The Role of Interleukin-1 Beta in Mediating LPS-Induced Reverse Transendothelial Migration of Intimal Dendritic Cells

Andrew Rajkumar

A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Laboratory Medicine and Pathobiology University of Toronto

Andrew Rajkumar Master of Science Laboratory Medicine and Pathobiology University of Toronto 2018

Abstract

Intimal dendritic-like cells (DCs) reside in regions of the aorta predisposed to atherosclerosis.

LPS and interleukin-1 beta (IL-1β) injections into C57BL/6 mice result in decreased numbers of intimal DCs due to their exit into the blood via reverse transendothelial migration (RTM). This study evaluated the role of IL-1b in RTM induced by intravenous LPS injection. IL-1β mRNA expression was rapidly upregulated in the intima by LPS. Experiments using genetic approaches

(Il1b-/-, Casp1-/- and Il1r1-/- mice) and function-blocking antibodies demonstrated a critical role for IL-1b production and signalling in LPS-induced RTM. Reciprocal bone marrow transplantation experiments revealed that IL-1β production and signalling only in the non- hematopoietic compartment, likely endothelium, was critical. Ex vivo studies showed that IL-1b could rescue RTM in the Il1b-/- aorta, implicating sustained intimal IL-1b signalling. These data suggest that intimal IL-1β production and signalling in endothelial cells is required for LPS- induced RTM of intimal DCs.

Acknowledgements I thank Dr. Myron Cybulsky and Dr. Jenny Jongstra-Bilen for all of their support, mentorship and guidance regarding my Masters project. Also, I am very grateful to my Supervisory Committee members Dr, Clinton Robbins and Dr. Stephen Girardin for all of their support and input.

I acknowledge Dr. Mark Roufaiel for providing me with his data, that guided me in planning of experiments. I thank Dr. Sharon Hyduk, Marwan Althagafi, and Kelly Tai for their support and patience, as they taught me all necessary experimental techniques required for this project. I also acknowledge Marwan Althagafi and Hisham Ibrahim for assisting me with the ex vivo experiments, and Dr. Sharon Hyduk and Chanele Polenz for genotyping mice used in experiments, as well as all individuals who helped me irradiate mice in the Animal Resource Centre. I also thank the rest of the Cybulsky lab for all of their support and help throughout my time in this lab.

I acknowledge the staff at the Animal Resource Centre in the Toronto Medical Discovery Tower, and at the Quarantine Facility in the Ontario Cancer Institute, for housing and taking care of all mice used in this project. In addition, I thank the Delaney Lab at McMaster University for providing me with Il1b-/- mice. I also thank the staff at the Advanced Optical Microscope Facility for all of their assistance regarding my use of their Laser Confocal Microscope.

Finally, I would like to thank all of my family and friends, for all of their support, encouragement and care throughout the duration of my Masters of Science program.

iii

Table of Contents

Acknowledgements ...... iii Table of Contents ...... iv List of Tables ...... vi List of Figures ...... vii List of Abbreviations ...... viii 1 Introduction ...... 1 1.1 Atherosclerosis ...... 1 1.2 Atherosclerosis susceptibility ...... 1 1.3 Resident Intimal Dendritic Cells (RIDCs) and the initiation of atherosclerosis ...... 2 1.4 Migration of Immune Cells ...... 4 1.4.1 Immune Cell Recruitment from Blood to Tissues ...... 4 1.4.2 Immune Cell Migration From Tissues to Lymphatics ...... 5 1.4.3 Reverse Transendothelial Migration ...... 6 1.5 The Interleukin-1 Family ...... 9 1.5.1 IL-1 production, processing and signalling ...... 9 1.5.2 Mice deficient in IL-1β production ...... 13 1.5.3 Regulation of the NLRP3 inflammasome ...... 13 1.5.4 Regulation of IL-1β production ...... 14 1.5.5 Downstream functions of IL-1β ...... 15 1.5.6 Involvement of IL-1 and related cytokines in atherosclerosis ...... 16 1.6 Rationale ...... 17 1.7 Hypothesis ...... 17 1.8 Aims ...... 18 2 Methods ...... 20 2.1 Reagents and Mice ...... 20 2.2 Mouse Injections ...... 21 2.3 Harvesting of aortae ...... 21 2.4 Collection of tissue for genotyping ...... 21 2.5 Reciprocal Bone Marrow Transplantation ...... 21 2.6 Ex Vivo Experiments ...... 22 2.7 En Face Immunostaining and Confocal Microscopy ...... 22 2.8 Isolation of RNA from Intimal Cells ...... 23 2.9 RT-qPCR ...... 23 2.10 Isolation of Peritoneal Macrophages ...... 24 3 Results ...... 26 3.1 Intimal expression of IL-1β and other pro-inflammatory genes during LPS-induced RTM of intimal DCs ...... 26 3.1.1 LPS induces increases in the intimal expression of IL-1 genes during the first wave of RTM ...... 26 3.1.2 LPS induces increases in gene expression of other pro-inflammatory cytokines ...... 27 3.2 IL-1β is required to elicit the first wave of RTM induced by LPS ...... 31 3.3 IL-1β is also required to elicit the second wave of RTM induced by LPS ...... 32

3.4 The production of IL-1β and signaling through its receptor in non-hematopoietic cells, as opposed to bone marrow-derived cells, is required for the first wave of RTM of intimal DCs ...... 35 3.5. Local effects of IL-1β on intimal cells are required for RTM of intimal DCs ...... 37 4 Discussion ...... 40 5 Future Directions ...... 45 6 References ...... 47

List of Tables Table 1: Important IL-1-related cytokines for this project, their receptors, and their overall pro or anti-inflammatory functions. 11 Table 2: Important IL-1 receptors for this project, their common names, and their ligands 11 Table 3: Primer sequences used to measure mRNA expression levels 25 Table 4: Primer sequences used for genotyping mice 25

List of Figures Figure 1: Regions in the aortic arch predisposed to atherosclerosis 3 Figure 2: The TLR4 agonist LPS induces RTM of intimal DCs. 8 – 9 Figure 3: IL-1β production, processing and signalling pathways 12 – 13 Figure 4: IL-1β is able to induce RTM of CD11c+ intimal DC. 19 Figure 5: Time-course of gene expression profiles for (A) IL-1β, (B) IL-1a and (C) IL-1Ra in WT mice following LPS injection. 28 Figure 6: Time-course of gene expression profiles for (A) IL-1R1, (B) IL-1RAcP and (C) IL-1R2 in WT mice following LPS injection. 29 Figure 7: Time-course of gene expression profiles for (A) TNF-a, (B) IL-6 and (C) IL-18 in WT mice following LPS injection. 30 Figure 8: Both waves of RTM are inhibited in Casp1-/-, Il1b-/- and Il1r1-/- mice 33 Figure 9: Both waves of RTM are inhibited in mice injected with neutralizing antibodies to IL-1β and IL-1α. 34 – 35 Figure 10: Reciprocal bone marrow transplantation experiments between WT and KO mice. 36 Figure 11: IL-1β acts locally in the intima in order to elicit RTM of DCs. 38 – 39 Figure 12: Potential mechanisms by which IL-1β mediates LPS-induced RTM of intimal DCs 44

vii

List of Abbreviations oC – degrees Celsius µg – microgram µL - microlitre Ab - antibody ANOVA – analysis of variance ApoE – apolipoprotein E ARC – Animal Resource Centre ASC – apoptosis-associated speck like protein containing a caspase recruitment domain, pycard ASC-/- - apoptosis-associated speck like protein containing a caspase recruitment domain knockout mice ASK – apoptosis signal-regulating kinase ATA – aurintricarboxylic acid ATF6 – activating transcription factor 6 ATP – adenosine triphosphate BrdU – 5-bromo-2’-deoxyuridine C5A – complement 5A Ca2+ - calcium ions Cad5-CreER – transgenic mice containing genes encoding for Cad5 and Cre recombinase on same promoter, Cre gene can be induced by activation of the estrogen receptor CANTOS – canakinumab anti-inflammatory thrombosis outcome study CARD – caspase recruitment domain Casp1-/- - caspase-1 knockout mice CD11c-Cre – transgenic mice containing genes encoding for CD11c and Cre recombinase on same promoter CD11c-EYFP – transgenic mice containing genes encoding for CD11c and EYFP proteins on same promoter CD11c-hBcl2 – transgenic mice containing genes encoding for CD11c and hBcl2 proteins on same promoter CCL19 – C-C chemokine ligand 19 CCL21 – C-C chemokine ligand 21 CCR7 – C-C chemokine receptor type 7, cluster of differentiation 197 CD – cluster of differentiation CD11c – cluster of differentiation 11c, integrin alphax CD45 – cluster of differentiation 45 CD68 – cluster of differentiation 68, macrosialin COX2 – cyclooxygenase 2 Cre – causes recombination CX3CL1 – chemokine (C-X3-C) motif ligand 1, fractalkine CX3CL12 – chemokine (C-X3-C) motif ligand 12, stromal-derived factor 1 CX3CR1 – chemokine (C-X3-C) motif receptor 1, fractalkine receptor CX3CR4 – chemokine (C-X3-C) motif receptor 4, cluster of differentiation 184 DAMP – danger-associated molecular pattern DAPI - 4′,6-diamidino-2-phenylindole DCs – dendritic cells DC-SIGN - Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin, cluster of differentiation 209

viii

DMEM – Dulbecco’s modified eagle’s medium (c)DNA – (complementary) deoxyribonucleic acid DT – diphtheria toxin DTR – diphtheria toxin receptor EC – endothelial cell ER – endoplasmic reticulum EYFP – enhanced yellow fluorescence protein FBS –fetal bovine serum Flt3 – fms-like tyrosine kinase 3, cluster of differentiation 135 Flt3L – fms-like tyrosine kinase 3 ligand g - gram GC – greater curvature GM-CSF – granulocyte-macrophage colony-stimulating factor h - hours H2O - water hBcl2 – human B cell lymphoma 2 HEPES – 4(2-hydroxyethyl)-1-piperazineethanesulfonic acid HP – high probability IkB – inhibitor of nuclear factor kappa B ICAM – intracellular cell adhesion molecule ICE – interleukin-converting enzyme IFN-γ – interferon gamma IgG – immunoglobulin G IKK – I kappa B kinase IL – interleukin IL-18 – interleukin 18 IL-18BP – interleukin 18 binding protein IL-1a - interleukin 1 alpha (IL-1F1) Il1a-/- - interleukin 1 alpha knockout mice IL-1β – interleukin 1 beta (IL-1F2) Il1b-/- - interleukin 1 beta knockout mice IL-1R1 – interleukin 1 receptor 1 Il1r1-/- - interleukin 1 receptor knockout mice Il1r1Cad5-Cre – mice with IL-1R1 gene knocked out in Cad5+ cells, expression of Cad5 can be induced by activation of estrogen receptor Il1r1CD11cCre – mice with IL-1R1 gene knocked out in CD11c+ cells Il1r1loxP – IL-1R1 floxed mice IL-1R2 – interleukin 1 receptor 2 IL-1Ra, IL-1RN gene – interleukin 1 receptor antagonist (IL-1F3) IL-1RAcP – interleukin 1 receptor accessory protein IP3R – inositol 1,4,5-trisphosphate receptor IRAK – interleukin-1 receptor-associated kinase 4 IRE1α –inositol-requiring enzyme 1 alpha IRF8 – interferon regulator factor 8 IV - intravenous JAM – junctional adhesion molecule JAX – Jackson Laboratories JNK – c-Jun N-terminal kinase K+ - potassium ions ix

KLF2 – Kruppel-like factor 2 KO – knockout LC – lesser curvature LDL – low density lipoprotein LRR – leucine-rich repeat domain Ldlr-/- - low-density lipoprotein receptor knockout mice LICAM – neural cell adhesion molecule L1 LOX-1 – lectin-like oxidized low density lipoprotein receptor-1 LP – low probability LPS – lipopolysaccharide Ly6C – lymphocyte antigen 6C M-CSF – macrophage colony stimulating factor MAPK – mitogen-activated protein kinase MCP-1 – macrophage chemoattractant protein-1, C-C chemokine ligand 2 MEKK3 – MAP kinase kinase kinase 3 MHCI – major histocompatibility complex class I MHCII – major histocompatibility complex class II mL - millilitre MMP – matrix metalloproteinase MyD88 – myeloid differentiation primary response 88 NA – numerical aperture NBD – nucleotide-binding domain NEMO - NF-kB essential modifier NF-kB – nuclear factor kappa B ng - nanograms NLR – nod-like receptor NLRP3 – nucleotide-binding domain, leucine-rich-containing family, pyrin domain-containing- 3 NTP-Stat1 – non-tyrosine phosphorylated signal transducer and activator of transcription 1 OX40L – cluster of differentiation 252 P2X7 – purinergic receptor P2X PAMP – pathogen-associated molecular pattern PBS – phosphate-buffered saline PECAM-1 – platelet endothelial cell adhesion molecule, cluster of differentiation 31 (CD31) PERK – protein kinase R-like ER kinase PFA - paraformaldehyde PI3K – phosphoinositide-3 kinase PKR – protein kinase R PLA2 – phospholipase A2 PolyI:C – polyinosinic:polycytidylic acid PYD – pyrin domain qPCR, RT-PCR – quantitative real-time polymerase chain reaction RIDC – resident intimal dendritic cells ROS – reactive oxygen species RPMI – Roswell Park Memorial Institute medium RTM – reverse transendothelial migration (m)RNA – (messenger) ribonucleic acid S1P – sphingosine-1 phosphate S1PR1 – sphingosine-1 phosphate receptor 1 x

SA-HRP – streptavidin-horseradish peroxidase SEM – standard error of the mean SphK1 – sphingosine kinase 1 SLAM – signaling lymphocytic activation molecule SYK – spleen tyrosine kinase TAB – TAK1-binding protein TAK – transforming growth factor beta-activated kinase Th17 – T helper cell 17 TIR – toll and interleukin 1 receptor-like domain TLR – toll-like receptor TMDT – Toronto Medical Discovery Tower TNFa - tumor necrosis factor alpha TOLLIP – toll interacting protein TRAF – TNF receptor associated factor TRX - thioredoxin TUNEL – terminal deoxynucleotidyl transferase dUTP nick end labeling Tyr-FITC – tyramide-flyorescein isothiocyanate UV – ultraviolet V - volts VCAM-1 – vascular cell adhesion molecule 1 VE-CAD – vascular endothelial cadherin, cadherin 5 (Cad5) WT – wild-type, C57BL/6 mice

1 Introduction

1.1 Atherosclerosis Atherosclerosis, a chronic inflammatory disease of the large muscular and elastic arteries, is the underlying cause of heart disease and stroke, which are the leading causes of death in North America1. The process of atherosclerosis begins when low-density lipoprotein (LDL) particles get taken up into the subendothelial layer of the artery wall called the intima. LDL particles are then modified and endocytosed by myeloid cells of the intima forming lipid droplets, which results in their foamy appearance. These “foam cells” appear as fatty streaks, characteristic of early atherosclerotic lesions. Over time, abundant numbers of macrophage foam cells accumulate in atherosclerotic plaques through monocyte recruitment and local proliferation2 3. Subsequently, these foam cells die and a mixture of lipids and dead cells form the necrotic core. Smooth muscle cells from the inner layer “media” of the arteries migrate to the intima, where they proliferate and differentiate into cells that synthesize extracellular matrix (ECM) proteins1. This leads to the formation of the fibrous cap that stabilizes the plaque and isolates the necrotic core from the blood. In advanced stages of atherosclerosis, matrix metalloproteinases (MMPs) degrade collagen that makes up the fibrous cap, and make the plaque prone to rupture4. Plaque rupture leads to release of thrombogenic proteins, accumulation of clotting factors and formation of thrombi that can block blood flow in arteries. This event can compromise the circulation in major organs such as the heart, leading to myocardial infarction, or the brain, leading to stroke1. Inflammatory events accompany all stages of atherogenesis.

