Analysis of Flower Color Variation in Carnation (Dianthus Caryophyllus L.) Cultivars Derived from Continuous Bud Mutations

This article is an Advance Online Publication of the authors’ corrected proof. Note that minor changes may be made before final version publication.

The Horticulture Journal Preview e Japanese Society for doi: 10.2503/hortj.UTD-007 JSHS Horticultural Science http://www.jshs.jp/

Analysis of Flower Color Variation in Carnation (Dianthus caryophyllus L.) Cultivars Derived from Continuous Bud Mutations

Hayato Morimoto1*, Takako Narumi-Kawasaki1,2, Takejiro Takamura1,2 and Seiichi Fukai1,2

1The United Graduate School of Agricultural Science, Ehime University, Matsuyama 790-8566, Japan 2Faculty of Agriculture, Kagawa University, Miki, Kagawa 761-0795, Japan

Bud-mutation carnation cultivars of the “MINAMI series” have a diversity of flower color in which the directions of bud sports are recorded. ‘Poly Minami’, which is the origin of the “MINAMI series”, produced the eight cultivars with various petal colors through continuous bud mutations. Flavonoid pigments analysis showed that the flower color variation is produced by the difference in the quantitative ratios of pelargonidin- typed anthocyanin and chalcononaringenin 2′-O-glucoside (Ch2′G). Acyanic cultivars; ‘Poly Minami’, ‘Lemon Minami’ and ‘Vanilla Minami’ had Ch2′G showing a yellow coloration as a major flavonoid with different concentrations in the petals. Cyanic cultivars with pinkish petals; ‘Orange Minami’, ‘Minami’, ‘Passion Minami’ and ‘Feminine Minami’ had different ratios of 3,5-di-O-(β-glucopyranosyl) pelargonidin 6′′-O-4,6′′′- O-1-cyclic malate (Pg3,5cMdG), showing a pink coloration, and Ch2′G as major flavonoids in the petals. The variegated cultivar ‘Sakura Minami’, with deep pink sectors and flecks on pale pink petals, accumulated a small amount of Pg3,5cMdG. The red-flowered cultivar ‘Tommy Minami’ accumulated pelargonidin 3-O- malylglucoside (Pg3MG) showing a red coloration as a major anthocyanin in the petals. The gene expression analysis through flower-bud development showed that the ratios of Pg3,5cMdG and Ch2′G are produced by the difference in the expression levels of flavonoid biosynthesis-related genes; the dihydroflavonol 4-reducatse gene (DFR), the chalcononaringenin 2′-O-glucosyltransferase gene (CHGT2) and the chalcone isomerase gene (CHI2) and the acyl-glucose-dependent anthocyanin 5-O-glucosyltransferase gene (AA5GT) and an anthocyanin transportation-related gene; the glutathione S-transferase-like gene (GSTF2). This study revealed that the flower color variations in the “MINAMI series” are caused by genetic and metabolic changes associated with flavonoid biosynthesis and identified five candidate genes for flower color changes in the “MINAMI series”.

Key Words: bud sports, cyanic color, acyanic color, flavonoids, flavonoid biosynthesis-related genes.

The diversity of flower color in ornamental plants is Introduction produced by four major pigments; chlorophyll, carot- The carnation (Dianthus caryophyllus L.) is one of enoid, betalain and flavonoid (Tanaka et al., 2008). The the most important ornamental plants in the global chlorophyll content of the petals decreases as the flower flower market. Carnation cultivars have flower color bud develops (Mayak et al., 1998). However, carnation diversity which is an attractive trait for consumers. cultivars with greenish petals can maintain a higher Carnation cultivars, with various petal colors, have concentration of chlorophyll in the petals under chloro- been bred by conventional cross breeding and bud mu- phyll degradation by flower-bud development than non- tation (Holley and Baker, 1991). Although bud muta- greenish-flowered carnations because of the higher rate tion is important for the production of novel cultivars, of the chlorophyll biosynthesis through petal maturation the mechanism of the flower color variation caused by (Ohmiya et al., 2014). Carotenoid contributes to the bud mutation remains unknown. flower coloration in the yellow to red range in many flowering plants, whereas the order Caryophyllales accumulates very low levels of carotenoid in the petals Received; April 13, 2018. Accepted; August 23, 2018. (Ohmiya, 2013). This was also confirmed in Dianthus First Published Online in J-STAGE on October 20, 2018. No conflicts of interest declared. plants belonging to Caryophyllaceae in the order * Corresponding author (E-mail: [email protected]). Caryophyllales (Gatt et al., 1998; Ohmiya et al., 2013).

The flower coloration in the order Caryophyllales is caused by the biosynthesis of betalain; betacyanin and betaxanthine giving red and yellow, respectively (Brockington et al., 2011). However, Molluginaceae and Caryophyllaceae, in the order Caryophyllales, pro- duce flavonoids in the petals instead of betalain 2. ‘Lemon Minami’ 5. ‘Minami’ 8. ‘Sakura Minami’ (Brockington et al., 2011; Kay et al., 1981). Flower color variation is produced by the combination of anthocyanins and chalcononaringenin 2′-O- glucoside (Ch2′G) in carnations (Maekawa and Nakamura, 1977) (Fig. 1). “Cyanic color” is caused by the accumulation of four major anthocyanins; pelargonidin 3-O-malylglucoside (Pg3MG), 3,5-di-O-(β- 1. ‘Poly Minami’ 4. ‘Orange Minami’ 7. ‘Feminine Minami’ glucopyranosyl) pelargonidin 6′′-O-4,6′′′-O-1-cyclic malate (Pg3,5cMdG), cyanidin 3-O-malylglucoside (Cy3MG) and 3,5-di-O-(β-glucopyranosyl) cyanidin 6′′-O-4,6′′′-O-1-cyclic malate (Cy3,5cMdG), generally giving red, pink, darkish red or purple, respectively (Bloor, 1998; Nakayama et al., 2000; Terahara and 3. ‘Vanilla Minami’ 6. ‘Passion Minami’ 9. ‘Tommy Minami’ Yamaguchi, 1986). These anthocyanins are synthesized Fig. 1. The derivation genealogy of nine of bud mutation cultivars by the anthocyanin malyltransferase (AMalT) and/ in the “MINAMI series”. The derivation genealogy is arranged or the acyl-glucose-dependent anthocyanin 5-O- by the combination of the flower pictures and the derivation glucosyltransferase (AA5GT) after transportation of genealogy reported by Morimoto et al. (2018). The petal color of each cultivar is shown in the upper right. The white arrow in pelargonidin 3-O-gulucoside (Pg3G) and/or cyanidin 3- ‘Sakura Minami’ shows a deep pink sector. O-glucoside (Cy3G) into the vacuoles by the glutathione S-transferase-like (GSTF2), resulting in genotype- specific-flower coloration (Abe et al., 2008; Matsuba et transposable elements, which can suppress or activate al., 2010; Sasaki et al., 2012). “Acyanic color” is pro- the expression of flavonoid biosynthesis-related genes, duced by the accumulations of flavonol/flavone and resulting in flower color changes (Itoh et al., 2002; Ch2′G which are responsible for white, cream and yel- Nishizaki et al., 2011; Momose et al., 2013a, b). A pre- low petal colors (Mato et al., 2000; Onozaki et al., vious study of bud mutations showed that irradiation 1999; Yoshida et al., 2004). When anthocyanin coexists treatment kills the epidermal cells of the periclinal chi- with Ch2′G in the same cells, orange and bronze petal mera. Hence, a new epidermis is regenerated from inner colors are produced (Geissman and Mehlquist, 1947; core cells (Richter and Singleton, 1955; Sagawa and Gonnet and Hieu, 1992). The petal color phenotypes of Mehlquist, 1957). It was determined by a histological carnations are genetically regulated by flavonoid analysis that X-ray irradiation induces the necrosis of biosynthesis-related genes and an anthocyanin the outer cells of the shoot apex in a white-flowered transportation-related gene (Geissman and Mehlquist, carnation ‘White Sim’, a periclinal chimera, and then 1947; Mehlquist, 1939; Sasaki at al., 2013) (Fig. S1). the tunica is reconstructed, resulting in the production To date, it has been reported that the chalcone isomer- of the carnations with the red and white petal colors ase gene (CHI), the flavanone 3-hydroxylase gene from ‘White Sim’ (Sagawa and Mehlquist, 1957). (F3H), the dihydroflavonol 4-reductase gene (DFR), the The aim of this study was to reveal how the flower flavonoid 3′-hydroxylase gene (F3′H), the anthocyani- color variations occurred in bud-mutation carnation cul- din synthase gene (ANS), GSTF2, AMalT and AA5GT tivars of the “MINAMI series”, which has a wide range are mainly involved in flower color variations in carna- of petal colors. First, we determined the major flavo- tions (Dedio et al., 1995; Itoh et al., 2002; Mato et al., noid pigments in the petals of each cultivar of the 2000, 2001; Momose et al., 2013a, b; Nishizaki et al., “MINAMI series”. Second, we investigated the flavo- 2011). Although the seven genes coding chalcononarin- noid amounts and the expression levels of the major genin 2′-O-glucosyltransferase (CHGT) for the synthe- flavonoid biosynthesis-related genes isolated from sis of Ch2′G from chalcononaringenin were isolated by cultivars of the “MINAMI series” during flower-bud Ogata et al. (2011) and Togami et al. (2011), the effect development. Based on these results, we identified can- on flower color variation has not been reported to date. didate genes which thought to be involved in the cause The flower color changes of carnations caused by of each bud mutation in the “MINAMI series”. bud mutations have been studied extensively (Imai, Materials and Methods 1936; Mato et al., 2000; Momose et al., 2013a, b; Morimoto et al., 2018; Wasscher, 1956). Bud mutations Plant materials have been reported to be caused by the mobility of Nine “MINAMI series” cultivars; ‘Poly Minami’ Hort. J. Preview 3

