Dosimetry Safety Medical Services Prof. Dr. Ana Martin-Villalba Prof. Dr. med. Ursula Weyrich Chair Dr. rer. nat. Annekathrin Kollenda Prof. Dr. med. 2867 Michael Baumann 2860 Rolf Schmitt Asja Pfaffenberger Walther Heipertz 2850 2779 3483 2864 2489 Research Program Research Program Research Program Research Program Research Program Research Program Cell Biology and Tumor Biology Functional and Structural Genomics Cancer Risk Factors Immunology Imaging and Radiooncology Infection, Inflammation and Cancer Core Facilities Administration and Prevention and Cancer Speaker Speaker Speaker Speaker Speaker Speaker Transfer of Information Prof. Dr. rer. nat. Prof. Dr. rer. nat. Prof. Dr.
    [Show full text]