1.2 Atherosclerosis susceptibility Atherosclerosis does not develop randomly in arteries; rather, there are certain regions that are predisposed. These regions are typically at curvatures and bifurcations in the arterial tree. The aortic arch is a region of the aorta that connects the ascending and descending regions of the aorta together with the branches of the brachiocephalic artery, the left common carotid artery, and the left subclavian artery (Figure 1). The inner or lesser curvature (LC) of the aortic arch is susceptible to lesion formation, while the outer or greater curvature (GC) is protected. The LC and GC experience different hemodynamics and this is underlying factor for the regional differences in atherosclerosis susceptibility. Disturbed laminar blood flow (disturbed flow) with a low time-averaged shear stress and different directions during each phase of the cardiac cycle (even a reverse direction during diastole)5 6 occurs in the LC, whereas uniform

1 laminar flow (laminar flow) with a high time-averaged shear stress and a uniform direction during the cardiac cycle occurs in the GC. Endothelial cells lining the inner surface of arteries sense hemodynamics. Laminar flow maintains a quiescent endothelium with elongated cells aligned with the direction of blood flow. Disturbed multidirectional flow results in unique signalling mediated by activation of ion channels, primary cilia, junctional signalling complexes, integrins and the cell cytoskeleton, which influences the shape of endothelial cells (polygonal or elongated in multiple directions with nuclear deformations). In addition, relatively higher levels of NF-kB proteins are expressed primarily in the cytosol of endothelial cells from LC regions. Thus, NF-kB signalling is primed for activation upon exposure to pro-inflammatory stimuli such as LPS and hypercholesterolemia7. Low-grade inflammation occurs in the LC of the aortic arch of wild-type mice, with elevated expression of pro-inflammatory genes coding for adhesion molecules and scavenger receptors, such as VCAM-1, ICAM-1, E-selectin and LOX-18 9. In contrast, transcription factors such as Kruppel-like factor 2 (KLF2) that encode atheroprotective genes are expressed in regions of uniform laminar flow10 11.

1.3 Resident Intimal Dendritic Cells (RIDCs) and the initiation of atherosclerosis As early as 1995, it has been shown that lesion-prone regions of the rabbit aorta contain a population of leukocytes. The majority of these cells express macrophage markers, are MHCII+ and exhibit dendritic cell (DC)-like morphology; other occasional cells present are eosinophils and neutrophils. In the healthy human aorta intimal DC-like cells are S-100+ and CD1a+, and are found in atherosclerosis-susceptible regions12. Normal C57BL/6 mouse aortae display intimal CD45+, CD68+, CD11c+ cells with dendritic-like morphology in atherosclerosis- susceptible areas3 8 (Fig. 1C), along with a few T cells8. These DCs are referred to as resident intimal DCs (RIDCs). The accumulation and homeostasis of these DCs was shown to be fractalkine (CX3CL1)-dependent, as mice deficient in its receptor (CX3CR1) presented with less DCs in this region compared to WT mice13. In addition, RIDC abundance is VCAM-1- dependent, as VCAM-1 deficient mice presented with less CD68+ intimal cells8. A low level of Ly6Chi monocyte recruitment occurs in the LC of normal mouse aortic arch, as was determined by a 24 hour BrdU assay8. However, the role of monocyte recruitment in the maintenance of RIDCs remains unknown. Subsequently, Choi et al described two major populations of DCs in the mouse intima14: classical Flt3-Flt3L signalling-dependent CD103+CD11b- DCs and

2 macrophage-colony stimulating factor (M-CSF)-dependent CD14+CD11b+DC-SIGN+ monocyte-derived DCs. A B

GC LC

GC LC GC

Figure 1: Regions in the aortic arch predisposed to atherosclerosis. (A) Schematic of the aortic arch. The lesser curvature (LC) and greater curvature (GC) of the aortic arch are indicated. Dotted lines indicate the cuts that were made when opening up the aorta. (B) Schematic of the aortic arch after the tissue is flattened. HP indicates the area where there is a high probability of atherosclerosis development; LP indicates the area with low probability of atherogenesis, these regions are present in the LC and GC respectively. (C) En face immunoconfocal image of an aortic arch from a C57BL/6 mouse. The aorta was stained with biotinylated anti-mouse CD11c, and Hoechst. Areas that represent the LC and GC are indicated. Blue: DAPI; Yellow: CD11c+ cells accumulated in LC. (A) and (B) are adapted from Iiyama et al., Circulation Research, 19999.

The primary function of DCs is to sense injury and present antigens to T cells. Tissue- resident DCs are considered immature, and detect danger-associated molecular patterns on pathogens (DAMPs) through pattern-recognition receptors (i.e. TLRs, NLRs). DCs internalize the danger molecules and migrate into the lymphatic system in order to reach the lymph nodes, where they can present antigens on either MHC class I molecules to be recognized by CD8+ T cells, or on MHC class II molecules to be recognized by CD4+ T cells. The process of DC maturation occurs in the lymphatic system, where they up-regulate co-stimulatory markers such as CD80 and CD86 on their surface. Although cultured aortic DCs captured and presented antigens on MHC class I molecules to CD8+ T cells in vitro14, it is unlikely that DCs actually present antigen in the aortic intima since only a few T cells were found in atherosclerosis predisposed LC regions3. In addition, lymphatics are present in the artery adventitia, but are not found in the intimal layer15. Intimal DCs constitutively express pro-inflammatory cytokine mRNA, including IL-1β, TNFa and IL-6, and depletion of intimal CD11c+ cells sharply reduced the intimal mRNA levels of these cytokines16. These data suggest that resident intimal DCs play an integral part to the basal pro-inflammatory environment of the atherosclerosis-susceptible regions. It is widely believed that resident intimal DCs participate in the initiation of atherosclerosis. DCs accumulate lipid in Ldlr-/- mice fed a high cholesterol diet in just 5 days, prior to the onset of monocyte recruitment and increased local cell proliferation. Depletion of CD11c+ cells by injection of diphtheria toxin (DT) into CD11c-DT receptor transgenic mice led to a decrease in intimal lipid area16, indicating that the majority of intimal lipid rapidly accumulates within intimal DCs. However, the consequence of this early lipid loading on gene expression is not as yet known. The intimal classical Flt3-dependent DCs exhibited atheroprotective properties, since their depletion lead to increased atherosclerotic lesions by an unknown mechanism17. Taken together, the function of resident intimal DCs in the initiation of atherosclerosis remains elusive.

1.4 Migration of Immune Cells 1.4.1 Immune Cell Recruitment from Blood to Tissues When tissue in an organism get infected or injured, the inflammatory cascade is triggered by the production of pro-inflammatory cytokines and chemokines, as well as adhesion molecules by endothelial cells, resident immune cells or recruited inflammatory cells. Cytokines

4 induce a wide variety of functions upon binding to their receptors, such as upregulation of adhesion molecules, modulation of cell survival, and changes in dynamics of blood flow that result from vasodilatation and increased permeability at sites of inflammation. Chemokines are chemotactic cytokines, which, as their name suggests, elicit downstream responses upon binding G protein-coupled chemokine receptors and eventually induce chemotaxis of immune cells18. The recruitment of immune cells by chemokines occurs through a series of steps, termed the leukocyte adhesion cascade. The process of tethering captures leukocytes in the bloodstream to loosely adhere to the endothelium. The leukocytes then crawl along the luminal endothelial layer (rolling), and continue to slow down (slow rolling) as they approach the site of injury. Leukocyte tethering, rolling and slow rolling are mediated by selectin molecules. Meanwhile, chemokines activate the endothelium to increase production and expression of adhesion molecules such as ICAM-1, ICAM-2 and VCAM-1. These molecules bind to integrin molecules on leukocytes, causing them to firmly adhere on the endothelium. At this point, junctional molecules such as PECAM1 and JAMs are downregulated, thus opening up endothelial junctions so that leukocytes can subsequently transmigrate into the subendothelial layer. There is also evidence that leukocytes can pass within endothelial cells as opposed to through their junctions, termed transcytosis19. 1.4.2 Immune Cell Migration From Tissues to Lymphatics Leukocyte migration from a site of inflammation into afferent lymphatics is critical to the initiation of an immune response and to the resolution of inflammation. DCs and T cells are the typical leukocytes that are involved in this pathway. DCs in tissues internalize and present antigens on their surface, and migrate from tissues into lymph nodes, where they upregulate co- stimulatory molecules, mature completely and interact with T cells20. Four stages are identified in this process. The first stage is termed the interstitial stage, where DCs migrate to the lymphatic endothelium. Here, there are many different mechanisms that have been proposed, including CCR7/CCL19 interactions, interactions between CCL21 on lymphatic endothelium and CCR7 on DCs, interactions between CXCL12 in lymphatic endothelium and CXCR4 on DCs, interactions between CX3CL1 on lymphatic endothelium and CX3CR1 on DCs, S1P(3) and S1P(1), and many other molecules. CCR7 is also present on CD4+ T cells, and is also involved in their egress into lymph nodes20. The second step of cell egress is the actual process of transmigration across the lymphatic endothelium. In DC egress, many of the above molecules mentioned in the leukocyte adhesion cascade are upregulated20, in addition to adhesion molecules VCAM-1, ICAM-1 and L1CAM20. The third stage of lymphatic migration occurs 5 within lymphatic vessels; CCR7/CCL21 interactions play a major role20. The final stage involves the migration of cells across the sinuses of distal lymph nodes. Key events involve CCR7/CCL19 interactions, along with the involvement of other molecules such as heparin sulfate or CD6920. 1.4.3 Reverse Transendothelial Migration The field of reverse transendothelial migration (RTM) is a novel area of study. RTM is a potential major mechanism of immune cell homeostasis and regulation. There are multiple mechanisms through which immune cells can be cleared from a site of injury. This includes apoptosis, migration of cells into lymphatics and RTM. These mechanisms are necessary in order to prevent excessive inflammation that could be harmful to healthy tissue and to the organism. RTM was first shown in cultured EC monolayers, where neutrophils migrated across the monolayer first and then migrated opposite to the initial direction21. One of the earliest in vivo studies of RTM was shown in neutrophils that exited the site of injury in zebrafish; the neutrophils transmigrated through the endothelium from the tissue and re-entered the bloodstream22 23. The process of neutrophil RTM was shown to be initiated by macrophage contact24, and these neutrophils expressed increased ICAM-1 and decreased CXCR123. In order for neutrophils to undergo RTM, the downregulation of JAM-C at endothelial cell junctions was necessary25. Neutrophils undergo RTM in certain human diseases as well, such as pancreatitis- associated acute lung injury26. In addition to neutrophils, other leukocytes can also undergo RTM. For example, T cells utilize RTM to exit the thymus into the bloodstream27. In an in vitro model, T cells reverse their direction of endothelial transmigration through endothelial signalling of CXCL1222 28. Monocyte-derived DCs can also undergo RTM. In vitro, blood monocytes differentiated into DCs after migrating through a cultured endothelial monolayer and phagocytosing subendothelial collagen beneath the endothelium, before reverse migrating back to the endothelial surface29. RTM of monocytes is dependent upon signalling by ICAM-1 and CD11/CD18 integrins30. RTM has also been described in tumor cells during cancer metastasis, which involves macrophage signalling, activation of the PI3K cascade, and secretion of proteases that cleave endothelial junction molecules23. RTM has recently been reported to occur in arteries. The aorta does not contain lymphatics except for the adventitial layer15; therefore, migration of intimal leukocytes into lymphatics would require migration through the entire media. Therefore, RTM of intimal cells 6 into the bloodstream is the most efficient way to exit the intima. Chlamydia pneumoniae, a bacterium transported by monocytes into atherosclerotic lesions31, is not found in normal arteries in regions predisposed to atherosclerosis32. This suggests that Chlamydia are cleared from the normal intima by RTM. Therefore, the Cybulsky lab studied the response of DCs in the intima of the ascending arch predisposed to atherosclerosis, upon exposure to danger signals33. Following a systemic injection of LPS, a decrease in number of CD11c+ intimal DCs was observed in the LC between 12 – 24 hours and 60 – 72 hours post-LPS (Fig. 2A), each followed by recovery of intimal DC numbers as a result of proliferation of the remaining cells. The decrease in intimal DCs was also observed upon activation of the inflammatory response via a TLR3 agonist, PolyI:C (Fig. 2B). The following experiments demonstrated that the decrease in intimal DCs was due to their exit out of the intima into the lumen, via the process of RTM. Scanning electron micrographs showed that an injection of LPS led to adhesion of leukocytes on the luminal layer of the endothelium of the LC when aortas were harvested 9h post-injection, and these leukocytes were shown to not only be recruited circulating monocytes, as inducing their death by clodronate liposomes did not completely eliminate leukocyte-endothelial adhesion33. Furthermore, it was confirmed that intimal DCs exited the intima after stimulation with LPS, when aortas of CD11c-EYFP mice were harvested and cannulated and a flow of media consisting of LPS was passed through the lumen, there was an increase in CD11c+ cells that was detected by EYFP staining (Fig. 2C). In addition, the decrease in intimal DCs was not observed in CD11c-hBcl2 transgenic mice, whose CD11c+ cells consisted of the anti-apoptotic factor hBcl2. Also, TUNEL staining did not indicate any increase in DNA in the intima upon injection of LPS (Fig. 2D, 2E). Together, these results show that the reduction in intimal DCs was not due to apoptosis, but because of RTM, and the decrease in CD11c+ cells at 24h and 72h post-LPS are referred to as 2 waves of RTM. Both waves of RTM were mediated by induced expression of CCL19 and its receptor CCR7 in intimal DCs. An injection of Chlamydia muridarum also induced two waves of RTM. Blood monocytes shuttled Chlamydia muridarum into the intima, and the second wave of RTM resulted in their clearance. RTM and the clearance of Chlamydia muridarum was inhibited in CCR7 deficient and hypercholesterolemic mice. If RTM can be rescued in hypercholesterolemic conditions, this process may be adaptable for the removal of myeloid cells loaded with intracellular lipid from atherosclerotic lesions. Thus, it is imperative to elucidate the mechanism of RTM and its inhibition by hypercholesterolemia. My project focuses on the role of IL-1β in LPS-induced RTM.

A B

D E

Figure 2

Figure 2: The TLR4 agonist LPS induces RTM of intimal DCs. (A) An injection of LPS induces a decrease in intimal DCs, represented by number of CD11c+ cells present in the LC of the aortic arch of WT mice. The decrease in counts occurs at 12 – 24 hours, and 60 – 72 hours post LPS, which indicates that LPS induces 2 waves of RTM. (B) Injection of Poly I:C, a TLR3 agonist, also induces both waves of RTM at similar timepoints (C) CD11c-EYFP mice were sacrificed and their aortas were cannulated ex vivo, before a buffer solution consisting of either LPS or PBS was passed through the lumen for the timepoints indicated on the graph. The number of EYFP+ cells collected from the buffer, representing intimal CD11c+ DCs, was graphed. (D) The amount of TUNEL-positive DNA was quantified in the LC of the aortic arch from WT mice at different timepoints after injection of LPS. The positive control group included arches from CD11c-DTR mice injected with DT, which kills intimal DCs. (E) PBS, LPS or PolyI:C was injected into CD11c-hBcl2 mice, and number of CD11c+ intimal DCs were quantified 24h post-injection. (C) shows that DCs have undergone RTM upon intreraction of LPS with the endothelium, while (D) and (E) indicate that apoptosis is not a factor that contributes to the decrease in intimal DCs. Values represent mean ± SEM. n > 6. * p < 0.05; ** p < 0.01; *** p < 0.001. This figure is adapted from Mark Roufaiel’s thesis.

