1 Investigating the Role of Shroom3 in Collagen Regulation And

Home , Apical constriction

Investigating the Role of Shroom3 in Collagen Regulation and Development of the Corneal Stroma

Thesis

Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in

the Graduate School of The Ohio State University

Cory James Lappin, B.S.

Graduate Program in Vision Science

The Ohio State University

2018

Thesis Committee

Timothy F. Plageman, PhD, Advisor

Heather L. Chandler, PhD

Andrew Hartwick, OD, PhD

Copyrighted by

Cory James Lappin

2018

Abstract

Purpose:

The cornea stroma consists of collagen fibrils that exist in a highly ordered structure, however the mechanisms by which collagen expression and its complex architecture are regulated are not well understood. Insight into the mechanisms that underlie collagen expression and fibril architecture would shed light onto the etiologies of corneal diseases. Thus, identifying specific pathways or proteins that are in involved in stromal collagen regulation could help better explain how collagen is regulated in health, and what goes wrong in cases of pathology. A protein recently shown to induce collagen expression is the cytoplasmic protein called Shroom3. This F-actin and Rho-kinase binding protein is best known for regulating epithelial cell shape during embryonic morphogenesis, but the mechanisms by which it regulates collagen expression have not been widely studied. Previous research has suggested that abnormal SHROOM3 disrupts cornea development in mouse embryos and that a homozygous missense mutation in this gene has been associated with the stromal thinning disease known as keratoconus.

Therefore, the purpose of this research was to further characterize the corneal phenotype in Shroom3-deficient embryos and discern what effect the keratoconus-associated mutation has on Shroom3 function.

Methods:

Embryonic corneal Shroom3 expression was observed using X-gal labeling of

Shroom3+/- embryos that express X-galactosidase under the control of the endogenous

Shroom3 promoter. To determine the function of Shroom3 during cornea development, control and Shroom3-deficient mouse embryos were analyzed using histological staining, immunofluorescent imaging, and electron microscopy to ascertain the effect on collagen expression, fibril size, keratocyte number, stromal thickness and corneal epithelial shape.

The consequences of mutations on Shroom3 function were analyzed in kidney- (MDCK) and cornea-derived (SIRC) cells following transfection with plasmids expressing wild- type Shroom3 (Shroom3wt), a Rho-kinase binding deficient mutation (Shroom3R1838C) and the keratoconus-associated mutation (Shroom3G59V). Epithelial cell shape and collagen expression were analyzed by immunofluorescent imaging and RT-PCR analysis, and electron microscopy was performed to analyze the effect Shroom3 has on collagen expression, fibril size, and corneal phenotypes.

Results:

Shroom3 expression in the cornea was observed in the central and peripheral cornea, however expression was higher in the periphery and posterior stroma. Shroom3-/- cornea epithelial cells had larger apical areas compared to Shroom3+/- cells, suggesting reduced apical constriction. Shroom3-/- corneas displayed a reduction in total number of keratocytes in the central cornea. There was no difference in stromal thickness between

Shroom3+/- and Shroom3-/- corneas when measured directly, but there was a reduction in the layers of keratocytes observed in Shroom3-/- corneas which acted as an indirect

iii measure of stromal thickness. The intensity of Col1 staining was reduced in the posterior stroma versus the anterior stroma in Shroom3-/- corneas, and the intensity of the Shroom3 null posterior stroma was lower than that of the Shroom3+/- posterior stroma.

Shroom3R1838C and Shroom3G59V variants caused increased Col4a1 expression compared to the Shroom3wt, and decreased Col1a1 expression, whereas the opposite was observed with in the Shroom3wt samples. The average stromal collagen fibril diameter was larger in Shroom3-/- corneas compared to Shroom3+/- corneas.

Conclusion:

Shroom3 is required for normal corneal development. Specifically, these results suggest that Shroom3 is responsible for facilitating lens vesicle separation from the overlying ectoderm by regulating corneal epithelial cell shape. Additionally, these data suggest Shroom3 normally promotes stromal expression of collagen type I and inhibits collagen type IV, limits fibril diameter size, and influences keratocyte number. Because both the G59V and R1838C mutations to Shroom3 disrupt its collagen regulation function, it further suggests that Shroom3 relies on both its PDZ and Rho-kinase-binding domains to perform this function. Future studies exploring the mechanisms underlying

Shroom3-dependent corneal collagen regulation and development may lead to a better understanding of the pathologies that disrupt collagen and lead to corneal disorders such as keratoconus.

Dedication

This work is dedicated to my loving family.

Thank you for your unconditional support, encouragement, and endless questions about

how my “mouse eye project” was going.

Acknowledgments

I would like to thank the numerous people who made my research possible. Thank you Dr. TJ Plageman for working with me as your first T35 student, and helping me navigate countless experiments from staining my first histology slides to analyzing my final data. I greatly appreciate your patience and flexibility in working with my schedule over the past several years. Thanks to your guidance and the time you dedicated to helping me with this research I was able to achieve my goal of completing my own original research project. Thank you for letting me live out my dream of being a scientist.

I would thank all the members of the lab past and present: Ken Herman, Maria

Muccioli, Jessica Martin, Nathalie Houssin and Dana Driver. Your support and practical guidance were invaluable. You were always willing to help me out at any time and with any issue. You taught me how to actually perform my research experiments from day one. I would probably still be on my first experiment if not for your help. I would also like to thank my fellow graduate students Melissa Eckes and Erica Shelton. You helped make our days in the lab waiting for PBS rinses to finish a much more enjoyable and humorous experience.