Five stages of flower-bud development Tokyo, Japan). The filtered extract was injected into an 1 2 3 4 5 HPLC system. The HPLC system was constructed with a CBM-20Alite system controller (Shimadzu Corp., Kyoto, Japan), an SPD-M10Avp detector (Shimadzu ‘Poly Minami’ Corp.), an SIL-10AF auto injector (Shimadzu Corp.), a DGU-12A degasser (Shimadzu Corp.), two LC-20AT ‘Lemon Minami’ pumps (Shimadzu Corp.) and two inertsil ODS-3 col- umns (3.0 mm × 50 mm and 3.0 mm × 250 mm, GL ‘Vanilla Minami’ Sciences Inc., Tokyo, Japan). The column temperature was maintained at 40°C by a CTO-20A column oven ‘Orange Minami’ (Shimadzu Corp.). Linear gradient elution for 40 min ‘Minami’ from 25 to 85% solvent B (0.1% trifluoroacetic acid, 20% acetic acid and 25% acetonitrile in H2O, v/v) in solvent A (0.1% trifluoroacetic acid in H O, v/v) was ‘Passion Minami’ 2 used as the solvent system. A flow rate of 0.4 mL·min−1 was maintained. Anthocyanins and Ch2′G were de- ‘Pippi Minami’ tected based on the absorption at 510 nm and 360 nm, ‘Feminine Minami’ respectively. The type of flavonoids in the petals was identified by comparing their retention times with au- ‘Sakura Minami’ thentic standards; Cy3MG, Cy3,5cMdG, Pg3MG and Pg3,5cMdG which were extracted from carnations bear- ing dark red, deep purple, red and deep pink flowers, ‘Tommy Minami’ respectively (Bloor, 1998; Nakayama et al., 2000; Terahara and Yamaguchi, 1986) and Ch2′G extracted Fig. 2. Flower-bud development in the “MINAMI series”. Stage 1, closed buds; stage 2, bud break; stage 3, top of inflorescence from the petals of a yellow-flowered cyclamen opened; stage 4, vertically elongated flowers; stage 5, fully (Miyajima et al., 1991). The chalcones and flavonols opened flowers. ‘Pippi Minami’ was not analyzed in this re- without Ch2′G (ChFl; almost all of the contents were search. flavonols) were calculated by subtracting the peak area of Ch2′G from the total peak area on the basis of the (pale yellow), ‘Lemon Minami’ (yellow), ‘Vanilla 360 nm absorption. Minami’ (off white), ‘Orange Minami’ (orange), ‘Minami’ (yellowish orange), ‘Passion Minami’ (pinkish orange), Cloning of flavonoid biosynthesis-related genes ‘Feminine Minami’ (deep pink), ‘Sakura Minami’ (var- To prepare for the gene expression analysis, flavo- iegated pink) and ‘Tommy Minami’ (pinkish red) were noid biosynthesis-related genes were isolated as fol- used for this research and the directions of bud muta- lows; the phenylalanine ammonia-lyase gene (PAL) and tions are shown in Fig. 1. For pigment determination the chalcone synthase gene (CHS) from ‘Orange and gene expression analysis, flower-bud development Minami’, CHI1 and CHI2 from ‘Orange Minami’ and was divided into five stages: stage 1, closed buds; stage ‘Feminine Minami’, CHGT1 from ‘Orange Minami’, 2, bud break; stage 3, top of inflorescence opened; stage CHGT2 from ‘Feminine Minami’, F3H, DFR, ANS, 4, vertically elongated flowers; stage 5, fully opened AMalT and AA5GT from ‘Orange Minami’ and an an- flowers (Fig. 2). The upper region of the petals, exhibit- thocyanin transportation-related gene, GSTF2, was iso- ing petal color characteristics, was used for high per- lated from ‘Feminine Minami’. To confirm the gene formance liquid chromatography (HPLC) and gene sequences, CHI1, CHI2 and DFR were also isolated expression analysis (Fig. 1). In the sectorial analysis of from ‘Poly Minami’. Ubiquitin 5 gene (UBQ5) was iso- ‘Sakura Minami’, deep pink sectors and pale pink related to use as an internal control of quantitative real- gions were used separately (Fig. 1). The sampled petals time PCR (qRT-PCR) from ‘Orange Minami’ in for RNA extraction were immediately frozen in liquid reference to the research paper of Nomura et al. (2012). nitrogen and stored at −80°C until use. The sampled Gene-specific primers were designed on the basis of the petals for HPLC analysis were dried at 40°C for 24 known sequence of NCBI (https://www.ncbi.nlm.nih. hours and stored at −20°C until use. gov/) and the genome sequence of Carnation DB (http:// carnation.kazusa.or.jp/) (Table S1). The total RNA was Determination of the amount and the types of flavonoid prepared from the frozen petals at stage 2 or 5 accord- pigments in petals by HPLC ing with the modified cetyl trimethyl ammonium bro- The dried petals were immersed in 50% acetic acid mide (CTAB) method (Chang et al., 1993). cDNA was (v/v) and incubated at room temperature (25°C) for 24 synthesized from the total RNA by using PrimeScript hours in the dark. The extract was passed through a reverse transcriptase (Takara Bio Inc., Shiga, Japan) 0.45 μm membrane filter (Advantec Toyo Kaisha, Ltd., and the GeneRacer Oligo dT primer: 5′-GCTGTCAA 4 H. Morimoto, T. Narumi-Kawasaki, T. Takamura and S. Fukai

CGATACGCTACGTAACGGCATGACAGTGTTTTTT ‘Poly Minami’ TTTTTTTTTTTT-3′ (Thermo Fisher Scientific Inc., Waltham, MA, USA), and used as a template of the PCR reaction. All gene sequences, including the open reading frame (ORF) and 3′-untranslated region, were ‘Orange Minami’ 4 amplified by using KOD-plus Neo DNA polymerase 1 (TOYOBO Co., Ltd., Osaka, Japan) and the designed gene-specific primers. The ends of the amplified frag- 4 510 nm ‘Feminine Minami’

ment were attached with adenine by Ex-Taq polymerase a 1

(Takara Bio Inc.) and cloned to pCR4 TOPO vectors by ce a TOPO TA cloning kit for sequencing (Thermo Fisher n ba Scientific Inc.). The sequences of the cloned genes were ‘Tommy Minami’ 5 determined by an ABI 3130 genetic analyzer (Thermo bsor A Fisher Scientific Inc.). The sequences of the isolated 3 genes were compared with the identified sequence of STD carnations by GENETYX Ver. 11 (GENETYX Corp., 5 Tokyo, Japan). 3 2 4