1.5 The Interleukin-1 Family The Interleukins are a family of cytokines with either pro-inflammatory or anti- inflammatory activity. They are produced by cells exposed to bacterial products such as lipopolysaccharide (LPS), danger associated molecular patterns (DAMPs) or other mediators of inflammation. The interleukins that are of particular interest to this project are IL-1F2 (IL-1β), IL-1F1 (IL-1a) and IL-1F3 (IL-1 receptor antagonist or IL-1Ra)34.Their receptors and downstream inflammatory effects are briefly summarized in Table 3. The structure of IL-1β was elucidated, as a tetrahedral structure with 12 beta strands forming many complex hydrogen bonds35. IL-1a consists of a β-barrel of 14 beta strands and triple helices36. IL-1Ra, whose structure comprises of a β-barrel consisting of 12 protein strands and 3 β-hairpin loops37, is a competitive inhibitor of IL-1a and IL-1β, and thus, is considered an anti-inflammatory molecule34. 1.5.1 IL-1 production, processing and signalling The transcription and translation of IL-1a and IL-1β is stimulated by DAMPs and pathogen associated molecular patterns (PAMPs), such as LPS. LPS binds to toll-like receptor 4

(TLR4), a transmembrane receptor with extracellular and cytoplasmic domains. LPS binds to the extracellular domain, resulting in a conformational change in TLR4 and the recruitment of MyD88 to the cytoplasmic Toll- and IL-1R-like (TIR) domain. This step, in turn, recruits multiple proteins that initiate a signalling cascade, which leads to the activation of NF-kB transcription factor and transcription of proinflammatory genes, including members of the IL-1 family38. While the IL-1a propeptide can elicit downstream pro-inflammatory functions, it can also be cleaved by calpain to produce IL-1a, also an active cytokine39. However, IL-1β is translated as a propeptide that need to be cleaved by the inflammasome to become active. The inflammasome is formed when danger signals induce NLRP3 to recruit ASC and procaspase-1. Procaspase-1 is auto-cleaved to activated caspase-1 (previously known as interleukin-1 converting enzyme or ICE), which in turn cleaves pro-IL-1β to activated IL-1β, which is then secreted34 (Fig. 3A). Pro-IL-1β may also be cleaved independently of the NLRP3 inflammasome. Studies dating back to the 1980’s have shown that pro-IL-1β could be cleaved by bacterial proteases40. Other proteases such as trypsin and plasmin from human monocytes, Granzyme A from leukocytes, elastin, cathepsin G, collagenase, and chymase in human mast cells also cleave pro- IL-1β. While each of these enzymes cleaves pro-IL-1β at different sites, the products of cleavage results in forms of active IL-1β34. NLRP3-independent cleavage of pro-IL-1β primarily occurs in neutrophilic inflammation, such as neutrophil-mediated arthritis of cartilage tissue. A schematic diagram representing a condensed version of the signalling cascade downstream of IL-1R1 activation is indicated on Fig. 3B. IL-1a and IL-1β bind to IL-1R1, a pro-inflammatory receptor that also has a TIR cytosolic domain capable of recruiting MyD88. The first step of signal transduction includes a conformational change in IL-1R1, required for its dimerization with the IL-1 co-receptor (IL-1RAcP). Both receptors share the same cytosolic TIR domain that recruits MyD88 and IRAK4. IRAK4 undergoes autophosphorylation and then phosphorylates IRAK1 and IRAK2, which causes the recruitment of TRAF6. TRAF6 is an E3 ubiquitin ligase that forms a complex with other E2 ubiquitin ligases and attaches polyubiquitin chains to IRAK1, TAB2, TAB3 and TAK1. The ubiquitination process (as mediated by TRAF6 and other E3 ligases) leads to the binding and oligomerization of TRAF6 with TAK1 and MEKK3, which activates the p38 MAPK, JNK and NF-kB pathways. IKK2 is then activated, which then initiates the formation of a complex consisting of IKK1, IKK2 and the NF-kB essential modifier (NEMO), which binds to polyubiquitin chains on IRAK1 and TAK1. The

10 inhibitor of nuclear factor B (IkB) is phosphorylated by activated IKK and polyubiquitinated and therefore degraded, which releases p65 and p50, the prototypic NF-kB subunits. Following translocation to the nucleus, the p65/p50 NF-kB complex binds to the promoters of genes coding for IkB and several proinflammatory genes such as TNF-a, IL-6, IL-8, MCP-1 and COX-234 41. A summary of the IL-1 receptors and their ligands is shown on Table 4.

Table 1: Important IL-1-related cytokines for this project, their receptors, and their overall pro or anti-inflammatory functions. Adapted from Dinarello, 200934. Name Receptor Property IL-1a IL-1R1 Pro-inflammatory IL-1β IL-1R1, IL-1R2 Pro-inflammatory IL-1Ra IL-1R1 Anti-inflammatory

Table 2: Important IL-1 receptors for this project, their common names, and their ligands. Adapted from Dinarello, 200934. Name Common name Ligands IL-1R1 Primary receptor IL-1a, IL-1β, IL-1Ra IL-1RAcP Co-receptor IL-1a, IL-1β, IL-1Ra IL-1R2 Decoy receptor IL-1β, pro-IL-1β

Figure 3

Figure 3: IL-1β production, processing and signalling pathways (A) Pathway by which LPS leads to the production and processing of active IL-1β by the canonical NLRP3 inflammasome. This figure was produced by Kawana et al., 201442. Permission to use the figure has been obtained from Austin Journal of Clinical Immunology (Austin Publishing Group) (B) Signalling pathway downstream of IL-1β binding to IL-1R1. This figure was produced by Vicenova et al., 200943. Permission to use the figure has been obtained from Physiological Research.

1.5.2 Mice deficient in IL-1β production ASC knockout mice (ASC-/-) lack the ability to assemble the NLRP3 inflammasome to process pro-IL-1β, and therefore ASC-/- peritoneal macrophages are unable to clear Listeria bacteria, and do not produce active caspase-1, IL-1β or IL-18 when infected with Listeria44. Caspase-1 knockout mice (Casp1-/-) are unable to process pro-IL-1β. Adherent Casp1-/- monocytes also exhibited decreased production and no secretion of IL-1β, and decreased secretion of TNF-a and IL-6, 16 hours after stimulation by LPS with nigericin, which induces K+ efflux that activates the NLRP3 inflammasome. In certain cases, however, caspase-1 deficient mice do exhibit inflammasome-independent processing of IL-1β45. In addition, these mice are also deficient in the caspase-11 gene46, important for pyroptosis47. Therefore, Casp1-/- mice may not be the most accurate model to study IL-1β function. On the other hand, IL-1β knockout mice (Il1b-/-) are deficient only in IL-1β and are a better model. These mice have reduced inflammatory processes such as fever or expression of COX-248. IL-1R1 knockout mice (Il1r1-/-) are unable to initiate signalling in response to IL-1 stimulation49, and is therefore also a suitable model to study IL-1 function. 1.5.3 Regulation of the NLRP3 inflammasome NLRP3 has been shown to be upregulated in neutrophils, monocytes, macrophages, DCs50, and to a lesser degree in non-immune cells51. The NLRP3 inflammasome is part of the set of nod-like receptors (NLRs), which consist of 3 domains: the leucine-rich repeat domain (LRR), the nucleotide-binding domain (NBD), and the pyrin domain (PYD). The LRR binds and recognizes ligands that are responsible for the activation of the inflammasome, while the NBD is responsible for the oligomerization of NLRP3 to form the inflammasomal complex. Apoptosis-associated speck-like protein containing a C-terminal caspase recruitment domain (ASC) consists of a PYD, which interacts with the PYD of NLRP3 and is thus recruited as part of the inflammasome. ASC also consists of a caspase recruitment domain (CARD), which binds

13 and interacts with the CARD domain of procaspase-1, which is eventually cleaved such that only the active caspase domain remains52. NLRP3 is activated upon the induction of 2 signals: the first one involves proinflammatory transcription factors such as nuclear-factor kappa B (NF- kB), while the second signal involves activation of the inflammasome or phosphorylation of ASC52. NLRP3 is regulated at the level of protein production. For example, ROS activates NF- kB outside of TLR4 signalling and increases production of NLRP353. Post-translational regulation of NLRP3 also occurs. A major regulator of the NLRP3 protein after its translation is its level of ubiquitination or deubiquitination, which would result in the degradation of the protein or inhibition of degradation respectively. Juliana et al. showed that the deubiquitination of NLRP3 by TLR4, ROS, and ATP is a major requirement in order for the inflammasome to elicit downstream functions54. The activation of NLRP3 can be regulated by the following processes: K+ efflux, ROS production, endoplasmic reticulum (ER) stress, mitochondrial dysfunction, Ca2+ levels, and lysosomal rupture (Fig. 3A)52. K+ efflux is induced by the activation of P2X7 receptors by ATP, which leads to the opening of pannexin hemichannels in the plasma membrane that release K+ 52 55 56. This activates the NLRP3 inflammasome via downstream signalling pathways that involve PKR, SYK and JNK through mitochondrial adapter proteins52 57 58. Increased levels of ROS oxidizes the thioredoxin (TRX) enzyme. TRX activates the ASK kinase enzyme to stimulate the MAP kinase and JNK pathways in order to phosphorylate ASC52 59. Along with these mechanisms, increased ROS production oxidizes mitochondrial DNA, which is important in the activation of NLRP352 60. ROS might also activate double-stranded RNA-dependent protein kinase (PKR), which activates the inflammasome58 61. ER stress is another important factor in NLRP3 activation. ER stress sensors, especially IRE1α, ATF6, PERK and IP3R, are known to increase NF-kB activation, ROS production62, and JNK52 62 63. Lysosomal rupture, which can be upregulated by ROS and cholesterol crystals64 65, leads to the release of cathepsin B, which can either directly bind and activate NLRP366 or JNK67. 1.5.4 Regulation of IL-1β production IL-1β is produced by macrophages, neutrophils, lymphocytes, DCs, endothelial cells, fibroblasts and muscle cells, and the cytokine acts on monocytes, lymphocytes, DCs, granulocytes, epithelial cells, endothelial cells, fibroblasts and smooth muscle cells43. IL-1β production can be stimulated through LPS signalling, and other non-TLR ligands such as

14 complement 5A (C5A).38 68. Regulators of NF-kB-mediated transcription downstream of LPS include NTP-Stat1 and IRF-869. In addition, IL-1a induces transcription of IL-1β70, and the NF- kB response itself can be inhibited by synthesized IkB71. Regulation of IL-1β processing is largely dependent on the NLRP3 inflammasome, which has been covered in detail in the previous section. Secretion of IL-1β is also important but this process is still poorly understood. IL-1β lacks a signal sequence that allows it to be processed in the ER and Golgi. Therefore, IL-1β is not secreted through conventional pathways, but through an alternate pathway that involves vesicular transport72. Andrei et al. showed that IL-1β secretion occurs through its internalization in endolysosomes or early lysosomes73; their exocytosis was activated by ATP-induced K+ efflux74. There is also evidence of IL-1β secretion as a consequence of autophagy, and this process was associated with heat shock proteins75 and ATP76. The formation of a non-canonical inflammasome, which involves caspase-4, caspase-5 and caspase-11, activates caspase-11 that cleaves Gasdermin D, which in turn oligomerizes to form pores in the membrane. This process might also mediate IL-1β secretion, especially when cells undergo increased oxidative stress77 78. Another type of cell death, necroptosis, has recently been proposed as a mechanism for ATP and K+ dependent IL-1β secretion79. IL-1β can also be regulated at the level of signalling. IL-1Ra can compete with IL-1a and IL-1β for IL-1R1 binding, but does not activate a downstream signalling response, since the IL-1RAcP is not recruited. In addition, IL-1 receptor type 2 (IL-1R2) lacks the TIR domain and thus sequesters IL-1 proteins without inducing an intracellular signalling response; therefore, it is considered an anti-inflammatory receptor (Table 4)34 80. IL-1R1 can also bind an adaptor toll- interacting protein (TOLLIP) that inhibits signalling cascade molecule IRAK181, and MAP kinases82. 1.5.5 Downstream functions of IL-1β IL-1β is known to influence gene expression of many proinflammatory and acute phase genes, such as cytokines and their receptors, growth factors, clotting factors, tissue remodelling factors, extracellular matrix molecules, oncogenes, and mediators of lipid synthesis83 84. IL-1β signalling increases expression of adhesion molecules such as VCAM-1, ICAM-1 and E- selectin, cytokine receptors such as those for IL-2, IL-3, and GM-CSF, and specific enzymes such as COX-2 and PLA283. IL-1β signalling also leads to the production of iNOS, which inhibits the contractile response in aortic smooth muscle cells85. IL-1β-mediated NOS

15 production was shown to affect fever levels, sleep patterns, hormone regulation, anabolism, and apoptosis83. IL-1β can alter gene expression profiles and cell markers, thus priming leukocytes to perform their appropriate functions. For example, IL-1β can upregulate CD40, OX40L, SLAM and IL-12 on DCs in order to influence their ability to stimulate T cells. Mast cells respond to IL-1β by secreting TNF-a, IL-3, IL-5 and IL-6 in order to mediate the response to allergens86. IL-1β is also required in order to stimulate Th17 cells and the production of IL-17 by Th17 cells87, in an IL-6-dependent manner88, and in T cell-mediated activation of B cells for antibody production89. 1.5.6 Involvement of IL-1 and related cytokines in atherosclerosis Multiple studies have shown the involvement of the NLRP3 inflammasome in the process of atherosclerosis. In patients with coronary atherosclerosis, the NLRP3 inflammasome was highly expressed in plaques, and was correlated with risk factors that lead to atherosclerosis90. Other components of the inflammasome, such as ASC and caspase-1, as well as IL-1β and IL-18, were also upregulated91. When LDLR-deficient mice were transplanted with bone marrow deficient in NLRP3 or any of its components, atherosclerotic lesions were decreased92 93. NLRP3 inflammasomes could be activated by cholesterol crystals in macrophages92. Cholesterol crystals produced neutrophil extracellular traps that primed macrophages to produce IL-1β which exacerbated atherosclerosis94. In addition, deficiency of caspase-1 in ApoE-deficient mice was shown to decrease atherosclerotic lesions, along with a lesser expression of IFN-γ and MHC II within those lesions95. However, another study showed that typical features of atherosclerosis, such as lesion size and macrophage infiltration, was not altered in mice deficient in NLRP3, ASC and caspase-1; these discrepancies could be due to differences in experimental conditions96. There has been a considerable number of studies that have implicated the role of IL-1β in mediating atherogenesis, in both human and mouse models. Early studies showed that IL-1β was induced by bacterial endotoxin and TNF-a in human vascular endothelial cells97 and smooth muscle cells98, and induced proliferation of the smooth muscle99, a common occurrence in late atherosclerotic lesions. It was also found that IL-1β increased procoagulant activity and leukocyte adhesion on vascular endothelial cells100. Later studies showed that lesion size and area were decreased in mice deficient in ApoE and IL-1β101, as well as in IL-1R1-deficient mice102. Lesion size was increased in mice heterozygous for the IL-1RN gene103. Since IL-1β had a critical role to play in the process of atherosclerosis, it was proposed that this cytokine

16 could be a potential target against cardiovascular disease. Initially, doses of recombinant IL-1Ra (anakinra) was shown to improve the phenotype of patients with various illnesses; however, a much more specific target to IL-1β would be its function-blocking antibody, also known as canakinumab (a monoclonal antibody against IL-1β). The CANTOS trial showed that 3 subcutaneous administrations of canakinumab in humans who have had previous myocardial infarctions led to a decreased level of C-reactive protein (marker of inflammation and cardiovascular disease) and reduced incidence of future myocardial infarctions and strokes104. Although these studies are in agreement with others on the critical role of IL-1β in atherogenesis, a study suggested a protective function for IL-1β signalling since deficiency of interleukin-1 receptor type I (IL-1R1) led to greater plaque instability105. IL-18 is another cytokine produced by the NLRP3 inflammasome, and is also shown to be involved in atherosclerotic processes. Human studies showed that levels of IL-18 in the plasma are good predictors of cardiovascular diseases106. IL-18 is expressed in human plaques, with greater expression levels in unstable plaques107 108. In addition, when IL-18 was inhibited by binding to its binding protein IL-18BP, lesion and fatty streak development in ApoE- deficient mice was inhibited, along with a decrease in macrophages and T cells109.