And finally, I would like to thank my thesis committee: Dr. Heather Chandler and

Dr. Andy Hartwick. Thank you for taking the time to lend your expertise to my research.

I greatly appreciate your contribution to my thesis.

Vita

May 2010 ...... New Philadelphia High School 2014...... B.S. Zoology, Miami University

Fields of Study

Major Field: Vision Science

vii

Table of Contents

Abstract ...... ii Dedication ...... v Acknowledgments ...... vi Vita ...... vii List of Figures ...... x Chapter 1: Introduction ...... 1 The Cornea...... 1 The Stroma ...... 2 Keratocytes ...... 3 Regional Differences ...... 3 Stromal Collagen ...... 4 Development and Transparency ...... 6 Keratoconus ...... 7 Genetics of Keratoconus ...... 10 Shroom3 ...... 12 Chapter 2: Materials and Methods ...... 17 X-Gal Staining ...... 17 Creation of G59V Mutation ...... 17 General Histology/Immunofluorescent Labeling ...... 18 Cell Culture ...... 20 Transfection of MDCK Cells ...... 21 MDCK Cell Staining and Apical-Basal Area Analysis ...... 22 Cornea Cell Staining and Apical-Basal Area Analysis ...... 23 Transfection of SIRC Cells...... 24 RNA Extraction ...... 24 cDNA Creation...... 25 Collagen Primer Design and Creation ...... 26 PCR Procedure ...... 27 viii

Collagen Expression Analysis...... 28 Keratocytes Analysis and Central Stromal Thickness ...... 30 Collagen Fibril Diameter Analysis ...... 31 Chapter 3: Results...... 32 Shroom3 Localization ...... 32 Apical Constriction in MDCK Cells ...... 33 Apical Constriction in Corneal Cells ...... 34 Corneal Thickness and Keratocyte Count ...... 36 Differences in Anterior and Posterior Collagen Expression ...... 38 Fibril Diameter ...... 40 Differences in Collagen Subtype Expression ...... 41 Chapter 4: Discussion ...... 43 Shroom3 Localization and Apical Constriction in Corneal Epithelial Cells ...... 43 Shroom3 and Peters’ Anomaly ...... 44 Shroom3 and Stromal Thickness ...... 45 Fibril Diameter Analysis...... 46 Shroom3 and Collagen Expression ...... 47 Chapter 5: Conclusion ...... 51 References ...... 53

List of Figures

Figure 1. The glycine at position G60 (G59 in mice) in the PDZ domain of Shroom3 is highly conserved amongst various species. This suggest the PDZ domain serves some important function and that potential disruption to this function could arise from a mutation at this point. A mutation to the ASD2 domain, such as the R1838C mutation, inhibits Shroom3’s ability to bind ROCK and thus interrupts the protein’s ability to induce apical constriction...... 14 Figure 2. X-gal staining reveals the location of Shroom3 expression (blue) in the mouse cornea. Shroom3 is expressed in the posterior stroma. The expression is more pronounced in the periphery than in the central stroma at E15.5...... 32 Figure 3. Comparison of the apical and basal aspects of Shroom3wt and Shroom3G59V MDCK cells (A). There was no significant difference between apical and basal area between Shroom3wt and Shroom3G59V MDCK cells (B). Scale bars = 20µm...... 33 Figure 4. Shroom3 expression in persistent lens stalk epithelium visualized with X-gal staining (A). En face view of the corneal epithelium from Shroom3+/- and Shroom3-/- E11.0 embryos immunolabeled with a β-catenin antibody (B). Scale bars = 50µm. The graph represents the average apical area of corneal epithelial cells quantified from control and Shroom3 deficient embryos (C). The average apical area of Shroom3-/- cells was significantly larger than that of Shroom3+/- cornea cells, suggesting impaired apical constriction...... 34 Figure 5. Hoechst nuclear staining of the central cornea from three different eyes of control and experimental E15.5 mouse embryos (A). There was a significantly lower keratocyte count over a 150-micron region of the central cornea in Shroom3-/- corneas compared to Shroom3+/- corneas. (B). There was no significant difference in direct thickness between the heterozygous and homozygous stromas (C). However, there was a significantly lower number of layers of keratocytes observed in the Shroom3-/- corneas compared to the Shroom3+/- corneas, which acts as an indirect measure of thickness (D). This suggests the mutation in Shroom3 may alter the number of keratocytes present in the cornea...... 36 Figure 6. Imaging of Collagen I (red) and nuclei (blue) in Shroom3+/- and Shroom3-/- mouse corneas with dashed line demarcating the approximate anterior and posterior stroma (A). The intensity of normalized Col1 staining was significantly different when comparing the anterior stroma and posterior stroma (defined as the top 50% and bottom 50% of the section’s thickness) of Shroom3-/- corneas and when comparing the posterior regions of Shroom3+/- and Shroom3-/- corneas (B). The reduction in Col1 staining intensity in the posterior stroma of the Shroom3-/- cornea suggests altered Col1 expression in the cornea lacking Shroom3. There was no significant difference in Col1 x staining intensity when comparing the anterior stromas of the Shroom3+/- and Shroom3-/- corneas or between the anterior and posterior regions of the Shroom3+/- corneas (B). Scale bars = 20µm...... 38 Figure 7. TEM images of Shroom3+/- and Shroom3-/- stromal collagen fibrils (A). Distribution of stromal collagen fibril diameters in Shroom3+/- and Shroom3-/- corneas (B). There was a significant difference in the average fibril diameter between the Shroom3+/- and Shroom3-/- fibrils, with the Shroom3-/- fibrils being larger. This suggests that Shroom3 plays a role in regulating fibril size, as precise fibril diameter is required for corneal transparency...... 40 Figure 8. SDHA, Shroom3, Col1a1 and Col4a1 expression in Shroom3wt, Shroom3R1838C, and Shroom3G59 samples visualized using UV-C light. Col1a1 expression was reduced in the Shroom3 mutant samples (R1838C mutation and G59V), whereas Col4a1 expression was increased in the mutant samples and reduced in the Shroom3wt sample. 41 Figure 9. Positive immunofluorescent-labeling of Shroom3 protein (as indicated by arrows) in epithelial junctions within the region of lens vesicle and surface ectodermal separation...... 43