Expression analysis by qRT-PCR 10 20 30 40 (min) Total RNA was extracted from the frozen petals at Retention time each flower-bud developmental stage according to the Fig. 3. HPLC chromatogram of anthocyanin in the fully opened modified CTAB method. To remove contamination by flowers of “MINAMI series” cultivars. Major peaks were iden- genomic DNA, the total RNA was treated with DNase tified as 1, undetermined anthocyanin (An1); 2, Cy3,5cMdG; 3, I of the RNeasy Plant Mini Kit (QIAGEN, Hilden, Cy3MG; 4, Pg3,5cMdG and 5, Pg3MG by comparing the reten- Germany) according to the manufacturer’s instructions. tion time of authentic standards (STD). cDNA was synthesized from the total RNA by the PrimeScript RT reagent Kit (Perfect Real Time) (Takara and the secondary peak of ‘Tommy Minami’ were Bio Inc.). Pg3MG and Cy3MG, respectively (Fig. 3). ‘Tommy Gene expression analysis by qRT-PCR was per- Minami’ also had very small amounts of Pg3,5cMdG formed by using SYBR Premix Ex Taq II (Takara Bio and Cy3,5cMdG (Fig. S2). On the other hand, no antho- Inc.) and a TaKaRa Thermal Cycler Dice Real-Time cyanins were detected in ‘Poly Minami’ and ‘Lemon System TP-800 (Takara Bio Inc.) according to the man- Minami’, whereas Pg3,5cMdG was detected in ‘Vanilla ufacturer’s instructions. The specific primer sets for Minami’ (Fig. 4A). Ch2′G accumulated in the petals of qRT-PCR are listed in Table S2. The PCR reaction was all cultivars (Fig. 4A). performed under the following conditions: at 95°C for ‘Poly Minami’, with pale yellow petals (Fig. 1), ac- 30 sec, 40 cycles (at 95°C for 5 sec, at 60°C for 30 sec), cumulated Ch2′G in the petals as a major flavonoid pig- 1 cycle (at 95°C for 15 sec, at 60°C for 30 sec, at 95°C ment (Fig. 4A). Three cultivars; ‘Lemon Minami’, for 15 sec). PCR programs of CHI2 and DFR are listed ‘Vanilla Minami’ and ‘Orange Minami’ were derived in Table S3. UBQ5 was used as an internal control. The from ‘Poly Minami’ by bud mutations (Fig. 1). ‘Lemon primer set for the detection of both DFR1 (acc. Minami’, with more yellowish petals, accumulated a no. LC377195) and DFR2 (acc. no. LC377270) was larger amount of Ch2′G, and the amount of ChFl was designed. markedly smaller than ‘Poly Minami’ (Fig. 5). An off- white-flowered cultivar ‘Vanilla Minami’ accumulated Results approximately one-tenth the amount of Ch2′G as com- Flavonoid pigments in the “MINAMI series” pared with ‘Poly Minami’. The amount of ChFl in To determine the major flavonoid pigments in the ‘Vanilla Minami’ was significantly larger than petals, HPLC analysis was carried out by using fully ‘Poly Minami’. ‘Vanilla Minami’ showed accumulation opened flowers. In the five cyanic cultivars, except of Pg3,5cMdG unlike ‘Poly Minami’ and ‘Lemon ‘Tommy Minami’, Pg3,5cMdG and an undetermined Minami’, although the amount was much less than anthocyanin (An1) were detected as the major peak and the five cyanic cultivars. ‘Orange Minami’, with bicolor the secondary peak, respectively (Fig. 3). The five cy- petals showing pink and yellow colorations (Fig. 1), anic cultivars also had a very small amount of Pg3MG mainly accumulated Pg3,5cMdG and An1 as the major in the petals (Figs. 4A and S2). The three cyanic culti- anthocyanins (Fig. 3). In addition, the amounts of vars, ‘Orange Minami’, ‘Passion Minami’ and ‘Femi- Ch2′G and ChFl accumulated in the petals of ‘Orange nine Minami’, had a very small amount of Cy3,5cMdG Minami’ were similar to those of ‘Poly Minami’. (Fig. S2). However, Cy3MG was not detected in the Three cultivars; ‘Minami’, ‘Passion Minami’ and five cyanic cultivars (Figs. 3 and S2). The major peak ‘Feminine Minami’ were derived from ‘Orange Hort. J. Preview 5

A An1 Pg3MG Pg3,5cMdG Ch2′G ds 150 onoi av l f 100 e of at r e

v 50 ti a ...... el . . d d d d d d d d ...... R n n n n n n n 0 n

B 200 200 200 2. ‘Lemon Minami’ 5. ‘Minami’ 8. ‘Sakura Minami’ 150 150 150

100 100 100

50 50 s 50 d i 0 n.d. n.d. n.d. n.d. n.d. n.d. 0 n.d.

o 0

n S1 S2 S3 S4 S5 S1 S2 S3 S4 S5 S1 S2 S3 S4 S5 200 200 vo 1. ‘Poly Minami’ 4. ‘Orange Minami’ 200 7. ‘Feminine Minami’ a

fl 150 150 150 f

o 100 100 100 e 50 50 50 rat

e n.d. n.d. n.d. n.d. n.d. n.d. 0 0 0 n.d.

tiv S1 S2 S3 S4 S5 S1 S2 S3 S4 S5

a S1 S2 S3 S4 S5 200 200 200 3. ‘Vanilla Minami’ 6. ‘Passion Minami’ 9. ‘Tommy Minami’

Rel 150 150 150

100 100 100

50 50 50

0 n.d. n.d. n.d. n.d. 0 n.d. 0 n.d. S1 S2 S3 S4 S5 S1 S2 S3 S4 S5 S1 S2 S3 S4 S5 Fig. 4. Major flavonoids accumulation in the fully opened flowers (A) and at five developmental stages (B) in nine “MINAMI series” cultivars. The amounts of major flavonoids are shown as a relative value. The peak area of HPLC is divided by the fresh weight (g) of the sample. The amounts of Ch2′G of ‘Poly Minami’ and Pg3,5cMdG of ‘Feminine Minami’ at stage 5 are defined as 100, respectively. The relative amount of Pg3MG in ‘Tommy Minami’ is shown as compared with that of Pg3,5cMdG in ‘Feminine Minami’. n.d.; not-detected. Error bars show standard errors of three biological replications (n = 3).

Minami’ by bud mutations (Fig. 1). ‘Minami’, with yel- Minami’ were derived from ‘Feminine Minami’ lowish orange petals (Fig. 1), accumulated a smaller (Fig. 1). ‘Sakura Minami’ showed one-fourth the amount of anthocyanin and a larger amount of Ch2′G amount of anthocyanin as compared with ‘Feminine than ‘Orange Minami’ (Fig. 4A), and the amount of Minami’, whereas the amount of Ch2′G did not differ ChFl was smaller than ‘Orange Minami’ as with markedly from that of ‘Feminine Minami’ (Fig. 4A). ‘Lemon Minami’ (Fig. 5). ‘Feminine Minami’ and The amount of ChFl was larger in the petals of ‘Sakura ‘Passion Minami’ accumulated a larger amount of an- Minami’ than ‘Feminine Minami’ (Fig. 5). The petals thocyanin and a smaller amount of Ch2′G as compared of ‘Tommy Minami’ were more reddish than ‘Feminine with ‘Orange Minami’. However, neither of these culti- Minami’ as determined by a color meter (Morimoto et vars showed a significant difference in the ChFl amount al., 2018). Only ‘Tommy Minami’ in the “MINAMI in the petals as with ‘Orange Minami’. ‘Passion Mina- series” accumulated Pg3MG, showing a red coloration, mi’ with pinkish orange colored petals accumulated a as the major anthocyanin (Fig. 3). The amount of larger amount of Ch2′G than ‘Feminine Minami’ with Pg3MG in ‘Tommy Minami’ was larger than ‘Feminine petals showing only pink coloration because the petal Minami’, whereas the amount of Ch2′G did not differ color phenotype showed bicolor petals displaying pink markedly from that of ‘Feminine Minami’. The amount and yellowish colorations (Fig. 1), whereas the yellow- of ChFl of ‘Tommy Minami’ was also a larger as ish part was smaller than ‘Orange Minami’ (Fig. 1). compared with that of ‘Feminine Minami’. Two cultivars; ‘Sakura Minami’ and ‘Tommy 6 H. Morimoto, T. Narumi-Kawasaki, T. Takamura and S. Fukai