1.6 Rationale A previous student in our laboratory published data showing that an intravenous injection of IL-1β into mice, or ex vivo incubation of aortas of mice with IL-1β, elicits RTM of intimal DCs in the lesser curvature of the aortic arch (Fig. 4A, 4B). He also showed that RTM of DCs is inhibited in ASC knockout mice incubated with LPS (Fig. 4C), and IL-1β, but not TNF- a, rescued this inhibition33. Moreover, IL-1β could induce RTM of DCs under hypercholesterolemic conditions (not shown). This work suggests that IL-1β is an essential component for LPS-induced RTM of intimal DCs. Additional experiments are required to confirm these findings. Furthermore, studies are necessary to determine if IL-1b signalling in endothelial cells, DCs or both cell types is required for RTM.

1.7 Hypothesis IL-1β production and signalling in the arterial intima is required for LPS-induced RTM of intimal DCs.

1.8 Aims 1. Investigate the expression of IL-1β, other IL-1 family members (IL-1a and IL-1Ra) and proinflammatory genes in the aortic intima throughout the process of LPS-induced RTM by an intravenous injection of LPS. 2. Investigate the function of IL-1β in LPS-induced RTM using genetic strategies and function- blocking antibodies. 3. Ascertain whether bone marrow-derived or artery wall cells produce and respond to IL-1β. 4. Investigate the local functions of IL-1β in LPS-induced RTM by an ex vivo approach.

A B

Figure 4: IL-1β is able to induce RTM of CD11c+ intimal DC. (A) Wild-type (C57BL/6) mice were IV injected with either PBS or different doses of IL-1β. (B) Aortas from wild-type mice were incubated ex vivo for 12 hours at 37oC with PBS or IL-1β. (C) Aortas from ASC-/- mice were incubated ex vivo for 12 hours at 37oC with PBS, 50 µg/mL LPS, 50 ng/mL IL-1β and 500 ng/mL TNF-a. For all graphs, the number of CD11c+ cells was enumerated using en face immunoconfocal microscopy. All ex vivo incubation took place in RPMI, 10% FBS, and 1% penicillin-streptomycin. Values represent mean ± SEM. n > 6. ** p < 0.01; *** p < 0.001. This figure is adapted from Mark Roufaiel’s thesis.

2 Methods

2.1 Reagents and Mice Ultrapure E. coli 011:B4 lipopolysaccharide (LPS) was purchased from Invivogen (cat. no. tlrl-pelps). Recombinant mouse IL-1β (cat. no. 401-ML/CF) was purchased from R&D systems. Polyclonal Armenian hamster IgG (cat. no. BE0091), Armenian hamster anti-mouse IL-1a (clone no. ALF-161, cat. no. BE0243) and Armenian hamster anti-mouse IL-1β (clone no. B122, cat. no. BE0246) blocking antibodies were purchased from BioCell. These reagents were injected intravenously (i.v.) via a tail vein of mice, or used in ex vivo incubations of aortas. For immunostaining experiments, conjugated antibodies to mouse antigens were used. Alexa Fluor 647 conjugated antibodies to CD11c (cat. no. 117312) and CD45 (cat. no. 103124) were purchased from BioLegend. Biotinylated anti-CD11c antibodies (cat. no. 553800) were purchased from BD Pharmingen. The TSATM Fluorescein System – Tyramide Signal Amplification Kit purchased from Perkin Elmer was used after staining with biotinylated antibodies. The reagents in the kit were FITC-conjugated Tyramide reagent (Tyr-FITC), amplification buffer, and streptavidin-conjugated horseradish peroxidase (SA-HRP). Hoechst 33342 was purchased from Molecular Probes, Invitrogen. For gene expression analysis by qPCR, intimal cells were harvested (see below) using LiberaseTM and DNase I enzymes (research grade, Roche), and FITC beads (Polysciences). RNA was isolated and converted to cDNA using reagents from the RNeasy micro RNA extraction kit (Qiagen) and the SuperScript III RT kit (Invitrogen), and the LightCycler 480 SYBR Green I master mix (Roche) was used in qPCR experiments. In addition, genotyping experiments involved a Long-Range Hot Start PCR kit (KAPA). Isolation of RNA from peritoneal macrophages was performed using the E.Z.N.A. total RNA kit (Omega Bio-Tek). All mice were used between 11 and 13 weeks of age. C57BL/6 (WT) mice were either bred in the Animal Resource Centre (ARC) in the Toronto Medical Discovery Tower (TMDT), or purchased from Ontario Cancer Institute or Jackson Laboratories (JAX) (stock no. 000664). Breeding pairs of Casp1-/- (stock no. 016621) and Il1r1-/- (stock no. 003245) mice were purchased from JAX, and breeding pairs of Il1b-/- mice were generously provided by the Delaney Lab at McMaster University, Hamilton, Ontario. All mice were housed and bred at the ARC in the TMDT, and were fed a standard rodent chow. For experiments measuring the first wave of RTM (Fig. 6A, 6B), Il1b-/- mice were bred, housed and obtained from the quarantine facility in the Ontario Cancer Institute, due to a diagnosis of Helicobacter infection. Pups from

20 infected Il1b-/- mice were negative for Helicobacter infection and were subsequently used for most experiments. All protocols were performed according to the guidelines of the Canadian Council of Animal Care.

2.2 Mouse Injections It was previously shown that RTM of intimal DCs is not only induced by LPS through TLR4, but by other TLR or NLR agonists33. Therefore ultrapure E. coli LPS was used throughout this project to focus on TLR4-mediated processes. The dose of LPS (30 µg) used throughout this work is lower by more than 3 folds compared to the previous published work since this dose was sufficient to elicit a decrease in CD11c+ cells that represented RTM and avoided occasional lethal effects observed with the higher doses. Mice were also injected with 100 µg anti-IL-1β, anti-IL-1a antibodies or IgG, or 50 ng IL-1β, during the appropriate experiments. All reagents were diluted in 200 µL PBS. All injections were performed i.v. via a tail vein.

2.3 Harvesting of aortae

Mice were sacrificed by isoflurane overdose or CO2 prior to perfusion at 1.5 psi, through the left ventricle with cold PBS and 4% paraformaldehyde (PFA) in order to fix the tissues. The entire aortic arch and surrounding tissue was removed from sacrificed mice, and placed in 1 mL of 4% PFA for 1 hour, before the ascending aortic arch was isolated by removing the surrounding fat under a dissection microscope, and cutting along the segments indicated on Figure 1A. For ex vivo procedures, aortic arch samples were not fixed.

2.4 Collection of tissue for genotyping In order to verify the genotypes of mice, a piece of earlobe was isolated from mice, using an ear puncher. Earlobes were incubated overnight in 55oC with proteinase K in order to digest the proteins. The extracts were heated for 10 min at 95oC, before they were diluted in PCR- grade H2O and centrifuged at 1400 rpm for 10 min.

2.5 Reciprocal Bone Marrow Transplantation All dissection instruments used in the procedures were sterilized with 70% ethanol.

Recipient mice (5 – 7 week old) were irradiated for 12 min in a gamma cell irradiator by exposure to 10 Grays of gamma irradiation by a radioactive cesium 137 source. Donor mice were sacrificed, and their tibia and femur bones were washed in ethanol and 1X sterile PBS. After the bones were further cleaned from surrounding muscles, RPMI (10% FBS, 1% penicillin-streptomycin) were used to flush out the marrow from the femur and tibia. Cells were layered on a 70 µm strainer and topped to 10 mL. Cells were counted using a hemocytometer, after dilution (1:5) of an aliquot with crystal violet in order to avoid counting red blood cells. After spinning for 10 min at 300 g, 5 X 106 cells in RPMI (300 µL) were injected into the irradiated recipient mice. Experiments were performed after recipient mice recovered for 6 weeks.

2.6 Ex Vivo Experiments Mice were perfused in the left ventricle with Krebs ringer buffer solution containing 10% FBS, 1% HEPES. Isolation of the aortic arch was performed as described in 2.3, but the aortae were not fixed, and the ascending arches were left intact and placed in 2 mL Krebs ringer buffer containing 10% FBS, 1% HEPES, 1% Penicillin-Streptomycin, with or without 25 µg/mL LPS, or 50 ng/mL IL-1β for up to 18 hours, with shaking at 120 rpm, at 37oC. The aortae were then placed in 4% PFA for 1 hour, and prepared for en face confocal analysis as in 2.3.

2.7 En Face Immunostaining and Confocal Microscopy All fixed aortae were placed on a shaker in 1.5 mL Eppendorf tubes, where they were immersed in 0.5% Triton X-100 for 5 minutes to permeabilize the cells and 3% hydrogen peroxide for 30 minutes to quench any peroxidase activity. Immunostaining was performed with biotinylated CD11c antibody (1:100) in 10% goat serum overnight followed by SA-HRP (1:200) for 30 minutes, Tyr-FITC (1:100) for 8 minutes, and Hoechst (1:400) for 25 minutes. Alexa Fluor 647 conjugated antibodies were also used in certain experiments (1:150 anti- CD11c, 1:100 anti-CD45). After each incubation step, there were 3 washes in PBS for 4 min each and 5 washes after the steps involving overnight Ab incubation and shaking with Tyr- FITC. The aortae were flattened and mounted on slides, and imaged under the confocal microscope with a Nikon A1R+ Resonance Scanning Confocal 40X oil (N.A. 1.3), and lasers emitted light of wavelengths 405, 488 and 640 nm, for Hoescht, Tyr-FITC and Alexa Fluor 647 staining respectively. Z-stack images (1 µm each) were compiled to a single image and stitched

22 to cover the LC area (Nikon NIS Elements C). The CD11c+ cells were counted using the ImageJ software (National Institute of Health, version 1.50i).

2.8 Isolation of RNA from Intimal Cells After perfusion of mice with 10 mL of cold PBS, aortae were cleaned in cold PBS containing 1 mM aurintricarboxylic acid (ATA), a ribonuclease inhibitor, on a silicone-coated dissection dish. Aortae were then pinned down on the dish with intima facing up and 2 µL DNase I and 100 µL of 25 µg/mL Liberase Blendzyme were added for 10 min at 370C in order to digest extracellular matrix molecules. After washing with PBS/ATA, a needle was used to gently scrape cells off the intima, covered in FITC beads. RNA carrier (0.04%) and β- mercaptoethanol were added prior to RNA isolation using the Qiagen microRNeasy kit, according to the supplier’s protocol.

2.9 RT-qPCR Random primers were added to RNA samples isolated from the intima and reverse transcription (RT) of mRNA was performed using the SuperScript III RT kit. The resulting cDNA (diluted 1:10) was used for gene expression analysis by real-time PCR (qPCR) using LightCycler 480 SYBR Green I master mix, along with forward and reverse primers that span exon-exon junctions. Primers for qPCR are listed in Table 1. Roche LightCycler 480 was used for qPCR; the settings required for SYBR Green I amplification are: 95oC for 5 minutes initially, then 45 cycles of 95oC for 10 seconds, 60oC for 20 seconds and 72oC for 30 seconds. Analysis of the relative amounts of mRNA was performed using the Roche LightCycler 480 software, and the comparative standard curve method. Standard curves were prepared by measuring 10-fold serial dilutions of mRNA levels from the heart, lungs, liver and lymph nodes of C57BL/6 mice after injections with 10 µg LPS for 2 hours. Relative amounts of mRNA expression values were calculated after normalizing to VE-cadherin. In order to genotype Casp1-/- and Il1r1-/- mice, DNA samples (section 2.4) were amplified by PCR (GeneAmp PCR System 9700, Applied Biosystems), using the primer sets indicated in Table 2, and reagents from the KAPA Long-Range HotStart PCR kit, as specified in the Jackson Laboratories website. 10X loading dye was added to the amplified PCR samples, before they were loaded onto a 2% agarose gel consisting of a 1:10000 dilution of Gel Red, a UV-activated fluorophore that binds to DNA. After electrophoresis at 100V, gels were placed

23 under a camera and bands were visualized under UV light (DNR Bio Imaging Systems, MiniBIS Pro). In order to genotype Il1b-/- mice, qPCR was performed. WT and mutant genotypes were determined by distinct melt curve profiles.

2.10 Isolation of Peritoneal Macrophages Thioglycollate-elicited peritoneal macrophages were harvested by Kenneth Ting (PhD candidate) in our laboratory from C57BL/6 mice, as previously described110. Cells (1 x 106/well in 24-well plates) were cultured overnight in DMEM (Wisent, QC) containing 10% FBS, 2 mM L-glutamine and 10000U/mL Penicillin-streptomycin. After washing off the non-adherent cells, adhered peritoneal macrophages were incubated in the same media with 10.6 ng/mL IL-1β, with control IgG, anti-IL-1β or anti-IL-1a function blocking antibodies (10 µg) for 1h prior to lysis and RNA purification according to the protocol provided by the supplier of the E.Z.N.A. total RNA kit.

Table 3: Primer sequences used to measure mRNA expression levels

Gene Primer 5’ – 3’ sequence VE-CAD Forward GAAAACCAGAAGAAACCGCTGAT Reverse CACTGGTCTTGCGGATGGA IL-1a Forward ACGGCTGAGTTTCAGTGAGACC Reverse CACTCTGGTAGGTGTAAGGTGC IL-1β Forward AGTTGACGGACCCCAAAAGA Reverse TGCTGCTGCGAGATTTGAAG IL-1R1 Forward ATGAGTTACCCGAGGTCCAG Reverse CTGTGCTCTTCAGCCACATT IL-1Ra Forward TGAAATGGCAGTCGCTAGTC Reverse TGAGCTGGTTGTTTCTCAGG IL-1R2 Forward GGAACCCATCCCTGTGATCA Reverse CAGAAACACTTTGCACGGGA IL-1RAcP Forward GGAGGATCTCAGGCGCAACTAT Reverse CCAGAAAGACCGTGGCTCCAAA TNF-a Forward GTAGCCCACGTCGTAGCAAAC Reverse GCACCACTAGTTGGTTGTCTTTGA IL-6 Forward TGCCATTGCACAACTCTTTTC Reverse TGCCATTGCACAACTCTTTTCT IL-18 Forward ACAGGCCTGACATCTTCTGC Reverse CCTTGAAGTTGACGCAAGAGT

Table 4: Primer sequences used for genotyping mice

Mouse Primer 5’ – 3’ sequence Strain Casp1-/- Wild-type Forward (12572) GAGACATATAAGGGAGAAGGG Common (12573) ATGGCACACCACAGATATCGG Mutant Forward (oIMR5944) TGCTAAAGCGCATGCTCCAGACTG Il1b-/- Wild-type Reverse AGCTCAGAGTCTCACCTTCA Common Forward GGAGCTATCACTTGACCACATC Mutant Reverse AGGCGATTAAGTTGGGTAACG Il1r1-/- Wild-type Forward (20665) GGTGCAACTTCATAGAGAGATGA Common (20666) TTCTGTGCATGCTGGAAAAC Mutant Forward (10774) CTCGTGCTTTACGGTATCGC

3 Results

The purpose of this project was to study the role of IL-1β in LPS-induced RTM of intimal DCs. Our laboratory previously published that an injection of LPS into C57BL/6 mice induced 2 waves of RTM of intimal CD11c+ myeloid cells, which occurred at 12h - 24h and 60h - 72h33 (Fig. 2A). The decrease in CD11c+ cells was not attributed to programmed cell death, as shown by TUNEL staining and CD11c-hBcl2 mice, and intimal DCs were collected from cannulated aortas exposed to a flow of LPS (Fig. 2C). In this study, genetic and antibody blockade approaches were used in order to study the importance of IL-1b during the two waves of LPS-induced RTM. The importance of IL-1b expression in hematopoietic versus non- hematopoietic compartments was assessed by bone marrow transplantation (BMT) using mice deficient in IL-1b and IL-1R1.