Chapter 1: Introduction

The Cornea

The cornea is the transparent front surface of the eye. It plays an integral role in the optics of the visual system and protects the other internal ocular structures (Chakravarti et al., 2006). The structure of the cornea is highly organized and tightly regulated to allow for optimal optical function (Chen et al., 2015). The human cornea consists of five principal layers (Asbell and Brocks, 2010). At the ocular surface lies the corneal epithelium which consists of three to five layers of stratified squamous nonkeratinized epithelial cells.

Underlying this tissue is Bowman’s membrane, a thin acellular extracellular matrix (ECM) that primarily consists of dense, irregular collagen (Asbell and Brocks, 2010). The stroma, which makes up the bulk of the cornea, is found posterior to Bowman’s membrane, and is comprised primarily of collagen. At the posterior margin of the cornea is the corneal endothelium which is a single layer of cells that regulates fluid and nutrient movement into the cornea. Descemet’s membrane acts as the basement membrane for the endothelial layer and is found between the stroma and corneal endothelium. While disruption of any of these layers can degrade quality of vision or compromise the cornea’s protective barrier function, the stroma has a particularly intricate structure that can greatly affect the function of the cornea if disturbed (Chen et al., 2015).

The Stroma

The structure of the stroma is vital to proper optics, strength and overall function of the cornea (Zhou et al., 2017; Chen et al., 2015). It accounts for nearly 90% of the corneal thickness, and consists of mainly water (76% by weight), collagen fibrils and their associated extracellular matrix proteins, and resident fibroblast-like cells called keratocytes

(Funderburgh, 2010; Chen et al., 2015; Hassell and Birk, 2010). Stromal collagen fibrils are structured into 200-250 highly organized layers, known as lamellae (Funderburgh,

2010; Maurice, 1970). Each fibril is on average 25-31 nm in diameter and the distribution of fibril sizes rarely deviates from this range (Funderburgh, 2010; Chen et al., 2015; Hassell and Birk, 2010). This organization is tightly regulated, as maintaining proper fibril diameter and spacing is required for corneal transparency (Funderburgh, 2010; Robert et al., 2001; Zhou et al., 2017; Chen et al., 2015; Hassell and Birk, 2010; Maurice, 1957;

Benedek, 1971; Farrell et al., 1973). This collagen lattice forms a crystal-like structure which creates destructive interference that allows light to pass through without scattering, which is ultimately responsible for the transmission of light through the cornea (Hassell and Birk, 2010; Benedek, 1971; Farrell et al., 1973; Maurice, 1957). While this structure is important for transparency, another important factor is stromal hydration (Zhou et al.,

2017; Hassell and Birk, 2010). Proteoglycans allow for precise hydration control of the stroma which is necessary to create the exact fibril spacing needed to minimize light scatter and facilitate transparency (Hassell and Birk, 2010).

Keratocytes

Keratocytes, which originate from neural-crest derived mesenchymal cells, are the main cells found in the stroma (Funderburgh, 2010). Keratocytes are responsible for maintaining the structure and function of the stromal layer by secreting and turning over the collagen fibril rich stromal ECM (Humphrey et al., 2014; Chen et al., 2015).

Keratocytes exist in a highly connected network, joined together by gap junctions which facilitate the potential movement of ions between them (Funderburgh, 2010; Chen et al.,

2015). Even though keratocytes typically remain quiescent and mitotically inactive, they actively synthesize and secrete ECM proteins including proteoglycans and collagen

(Funderburgh, 2010; Chen et al., 2015; Hassell and Birk, 2010; Cintron et al., 1983;

Funderburgh et al., 1986; Cornuet et al., 1994; Young et al., 2007). Thus, keratocytes play a key role in maintaining stromal collagen structure.

Regional Differences

The distribution and organization of collagen varies throughout the cornea.