200 ‘Orange Minami’ (acc. no. LC377192) and ‘Feminine l

hF Minami’ (acc. no. LC377265) had very short ORF re- C 150 sulting from the footprint. The footprint was present of

t within the first exon of the isolated CHI1 genes. The a 100 r

e CHI1 was also isolated from ‘Poly Minami’ (acc. v ti

a 50 no. LC377264), and then the base sequences of the l e CHI1 genes having the footprint in the three cultivars R 0 were compared with the known CHI1 genes derived from the other carnation cultivars. The results showed that the base sequences of the CHI1 genes of the three cultivars showed a perfect match and the footprint cor- responded to that of the gDicCHI1 derived from Fig. 5. The amounts of chalcones and flavonols without Ch2′G ‘7019-0’ reported by Itoh et al. (2002) (Fig. S3). The (ChFl) in fully opened flowers of nine “MINAMI series” culti- footprint of the gDicCHI1 is known to cause a frame- vars. The ChFl is shown as a relative value. The amount of shift mutation (Itoh et al., 2002). Thus, the CHI1 genes ChFl was calculated by subtracting the peak area of Ch2′G from the total peak area at 360 nm and divided by the fresh of the three cultivars also showed to stop translation at weight (g). The ChFl amount of ‘Poly Minami’ at stage 5 is de- 29 amino acids lacking the conserved domains and the fined as 100. Dotted line shows 100 values of ChFl. Data repre- specific residues (Jez and Noel, 2002; Jez et al., 2000; sent the means and standard errors of three biological Shimada et al., 2003) (data not shown). replications (n = 3). The base sequences of the CHI2 genes isolated from ‘Orange Minami’ (acc. no. LC377193) and ‘Feminine Change in the amount of flavonoid pigments in the pet- Minami’ (acc. no. LC377269) did not have footprints. als during flower-bud development The CHI2 of ‘Poly Minami’ (acc. no. LC377268) did To investigate changes in the accumulated amount of not have a footprint either. The base sequences of the the major flavonoids during flower-bud development, CHI2 genes of these three cultivars showed 98.6% ho- Pg3,5cMdG or Pg3MG and Ch2′G were compared mology, as compared with DcCHI2 (Dca60978 from among cultivars. We used five flower-bud developmen- Carnation DB) and the amino acid sequences of the tal stages (Fig. 2). The petals of stage 1 were not col- CHI2 genes had conserved residues, such as the active ored in cyanic cultivars since anthocyanin did not sites associated with substrate specificity and the hydro- accumulate (Fig. 4B), and showed the same petal color gen bond network (Jez and Noel, 2002; Jez et al., 2000; in all cultivars (data not shown). After bud break, the Shimada et al., 2003) (Fig. S4). flower color intensity in the cyanic cultivars increased The base sequences of the DFR genes isolated from due to anthocyanin accumulation according to the ‘Orange Minami’ and ‘Feminine Minami’ were a per- flower-bud development (Figs. 2 and 4B). Pg3,5cMdG fect match and had the same sequences as the 26 bp or Pg3MG was not detected at stage 1 in any cultivars existing within the DpDFR of Dianthus plumarius, (Fig. 4B). Other anthocyanins were not detected at this whereas the known DFR (acc. no. Z67983) did not have stage either (data not shown). However, the accumula- the same sequences (Fig. S5). The isolation of DFR tion of Ch2′G had already started. The accumulative from ‘Poly Minami’ was performed with the primer set amount of Pg3,5cMdG or Pg3MG increased rapidly at used for the isolation of DFR from ‘Orange Minami’ stages 2 to 3 and stages 4 to 5 in five cyanic cultivars and ‘Feminine Minami’ (Table S1). The result showed without ‘Minami’. The accumulation of Ch2′G also that the base sequence of the DFR isolated from ‘Poly showed a tendency to increase at stages 2 to 3 and Minami’ was different from those of ‘Orange Minami’ stages 4 to 5 in five cyanic cultivars without ‘Feminine and ‘Feminine Minami’; it had of a target site Minami’. duplication-like sequence concerning insertion of a transposon or a footprint-like sequence concerning ex- Isolation of flavonoid biosynthesis-related genes cision of a transposon (Fig. 6). Therefore, the DFR The flavonoid biosynthesis-related genes isolated genes isolated from ‘Orange Minami’ and ‘Feminine form the “MINAMI series” cultivars indicated a close Minami’ were named DFR1 (acc. no. LC377195), and similarity to those of GenBank and Carnation DB. The the DFR isolated from ‘Poly Minami’ was named DDBJ accession numbers of the isolated gene se- DFR2 (acc. no. LC377270). The DFR2 isolated from quences were shown as follows: PAL, LC377188; CHS, ‘Poly Minami’ showed high homology with that of the LC377191; CHGT1, LC377271; CHGT2, LC377272; gDicDFR1 isolated from ‘Rhapsody’ (Itoh et al., 2002). F3H, LC377194; ANS, LC377196; AMalT, LC377198; The base sequence of the DFR2 showed approximately AA5GT, LC377199; GSTF2, LC377197; UBQ5, 98% homology with the DFR1 isolated from ‘Orange LC377200. The base sequences of CHI and DFR dif- Minami’. The predicted protein of the isolated DFR2, fered from known sequences. which encodes 29 amino acids by a frameshift muta- The base sequences of the CHI1 genes isolated from tion, lacked the conserved domains and the regions of Hort. J. Preview 7

‘Symphony Rose’ gDicDFR1 ATGGTTTCTAGTACAATTAACGAGACACTAGACGC------GGAGAC-GGTAAACATGA ‘Rhapsody’ gDicDFR1 ATGGTTTCTAGTACAATTAACGAGACACTAGACGCATAGACGGTAAACATGA ‘Poly Minami’ DcDFR2 ATGGTTTCTAGTACAATTAACGAGACACTAGACGCGGAGACGGTAAACATGA ‘Orange Minami’ DcDFR1 ATGGTTTCTAGTACAATTAACGAGACACTAGACGC------GGAGAC-GGTAAACATGA Fig. 6. Comparison of the partial first exon sequences of the DcDFR genes isolated from ‘Poly Minami’, ‘Orange Minami’ and the known gDicDFR1. The two known gDicDFR1 genes were isolated form ‘Symphony Rose’ and ‘Rhapsody’ (Itoh et al., 2002). Bold letters show the start codon. Black underlines indicate footprints when the dTdic1 transposon was excised. Dotted lines indicate no footprint. Gray box “CGGAGACG” of the DcDFR2, isolated from the petals of ‘Poly Minami’, shows the target site duplication-like sequence or the footprint- like sequence.

30 PAL1 3 CHGT2 20 2

10 1

0 0 4 7.5 CHS DFR 3 s 5.0

el 2 v 2.5 1 le

0 s 0 on el i

0.08 v 60 ss CHI2 ANS 0.06 le 40 on xpre

0.04 i e

ss 20 0.02 ne 0 0 ge xpre

60 e 20

ve F3H AMalT

40 ne

ge 10 elati

R 20 ve

0 0 0.05 elati 4 CHGT1 R AA5GT 0.04 3 0.03 2 0.02 0.01 1 0 0 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 8 Stage 1 Stage 2 Stage 3 Stage 4 Stage 5 GSTF2 6 4 2 0 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 Stage 1 Stage 2 Stage 3 Stage 4 Stage 5 Fig. 7. Expression levels of flavonoid biosynthesis-related genes through flower-bud development in the “MINAMI series”. 1, ‘Poly Minami’; 2, ‘Lemon Minami’; 3, ‘Vanilla Minami’; 4, ‘Orange Minami’; 5, ‘Minami’; 6, ‘Passion Minami’; 7, ‘Feminine Minami’; 8, ‘Sakura Minami’; 9, ‘Tommy Minami’. Gene expression levels were normalized with UBQ5 as an internal control. Data represent the means and standard errors of three biological replications (n = 3). substrate specificity (Beld et al., 1989; Johnson et al., stage 1 in all cultivars, and then these genes were ex- 2001) (data not shown). pressed highly at stages 2 to 5, unlike CHI2 and F3H. The expression pattern of AA5GT was a little different Expression pattern of flavonoid biosynthesis-related from those of DFR and ANS. The expression level of genes during flower-bud development AA5GT was low at stage 3 and increased at stage 4 in The expression level of PAL1 tended to increase all cultivars. slightly through the development of flower buds CHGT1 was expressed highly at stage 1 in cultivars (Fig. 7). The expression level of CHS tended to be high accumulating a large amount of anthocyanin and at at stages 1 and 2 and decreased at stages 3 and 4. Fur- stage 5 in seven cultivars except ‘Minami’ and ‘Tommy thermore, at stage 5, the expression level of CHS was Minami’, whereas the expression level was very low at high in all cultivars. CHI2 and F3H were also expressed stages 2 to 4 in all cultivars (Fig. 7). The expression at stages 1 and 2, and then those expression levels de- pattern of CHGT2 differed from that of CHGT1. The creased from stages 3 to 5. The expression levels of expression pattern of CHGT2 was similar to those of DFR, ANS, GSTF2, AMalT and AA5GT were low at late biosynthetic genes such as DFR and GSTF2. In 8 H. Morimoto, T. Narumi-Kawasaki, T. Takamura and S. Fukai