3.1 Intimal expression of IL-1β and other pro-inflammatory genes during LPS-induced RTM of intimal DCs The mRNA expression of intimal IL-1b as well as other genes of the IL-1 family was assessed at different time points throughout RTM in order to correlate expression with the two distinct waves of RTM. In peritoneal macrophages, it is known that LPS induces a time- dependent production of IL-1β, TNF-a and IL-6110. The inflammatory landscape of the intima was further characterized by similar analyses of mRNA expression levels of other pro- inflammatory genes that are typically induced by LPS in other myeloid cell systems. 3.1.1 LPS induces increases in the intimal expression of IL-1 genes during the first wave of RTM Figure 5A shows that LPS induced intimal mRNA expression of IL-1β rapidly, with two peaks within 12 hours. The first peak (200-fold increase relative to baseline) occurred at 3h followed by a second peak (about 175-fold increase) at 9h. These oscillations in IL-1b induction preceded and coincided with the first wave of RTM, which occurs between 6 and 12h post-LPS1 (Fig. 5A). Expression levels gradually increased further up to 48h and during the second waves of RTM at 72h; however, this increase was not statistically significant (Fig. 5A). mRNA levels of IL-1a, another cytokine binding to IL-1R1, was induced 20-fold after 3h, coinciding with the first peak of IL-1β mRNA induction, while the second peak appeared more sustained, reaching maximal expression 24h post-LPS (Fig. 5B). These changes were

26 accompanied by a rapid induction of IL-1Ra mRNA levels which showed a similar profile to IL- 1a (Fig. 5C). Expression levels of IL-1a and IL-1Ra mRNA gradually declined and reached baseline levels by 96h. There appeared to be a decrease in IL-1Ra mRNA between 56 and 60 hours, which precedes the second wave of RTM. The mRNA expression profiles of the IL-1 receptors were also assessed within the duration of the two-waves of LPS-induced RTM. While relatively small induction of IL-1R1 was observed over the first wave of RTM (Fig. 6A), no significant changes were observed in the mRNA levels of IL-1RAcP, the co-receptor (Fig. 6B). Interestingly, a sustained and significant increase of IL-1R2 (decoy receptor) mRNA levels, up to 40-fold, was measured following the first wave of RTM, with peak expression at 48h (Fig. 6C). Subsequently expression declined coincident with the second wave of RTM (between 54 and 72 hours post-LPS) and a second peak was observed at 72h. 3.1.2 LPS induces increases in gene expression of other pro-inflammatory cytokines The initial bursts that are of intimal IL-1β mRNA expression suggest that it has a critical function in the initiation of LPS-induced RTM. TNF-a is a pro-inflammatory cytokine whose transcription and translation is induced downstream of TLR4 and IL-1R1 signalling111. In agreement with a potential requirement for local signalling, LPS-induced TNF-a mRNA expression levels displayed a similar oscillatory characteristic of the two peaks mRNA of IL-1β mRNA expression at 3 and 9h post-LPS (Fig. 7A). The LPS-induced mRNA expression of IL-6 mRNA, another proinflammatory cytokine whose expression is regulated by IL-1β112, displayed an induction profile that was similar to that of IL-1a (Fig. 7B). Like IL-1β, IL-18 is a proinflammatory cytokine with the pro-IL-18 cleaved by caspase-1 in the NLRP3 inflammasome complex113. Modest increases in IL-18 mRNA expression levels were observed at and beyond 72h post-LPS, following the second wave of RTM1 (Fig. 7C). Overall, mRNA of IL-1b and other proinflammatory cytokines (IL-1a, TNFa and IL-6) is induced dramatically in the arterial intima prior to and during the first wave of RTM (6 – 12 hours post-LPS). This coincides with induction of IL-1RA and IL-1R2, which are inhibitors of IL-1 signalling. Although a peak of IL-1b mRNA expression was not observed prior to the second wave of RTM (54 – 72 hours post-LPS), expression was still elevated relative to baseline levels and the expression of IL-1RA and IL-1R2 declined at 54 and 60h post-LPS, which may account for IL-1R1 signalling coincident with the second wave of RTM.

A B

Figure 5: Time-course of gene expression profiles for (A) IL-1β, (B) IL-1a and (C) IL-1Ra in WT mice following LPS injection. Mice were injected iv with 30 µg of LPS, and the intima was micro-dissected at sequential time points. Intimal cell RNA was isolated, and gene expression levels were determined by reverse transcription and qPCR. All values are normalized to the endothelial VE-cadherin (Cad5) mRNA levels and plotted relative to the expression level at 0 h (no injection). Values represent mean ± SEM. n = 5 - 6. Statistically significant differences from the 0 h time point were determined using one-way ANOVA with Dunnett’s multiple comparison test; * p<0.05; ** p<0.01; *** p<0.001.

A B

Figure 6: Time-course of gene expression profiles for (A) IL-1R1, (B) IL-1RAcP and (C) IL- 1R2 in WT mice following LPS injection. Mice were injected iv with 30 µg of LPS, and the intima was micro-dissected at sequential time points. Intimal cell RNA was isolated, and gene expression levels were determined by reverse transcription and qPCR. All values are normalized to the endothelial VE-cadherin (Cad5) mRNA levels and plotted relative to the expression level at 0 h (no injection). Values represent mean ± SEM. n = 5 - 6. Statistically significant differences from the 0 h time point were determined using one-way ANOVA with Dunnett’s multiple comparison test; * p<0.05; *** p<0.001.

A B

Figure 7: Time-course of gene expression profiles for (A) TNF-a, (B) IL-6 and (C) IL-18 in WT mice following LPS injection. Mice were injected iv with 30 µg of LPS, and the intima was micro-dissected at sequential time points. Intimal cell RNA was isolated, and gene expression levels were determined by reverse transcription and qPCR. All values are normalized to the endothelial VE-cadherin (Cad5) mRNA levels and plotted relative to the expression level at 0 h (no injection). Values represent mean ± SEM. n = 5 - 6. Statistically significant differences from the 0 h time point were determined using one-way ANOVA with Dunnett’s multiple comparison test; *** p<0.001.

3.2 IL-1β is required to elicit the first wave of RTM induced by LPS Previous data showed that incubation of aortas from ASC-/- mice with LPS ex vivo did not elicit RTM (Fig. 4C), and the same result was shown in vivo upon injection of LPS (data not shown). IL-1b rescued RTM in ASC-/- mice pointing to a critical role for IL-1b in this process. In this study other mouse models were used that are deficient in IL-1β production, processing and signaling: Il1b-/-, Casp1-/- and Il1r1-/- mice, respectively and compared to WT mice. Aortae from WT mice were harvested at 24h post-LPS injection and stained for CD11c and analyzed by en face confocal microscopy (Fig. 8A, 8B). As shown in a representative confocal image (Fig. 8A) and the cumulative data (Fig. 8B), numbers of CD11c+ cells in the LC of the aortic arch decreased by 31% in LPS injected mice relative to PBS. This decrease was minimal and lacked statistical significance between PBS and LPS-injected groups in Casp1-/-, Il1b-/- and Il1r1-/- mice. It is to note that the baseline level of CD11c+ cells in Casp1-/- mice was significantly lower (Fig. 8B), which suggested a role for Caspase-1 in homeostasis of intimal DCs. As a second approach, antibody blockade experiments were performed with function- blocking antibodies neutralizing IL-1β or IL-1α or control IgG. First, the specificity of these function blocking antibodies were tested with thioglycollate-elicited peritoneal macrophages that were stimulated with purified recombinant mouse IL-1β for 2h. (Fig. 9A). IL-1β induced IL-1β and TNF-α mRNA in these cells. The induction of these genes was not detectable when cells were pre-incubated with the function-blocking antibodies against IL-1β, when compared to the mRNA levels with control IgG. In contrast, anti-IL-1α blocking Abs did not affect IL-1β and TNF-α gene expression. This experiment confirmed that there is no cross-reactivity between the IL-1α and IL-1β blocking antibodies. Subsequently, WT mice were injected with LPS and the antibodies tested above, and the aortic arches were harvested 24h later (Fig. 9B). As expected, CD11c+ intimal cell numbers were reduced significantly (25%) when LPS was injected along with IgG control for 24h, relative to the intimal cell numbers with IgG alone, indicating that IgG injection did not affect RTM. However, neutralizing IL-1β or IL-1α significantly blocked LPS- induced RTM. These data are consistent with the findings in Figure 8B that signaling through IL-1R1 is required for LPS-induced RTM. Interestingly, these data suggest that IL-1α or IL-1β are equally critical for the first wave of LPS-induced RTM. In the future, the role of IL-1α needs to be tested in Il1a-/- mice.

3.3 IL-1β is also required to elicit the second wave of RTM induced by LPS Figure 5A showed that gene expression levels of IL-1β were upregulated before the first wave of RTM. During the second wave (60h - 72h) the increase in IL-1β mRNA levels were not statistically significant. However, the mRNA expression profiles for pro-IL-1β do not provide direct information about the levels of mature IL-1β protein that can be actively involved in the subsequent second wave of LPS-induced RTM. Therefore, experiments were performed to determine whether IL-1β is required for the second wave of RTM at 72h post-LPS, using Casp1- /- and Il1b-/- mice (Fig. 8C). Previously published data indicated a decrease in CD11c+ cells at 60 – 72h after an injection of 100 µg LPS (Fig. 2A); an injection of 30 µg of ultrapure LPS produced the same result (data not shown). There was no significant decrease in intimal CD11c+ cell numbers in both Casp1-/- and Il1b-/- mice, suggesting that the second wave of LPS-induced RTM may require IL-1β (Fig. 8C). The drawback from these experiments is that with the knockout mice used, the first wave is already inhibited which may prevent the second wave even if IL-1β was not directly involved. Therefore, a second approach with function-blocking antibodies was used. LPS or PBS was injected to WT mice for 72h and anti-IL-1β or anti-IL-1a blocking antibodies or IgG was injected 48h post-LPS for 24h (Fig. 9C). This protocol allowed for the first wave of LPS-induced RTM to occur prior to adding the blocking antibodies for testing the second wave. The data generated was similar to Figure 9B; RTM of intimal DCs occurred in the aortas of WT mice injected with LPS and IgG, while there was inhibition of RTM when LPS was injected with anti-IL-1β or anti-IL-1α antibodies (Fig. 9C). Overall, these data confirmed that both IL-1β and IL-1α are required for the first and second waves of LPS- induced RTM. The fact that both IL-1β and IL-1α signal through the same receptor, IL-1R1, suggest that common signaling molecule(s) or secreted product(s) produced through the same receptor signaling pathway may be critical for LPS-induced RTM (see the scheme in Discussion).

PBS LPS A

B C Measuring Wave 1 RTM in Il1b-/-, Casp1-/- Measuring Wave 2 RTM in Il1b-/- and and Il1r1-/- mice Casp1-/- mice

0h 24h 0h 72h

LPS Harvest PBS Harvest PBS aortas LPS aortas

Figure 8: Both waves of RTM are inhibited in Casp1-/-, Il1b-/- and Il1r1-/- mice (A) Representative tiled en face confocal microscopy images showing CD11c+ cells in the entire lesser curvature of the ascending aorta of WT mice injected with either PBS or LPS. The absolute number of CD11c+ cells was determined in the LC of the aortic arch in WT mice and mice deficient in caspase-1, IL-1β or IL-1R1 at 24 hours (B) and 72 hours (C) after iv injection of PBS or LPS (30 µg). Schematic plan for all experiments performed are above the graphs. Aortas were stained with Alexa-647 anti-CD11c Ab (WT, Casp1-/- mice) or biotinylated anti- CD11c Ab (Il1b-/-, Il1r1-/- mice). Values represent mean ± SEM. n = 5 – 9. Statistically significant differences were determined using one-way ANOVA with the Bonferroni post-hoc test; * p<0.05.

Peritoneal macrophages incubated with IL-1β and Ab A

B Measuring Wave 1 RTM with C Measuring Wave 2 RTM with anti-IL-1β and anti-IL-1α Ab anti-IL-1β and anti-IL-1α Ab

0h 24h 0h 48h 72h

1. LPS Harvest PBS IgG Harvest 2. IgG; anti-IL-1β; aortas LPS anti-IL-1β aortas anti-IL-1α anti-IL-1α

Figure 9

Figure 9: Both waves of RTM are inhibited in mice injected with neutralizing antibodies to IL- 1β and IL-1α. (A) Gene expression levels of TNF-α and IL-1β after peritoneal macrophages from WT mice were incubated with IgG, anti-IL-1β or anti-IL-1α antibodies and stimulated with IL-1β for 2h. (B) Absolute numbers of CD11c+ cells was determined in WT mice at 24 hours after iv injection of PBS or LPS (30 µg), immediately followed by another injection of IgG, anti-IL-1β or anti-IL-1α antibodies (100 µg). (C) Absolute numbers of CD11c+ cells was determined in WT mice at 72 hours after iv injection of PBS or LPS (30 µg), when IgG, anti-IL- 1β or anti-IL-1α antibodies (100 µg) were injected at 48h post-LPS. Schematic plan for all experiments performed are above the graphs. Aortas were stained with biotinylated anti-CD11c Ab. Values represent mean ± SEM. n = 7 – 8. Statistically significant differences were determined using one-way ANOVA with the Bonferroni post-hoc test; * p<0.05.

3.4 The production of IL-1β and signaling through its receptor in non-hematopoietic cells, as opposed to bone marrow-derived cells, is required for the first wave of RTM of intimal DCs Roufaiel et al. showed that CCL19-CCR7 interactions were essential to mediate RTM of intimal DCs33. They also showed that CCL19 production and signalling via CCR7 receptors on DCs that belong to the hematopoietic compartment, as opposed to on artery wall cells, was essential for RTM33. Therefore, it was of interest to ascertain whether IL-1β production and signalling in artery wall cells or bone marrow cells was required for RTM. In the following experiments, reciprocal BMT was performed on lethally-irradiated recipient WT, Il1b-/- or Il1r1- /- mice, which were transplanted with WT or knockout bone marrow. After 6-7 weeks of recovery, the mice were injected with LPS or PBS and their aortas were harvested 24h later and stained for CD11c (Fig. 10A). The table in Figure 10A lists the phenotypes of the three types of chimeric mice produced. In WT recipient mice transplanted with WT bone marrow, a decrease in intimal DC numbers was observed 24h after an injection of LPS, which is consistent with RTM. This experiment confirmed that BMT procedure did not affect the process of RTM (Fig. 10B, 10C). In WT recipient mice transplanted with Il1b-/- or Il1r1-/- bone marrow, a decrease in intimal Cd11c+ cells was observed, consistent with RTM, but in Il1b-/- or Il1r1-/- recipient mice transplanted with WT bone marrow, a decrease in intimal Cd11c+ cells was not observed, suggesting that RTM was inhibited (Fig. 10B, 10C). Therefore, these results showed that RTM of intimal DCs was elicited through IL-1β and its receptor IL-1R1 in the non-hematopoietic

compartment as opposed to bone marrow-derived cells. Since the intima consists of endothelial cells, and leukocytes that are derived from bone marrow, these data suggest that IL-1β production and signalling on endothelial cells, not intimal DCs, was responsible for RTM.

0h <6h 6-7 wks 24h

Irradiate Isolate bone Inject PBS, LPS Harvest recipient marrow and aortas mice transplant

WT à WT WT à KO KO à WT No deficiency Deficiency in artery wall Deficiency in bone marrow cells cells

B C BMT: WT ßà Il1b-/- BMT: WT ßà Il1r1-/-

Figure 10: Reciprocal bone marrow transplantation experiments between WT and KO mice. (A) Schematic of reciprocal bone marrow transplantation and subsequent assessment of RTM, and table explaining cells expressing deficiency of genes in each group of mice with transplanted bone marrow. The absolute number of intimal CD11c+ cells (stained with biotinylated CD11c Ab) in Il1b-/- (B) or Il1r1-/- (C) chimeric mice was enumerated in the LC of the ascending aortic arch. Mice were injected with either PBS or LPS 24h before analysis. Values represent mean ± SEM. n = 3 – 8. Statistically significant differences were determined using the Student’s t-test, between PBS and LPS-injected groups. * p<0.05; ** p<0.01.