Collagen in the central cornea has an orthogonal orientation, while the periphery has an interweaving pattern (Chen et al., 2015; Boote et al., 2008). This difference in pattern allows for maximum transparency in the central cornea and maximum strength in the periphery (Chen et al., 2015; Meek and Knupp, 2015). In humans and rabbits, the fibrils in posterior stroma have a smaller diameter than the collagen fibrils found in the anterior stroma (Chakravarti et al., 2006). Whereas, in normal murine models there is only a slight increase in fibril diameter observed in the posterior stroma compared to the anterior stroma

(Chakravarti et al., 2006). The posterior stroma tends to have a more organized fibrillar 3 structure, which is a pattern seen across different species (Chakravarti et al., 2006). Early in development, the anterior stroma is more organized and has a higher fibril density compared to the posterior stroma, which does not achieve the same organizational level and density until later in postnatal development (Chakravarti et al., 2006). It has also been shown that keratocytes secrete ECM at a faster rate in the central cornea than in the periphery (Hassell and Birk, 2010; Rada et al., 1996).

Stromal Collagen

The main collagens found in the stroma are collagen types I, III, IV and V although several other collagens such as VI, VIII and XII can also be found (Funderburgh, 2010;

Robert et al., 2001). Type I collagen is the most abundant stromal collagen, accounting for

80-90% of the total collagen in the stroma (Chen et al., 2015). Collagen fibrils are heterotopic and consist of interwoven type I and V collagen (Funderburgh, 2010; Chen et al., 2015). This interweaving allows for the creation fibrils of a precise diameter during fibrillogenesis (Funderburgh, 2010). Type XII helps maintain regular fibril spacing. The second major element of the ECM are proteoglycans. The specific proteoglycans found in the stroma are decorin, lumican, keratocan and mimican (Funderburgh, 2010; Hassell and

Birk, 2010: Li et al., 1992, Blochberger et al., 1992; Kao et al., 2006, Corpuz et al., 1996;

Chakravarti, 2006; Funderburgh et al., 1997). Collagen and proteoglycans interact to allow for the formation of fibrils with precise diameter, spacing and length during fibrillogenesis

(Funderburgh, 2010). The diameter of each collagen fibril is carefully controlled, with lateral growth inhibited, as large collagen fibrils do not allow for transparency (Chen et al.,

2015). Collagen V, lumican and decorin have been shown to be responsible for this 4 regulation of fibril size (with lumican being the primary regulator of diameter) with the other proteoglycans being responsible for regulating fibril spacing (Hassell and Birk, 2010;

Rada et al.,1993, Chakravarti, 2006). In lumican knockout models, lateral growth of fibrils is no longer inhibited and fibril diameters increase, resulting in a loss of corneal transparency (Chakravarti et al., 2006). This is the reason collagen fibrils in the stroma rarely deviate from the normally observed 25-31 nm diameter, and the spacing of the fibrils is so consistent. Disruption of normal stromal proteoglycans has been shown to result in corneal pathology such as macular corneal dystrophy (Hassell and Birk, 2010; Midura et al., 1990; Hayashida et al., 2006; Musselmann and Hassell, 2006). Therefore, both collagen and proteoglycans play a major role in facilitating stromal structure and transparency.

The collagen of the stroma is also highly active and is turned over relatively quickly (Humphrey et al., 2014). The keratocytes, though semi-quiescent in health, actively secrete collagen and regulate its spacing (Funderburgh, 2010; Hassell and Birk, 2010).

Keratocytic synthesis of ECM has been shown to be regulated by growth factors including

IGF-I/II and TGF-β (Hassell and Birk, 2010). Therefore, the particular growth factor that stimulates this synthesis will ultimately determine the nature of the collagen created. IGF-

I/II signaling has been associated with normal, organized collagen formation whereas TGF-

β mediated signaling can result in disorganized collagen secretion and scarring (Hassell and Birk, 2010). Proper ECM synthesis is important as disruption of the stroma’s collagen building blocks and highly organized structure can lead to severe impairment of corneal function (Chen et al., 2015; Hassell and Birk, 2010).

Development and Transparency

To maintain transparency, there must be adaptive changes to the stromal collagen structure during embryonic development and continuing after birth (Chakravarti et al.,

2006). The embryonic and postnatal development of the stroma is carefully regulated, so disruption at any stage of development could lead to altered stromal structure and function

(Mas Tur et al., 2017; Chen et al., 2015; Chakravarti et al., 2006). The stroma is derived from neural crest cells and arises from a wave of neural crest migration during embryonic development in mammalian species (Funderburgh, 2010). These neural crest cells will become the endothelial cells that form the posterior surface of the cornea, as well as the stromal cells anterior to the endothelium. Once the endothelium is completely formed, stromal neural crest cells begin to build up the extracellular matrix (ECM) that is destined to become the stroma proper (Funderburgh, 2010; Hassell and Birk, 2010; Coulombre and

Coulombre, 1958; Toole and Trelstad, 1971; Cintron et al., 1983). Concurrently, the stroma dehydrates and thins, creating the proper fibril spacing necessary for transparency of the tissue (Funderburgh, 2010). This precise spacing is required to decrease light scatter which in turns allows the cornea to be transparent (Chen et al., 2015). The proteoglycans in each fibril, especially keratan sulfate, are responsible for attracting water and regulating the amount of hydration of each fibril, thus making the proteoglycans a key player in maintaining corneal transparency (Hassell and Birk, 2010). Corneal transparency is also facilitated by the expression of crystallins in keratocytes, which allow for uninterrupted light transmission through the stroma despite the presence of these cells (Funderburgh,

2010; Jester et al., 1999; Piatigorsky, 1998, 2000; Jester, 2008). Many pathways and steps

6 are involved in proper corneal development, so if there is a disruption to any of these steps or cellular interactions, it could potentially result in aberrant corneal development and pathology such as corneal ectasia (Chen et al., 2015). Although the basic steps of embryonic and postnatal corneal development are well known, the exact mechanisms and pathways that control the cornea’s development, especially in regard to collagen synthesis and secretion, are not fully understood (Chakravarti et al., 2006). It is for this reason that a thorough understanding of the mechanisms behind the creation and maintenance of this intricate collagen structure is critical to elucidating the underlying pathophysiology of corneal ectasias that arise from collagen disruption.