(A) (B) (C) l

1.0 150 h 250 in f C n o

a f

200 Q5 0.8 y o te

c a 100 r o te

150 0.6 /UB a e th 2 r

F 0.4

e 100 tiv a

50 T l la tiv e

ta 50 0.2 GS la R to 0 e 0 0 R 1 2 3 1 2 3 1 2 3 Fig. 8. Sectional analysis in ‘Sakura Minami’. (A) Relative rate of total anthocyanin amount. The peak areas of HPLC are divided by fresh weight (g) of the fully opened flowers. The total anthocyanin amount is shown as a relative value when the amount of total anthocyanin at 510 nm absorption in ‘Feminine Minami’ is defined as 100. (B) Relative rate of ChFl amount. The amount of ChFl is shown as a relative value when the amount of ChFl in ‘Feminine Minami’ is defined as 100. (C) The expression level of GSTF2. The data were normalized with UBQ5 as an internal control. 1, ‘Feminine Minami’; 2, deep pink sectors of ‘Sakura Minami’; 3, pale pink regions of ‘Sakura Minami’. (A) to (C) data represent the means and standard errors of three biological replications (n = 3). addition, CHGT2 showed a tendency toward a low pink sectors and the pale pink regions of fully opened expression level through flower-bud development in flowers. The deep pink sectors of ‘Sakura Minami’ cyanic cultivars except ‘Orange Minami’. showed a markedly larger amount of total anthocyanin as compared with pale pink regions (Fig. 8A), whereas Comparison of gene expression levels among nine the amount of ChFl showed no difference between the “MINAMI series” cultivars deep pink sectors and the pale pink regions of ‘Sakura We compared the expression levels of flavonoid Minami’ (Fig. 8B). In addition, the expression level of biosynthesis-related genes among bud-mutation culti- GSTF2 was significantly higher in the deep pink sector vars (Fig. 7). ‘Poly Minami’, as the origin of the regions of ‘Sakura Minami’ than the pale pink regions “MINAMI series” (Fig. 1), showed very low expres- and similar to that of ‘Feminine Minami’ (Fig. 8C). sion of DFR at all stages of flower-bud development. These results indicate that the flower color of ‘Sakura ‘Lemon Minami’ and ‘Vanilla Minami’ derived from Minami’ is linked to the reduction of GSTF2 expression ‘Poly Minami’ also showed a very low expression level in the pale pink regions. ‘Tommy Minami’, derived of DFR through flower-bud development. In ‘Lemon from ‘Feminine Minami’, expressed AA5GT in the pet- Minami’, the expression level of CHI2 was significant- als. It showed a lower expression level through flower- ly lower at stages 1 and 2 than ‘Poly Minami’. In bud development, particularly at stages 1 and 2, than ‘Vanilla Minami’, the expression levels of PAL, CHS, ‘Feminine Minami’. CHI2, F3H, AMalT, AA5GT and GSTF2 tended to be Discussion higher at stages 1 and 2 as compared with ‘Poly Minami’. ‘Orange Minami’ showed a higher expression level of Relationship between flavonoid accumulation and gene DFR than ‘Poly Minami’. In addition, the expression expression through flower-bud development level of CHI2 at stage 2 was lower than ‘Poly Minami’. The bud-mutation carnation cultivars in the “MINAMI In ‘Minami’ derived from ‘Orange Minami’ (Fig. 1), series” consist of various flower color genotypes CHI2 showed a lower expression level than that of which originated from one genotype, ‘Poly Minami’, ‘Orange Minami’ at stages 1 and 2 the same as ‘Lemon and this derivation history has been clearly documented Minami’ (Fig. 7). In ‘Passion Minami’ derived from (Morimoto et al., 2018). The present study revealed that ‘Orange Minami’, CHI2 was expressed more highly at the petal color variation of the “MINAMI series” is de- stage 1 as compared with ‘Orange Minami’. The ex- termined by the composition and the quantity of accu- pression level of CHGT2 was markedly lower at all mulative flavonoids in the petals (Fig. 4A). Moreover, developmental stages. In ‘Feminine Minami’ derived we revealed the candidate genes responsible for flower from ‘Orange Minami’, CHI2 was expressed more color mutation. No cultivars in the “MINAMI series” highly at stages 1 and 2 than that of ‘Orange Minami’. accumulated anthocyanins in the petals of closed buds, The expression level of CHGT2 of ‘Feminine Minami’ showing no coloration due to very low expression lev- was lower at stages 3 to 5 than that of ‘Orange els of late biosynthetic genes such as DFR and GSTF2 Minami’, whereas it was higher than ‘Passion Minami’ (Figs. 2, 4B and 7). On the other hand, all cultivars had at all developmental stages. already started accumulating Ch2′G before flower buds In ‘Sakura Minami’ derived from ‘Feminine Minami’ break due to the combination of the expression of early (Fig. 1), the expression level of GSTF2, an anthocyanin biosynthetic genes such as PAL and CHS and the glyco- transportation-related gene, tended to be lower, particu- sylation of chalcononaringenin by CHGT activity larly at stage 3 (Fig. 7). ‘Sakura Minami’ has deep pink (Fig. 7). The expression of CHGT1/2 at stage 1 may be sectors and flecks on pale pink petals (Fig. 1). There- related to the accumulation of Ch2′G, whereas there fore, we investigated the amounts of total anthocyanin was no clear correlation between the amounts of Ch2′G and ChFl and the expression level of GSTF2 in the deep and the expression levels of CHGT1/2 at stages 2 to 5. Hort. J. Preview 9

The expression of CHGT1/2 in closed buds could affect of Ch2′G from chalcononaringenin by CHGTs was the accumulation of Ch2′G from bud break. It has been given priority over the conversion to naringenin due to reported that carnation cultivars have seven CHGTs the low expression level of CHI2 (Fig. 7). Therefore, (Ogata et al., 2004; Togami et al., 2011). Furthermore, the amount of ChFl was smaller in the petals of ‘Lemon carnations have over ten types of CHGTs according to Minami’ than ‘Poly Minami’ (Fig. 5). Although the Carnation DB. Therefore, the other CHGTs, except the Ch2′G content is related to the intensity of the yellow isolated CHGT1/2 in this research, are likely related to petal color, the factors that regulate the concentration of the accumulation of Ch2′G in the “MINAMI series”. Ch2′G have not been identified (Yoshida et al., 2004). The increases in anthocyanin and Ch2′G contents in the Our results suggest that the suppression of CHI2 tran- petals were caused by the expression of the late biosyn- scription is one of the causes of the change in intensity thetic genes and CHGTs, respectively. We found that of the yellow petal color. the cultivar-specific-composition ratio of anthocyanin ‘Vanilla Minami’, derived from ‘Poly Minami’, accu- and Ch2′G did not change during flower-bud develop- mulated a much smaller amount of Ch2′G as compared ment (Fig. 4B). This indicated that the composition with ‘Poly Minami’ (Fig. 4A), resulting in an off-white ratio of anthocyanin and Ch2′G, identifying the specific coloration in the petals (Fig. 1). However, the results of phenotype, is determined genetically at the early stage gene expression analysis could not explain the genetic of flower-bud development. mechanism of the derivation of ‘Vanilla Minami’ from ‘Poly Minami’, since the expression levels of CHI2 and Genetic derivation of the “MINAMI series” CHGT1/2, which are involved in the concentration of ‘Poly Minami’, the origin of the “MINAMI series” Ch2′G, did not differ significantly (Fig. 7). ‘Vanilla cultivars (Fig. 1), accumulated Ch2′G in the petals as Minami’ showed a higher expression level of CHI1 the major flavonoid pigment without anthocyanin than ‘Poly Minami’ (Fig. S6), whereas the first exon of (Fig. 4A), resulting in a pale yellow coloration (Fig. 1). the CHI1 (acc. no. LC377267) isolated from ‘Vanilla As with the accumulation of Ch2′G, the inactivation of Minami’ also carried the footprint causing enzyme in- DFR is also needed for the yellow coloration in the activity the same as ‘Poly Minami’ (data not shown). carnation petals because chalcononaringenin is non- This suggests the possibility that the low expression enzymatically converted to naringenin, a precursor for levels of the other CHGTs decrease the synthesis of anthocyanin biosynthesis (Itoh et al., 2002; Moustafa Ch2′G from chalcononaringenin and accelerates the and Wong, 1967; Spribille and Forkmann, 1982; Stitch conversion of chalcononaringenin to naringenin be- et al., 1992). In fact, the expression of DFR was sup- cause the amount of ChFl in ‘Vanilla Minami’ was larg- pressed at all stages of flower-bud development in er than ‘Poly Minami’ (Fig. 5). Currently, expression yellow carnation cultivars in the “MINAMI series” analysis of the other CHGTs is in progress. (Fig. 7). It has been reported that the sequence mutation ‘Orange Minami’, derived from ‘Poly Minami’ of CHI or the repression of CHI transcripts may de- (Fig. 1), produced a similar amount of Ch2′G in the pet- crease the conversion of chalcononaringenin to narin- als as ‘Poly Minami’ (Fig. 4A). In addition, ‘Orange genin and promote the synthesis of Ch2′G from Minami’ accumulated anthocyanin in the petals because chalcononaringenin (Itoh et al., 2002; Yoshida et al., DFR1 was expressed more highly than that of ‘Poly 2004). Thus, we isolated two CHI genes from the petals Minami’ (Fig. 7). Thus, ‘Orange Minami’ accumulated of three cultivars in the “MINAMI series” with the both anthocyanin and Ch2′G (Fig. 4A), with bicolor reference of Carnation DB. In Carnation DB, CHI1 petals consisted of pink distal and yellowish orange (Dca60979) localized close to CHI2 (Dca60978) on the proximal regions (Fig. 1). First, we assumed that the same scaffold 94 (Miyahara et al., 2018). ‘Poly derivation of ‘Orange Minami’ from ‘Poly Minami’ Minami’ had two types of CHI, CHI1 coding an inac- was caused by restoring the expression of DFR1 due to tive enzyme caused by the footprint as mentioned above the excision of the transposable element as mentioned and CHI2 coding an active enzyme (Figs. S3 and S4). by Itoh et al. (2002). However, there was no footprint in This fact suggests that CHI2 converts chalcononaringe- the base sequences of the DFR1 genes isolated from nin to naringenin because flavonols accumulate in the ‘Orange Minami’ and ‘Feminine Minami’. To confirm petals of ‘Poly Minami’ (Fig. 5). Therefore, these re- whether DFR1 of ‘Poly Minami’ has normal base se- sults demonstrated that the blocking of anthocyanin quences, we carried out isolation of DFR1 from ‘Poly biosynthesis by the suppression of DFR expression is Minami’. The result of the sequencing analysis showed one of the causes of ‘Poly Minami’ with pale yellow that the DFR of ‘Poly Minami’ (DFR2) had the se- petals. quence of a target site duplication-like or a footprint- Lemon Minami’, derived from ‘Poly Minami’ like, showing high homology with a footprint of the (Fig. 1), has more yellowish petals than ‘Poly Minami’ gDicDFR isolated from ‘Rhapsody’ (Itoh, et al., 2002) due to a larger amount of Ch2′G in the petals (Figs. 1 (Fig. 6). The normal DFR1 sequence could not be iso- and 4A). It is assumed that ‘Lemon Minami’ accumulated from ‘Poly Minami’ by RT-PCR. However, lated the larger amount of Ch2′G because the synthesis genomic analysis showed that ‘Poly Minami’ had 10 H. Morimoto, T. Narumi-Kawasaki, T. Takamura and S. Fukai