3.5. Local effects of IL-1β on intimal cells are required for RTM of intimal DCs It is most likely that intravenous injection of LPS into mice elicits production of IL-1β and other cytokines not only in the intima but rather systemically, in multiple organs, e.g., liver and spleen, resulting in elevated IL-1β circulating in the blood114 115 116. In fact, it was shown that an injection of LPS in mice led to an increase in serum TNF-a at 1h - 2h, followed by an increase in serum IL-1β and IL-6 at 4h onward117 118. Thus, systemically produced IL-1β may induce other proinflammatory cytokines, which could possibly mediate RTM of intimal DCs. The data presented in Figures 8 and 9 do not address these considerations, i.e., whether other critical cytokines may be induced by LPS or IL-1β signalling systemically or locally in the aorta. While an injection of LPS is not sufficient to induce RTM in Il1b-/- mice, an injection of LPS followed by 2 injections of IL-1β at 3h and 9h post-LPS, corresponding to the increase in local IL-1β gene expression in the intima (Fig. 11A), did elicit a decrease in CD11c+ cells. This result suggested that local IL-1β signalling in the intima at those time points is required for RTM of intimal DCs. However, unlike in WT mice, where RTM was induced upon a single injection of IL-1β 24h prior to harvesting aortas (Fig. 11B), this injection did not induce RTM in Il1b-/- mice (Fig. 11C). We speculated that this result is because i.v. injected LPS or IL-1β cannot induce local production of IL-1β in Il1b-/- mice, in contrast to WT mice, and furthermore, LPS or IL-1β are cleared rapidly from the blood after a single i.v. injection. Circulating TNFa and IL-1β produced in response to injected LPS are also cleared rapidly119 120. Therefore, ex vivo experiments were performed using aortas harvested from Il1b-/- mice and incubated with PBS, LPS or IL-1β. The ex vivo incubation will maintain a constant level of IL-1β, unlike after a single i.v. injection in vivo. There was no decrease in the number of intimal CD45+ cells if aortas were incubated with LPS, but IL-1β incubation reduced intimal CD45+ cells, consistent with RTM (Fig. 11D). Since there is no known apoptosis defect in Il1b-/- mice, this experiment is consistent with IL-1-dependent RTM, as opposed to apoptosis, as the process that accounts for reduced number of intimal myeloid cells. Therefore, these results with Il1b-/- mice suggest that IL-1β acts locally in non-hematopoietic cells to elicit RTM of intimal DCs. A future direction is to identify key downstream mediators produced by IL-1 signalling.

-/- A RTM rescue experiments in Il1b mice 0h 3h 9h 24h

PBS ------Harvest LPS ------aortas LPS IL-1β IL-1β

B C In vivo mIL-1β (WT mice) (Il1b-/- mice)

Ex vivo mIL-1β (Il1b-/- mice) D 0h 18h

PBS, LPS, Fix IL-1β

Figure 11

Figure 11: IL-1β acts locally in the intima in order to elicit RTM of DCs. (A) RTM rescue experiments performed in Il1b-/- mice. The absolute number of CD11c+ cells was determined in the LC of the aortic arch in WT mice and mice deficient in IL-1β at 24 hours (B) post PBS, LPS (30 µg), or LPS + 2 IL-1β (50 ng per injection) injections. RTM was compared between WT (B) and Il1b-/- mice (C), which were injected with IL-1β and whose aortas were harvested 24h later. The graph in (B) has been adapted from Mark Roufaiel’s thesis. (D) Numbers of CD45+ cells were determined in Il1b-/- mice 18 hours after incubation of aortas ex vivo with PBS, LPS (25 µg/mL) or IL-1β (50 ng/mL). Schematic plan for all experiments performed are above the graphs, except for (B) and (C), whose schematics are that of Fig. 8B, except that IL-1β was injected as opposed to LPS. Aortas were stained with biotinylated anti-CD11c Ab or Alexa Fluor 647 anti-CD45 Ab. Values represent mean ± SEM. n = 5 – 9. Statistically significant differences were determined using one-way ANOVA with the Bonferroni post-hoc test; * p<0.05; ** p<0.01; *** p<0.001.

4 Discussion

Previously published data from our laboratory showed that infection of wild type C57BL/6 mice by intranasal or intravenous administration of the intracellular pathogen, Chlamydia muridarum, or inflammation by TLR agonists such as PolyI:C or LPS, induced RTM of intimal DCs that are present in atherosclerosis-susceptible regions of the aortic arch33. Chlamydia muridarum was removed by RTM of DCs, suggesting that RTM is a protective mechanism against infection in the normal aorta. It was proposed that inflammatory cytokines such as IL-1β or TNF-a are produced under conditions that induce RTM and they may have a role in this process. In fact, intravenous administration of IL-1β, or ex vivo incubation of the normal arch with IL-1β, did induce RTM of DCs (Fig. 4A, 4B)33. Since IL-1β is produced downstream of LPS signalling, the aim of this study was to verify whether LPS-induced IL-1β is critical for RTM of intimal DCs and obtain potential mechanistic insights. This study confirmed that IL-1β expression and signalling are critical for LPS-induced RTM of intimal CD11c+ DCs in C57BL/6 mice. LPS induces RTM in two waves (Fig. 2A) and evidence is presented that IL-1β is required for both waves using mice deficient in caspase-1 or IL-1β, which do not produce IL-1β, or mice deficient in IL-1R1, which lack IL-1β-induced signalling (Fig. 8). Gene expression of IL-1β, its related cytokines and receptors, and other pro- inflammatory cytokines were significantly increased before and during the first wave of RTM (Fig. 5 – 7). Experiments with function-blocking antibodies against IL-1β further confirmed the findings with the knockout mice and were especially valuable to demonstrate the importance of IL-1β for the second wave of LPS-induced RTM (Fig. 9B, 9C). Moreover, the results with the antibodies negated any potential compensation issue due to IL-1b deficiency in the knockout models that could have contributed to the results. The second wave of RTM occurs between 60- 72h. However, LPS and IL-1β are cleared from the bloodstream via the kidneys and liver at 30 min and 90 min respectively, well before the second wave of RTM begins119 120. Thus, the requirement for IL-1b for the second wave is intriguing. There is a slight increase in the expression of IL-1β, TNF-a and IL-6 from 54h to 72h post-LPS (Fig. 5A, 7A, 7B). Whether this second increase in the expression of these genes is in endothelial cells or DCs that proliferated between both waves of RTM and the triggers involved have yet to be discovered. Reciprocal bone marrow transplantation experiments suggested that IL-1β produced by artery wall cells, as opposed to bone marrow-derived cells, was important to elicit the first wave of LPS-induced RTM (Fig. 10).

Previously, it was demonstrated that the reduction in intimal DC numbers during the first and second wave after injection of LPS into WT mice correlated with their exit from the intima, rather than apoptosis, as shown by scanning electron microscopy, cannulation experiments and assessing apoptosis of intimal DCs (Fig. 2, detailed explanation in Introduction)33. For example, when aortae of CD11c-EYFP mice were cannulated, and exposed to a flow of media containing LPS, CD11c+EYFP+ cells were collected (Fig. 2C). Therefore, a significant reduction in intimal DCs upon exposure to LPS or IL-1b in the study by Roufaiel et al.33, and in this thesis, was attributed to RTM. In the future, key findings of this study will be verified by approaches used previously to demonstrate RTM or by imaging in real-time, once established in the laboratory. It is important to note that the baseline numbers of CD11c+ cells in Casp1-/- mice was significantly lower than those of WT mice, and this trend was observed in Il1b-/- and Il1r1-/- mice (Fig. 8B). In addition, BMT experiments showed that baseline numbers were lower in recipient Il1b-/- and Il1r1-/- mice transplanted with WT bone marrow cells (Fig. 10). These results indicate that IL-1β is important for the homeostasis of intimal DCs. There are 2 types of DC populations with different markers that were shown to be present in the intima14 (described in the Introduction). It could be envisaged that if there is a specific population of DCs that preferentially undergoes RTM but missing in mice deficient in IL-1β or signalling, the lack of LPS-induced RTM in intimal DCs in these mice may be due to the absence of this population. However, this was shown not to be the case in Il1b-/- mice, as in vivo and ex vivo treatment with IL-1β rescued RTM, indicating that the intimal DCs in these mice are capable of undergoing RTM (Fig. 11A, 11D). An injection of LPS induces IL-1a, IL-1β, IL-1Ra, TNF-a and IL-6 in macrophages that reside in the marginal zone of the spleen. These cytokines are then released into the serum115 121 116, and could mediate pathological effects in multiple organs. In addition, Figure 9A showed that stimulation of peritoneal macrophages with IL-1β results in IL-1β and TNF-a production. Therefore, it is possible that upon injection of LPS or IL-1β, systemic production of IL-1β or downstream cytokines are responsible for RTM of DCs. It was because of these considerations that ex vivo experiments were undertaken, which showed that incubation of aortas from Il1b-/- mice with recombinant mouse IL-1β induced RTM (Fig. 11D). Therefore, combined with the data from in vivo experiments, we conclude that LPS-induced IL-1β in the intima signals locally via the IL-1R1 on endothelial cells to induce the production of downstream molecules or cytokines that mediate the process of RTM of intimal DCs.

Results of gene expression levels of LPS-induced IL-1β showed two rapid peaks of expression at 3h and 9h post-LPS, time points that respectively precede the onset and coincide with, the first wave of RTM (Fig. 5A). While this study showed that endothelial IL-1β is important for RTM (Fig. 10B), previous data from our lab showed that intimal DCs also produce IL-1β16. Therefore, it is possible that the oscillating levels of mRNA expression of IL- 1β at 3h to 9h post-LPS results from different cells producing IL-1β at different times. Based on the results with BMT showing that endothelial IL-1β production is critical for the first wave of RTM, it is possible that the first wave of IL-1β in endothelial cells induces intimal DCs to produce IL-1β subsequently, corresponding to the second pulse at 9h. IL-1β was shown to mediate the migration of neutrophils across endothelial cells in a Ca2+-dependent manner122. Moreover, IL-1β promoted RTM of neutrophils by reducing JAM-C expression in endothelial cells within veins of the cremaster muscle25. Further studies have to be performed in order to determine if IL-1β mediates RTM of intimal DCs utilizing these mechanisms. mRNA expression levels of TNF-a followed a very similar pattern to that of IL- 1β, with peaks of mRNA expression at 3h and 9h post-LPS (Fig. 5A, 7A). Further studies need to be performed to determine the relationship between LPS-induced IL-1β and TNF-a during LPS-induced RTM of intimal DCs. It is possible that both cytokines might have complementary functions since both IL-1β and TNF-a are pro-inflammatory cytokines that promote monocyte recruitment into tissues18 and TNF-a was shown to upregulate adhesion molecules such as VCAM-1123 and CX3CL1124. In addition, CX3CL1 also promotes cell survival125. Therefore, TNF-a functions might be complementary to the role of IL-1β in mediating RTM by promoting adhesion molecule expression and survival of the intimal DCs and their increased exit through the endothelium. In fact, it was shown that an injection of TNF-a (500 ng) induced a decrease in intimal DCs33. IL-1a mRNA expression profile is similar to that of IL-6; upregulated from 3h to 24h after LPS injection, which covers the first wave of RTM (Fig. 5B, 7B). Both IL-1a and IL-6 increased the motility and migration capability of cultured melanoma cells131 17. Both cytokines are also involved in the recruitment of leukocytes. IL-1a was shown to induce ICAM-1, VCAM-1, and release CX3CL1 in cultures of brain endothelial cells126 and increase survival of cultured cancer cells127. IL-6 upregulates adhesion molecules such as ICAM-1128 and also increased the mobility of cultured melanoma cells129, and cancer cells by increasing expression

42 of anti-apoptotic proteins130. The functions of IL-1a and IL-6 in the intima could be to increase the motility and/or survival of intimal DCs during RTM of these DCs. Experiments with neutralizing antibodies against IL-1a inhibited LPS-induced RTM (Fig. 9B, 9C), which could be associated with its potential functions discussed above. Previous published data from our laboratory showed that LPS induced expression of CCL19 and CCR7 in myeloid cells is critical for LPS-induced RTM of intimal DCs. LPS- induced expression of CCL19 and CCR7 occurs from 4h to 12h in intimal CD11c+ cells, just before and during the first wave of RTM. In non-intimal tissues, IL-1β stimulation increased the expression levels of CCL19 in rheumatoid arthritis132 and CCR7 in osteoclasts133. Therefore, LPS-induced IL-1β may increase the expression of CCL19 and CCR7 in intimal DCs. However, our results show that endothelial IL-1β and IL-1R1 are required for RTM (Fig. 10), while CCL19 and CCR7 on intimal DCs is required for RTM33; therefore, mechanisms of cross-talk between endothelial cells and DCs are required in order to elicit RTM. A possible mediator of endothelial cell-DC cross-talk is the interaction between S1P and S1PR. SphK1 phosphorylates and activates sphingosine-1 phosphate (S1P), that signals through S1PR1 to mediate RTM of T cells from the thymus134. In addition, experiments using FTY720, an inhibitor of S1P signalling, demonstrated that this pathway is critical for LPS-induced RTM of intimal DCs (Mark Roufaiel’s thesis). S1PR1 appears to be expressed in intimal myeloid cells since depletion of DCs in the DT-injected DTR model, reduced the expression of S1PR1, but not SphK1 (Mark Roufaiel’s thesis). Therefore, these results suggest that S1P production in endothelial cells and S1P signalling on S1PR1 in DCs are required for RTM. Since IL-1β upregulates SphK1 in glioblastoma cells135, IL-1β signalling might induce SphK1 expression that produces S1P in endothelial cells, which in turn signals through S1PR1 in intimal DCs that stimulates RTM by inducing CCL19/CCR7 signalling on DCs (see Model, Fig. 12). It was previously reported that under conditions of hypercholesterolemia foam cells are retained in the intima and our laboratory showed that LPS-induced RTM is inhibited upon feeding Ldlr-/- mice with cholesterol rich diet for 1 week33 136 137. If this inhibition is due to a defect in the function of IL-1β in RTM, understanding the processes downstream of IL-1β signalling will be critical so that interventions which restore RTM of foam cells, in order to remove them from plaques, will circumvent production and signalling of the pro-atherosclerotic cytokine IL-1β101 102 103.

Lumen

LPS

TLR4 ↑CAM

cytokines B A ↓ JAM IL-1β C IL-1R1 D S1P LPS – lipopolysaccharide TLR4 – toll-like receptor 4IL -1β – interleukin-1 beta IL-1β IL-1R1 – IL-1 receptor 1 S1P – sphingosine-1 phosphate S1PR1 – S1P receptor 1 S1PR1 CCL19 – C-C type chemokine CCR7ligand –19 C -C type chemokine CAM – Cell adhesion molecule Intima CCR7 receptor 19 JAM – Junctional adhesion molecule IL-1a

CCL19

Figure 12: Potential mechanisms by which IL-1β mediates LPS-induced RTM of intimal DCs. LPS binds to TLR4 on endothelial cells lining the lumen of atherosusceptible regions. Downstream signalling of TLR4 leads to the production, processing and secretion of IL-1β, which in turn binds to IL-1R1 on endothelial cells. This induces a number of responses that could potentially elicit RTM of DCs. (A) IL-1R1 signalling leads to the transcription and translation of other proinflammatory cytokines, such as TNF-a and IL-6, which in turn could mediate RTM of intimal DCs via multiple processes such as upregulation of adhesion molecules and mediation of survival and motility of DCs. (B) IL-1β signalling upregulates adhesion molecules, which may mediate the migration of intimal DCs out of the endothelial layer while reverse transmigrating. (C) IL-1b signalling downregulates junctional molecules which allow the endothelial junctions to become permissive for the crossing of the intimal DCs into the lumen (D) IL-1β signalling promotes the production of S1P which may signal through the S1PR, and the upregulation of CCL19 and signaling through CCR7, which mediate the process of RTM of intimal DCs.