Keratoconus

One of the most common conditions that results in disruption of corneal structure and function is keratoconus. Keratoconus occurs in both sexes and in all races and ethnicities (Mas Tur et al., 2017). The disease can cause significant visual impairment and result in a poorer reported quality of life (Kymes et al., 2004). Keratoconus occurs when the cornea thins leading to ectasia and a conical shape (Mas Tur et al., 2017). The underlying cause of keratoconus is unknown, but both genetic and environmental factors have been implicated (Mas Tur et al., 2017; Bykhovskaya et al., 2016; Lu et al., 2013;

McMonnies, 2015; Rabinowitz, 1998; Romero- Jiménez et al., 2010). However, even the proposed causes have poorly understood mechanisms and pathways (Mas Tur et al., 2017;

Bykhovskaya et al., 2016; Romero- Jiménez et al., 2010). Despite the complex and enigmatic underpinnings of keratoconus, there have been promising findings implicating

7 the stromal layer of the cornea – particularly stromal keratocytes and collagens – as primary players in the underlying etiology of keratoconus (Rabinowitz, 1998).

Keratoconus is the most commonly observed corneal ectasia, with a prevalence estimated to be between roughly 5 per 1,000 to 50 per 100,000 worldwide and an incidence of 1 per 2,000 (Rabinowitz, 1998; Romero- Jiménez et al., 2010). Although these numbers have been widely reported, newer studies have suggested that both the incidence and prevalence or keratoconus is markedly higher than previously reported, which further demonstrates the need to better understand this disease (Godefrooij et al.,

2017). Keratoconus can severely disrupt proper corneal function as it can damage each of the five layers of the cornea. The classic presentation of keratoconus is a thinned inferior temporal or central region of the cornea that results in the namesake conical protrusion

(Bykhovskaya et al., 2016; Rabinowitz, 1998). The most common clinical signs and symptoms observed in keratoconus roughly correspond to the damage it causes to each of the corneal layers. A ring-shaped accumulation of iron, known as Fleischer’s Ring, is often seen encircling the base of the conical protrusion (Rabinowitz, 1998, Romero-

Jiménez et al., 2010). This ring occurs due to deposition of iron in corneal epithelial cells

(Rabinowitz, 1998). Breaks in Bowman’s membrane are common along with stromal protrusion through these breaks (Rabinowitz, 1998, Romero- Jiménez et al., 2010). The earliest sign of keratoconus is stromal thinning, which first begins on the posterior surface of the cornea before any anterior signs are visible (this is known as forme fruste keratoconus) (Amsler, 1961; Belin and Khachikian, 2009; Naderan et al., 2017; Awad et al., 2017). As the disease progresses, the stroma becomes noticeably thinned and anterior

8 stromal scars are sometimes present (Rabinowitz, 1998). Descemet’s membrane and the endothelial layer are often left untouched by keratoconus except in the most severe cases

(Romero- Jiménez et al., 2010). If breaks in Descemet’s membrane do occur, it can result in stromal edema which causes painful corneal hydrops (Rabinowitz, 1998, Romero-

Jiménez et al., 2010). Each of these structural damages can interrupt visual function ranging from mild to severe impairment. The most common optical conditions encountered in keratoconus are high myopia and irregular astigmatism, as well as reduced visual acuity and contrast sensitivity (Rabinowitz, 1998).

Due to the potentially severe visual impairment caused by keratoconus and its relatively high prevalence and incidence, many have strived to discover the underlying etiology of keratoconus. Despite the numerous efforts undertaken, no definitive cause of keratoconus has yet been identified (Mas Tur et al., 2017; Bykhovskaya et al., 2016;

Romero- Jiménez et al., 2010). However, it is generally agreed upon that keratoconus is a multifactorial disease with both genetic and environmental components (Khaled et al.,

2017; Kenney and Brown, 2003). Genetic and clinical studies have identified several common factors that are present in many with the condition. Common environmental factors implicated in keratoconus are atopy, eye rubbing, rigid contact lens wear, chronic lid disease (such as blepharitis) and dry eye (Rabinowitz, 1998, Romero- Jiménez et al.,

2010). At least one of these factors in usually seen in a person with keratoconus, however it is unknown whether these factors are causative or resultant of the condition (Rabinowitz,

1998). There is also currently disagreement regarding the underlying nature of the ectasia.

Keratoconus is classically described as a non-inflammatory condition (Rabinowitz, 1998).

However, this classification has been challenged, and it has been suggested that keratoconus is more accurately labeled as a quasi-inflammatory condition – that is an inflammatory process that lacks the classic clinical signs of pain, erythema, edema and calor (McMonnies, 2015). Despite overarching uncertainty surrounding the nature of keratoconus, the stroma – specifically stromal collagen – has been identified as a strong candidate for elucidating the pathophysiology of keratoconus (Rabinowitz, 1998).