‘Poly Minami’ gDcDFR1 1 ‘Poly Minami’ gDcDFR2 1 ‘Poly Minami’ DcDFR2 1 ‘Orange Minami’ DcDFR1 1

‘Poly Minami’ gDcDFR1 83 ‘Poly Minami’ gDcDFR2 91 ‘Poly Minami’ DcDFR2 91 ‘Orange Minami’ DcDFR1 83 ●● ‘Poly Minami’ gDcDFR1 173 ‘Poly Minami’ gDcDFR2 181 ‘Poly Minami’ DcDFR2 177 ‘Orange Minami’ DcDFR1 169 ●● ● ●● ● ‘Poly Minami’ gDcDFR1 263 ‘Poly Minami’ gDcDFR2 271 ‘Poly Minami’ DcDFR2 177 ‘Orange Minami’ DcDFR1 169 ● ● ● ‘Poly Minami’ gDcDFR1 353 ‘Poly Minami’ gDcDFR2 361 ‘Poly Minami’ DcDFR2 178 ‘Orange Minami’ DcDFR1 170 Fig. 9. The partial sequences of two genomic DFR genes (gDcDFR1 and gDcDFR2) isolated from the petals of ‘Poly Minami’. The sequences of gDcDFR1 and gDcDFR2 were compared with the cDNA sequences of DcDFR1 and DcDFR2 from ‘Orange Minami’ and ‘Poly Minami’, respectively. Black boxes show the first exon and the partial second exon. 170 to 352 and 178 to 360 sequences show the first intron. The open box shows the predicted duplication site or footprint. Circles show the differences in the sequences of DFR1 and DFR2. genomic DFR1 and DFR2 in the petals (Fig. 9). In the amount of anthocyanin and a smaller amount of Ch2′G present study, we could not confirm that DFR1 and (Fig. 4A). Yoshida et al. (2004) investigated the rela- DFR2 are allelic. These results suggest that genomic tionship between the S gene regulating anthocyanin DFR1 is absent only in the epidermis of ‘Poly Minami’, amount and the concentration of Ch2′G involved in the causing anthocyanin accumulation, or that the expres- intensity of the yellow petal color, however they could sion of the DFR1 is down-regulated by mutation of ac- not find the regulation factors of the Ch2′G amount. In tive transcription factors or repressors. this study, the variation in the Ch2′G content may have ‘Minami’, derived from ‘Orange Minami’ (Fig. 1), contributed to the intensity of the yellow petal color by had smaller anthocyanin and larger Ch2′G amounts in regulating CHI2 and CHGT2 expressions. the petals than ‘Orange Minami’ (Fig. 4A). Gene ex- ‘Feminine Minami’, derived from ‘Orange Minami’ pression analysis indicated that the difference in the (Fig. 1), accumulated a larger amount of Pg3,5cMdG composition of Pg3,5cMdG and Ch2′G between the two and a smaller amount of Ch2′G as compared with cultivars was caused by the lower expression level of ‘Orange Minami’ (Fig. 4A). The derivation could be CHI2 in ‘Minami’ as in ‘Lemon Minami’ (Fig. 7). The explained by the high expression level of CHI2 at early lower expression level of CHI2 decreased the conver- developmental stages and the low expression level of sion of chalconnaringenin to naringenin, resulting in a CHGT2 at late developmental stages as mentioned reduction in the ChFl amount as in ‘Lemon Minami’ above in the derivation of ‘Passion Minami’. ‘Feminine (Fig. 5). Moreover, a low expression level of CHI2 pro- Minami’ also expressed inactive CHI1 highly, the same motes the accumulation of Ch2′G, but does not com- as ‘Vanilla Minami’ (Fig. S6), but we could not eluci- pletely block the conversion of chalconnaringenin to date why the expression level of CHI1 was significantly naringenin because of the non-enzymatic reaction as in higher than the derivative parent. For an analogy of the other carnations (Spribille and Forkmann, 1982). There- gene expression analysis for CHIs and CHGTs, the reg- fore, the single yellowish-orange petals of ‘Minami’ are ulator for both expression of CHIs and CHGTs may be produced by a small amount of anthocyanin and a large involved in bud mutations of the “MINAMI series” cul- amount of Ch2′G caused by sufficient DFR expression tivars. and the suppression of CHI2, respectively (Figs. 1, 4A In ‘Sakura Minami’, derived from ‘Feminine and 7). Minami’ (Fig. 1), the expression level of GSTF2 tended In ‘Passion Minami’, derived from ‘Orange Minami’ to be lower than ‘Feminine Minami’ during flower-bud (Fig. 1), the expression level of CHGT2 was markedly development (Fig. 7). Moreover, the expression level of lower than the other cultivars during flower-bud devel- GSTF2 was markedly higher in the deep pink sectors, opment (Fig. 7). In addition, ‘Passion Minami’ showed accumulating a large amount of anthocyanin (Fig. 8A), that a higher expression level of CHI2 at stage 1 as as compared with the pale pink regions (Fig. 8C). The compared with ‘Orange Minami’. Thus, the low activity GSTF2 enzyme is responsible for the intensity of the of CHGT2 and the high activity of CHI2 were consid- cyanic petal color in carnations by the regulation of ered to accelerate the conversion of chalcononaringenin anthocyanin transportation into vacuoles (Momose et to naringenin, resulting in accumulation of a larger al., 2013a; Sasaki et al., 2012). In the variegated carna- Hort. J. Preview 11