5 Future Directions

This study showed that IL-1b is critical for LPS-induced RTM. As mentioned before, intimal CD11c+ cell numbers were used as a surrogate to monitor RTM. Many approaches were previously used that showed a good correlation between DC numbers and exit of DCs from the intima into the lumen and absence of increased apoptosis33; thus, key findings of this study will be tested by live cell imaging of DC migration from the intima into the aortic lumen ex vivo. LPS is a purified component of bacterial endotoxin that can potentially cause sepsis-like symptoms. Although a titrated amount of LPS that does not cause mortality (30 µg/mouse) was used, in the future, LPS could be substituted with another molecule such as Lipid A, the lipid component of the LPS molecule. Synthetic monophosphoryl Lipid A was shown to be virtually non-toxic, as opposed to natural Lipid A, LPS or its derivatives138; therefore, systemic toxic effects, such as excessive cytokine production (referred to as a cytokine storm), complement proteins and arachidonic metabolites, disseminated intravascular coagulation, excessive hypotension and even death, that are normally produced by LPS may be minimized. During reciprocal bone marrow transplantation experiments, lethal irradiation and subsequent loss of bone marrow, or the transplantation of bone marrow of a different genotype, are invasive procedures and may produce compensatory responses from cells other than bone marrow cells, that might affect the results. Therefore, a better experimental procedure would use a conditional (e.g., Cre-Lox) mouse system. An Il1r1loxP mouse model has been generated by Robson et al139. These mice can be crossed with a CD11c-Cre or Cad5-CreERT2 mice (Cad5 is the gene that expresses the VE-cadherin protein, a common marker for endothelial cells), where the resulting strains will either be CD11c-Cre; Il1r1loxP/loxP or Cdh5-CreERT2; Il1r1loxP/loxP mice. In the CD11c-Cre; Il1r1loxP/loxP model, when the CD11c transgene is transcribed in DCs (i. e. during the process of DC maturation), the Cre recombinase enzyme is also produced, and binds to the LoxP sites on the IL-1R1 gene in order to “flox” or remove the floxed alleles and thus inhibit production of IL-1R1 in DCs. In the Cdh5-CreERT2; Il1r1loxP/loxP mouse model, a similar process takes place, except that it is necessary to induce the production of Cre using tamoxifen, which binds to the estrogen receptor that regulates nuclear translocation of Cre, and subsequently deletes Il1r1 alleles in endothelial cells. In this manner, it would be possible to avoid bone marrow transplantation, and provide results with mice deficient in IL-1R in specifically either endothelial cells or intimal DCs.

While qPCR is the gold standard in sensitivity and efficiency for gene expression studies, and provided valuable information on the intimal expression of IL-1β and other pro- inflammatory cytokines, a broader approach such as RNA-seq could be used that can provide information on a wide range of pro-inflammatory genes and non-coding RNA in the intima in response to LPS. These experiments will ultimately be performed on isolated intimal endothelial and myeloid cell populations or at the level of a single cell analysis. These methodologies are currently being developed in our laboratory.

6 References

1. Libby, P., Ridker, P. M. & Hansson, G. K. Progress and challenges in translating the biology of atherosclerosis. Nature 473, 317–325 (2011). 2. Robbins, C. S. et al. Local proliferation dominates lesional macrophage accumulation in atherosclerosis. Nat. Med. 19, 1166–1172 (2013). 3. Zhu, S.-N., Chen, M., Jongstra-Bilen, J. & Cybulsky, M. I. GM-CSF regulates intimal cell proliferation in nascent atherosclerotic lesions. J. Exp. Med. 206, 2141–2149 (2009). 4. Shah, P. K. & Galis, Z. S. Matrix metalloproteinase hypothesis of plaque rupture: players keep piling up but questions remain. Circulation 104, 1878–1880 (2001). 5. Davies, P. F., Shi, C., Depaola, N., Helmke, B. P. & Polacek, D. C. Hemodynamics and the focal origin of atherosclerosis: a spatial approach to endothelial structure, gene expression, and function. Ann. N. Y. Acad. Sci. 947, 7-16-17 (2001). 6. Cybulsky, M. I., Cheong, C. & Robbins, C. S. Macrophages and Dendritic Cells: Partners in Atherogenesis. Circ. Res. 118, 637–652 (2016). 7. Hajra, L. et al. The NF-kappa B signal transduction pathway in aortic endothelial cells is primed for activation in regions predisposed to atherosclerotic lesion formation. Proc. Natl. Acad. Sci. U. S. A. 97, 9052–9057 (2000). 8. Jongstra-Bilen, J. et al. Low-grade chronic inflammation in regions of the normal mouse arterial intima predisposed to atherosclerosis. J. Exp. Med. 203, 2073–2083 (2006). 9. Iiyama, K. et al. Patterns of vascular cell adhesion molecule-1 and intercellular adhesion molecule-1 expression in rabbit and mouse atherosclerotic lesions and at sites predisposed to lesion formation. Circ. Res. 85, 199–207 (1999). 10. Dekker, R. J. et al. Prolonged fluid shear stress induces a distinct set of endothelial cell genes, most specifically lung Krüppel-like factor (KLF2). Blood 100, 1689–1698 (2002). 11. Parmar, K. M. et al. Integration of flow-dependent endothelial phenotypes by Kruppel-like factor 2. J. Clin. Invest. 116, 49–58 (2006). 12. Millonig, G. et al. Network of vascular-associated dendritic cells in intima of healthy young individuals. Arterioscler. Thromb. Vasc. Biol. 21, 503–508 (2001). 13. Liu, P. et al. CX3CR1 deficiency impairs dendritic cell accumulation in arterial intima and reduces atherosclerotic burden. Arterioscler. Thromb. Vasc. Biol. 28, 243–250 (2008). 14. Choi, J.-H. et al. Identification of antigen-presenting dendritic cells in mouse aorta and cardiac valves. J. Exp. Med. 206, 497–505 (2009).

15. Martel, C. et al. Lymphatic vasculature mediates macrophage reverse cholesterol transport in mice. J. Clin. Invest. 123, 1571–1579 (2013). 16. Paulson, K. E. et al. Resident intimal dendritic cells accumulate lipid and contribute to the initiation of atherosclerosis. Circ. Res. 106, 383–390 (2010). 17. Choi, J.-H. et al. Flt3 signaling-dependent dendritic cells protect against atherosclerosis. Immunity 35, 819–831 (2011). 18. Arango Duque, G. & Descoteaux, A. Macrophage cytokines: involvement in immunity and infectious diseases. Front. Immunol. 5, 491 (2014). 19. Ley, K., Laudanna, C., Cybulsky, M. I. & Nourshargh, S. Getting to the site of inflammation: the leukocyte adhesion cascade updated. Nat. Rev. Immunol. 7, 678–689 (2007). 20. Förster, R., Braun, A. & Worbs, T. Lymph node homing of T cells and dendritic cells via afferent lymphatics. Trends Immunol. 33, 271–280 (2012). 21. Buckley, C. D. et al. Identification of a phenotypically and functionally distinct population of long-lived neutrophils in a model of reverse endothelial migration. J. Leukoc. Biol. 79, 303–311 (2006). 22. Burn, T. & Alvarez, J. I. Reverse transendothelial cell migration in inflammation: to help or to hinder? Cell. Mol. Life Sci. CMLS 74, 1871–1881 (2017). 23. Mathias, J. R. et al. Resolution of inflammation by retrograde chemotaxis of neutrophils in transgenic zebrafish. J. Leukoc. Biol. 80, 1281–1288 (2006). 24. Tauzin, S., Starnes, T. W., Becker, F. B., Lam, P. & Huttenlocher, A. Redox and Src family kinase signaling control leukocyte wound attraction and neutrophil reverse migration. J. Cell Biol. 207, 589–598 (2014). 25. Woodfin, A. et al. The junctional adhesion molecule JAM-C regulates polarized transendothelial migration of neutrophils in vivo. Nat. Immunol. 12, 761–769 (2011). 26. Wu, D. et al. Reverse-migrated neutrophils regulated by JAM-C are involved in acute pancreatitis-associated lung injury. Sci. Rep. 6, 20545 (2016). 27. Ernström, U., Glyllensten, L. & Larsson, B. Venous output of lymphocytes from the thymus. Nature 207, 540–541 (1965). 28. Lee, J. Y., Buzney, C. D., Poznansky, M. C. & Sackstein, R. Dynamic alterations in chemokine gradients induce transendothelial shuttling of human T cells under physiologic shear conditions. J. Leukoc. Biol. 86, 1285–1294 (2009).

29. Randolph, G. J., Beaulieu, S., Lebecque, S., Steinman, R. M. & Muller, W. A. Differentiation of monocytes into dendritic cells in a model of transendothelial trafficking. Science 282, 480–483 (1998). 30. Randolph, G. J. & Furie, M. B. Mononuclear phagocytes egress from an in vitro model of the vascular wall by migrating across endothelium in the basal to apical direction: role of intercellular adhesion molecule 1 and the CD11/CD18 integrins. J. Exp. Med. 183, 451–462 (1996). 31. Filardo, S., Di Pietro, M., Farcomeni, A., Schiavoni, G. & Sessa, R. Chlamydia pneumoniae- Mediated Inflammation in Atherosclerosis: A Meta-Analysis. Mediators Inflamm. 2015, 378658 (2015). 32. Kuo, C. C. et al. Chlamydia pneumoniae (TWAR) in coronary arteries of young adults (15- 34 years old). Proc. Natl. Acad. Sci. U. S. A. 92, 6911–6914 (1995). 33. Roufaiel, M. et al. CCL19-CCR7-dependent reverse transendothelial migration of myeloid cells clears Chlamydia muridarum from the arterial intima. Nat. Immunol. 17, 1263–1272 (2016). 34. Dinarello, C. A. Immunological and inflammatory functions of the interleukin-1 family. Annu. Rev. Immunol. 27, 519–550 (2009). 35. Priestle, J. P., Schär, H. P. & Grütter, M. G. Crystal structure of the cytokine interleukin-1 beta. EMBO J. 7, 339–343 (1988). 36. Graves, B. J. et al. Structure of interleukin 1 alpha at 2.7-A resolution. Biochemistry (Mosc.) 29, 2679–2684 (1990). 37. Schreuder, H. A. et al. Refined crystal structure of the interleukin-1 receptor antagonist. Presence of a disulfide link and a cis-proline. Eur. J. Biochem. 227, 838–847 (1995). 38. Akira, S. & Takeda, K. Toll-like receptor signalling. Nat. Rev. Immunol. 4, 499–511 (2004). 39. Carruth, L. M., Demczuk, S. & Mizel, S. B. Involvement of a calpain-like protease in the processing of the murine interleukin 1 alpha precursor. J. Biol. Chem. 266, 12162–12167 (1991). 40. Black, R. A. et al. Generation of biologically active interleukin-1 beta by proteolytic cleavage of the inactive precursor. J. Biol. Chem. 263, 9437–9442 (1988). 41. Weber, A., Wasiliew, P. & Kracht, M. Interleukin-1 (IL-1) pathway. Sci. Signal. 3, 1 - 6 (2010).

42. Kawana, Natsuki, Yamamoto, Yoji, Kino, Yoshihiro & Satoh, Jun-ichi. Molecular Network of NLRP3 Inflammasome Activation-Responsive Genes in a Human Monocyte Cell Line. Austin J. Clin. Immunol. 1, 1017 (2014). 43. Vicenová, B., Vopálenský, V., Burýsek, L. & Pospísek, M. Emerging role of interleukin-1 in cardiovascular diseases. Physiol. Res. 58, 481–498 (2009). 44. Ozören, N. et al. Distinct roles of TLR2 and the adaptor ASC in IL-1beta/IL-18 secretion in response to Listeria monocytogenes. J. Immunol. Baltim. Md 1950 176, 4337–4342 (2006). 45. Abdalla, H. et al. Mycobacterium tuberculosis infection of dendritic cells leads to partially caspase-1/11-independent IL-1β and IL-18 secretion but not to pyroptosis. PloS One 7, e40722 (2012). 46. Kayagaki, N. et al. Non-canonical inflammasome activation targets caspase-11. Nature 479, 117–121 (2011). 47. de Gassart, A. & Martinon, F. Pyroptosis: Caspase-11 Unlocks the Gates of Death. Immunity 43, 835–837 (2015). 48. Horai, R. et al. Production of mice deficient in genes for interleukin (IL)-1alpha, IL-1beta, IL-1alpha/beta, and IL-1 receptor antagonist shows that IL-1beta is crucial in turpentine-induced fever development and glucocorticoid secretion. J. Exp. Med. 187, 1463–1475 (1998). 49. Glaccum, M. B. et al. Phenotypic and functional characterization of mice that lack the type I receptor for IL-1. J. Immunol. Baltim. Md 1950 159, 3364–3371 (1997). 50. Guarda, G. et al. Differential expression of NLRP3 among hematopoietic cells. J. Immunol. Baltim. Md 1950 186, 2529–2534 (2011). 51. Turner, M. D., Nedjai, B., Hurst, T. & Pennington, D. J. Cytokines and chemokines: At the crossroads of cell signalling and inflammatory disease. Biochim. Biophys. Acta 1843, 2563– 2582 (2014). 52. Hoseini, Z. et al. NLRP3 inflammasome: Its regulation and involvement in atherosclerosis. J. Cell. Physiol. 233, 2116–2132 (2018). 53. Chandel, N. S., Trzyna, W. C., McClintock, D. S. & Schumacker, P. T. Role of oxidants in NF-kappa B activation and TNF-alpha gene transcription induced by hypoxia and endotoxin. J. Immunol. Baltim. Md 1950 165, 1013–1021 (2000). 54. Juliana, C. et al. Non-transcriptional priming and deubiquitination regulate NLRP3 inflammasome activation. J. Biol. Chem. 287, 36617–36622 (2012). 55. Pétrilli, V. et al. Activation of the NALP3 inflammasome is triggered by low intracellular potassium concentration. Cell Death Differ. 14, 1583–1589 (2007). 50

56. Surprenant, A., Rassendren, F., Kawashima, E., North, R. A. & Buell, G. The cytolytic P2Z receptor for extracellular ATP identified as a P2X receptor (P2X7). Science 272, 735–738 (1996). 57. Yaron, J. R. et al. The oxindole Syk inhibitor OXSI-2 blocks nigericin-induced inflammasome signaling and pyroptosis independent of potassium efflux. Biochem. Biophys. Res. Commun. 472, 545–550 (2016). 58. Zhang, P., Langland, J. O., Jacobs, B. L. & Samuel, C. E. Protein kinase PKR-dependent activation of mitogen-activated protein kinases occurs through mitochondrial adapter IPS-1 and is antagonized by vaccinia virus E3L. J. Virol. 83, 5718–5725 (2009). 59. Harijith, A., Ebenezer, D. L. & Natarajan, V. Reactive oxygen species at the crossroads of inflammasome and inflammation. Front. Physiol. 5, 352 (2014). 60. Shimada, K. et al. Oxidized mitochondrial DNA activates the NLRP3 inflammasome during apoptosis. Immunity 36, 401–414 (2012). 61. Li, G., Scull, C., Ozcan, L. & Tabas, I. NADPH oxidase links endoplasmic reticulum stress, oxidative stress, and PKR activation to induce apoptosis. J. Cell Biol. 191, 1113–1125 (2010). 62. Wang, M. & Kaufman, R. J. The impact of the endoplasmic reticulum protein-folding environment on cancer development. Nat. Rev. Cancer 14, 581–597 (2014). 63. Urano, F. et al. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science 287, 664–666 (2000). 64. Freeman, D. et al. Alpha-synuclein induces lysosomal rupture and cathepsin dependent reactive oxygen species following endocytosis. PloS One 8, e62143 (2013). 65. Rajamäki, K. et al. Cholesterol crystals activate the NLRP3 inflammasome in human macrophages: a novel link between cholesterol metabolism and inflammation. PloS One 5, e11765 (2010). 66. Bruchard, M. et al. Chemotherapy-triggered cathepsin B release in myeloid-derived suppressor cells activates the Nlrp3 inflammasome and promotes tumor growth. Nat. Med. 19, 57–64 (2013). 67. Rossol, M. et al. Extracellular Ca2+ is a danger signal activating the NLRP3 inflammasome through G protein-coupled calcium sensing receptors. Nat. Commun. 3, 1329 (2012). 68. Kaspar, R. L. & Gehrke, L. Peripheral blood mononuclear cells stimulated with C5a or lipopolysaccharide to synthesize equivalent levels of IL-1 beta mRNA show unequal IL-1 beta protein accumulation but similar polyribosome profiles. J. Immunol. Baltim. Md 1950 153, 277– 286 (1994). 51