A significant amount of corneal thickness is attributed to collagen, which is disrupted in stromal thinning diseases such as keratoconus. It has been argued that the pathogenesis could ultimately be attributed to abnormal collagen organization and function that occurs in adulthood or during development (Mas Tur et al., 2017; Chen et al., 2015).

The stroma in keratoconus is usually thinned centrally, exhibits a decrease in number of lamellae, and has a reduced keratocyte density (Takahashi et al., 1990; Haque et al, 2006,

Ku et al., 2008; Hollingsworth et al., 2005). Collagen structure is also disrupted, as fibril diameter distribution is altered (Akhtar et al., 2008). Collagen types I, IV, V and VIII and their signaling pathways have all been shown to be altered in keratoconus (Bykhovskaya et al., 2016; Lu et al., 2013).

Genetics of Keratoconus

Genetic analysis of patients with keratoconus further implicates disruption of normal collagen expression as a potential cause of the ectasia. Analyzing the genes involved in keratoconus is critical, as a mutation in any gene that plays a role in regulating collagen structure could result in abnormal stromal organization and function (Chen et al.,

2015). In addition, it is estimated 10-50% of keratoconus patients have a family member 10 who also has keratoconus, suggesting a strong genetic component to the disease

(Rabinowitz, 1998; Gonzalez and McDonnell, 1992; Hammerstein, 1974; Zhou et al.,

1998). Genetic studies of keratoconus patients have identified several potential genes that may be involved in the disease process. Many of the genes identified are related to collagen expression or regulation. Specifically, LOX, TGFβ1, COL1A1, COL4A and COL8A have arisen as genes that may be disrupted in keratoconus (Bykhovskaya et al., 2012; Lu et al.,

2013; Rabinowitz, 1998; Li et al., 2006). LOX is involved in collagen cross-linking, TGFβ1 is involved in the collagen synthesis signaling cascade and COL1A1, COL4A and COL8A encode for their respective collagens (Bykhovskaya et al., 2016; Bykhovskaya et al., 2012).

Although collagen gene mutations can be relatively non-specific and other non-collagen genes have been identified as potential culprits, it has been shown that collagen-related genes appear to be the only genes that consistently affect corneal thickness, which is reduced in keratoconus (Bykhovskaya et al., 2016; Lu et al., 2013). Because no COL4A or

COL8A gene mutations have been shown to be pathogenic (Mas Tur et al., 2017;

Bykhovskaya et al., 2016; Karolak et al., 2011), some feel that keratoconus is not likely caused by a direct collagen gene mutation (Mas Tur et al., 2017; Aldave et al., 2006).

Seeing as no collagen gene mutation appears to be responsible for the abnormal collagen present in keratoconus, it suggests that there is some other mechanism causing the disruption of collagen rather a direct collagen mutation. One novel mechanism is a mutation in the SHROOM3 gene, which has been observed in a keratoconus patient (Tariq et al., 2011). The presence of collagen-related genes being routinely implicated in keratoconus suggests that a genetic collagen defect may play a prominent role in the disease

11 process, but the defect may be in a gene that regulates collagen rather than the collagen gene itself. Thus, if Shroom3 affects collagen expression, it opens the possibility that a defect in Shroom3 could indirectly cause the disruption of stromal collagen observed in keratoconus.

Thus, while development, structure and function of the corneal stroma in health are relatively well known, the mechanisms and pathophysiology behind many of the disease conditions that disrupt the stroma, such as keratoconus, are not as well understood (Gage et al., 2005). For this reason, it would be beneficial to understand how the intricate structure of the stroma is created and maintained in health, so it could be compared to the tissue in a diseased state. Given that the presence of a mutation in SHROOM3 has been observed in keratoconus, Shroom3 presents as novel player in the regulation of stromal collagen that may be disrupted in keratoconus.

Shroom3

Shroom3 is a cytoskeletal protein that binds F-actin and activates actomyosin filament contraction (Tariq et al., 2011; Lee et al., 2009). This binding and regulating of actin distribution allows for its known function of facilitating and inducing apical constriction in epithelial cells (Plageman et al., 2010; Haigo et al., 2003; Hildebrand,

2005; Lee et al., 2007). In Shroom3 knockout models, apical constriction does not occur

(Hildebrand and Soriano, 1999; Haigo et al., 2003). Apical constriction refers to a morphological change, where an epithelial cell changes from a cylindrical to a conical shape. Apical constriction occurs when non-muscle myosins located at the apical aspect of the cell interact with actin resulting in contraction and a smaller apical area (Dawes- 12

Hoang et al., 2005). This change is often required for proper embryological development, such as neural tube closure (Lecuit and Lenne, 2007). Therefore, Shroom3 plays a critical role in the morphogenesis of many of the body’s tissues including the neural tube, thyroid, kidney, gut and several structures of the eye (Hildebrand, 2005; Plageman et al.,

2010, Plageman et al., 2011b; Khalili et al., 2016; Loebel et al., 2016; Tariq et al., 2011).

In each case, Shroom3 helps organize the structure of these tissues via its regulation of actomyosin contraction and the regulation of epithelial cell shape (Plageman et al.,

2011a).