2. ‘Lemon Minami’ 5. ‘Minami’ 8. ‘Sakura Minami’

dwn: CHI2 dwn: CHI2 up: CHI2 dwn: GSTF2 up: DFR dwn: CHGT2 1. ‘Poly Minami’ 4. ‘Orange Minami’ 7. ‘Feminine Minami’ up: CHI2 unknown dwn: AA5GT dwn: CHGT2 3. ‘Vanilla Minami’ 6. ‘Passion Minami’ 9. ‘Tommy Minami’ Fig. 10. Relationship with bud mutations and the expression of flavonoid biosynthesis-related genes in the “MINAMI series”. The derivation genealogy of the “MINAMI series” is combined with the up-regulation (up) and down-regulation (dwn) of the candidate genes for bud mutations. tion ‘Daisy-VP’ with deep pink sectors and flecks on Minami’, etc. The investigation of the genomic AA5GT the pale pink petals, the inactive GSTF2 carrying trans- structure in each cell layer will allow us to understand poson dTac1 is known to reduce only the anthocyanin the derivation mechanism of ‘Tommy Minami’ from content but not the flavonol content, resulting in pale ‘Feminine Minami’. pink regions (Momose et al., 2013a). On the other hand, The present study demonstrated that the flower color the deep pink sectors and flecks, in which a larger diversity in the “MINAMI series” is produced by the amount of anthocyanin accumulates, are involved in the composition ratio of pelargonidin glucosides, showing GSTF2 reversion caused by the excision of dTac1 pink or red coloration, and Ch2′G showing a yellow (Momose et al., 2013a). Therefore, ‘Sakura Minami’ coloration. In addition, we found that the composition has deep pink sectors and flecks on the pale pink petals of flavonoid pigments, which determines flower color since GSTF2 expression is decreased due to the inser- phenotype, is regulated by the up-regulation and/or the tion of a transposon or some other factors in the pale down-regulation of flavonoid biosynthesis-related pink regions. genes (Fig. 10). The derivations of the “MINAMI se- ‘Tommy Minami’, derived from ‘Feminine Minami’ ries” cultivars are involved in DFR, GSTF2 and (Fig. 1), accumulated Pg3MG as the major anthocyanin AA5GT, which have already been reported as key fac- in the petals, resulting in a red coloration (Figs. 1 and tors producing the variation of petal color in other car- 3). It is known that the accumulation of Pg3MG is nation cultivars (Itoh et al., 2002; Momose et al., caused by the suppression of AA5GT (Matsuba et al., 2013a; Nishizaki et al., 2011). In addition, we found 2010; Nishizaki et al., 2011). Although the expression that CHI2 and CHGT2 are also the key factors for petal level of AA5GT in ‘Tommy Minami’ was lower than color variation in “MINAMI series” cultivars. Further- the other cultivars during flower-bud development, a more, ‘Poly Minami’, ‘Orange Minami’ and ‘Passion sufficient expression level of AA5GT was achieved in Minami’ with bicolor petals, in which the distal petal the fully opened flowers (Fig. 7). It seems that the color is different from the proximal petal color, were AA5GT expression induced the synthesis of a certain used in this study. The elucidation of the bud mutation amount of Pg3,5cMdG, whereas the amount of mechanism of the “MINAMI series” will lead to an Pg3,5cMdG was very small in ‘Tommy Minami’ understanding of how the bicolor is generated in carna- (Fig. S2). In addition, we could not find any mutations tion cultivars. We expect this finding to contribute to a of the AA5GT transcripts in ‘Tommy Minami’ (Fig. S7). systematic breeding of flowers with single color or bi- If AA5GT is expressed in the epidermal cells derived color in carnations. from L1, ‘Tommy Minami’ would accumulate Acknowledgements Pg3,5cMdG as the major anthocyanin in the petals. However, ‘Tommy Minami’ accumulated Pg3MG as We thank Mr. Mituhiro Manabe for providing the the major anthocyanin. The total RNA extracted from “MINAMI series” cut flowers. We also thank Dr. the petal tissues including L1, L2 and L3 was used for Yoshihiro Ozeki, Dr. Taira Miyahara (Tokyo University the gene expression analysis in this research. Therefore, of Agriculture and Technology) and Dr. Masayoshi these results suggest that only L1 cells of ‘Tommy Nakayama (NARO) for their advice. Minami’ differ from those of ‘Feminine Minami’ and Literature Cited that ‘Feminine Minami’ is a chimera. Studies on chimeras of carnations have mainly reported about the pheno- Abe, Y., M. Tera, N. Sasaki, M. Okamura, N. Umemoto, M. types or histological analysis related to tunica Momose, N. Kawahara, H. Kamakura, Y. Goda, K. reconstruction (Frey and Janick, 1991; Hackett and Nagasawa and Y. Ozeki. 2008. Detection of 1-O- malylglucose: Pelargonidin 3-O-glucose-6′′-O- Anderson, 1967; Imai, 1936; Johnson, 1980; Pereau- malyltransferase activity in carnation (Dianthus Leroy 1974; Sagawa and Mehlquist, 1957). Histological caryophyllus). Biochem. Biophys. Res. Commun. 373: 473– or genetic analysis may lead to the elucidation of the 477. derivation mechanisms from ‘Poly Minami’ to ‘Orange Beld, M., C. Martin, H. Huits, A. R. Stuitje and A. G. M. Gerats. 12 H. Morimoto, T. Narumi-Kawasaki, T. Takamura and S. Fukai