69. Unlu, S. et al. Phosphorylation of IRF8 in a pre-associated complex with Spi-1/PU.1 and non-phosphorylated Stat1 is critical for LPS induction of the IL1B gene. Mol. Immunol. 44, 3364–3379 (2007). 70. Dinarello, C. A. et al. Interleukin 1 induces interleukin 1. I. Induction of circulating interleukin 1 in rabbits in vivo and in human mononuclear cells in vitro. J. Immunol. Baltim. Md 1950 139, 1902–1910 (1987). 71. Sun, S. C., Ganchi, P. A., Ballard, D. W. & Greene, W. C. NF-kappa B controls expression of inhibitor I kappa B alpha: evidence for an inducible autoregulatory pathway. Science 259, 1912–1915 (1993). 72. Rubartelli, A., Cozzolino, F., Talio, M. & Sitia, R. A novel secretory pathway for interleukin-1 beta, a protein lacking a signal sequence. EMBO J. 9, 1503–1510 (1990). 73. Andrei, C. et al. The secretory route of the leaderless protein interleukin 1beta involves exocytosis of endolysosome-related vesicles. Mol. Biol. Cell 10, 1463–1475 (1999). 74. Andrei, C. et al. Phospholipases C and A2 control lysosome-mediated IL-1 beta secretion: Implications for inflammatory processes. Proc. Natl. Acad. Sci. U. S. A. 101, 9745–9750 (2004). 75. Zhang, M., Kenny, S. J., Ge, L., Xu, K. & Schekman, R. Translocation of interleukin-1β into a vesicle intermediate in autophagy-mediated secretion. eLife 4, (2015). 76. MacKenzie, A. et al. Rapid secretion of interleukin-1beta by microvesicle shedding. Immunity 15, 825–835 (2001). 77. Sitia, R. & Rubartelli, A. The unconventional secretion of IL-1β: Handling a dangerous weapon to optimize inflammatory responses. Semin. Cell Dev. Biol. (2018). doi:10.1016/j.semcdb.2018.03.011 78. Carta, S. et al. Cell stress increases ATP release in NLRP3 inflammasome-mediated autoinflammatory diseases, resulting in cytokine imbalance. Proc. Natl. Acad. Sci. U. S. A. 112, 2835–2840 (2015). 79. Gutierrez, K. D. et al. MLKL Activation Triggers NLRP3-Mediated Processing and Release of IL-1β Independently of Gasdermin-D. J. Immunol. Baltim. Md 1950 198, 2156–2164 (2017). 80. Schett, G., Dayer, J.-M. & Manger, B. Interleukin-1 function and role in rheumatic disease. Nat. Rev. Rheumatol. 12, 14–24 (2016). 81. Burns, K. et al. Tollip, a new component of the IL-1RI pathway, links IRAK to the IL-1 receptor. Nat. Cell Biol. 2, 346–351 (2000). 82. Mendoza, H. et al. Roles for TAB1 in regulating the IL-1-dependent phosphorylation of the TAB3 regulatory subunit and activity of the TAK1 complex. Biochem. J. 409, 711–722 (2008). 52

83. Dinarello, C. A. Biologic basis for interleukin-1 in disease. Blood 87, 2095–2147 (1996). 84. Tamura, M., Arakaki, N., Tsubouchi, H., Takada, H. & Daikuhara, Y. Enhancement of human hepatocyte growth factor production by interleukin-1 alpha and -1 beta and tumor necrosis factor-alpha by fibroblasts in culture. J. Biol. Chem. 268, 8140–8145 (1993). 85. Beasley, D., Schwartz, J. H. & Brenner, B. M. Interleukin 1 induces prolonged L-arginine- dependent cyclic guanosine monophosphate and nitrite production in rat vascular smooth muscle cells. J. Clin. Invest. 87, 602–608 (1991). 86. Sims, J. E. & Smith, D. E. The IL-1 family: regulators of immunity. Nat. Rev. Immunol. 10, 89–102 (2010). 87. Chung, Y. et al. Critical regulation of early Th17 cell differentiation by interleukin-1 signaling. Immunity 30, 576–587 (2009). 88. Acosta-Rodriguez, E. V., Napolitani, G., Lanzavecchia, A. & Sallusto, F. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells. Nat. Immunol. 8, 942–949 (2007). 89. Nakae, S., Asano, M., Horai, R., Sakaguchi, N. & Iwakura, Y. IL-1 enhances T cell- dependent antibody production through induction of CD40 ligand and OX40 on T cells. J. Immunol. Baltim. Md 1950 167, 90–97 (2001). 90. Paramel Varghese, G. et al. NLRP3 Inflammasome Expression and Activation in Human Atherosclerosis. J. Am. Heart Assoc. 5, (2016). 91. Shi, X., Xie, W.-L., Kong, W.-W., Chen, D. & Qu, P. Expression of the NLRP3 Inflammasome in Carotid Atherosclerosis. J. Stroke Cerebrovasc. Dis. 24, 2455–2466 (2015). 92. Duewell, P. et al. NLRP3 inflammasomes are required for atherogenesis and activated by cholesterol crystals. Nature 464, 1357–1361 (2010). 93. Hendrikx, T. et al. Bone marrow-specific caspase-1/11 deficiency inhibits atherosclerosis development in Ldlr(-/-) mice. FEBS J. 282, 2327–2338 (2015). 94. Warnatsch, A., Ioannou, M., Wang, Q. & Papayannopoulos, V. Inflammation. Neutrophil extracellular traps license macrophages for cytokine production in atherosclerosis. Science 349, 316–320 (2015). 95. Gage, J., Hasu, M., Thabet, M. & Whitman, S. C. Caspase-1 deficiency decreases atherosclerosis in apolipoprotein E-null mice. Can. J. Cardiol. 28, 222–229 (2012). 96. Menu, P. et al. Atherosclerosis in ApoE-deficient mice progresses independently of the NLRP3 inflammasome. Cell Death Dis. 2, e137 (2011).

97. Libby, P. et al. Endotoxin and tumor necrosis factor induce interleukin-1 gene expression in adult human vascular endothelial cells. Am. J. Pathol. 124, 179–185 (1986). 98. Libby, P., Ordovas, J. M., Birinyi, L. K., Auger, K. R. & Dinarello, C. A. Inducible interleukin-1 gene expression in human vascular smooth muscle cells. J. Clin. Invest. 78, 1432– 1438 (1986). 99. Libby, P., Warner, S. J. & Friedman, G. B. Interleukin 1: a mitogen for human vascular smooth muscle cells that induces the release of growth-inhibitory prostanoids. J. Clin. Invest. 81, 487–498 (1988). 100. Bevilacqua, M. P., Pober, J. S., Wheeler, M. E., Cotran, R. S. & Gimbrone, M. A. Interleukin-1 activation of vascular endothelium. Effects on procoagulant activity and leukocyte adhesion. Am. J. Pathol. 121, 394–403 (1985). 101. Kirii, H. et al. Lack of interleukin-1beta decreases the severity of atherosclerosis in ApoE- deficient mice. Arterioscler. Thromb. Vasc. Biol. 23, 656–660 (2003). 102. Chamberlain, J. et al. Interleukin-1beta and signaling of interleukin-1 in vascular wall and circulating cells modulates the extent of neointima formation in mice. Am. J. Pathol. 168, 1396– 1403 (2006). 103. Isoda, K. et al. Lack of interleukin-1 receptor antagonist modulates plaque composition in apolipoprotein E-deficient mice. Arterioscler. Thromb. Vasc. Biol. 24, 1068–1073 (2004). 104. Ridker, P. M. et al. Antiinflammatory Therapy with Canakinumab for Atherosclerotic Disease. N. Engl. J. Med. 377, 1119–1131 (2017). 105. Alexander, M. R. et al. Genetic inactivation of IL-1 signaling enhances atherosclerotic plaque instability and reduces outward vessel remodeling in advanced atherosclerosis in mice. J. Clin. Invest. 122, 70–79 (2012). 106. Everett, B. M., Bansal, S., Rifai, N., Buring, J. E. & Ridker, P. M. Interleukin-18 and the risk of future cardiovascular disease among initially healthy women. Atherosclerosis 202, 282– 288 (2009). 107. Mallat, Z. et al. Expression of interleukin-18 in human atherosclerotic plaques and relation to plaque instability. Circulation 104, 1598–1603 (2001). 108. Gerdes, N. et al. Expression of interleukin (IL)-18 and functional IL-18 receptor on human vascular endothelial cells, smooth muscle cells, and macrophages: implications for atherogenesis. J. Exp. Med. 195, 245–257 (2002). 109. Mallat, Z. et al. Interleukin-18/interleukin-18 binding protein signaling modulates atherosclerotic lesion development and stability. Circ. Res. 89, E41-45 (2001). 54

110. Jongstra-Bilen, J. et al. Oxidized Low-Density Lipoprotein Loading of Macrophages Downregulates TLR-Induced Proinflammatory Responses in a Gene-Specific and Temporal Manner through Transcriptional Control. J. Immunol. Baltim. Md 1950 199, 2149–2157 (2017). 111. Ikejima, T., Okusawa, S., Ghezzi, P., van der Meer, J. W. & Dinarello, C. A. Interleukin-1 induces tumor necrosis factor (TNF) in human peripheral blood mononuclear cells in vitro and a circulating TNF-like activity in rabbits. J. Infect. Dis. 162, 215–223 (1990). 112. Libermann, T. A. & Baltimore, D. Activation of interleukin-6 gene expression through the NF-kappa B transcription factor. Mol. Cell. Biol. 10, 2327–2334 (1990). 113. Gu, Y. et al. Activation of interferon-gamma inducing factor mediated by interleukin-1beta converting enzyme. Science 275, 206–209 (1997). 114. Simpson, K. J., Lukacs, N. W., Colletti, L., Strieter, R. M. & Kunkel, S. L. Cytokines and the liver. J. Hepatol. 27, 1120–1132 (1997). 115. Gabellec, M. M., Griffais, R., Fillion, G. & Haour, F. Expression of interleukin 1 alpha, interleukin 1 beta and interleukin 1 receptor antagonist mRNA in mouse brain: regulation by bacterial lipopolysaccharide (LPS) treatment. Brain Res. Mol. Brain Res. 31, 122–130 (1995). 116. Semaeva, E. et al. Access to the spleen microenvironment through lymph shows local cytokine production, increased cell flux, and altered signaling of immune cells during lipopolysaccharide-induced acute inflammation. J. Immunol. Baltim. Md 1950 184, 4547–4556 (2010). 117. Zuckerman, S. H., Shellhaas, J. & Butler, L. D. Differential regulation of lipopolysaccharide-induced interleukin 1 and tumor necrosis factor synthesis: effects of endogenous and exogenous glucocorticoids and the role of the pituitary-adrenal axis. Eur. J. Immunol. 19, 301–305 (1989). 118. Matsuzaki, J., Kuwamura, M., Yamaji, R., Inui, H. & Nakano, Y. Inflammatory responses to lipopolysaccharide are suppressed in 40% energy-restricted mice. J. Nutr. 131, 2139–2144 (2001). 119. Yao, Z. et al. Blood-Borne Lipopolysaccharide Is Rapidly Eliminated by Liver Sinusoidal Endothelial Cells via High-Density Lipoprotein. J. Immunol. Baltim. Md 1950 197, 2390–2399 (2016). 120. Newton, R. C., Uhl, J., Covington, M. & Back, O. The distribution and clearance of radiolabeled human interleukin-1 beta in mice. Lymphokine Res. 7, 207–216 (1988). 121. Ge, Y. et al. Relationship of tissue and cellular interleukin-1 and lipopolysaccharide after endotoxemia and bacteremia. J. Infect. Dis. 176, 1313–1321 (1997). 55

122. Huang, A. J. et al. Endothelial cell cytosolic free calcium regulates neutrophil migration across monolayers of endothelial cells. J. Cell Biol. 120, 1371–1380 (1993). 123. Lee, C.-W. et al. Transcriptional regulation of VCAM-1 expression by tumor necrosis factor-alpha in human tracheal smooth muscle cells: involvement of MAPKs, NF-kappaB, p300, and histone acetylation. J. Cell. Physiol. 207, 174–186 (2006). 124. Yoshikawa, M. et al. TNF-alpha and IL-4 regulate expression of fractalkine (CX3CL1) as a membrane-anchored proadhesive protein and soluble chemotactic peptide on human fibroblasts. FEBS Lett. 561, 105–110 (2004). 125. White, G. E., McNeill, E., Channon, K. M. & Greaves, D. R. Fractalkine promotes human monocyte survival via a reduction in oxidative stress. Arterioscler. Thromb. Vasc. Biol. 34, 2554–2562 (2014). 126. Thornton, P. et al. Platelet interleukin-1alpha drives cerebrovascular inflammation. Blood 115, 3632–3639 (2010). 127. Wolf, J. S. et al. IL (interleukin)-1alpha promotes nuclear factor-kappaB and AP-1-induced IL-8 expression, cell survival, and proliferation in head and neck squamous cell carcinomas. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 7, 1812–1820 (2001). 128. Chen, Q. et al. Fever-range thermal stress promotes lymphocyte trafficking across high endothelial venules via an interleukin 6 trans-signaling mechanism. Nat. Immunol. 7, 1299– 1308 (2006). 129. Linnskog, R., Jönsson, G., Axelsson, L., Prasad, C. P. & Andersson, T. Interleukin-6 drives melanoma cell motility through p38α-MAPK-dependent up-regulation of WNT5A expression. Mol. Oncol. 8, 1365–1378 (2014). 130. Meng, F., Yamagiwa, Y., Ueno, Y. & Patel, T. Over-expression of interleukin-6 enhances cell survival and transformed cell growth in human malignant cholangiocytes. J. Hepatol. 44, 1055–1065 (2006). 131. Dekker, S. K. et al. Characterization of interleukin-1 alpha-induced melanoma cell motility: inhibition by type I and type II receptor-blocking monoclonal antibodies. Melanoma Res. 7, 223–230 (1997). 132. Pickens, S. R. et al. Characterization of CCL19 and CCL21 in rheumatoid arthritis. Arthritis Rheum. 63, 914–922 (2011). 133. Lee, J. et al. Stimulation of osteoclast migration and bone resorption by C-C chemokine ligands 19 and 21. Exp. Mol. Med. 49, e358 (2017).

134. Matloubian, M. et al. Lymphocyte egress from thymus and peripheral lymphoid organs is dependent on S1P receptor 1. Nature 427, 355–360 (2004). 135. Paugh, B. S. et al. Interleukin-1 regulates the expression of sphingosine kinase 1 in glioblastoma cells. J. Biol. Chem. 284, 3408–3417 (2009). 136. Randolph, G. J. Mechanisms that regulate macrophage burden in atherosclerosis. Circ. Res. 114, 1757–1771 (2014). 137. Moore, K. J., Sheedy, F. J. & Fisher, E. A. Macrophages in atherosclerosis: a dynamic balance. Nat. Rev. Immunol. 13, 709–721 (2013). 138. Fox, C. B., Friede, M., Reed, S. G. & Ireton, G. C. Synthetic and natural TLR4 agonists as safe and effective vaccine adjuvants. Subcell. Biochem. 53, 303–321 (2010). 139. Robson, M. J. et al. Generation and Characterization of Mice Expressing a Conditional Allele of the Interleukin-1 Receptor Type 1. PloS One 11, e0150068 (2016).