While Shroom3 has been shown to play a role in tissue morphogenesis through facilitating apical constriction, other functions of the protein have not been thoroughly explored (Hildebrand, 2005; Plageman et al., 2010; Plageman et al., 2011b; Khalili et al.,

2016; Loebel et al., 2016). One potential novel function of Shroom3 involves regulation of collagen expression. Previous studies have shown that Shroom3 upregulates collagen expression in the kidneys (Menon et al., 2015). Paired with the observation of a SHROOM3 mutation in keratoconus (Tariq et al., 2011), which is a disease that involves disruption of collagen, it is possible that Shroom3 could regulate collagen in the cornea as well.

Therefore, given these findings it was hypothesized that Shroom3 plays a role in corneal collagen regulation.

If Shroom3 has the potential to regulate collagen expression in the cornea, it most likely does so through the Rho-kinase signaling pathway. Currently, all known functions of Shroom3 act through the Rho-kinase pathway and are dependent on the Rho-kinases

Rock1/2, which are responsible for phosphorylating and activating non-muscle myosin

13 which facilitates contraction in epithelial cells (Hildebrand, 2005; Plageman et al., 2011a;

Nishimura and Takeichi, 2008). However, other possible pathways have yet to be investigated, and it is possible Shroom3 acts upon collagen through a novel pathway.

2013; Hildebrand, 2005; Hildebrand and Soriano, 1999). Thus, the specific protein that the PDZ binds and the full functionality of the PDZ domain in Shroom3 is not fully understood. Although the PDZ domain is not required for Shroom3’s known function of apical constriction, it is conserved amongst the members of the Shroom family (Haigo et

14 al., 2003; Hildebrand, 2005; Dietz et al., 2006). This suggests that the PDZ domain may have some other function beyond facilitating apical constriction. Additionally, the glycine at the amino acid 60 position of the PDZ domain is highly conserved among PDZ domains of several proteins including Shroom protein family members of multiple species (Tariq et al., 2011, Fig. 1). This suggests that this glycine is critical to the yet to be fully understood function the PDZ domain. The importance of this glycine and the

PDZ domain are underscored by the finding that a homozygous, missense mutation which substitutes a valine for a glycine at amino acid 60 (G60V) in a PDZ domain within the long isoform of Shroom3 has been identified as a mutation observed in a patient with keratoconus (Tariq et al., 2011). Thus, given that Shroom3 has been shown to regulate collagen expression and a mutation in the PDZ domain of Shroom3, of which the domain’s function is not fully known, has been associated with keratoconus – it is hypothesized that Shroom3 regulates collagen expression in the cornea and it may do so through the action of the PDZ domain.

Therefore, to investigate if Shroom3 does regulate the expression of stromal collagen and if it does so through the PDZ domain there are several questions that have been explored. Experiments were created and aimed to investigate these questions including: Where is Shroom3 localized in the cornea? Does Shroom3 facilitate apical constriction of cells in corneal tissue as it is known to do in other tissues? Does altered

Shroom3 expression affect collagen expression, and if so which collagen types does it affect and how are they affected? If the cornea is affected by altering Shroom3, how it affected? These questions were investigated by analyzing apical constriction, collagen

15 expression and collagen structure in cells where Shroom3 expression was altered. A better understanding of these basic questions would help more thoroughly elaborate the functions of Shroom3 and the role it plays in creating the intricate collagen architecture ultimately necessary for proper corneal structure and function.

Chapter 2: Materials and Methods

X-Gal Staining

E15.5 embryos were obtained from timed matings of mice (Shroom3+/-) harboring the lacZ gene, which is regulated by the endogenous Shroom3 promoter (Hildebrand and

Soriano, 1999). Embryos were fixed and incubated with the X-gal substrate as previously described (Plageman et al., 2010). Following the X-gal assay, embryos were histologically sectioned and imaged.

Creation of G59V Mutation

To generate the G59V mutation two rounds of PCR was performed on the pCS2-

Shroom3-Flag expression vector (Plageman et al., 2010) using primers containing a mismatched T instead of a G to convert the glycine codon (GGG) into a valine codon

(GTG) and an incorporated HindIII restriction site. The primers used were (p1-5’-

GGGACGTCGGAGCAAGCTTGA, p2-5’-CGAAGCTTCACCCCTCCTGAC, p3-5’-

GATTGAAGAAGTGGGCAAAGC, p4-5’-GCTTTGCCCACTTCTTCAATC). In the first round of PCR the primers P1/P4 and P2/P3 were paired with the pCS2-Shroom3-

Flag vector to generate a 293bp and 276bp fragment. These fragments were gel-purified and mixed together and a second round of PCR was performed with the P1/P2 primer pair. The resulting larger fragment was digested with HindIII and subcloned into the

HindIII site of the pCS2-Shroom3-Flag vector in order to replace the wild-type Shroom3 sequence with the G59V-containing version of the plasmid. Clones were screened and the mutation verified by Sanger-sequencing.

General Histology/Immunofluorescent Labeling

Mus musculus embryos of the desired stages were obtained from CO2-euthanized pregnant females of timed matings. The eyes were dissected, placed in 15% sucrose-PBS

(phosphate-buffered saline) solution at room temperature until the tissue sank. The process was then repeated in 30% sucrose solution. The eyes were rinsed, embedded in optimal cutting temperature (OCT) gel (Abcam), and frozen using dry ice and 100% ethanol. Frozen tissue was stored at -80°C until ready for use. A cryostat microtome

(Leica CM1950) was used to obtain 10-micron slices of tissue embedded in OCT gel.