1989. Flavonoid synthesis in Petunia hybrida: partial char- tion (Dianthus caryophyllus). J. Japan. Soc. Hort. Sci. 70: acterization of dihydroflavonol-4-reductase genes. Plant 315–319. Mol. Biol. 13: 491–502. Mato, M., T. Onozaki, Y. Ozeki, D. Higeta, Y. Itoh, Y. Yoshimoto, Bloor, S. J. 1998. A macrocyclic anthocyanin from red/mauve I. Hiroshi, H. Ikeda, H. Yoshida and M. Shibata. 2000. carnation flowers. Phytochemistry 49: 225–228. Flavonoid biosynthesis in white-flowered Sim carnations Brockington, S. F., R. H. Walker, B. J. Glover, P. S. Soltis and (Dianthus caryophyllus). Sci. Hortic. 84: 333–347. D. E. Soltis. 2011. Complex pigment evolution in the Caryo- Matsuba, Y., N. Sasaki, M. Tera, M. Okamura, Y. Abe, E. phyllales. New Phytol. 190: 854–864. Okamoto, H. Nakamura, H. Funabashi, M. Takatsu, M. Chang, S., J. Puryear and J. Cairney. 1993. A simple and efficient Saito, H. Matsuoka, K. Nagasawa and Y. Ozeki. 2010. A method for isolating RNA from pine trees. Plant Mol. Biol. novel glucosylation reaction on anthocyanins catalyzed by Rep. 11: 113–116. acyl-glucose-dependent glucosyltransferase in the petals of Dedio, J., H. Saedler and G. Forkmann. 1995. Molecular cloning carnation and delphinium. Plant Cell 22: 3374–3389. of the flavanone 3β-hydroxylase gene (FHT) from carnation Mayak, S., T. Tirosh, J. E. Thompson and S. Ghosh. 1998. The (Dianthus caryophyllus) and analysis of stable and unstable fate of ribulose-1,5-bisphosphate carboxylase subunits dur- FHT mutants. Theor. Appl. Genet. 90: 611–617. ing development of carnation petals. Plant Physiol. Bio- Frey, L. and J. Janick. 1991. Organogenesis in carnation. J. Amer. chem. 36: 835–841. Soc. Hort. Sci. 116: 1108–1112. Mehlquist, G. A. L. 1939. Inheritance in the carnation, Dianthus Gatt, M. K., K. R. W. Hammett, K. R. Markham and B. G. caryophyllus. I. Inheritance of flower color. Proc. Am. Soc. Murray. 1998. Yellow pinks: interspecific hybridization be- Hortic. Sci. 37: 1019–1021. tween Dianthus plumarius and related species with yellow Miyahara, T., N. Sugishita, M. Ishida-Dei, E. Okamoto, T. flowers. Sci. Hortic. 77: 207–218. Kouno, E. A. Cano, N. Sasaki, A. Watanabe, K. Tasaki, M. Geissman, T. A. and G. A. L. Mehlquist. 1947. Inheritance in the Nishihara and Y. Ozeki. 2018. Carnation I locus contains carnation, Dianthus caryophyllus. IV. The chemistry of two chalcone isomerase genes involved in orange flower flower color variation, I. Genetics 32: 410–433. coloration. Breed. Sci. 68: 481–487. Gonnet, J. F. and H. Hieu. 1992. In situ micro-spectrophotometric Miyajima, I., T. Maehara, T. Kage and K. Fujieda. 1991. Identifi- and micro-spectrocolorimetric investigation of vacuolar cation of the main agent causing yellow color of yellow- pigments in flowers of cultivars of carnation (Dianthus flowered cyclamen mutant. J. Japan. Soc. Hort. Sci. 60: 409– caryophyllus). J. Hortic. Sci. 67: 663–676. 414. Hackett, W. P. and J. M. Anderson. 1967. Aseptic multiplication Momose, M., Y. Itoh, N. Umemoto, M. Nakayama and Y. Ozeki. and maintenance and differentiated carnation shoot tissue 2013a. Reverted glutathione S-transferase-like genes that derived from shoot apices. Proc. Amer. Soc. Hort. Sci. 90: influence flower color intensity of carnation (Dianthus 365–369. caryophyllus L.) originated from excision of a transposable Holley, W. D. and R. Baker. 1991. Carnation production II. element. Breeding Sci. 63: 435–440. Kendall-Hunt Publishing, Company. Dubuque. USA p. 21– Momose, M., M. Nakayama, Y. Itoh, N. Umemoto, T. Toguri and 29. Y. Ozeki. 2013b. An active hAT transposable element caus- Imai, Y. 1936. Sports of perpetual carnations. J. Coll. Agric. ing bud mutation of carnation by insertion into the flavonoid Tokyo Imperial Univ. 14: 1–11. 3′-hydroxylase gene. Mol. Genet. Genomics 288: 175–184. Itoh, Y., D. Higeta, A. Suzuki, H. Yoshida and Y. Ozeki. 2002. Morimoto, H., T. Narumi-Kawasaki, T. Takamura and S. Fukai. Excision of transposable elements from the chalcone isomer- 2018. Petal color characteristics of carnation mutative culti- ase and dihydroflavonol 4-reductase genes may contribute to vars MINAMI series. Acta Hort. 1208: 7–12. the variegation of the yellow-flowered carnation (Dianthus Moustafa, E. and E. Wong. 1967. Purification and properties of caryophyllus). Plat Cell Physiol. 43: 578–585. chalcone-flavanone isomerase from soya bean seed. Phyto- Jez, J. M. and J. P. Noel. 2002. Reaction mechanism of chalcone chemistry 6: 625–632. isomerase. pH dependence, diffusion control, and product Nakayama, M., M. Koshioka, H. Yoshida, Y. Kan, Y. Fukui, A. binding differences. J. Biol. Chem. 277: 1361–1369. Koike and M. Yamaguchi. 2000. Cyclic malyl anthocyanins Jez, J. M., M. E. Bowman, R. A. Dixon and J. P. Noel. 2000. in Dianthus caryophyllus. Phytochemistry 55: 937–939. Structure and mechanism of the evolutionarily unique plant Nishizaki, Y., Y. Matsuba, E. Okamoto, M. Okamura, Y. Ozeki enzyme chalcone isomerase. Nat. Struct. Biol. 7: 786–791. and N. Sasaki. 2011. Structure of the acyl-glucose-dependent Johnson, E. T., S. Ryu, H. Yi1, B. Shin, H. Cheong and G. Choi. anthocyanin 5-O-glucosyltransferase gene in carnations and 2001. Alteration of a single amino acid changes the substrate its disruption by transposable elements in some varieties. specificity of dihydroflavonol 4-reductase. Plant J. 25: 325– Mol. Genet. Genomics 286: 383–394. 333. Nomura, Y., S. Morita, T. Harada and S. Satoh. 2012. Cloning, Johnson, R. T. 1980. Gamma irradiation and in vitro induced sep- characterization and expression of carnation (Dianthus aration of chimeral genotypes in carnation. HortScience 15: caryophyllus L.) ubiquitin genes and their use as a normali- 605–606. zation standard for gene expression analysis in senescing Kay, Q. O. N., H. S. Daoud and C. H. Stirton. 1981. Pigment dis- petals. J. Japan. Soc. Hort. Sci. 81: 357–365. tribution, light reflection and cell structure in petals. Bot. J. Ogata, J., Y. Itoh, M. Ishida, H. Yoshida and Y. Ozeki. 2004. Linn. Soc. 83: 57–84. Cloning and heterologous expression of cDNAs encoding Maekawa, S. and N. Kawamura. 1977. Studies on the coloration flavonoid glucosyltransferases from Dianthus caryophyllus. of carnation flowers. VIII. The relationship between the Plant Biotechnol. 21: 367–375. color and pigment of intact flowers. Sci. Rept. Fac. Agr. Ohmiya, A. 2013. Qualitative and quantitative control of carot- Kobe Univ. 12: 161–166. enoid accumulation in flower petals. Sci. Hortic. 163: 10–19. Mato, M., T. Onozak, Y. Ozeki, D. Higeta, Y. Itoh, T. Hisamatsu, Ohmiya, A., H. Masami, K. Yagi, K. Tanase and C. Yamamizo. H. Yoshida and M. Shibata. 2001. Flavonoid biosynthesis in 2014. Identification of genes associated with chlorophyll ac- pink-flowered cultivars derived from ‘William Sim’ Carna- cumulation in flower petals. PLoS One. 9(12): e113738. doi: Hort. J. Preview 13

10.1371/journal.pone.0113738. Ayabe. 2003. A cluster of genes encodes the two types of Ohmiya, A., K. Tanase, M. Hirashima, C. Yamamizo and M. chalcone isomerase involved in the biosynthesis of general Yagi. 2013. Analysis of carotenogenic gene expression in flavonoids and legume-specific 5-deoxy(iso)flavonoids in petals and leaves of carnation (Dianthus caryophyllus L.). Lotus japonicus. Plant Physiol. 131: 941–951. Plant Breeding 132: 423–429. Spribille, R. and G. Forkmann. 1982. Chalcone synthesis and Onozaki, T., M. Mato, M. Shibata and H. Ikeda. 1999. Differ- hydroxylation of flavonoids in 3′-position with enzyme ences in flower color and pigment composition among white preparations from flowers of Dianthus caryophyllus L. carnation (Dianthus caryophyllus L.) cultivars. Sci. Hortic. (carnation). Planta 155: 176–182. 82: 103–111. Stich, K., T. Eidenberger, F. Wurst and G. Forkmann. 1992. En- Pereau-Leroy, P. 1974. Genetic interaction between the tissues of zymatic conversion of dihydroflavonols to flavan-3,4-diols carnation petals as periclinal chimeras. Radiat. Bot. 14: 109– using flower extracts of Dianthus caryophyllus L. (carna- 116. tion). Planta 187: 103–108. Richter, A. and W. R. Singleton. 1955. The effect of chronic Tanaka, Y., N. Sasaki and A. Ohmiya. 2008. Biosynthesis of plant gamma radiation on the production of somatic mutations in pigments: anthocyanins, betalains and carotenoids. Plant J. carnations. Proc. Natl. Acad. Sci. USA. 41: 295–300. 54: 733–749. Sagawa, Y. and G. A. L. Mehlquist. 1957. The mechanism re- Terahara, N. and M. Yamaguchi. 1986. 1H NMR spectral analysis sponsible for some X-ray induced change in flower colour of of the malylated anthocyanins from Dianthus. Phytochemis- the carnations, Dianthus caryophyllus. Amer. J. Bot. 44: try 25: 2906–2907. 397–403. Togami, J., H. Okuhara, N. Nakamura, K. Ishiguro, C. Hirose, Sasaki, N., Y. Matsuba, Y. Abe, M. Okamura, M. Momose, N. M. Ochiai, Y. Fukui, M. Yamaguchi and Y. Tanaka. 2011. Umemoto, M. Nakayama, Y. Itoh and Y. Ozeki. 2013. Re- Isolation of cDNAs encoding tetrahydroxychalcone 2′- cent advances in understanding the anthocyanin modifica- glucosyltransferase activity from carnation, cyclamen, and tion steps in carnation flowers. Sci. Hortic. 163: 37–45. catharanthus. Plant Biotechnol. 28: 231–238. Sasaki, N., Y. Nishizaki, Y. Uchida, E. Wakamatsu, N. Umemoto, Wasscher, J. 1956. The importance of sports in some florist’s M. Momose, M. Okamura, H. Yoshida, M. Yamaguchi, M. flowers. Euphytica 5: 163–170. Nakayama, Y. Ozeki and Y. Itoh. 2012. Identification of the Yoshida, H., Y. Itoh, Y. Ozeki, T. Iwashina and M. Yamaguchi. glutathione S-transferase gene responsible for flower color 2004. Variation in chalcononaringenin 2′-O-glucoside con- intensity in carnations. Plant Biotechnol. 29: 223–227. tent in the petals of carnations (Dianthus caryophyllus) bear- Shimada, N., T. Aoki, S. Sato, Y. Nakamura, S. Tabata and S. ing yellow flowers. Sci. Hortic. 99: 175–186.