The slices were adhered to glass slides. Slides were stored at -20° C until ready for use.

Slides were placed on a slide warmer for 1 hour. The slides were then put through three rinses of 10 minutes each in PBS-T (detergent solution of PBS and Tween 20,

Fisher Scientific) at room temperature. The PBS-T was removed and replaced with each rinse. If antigen retrieval was required, it was done after completion of the first three

PBS-T rinses. The antigen retrieval was process was performed by placing slides in 100 mM Tris solution (MP Biomedicals) and then in a pressure cooker at 70 kPA for 15 minutes, after which the slides were put through another set of three, 10-minute of PBS-T rinses.

After the completion of the PBS-T rinses (two sets of rinses if antigen retrieval was used), the slides were placed on a slide warmer until dry. Two rings of liquid blocker were drawn around each tissue sample using a PAP Pen (Abcam) and returned to the slide warmer until the blocker had dried. The slides were then placed on a damp paper towel and the primary antibody solution was applied until the entire sample was covered.

Primary antibodies solutions were prepared using 1000 µL PBS-T, 40 mg dried milk and the appropriate concentration of the desired antibody (the exact antibodies and concentrations used are listed within the specific experiment sections of their respective use). Secondary antibodies were prepared in the same manner. Antibody solutions were kept in the dark on a shaker until ready for use. The slides were then placed on a rocker with a gentle motion and kept in the dark for ~24 hours at 4°C.

After 24 hours, the remaining primary antibody solution was removed via aspiration. The slides were then put through three, 10-minute PBS-T washes. Upon completion of the rinses, the slides were placed on a slide warmer until dry and another ring of liquid blocker was applied. The slides were then placed on a damp paper towel and the secondary antibody solution was added. The slides were then placed on a rocker with a gentle motion in the dark for 1 hour at room temperature or for 4 hours if kept at

4°C, after which any remaining solution was removed via aspiration. The slides were then put through three, 10-minute rinses of PBS. The slides were then either cover- slipped immediately or stored in PBS solution in the dark, on a rocker with gentle motion at 4°C until ready for use.

When the slides were ready to be used, they were placed on a damp paper towel and three drops of Fluoro-Gel (Fisher Scientific) were applied to each sample. A cover slip was then placed over the slide, and the slide was kept in the dark until images were taken. Cover-slipping was performed ~15 minutes before imaging with immunofluorescence microscopy. Immunofluorescence microscopy was performed using

19 indirect immunofluorescent antibodies and images were collected using a Zeiss

Observer.Z1 microscope and Zen imaging software.

Cell Culture

A rabbit (Oryctolagus cuniculus) corneal cell line was maintained for corneal collagen DNA analysis. The cell line used was a SIRC (Statens Seruminstitut Rabbit

Cornea, ATTC CCL-60) cell line. Cells were plated on Falcon tissue culture dishes

(Corning) in MEM (minimum essential media, Corning) media mixture including antibiotics, growth factors and amino acids. The mixture included 500 mL MEM, 10 mL penicillin and mitomycin, 50 mL 10% FBS (fetal bovine serum, Corning) and 5.0 mL non-essential amino acids (Corning). Cells were incubated at 37°C and 5% CO2.

Prior to splitting cells, the MEM mixture and 0.25% Trypsin (Corning) were warmed in a water bath (37°C) for 30 minutes. After removal from incubator, the old

MEM mixture was removed via aspiration and 1.0 mL of Trypsin was added to each plate. Plates were then returned to the incubator for 5-10 minutes until the cells had trypsinized. The breakdown of cellular adhesions to the media was verified using a light microscope. After trypsinization, 5.0 mL of MEM mixture was added to the plates to neutralize the Trypsin. New plates were created by adding 3.0 mL of MEM mixture to the plates. A volume of 1.0 mL was extracted from the existing plates and transferred to the new plates. The result was a 1:6 cell ratio, which is within the recommended 1:4-1:8 ratio for these cells (SIRC [Statens Seruminstitut Rabbit Cornea] (ATCC® CCL60™)

Product sheet). Cells were incubated at 37°C and 5% CO2 in the presence of moisture.

Cells were split once per week. 20

Transfection of MDCK Cells

Madin-Darby Canine Kidney (MDCK, ATCC CCL-34) cells were cultured using standard methods in Dulbecco's Modified Eagle Medium (DMEM, Corning) media supplemented with 10% FBS, 1%Penn/Strep, and 1% non-essential amino acids (from

100x stock, Corning) and used for cell transfection. Each well had 0.5 µg of the desired

DNA plasmid added. The Shroom3wt plasmid stock concentration was 4.75 µg/µL. The

Shroom3G59V plasmid stock concentration was 0.893 µg/µL. Plasmids used in the transfection were diluted to 1:10 in serum free DMEM media (Corning). Transfer reagent solutions were created using 12.5 µL of DMEM and 3.0 µL of TransIT 293 (Mirus) transfer reagent. The Shroom3wt plasmid solution contained 12.5 µL DMEM and 3.16 µL of 0.475 µg/µL Shroom3wt plasmid. The Shroom3G59V plasmid solution contained 12.5

µL DMEM and 16.8 µL of 0.0893 µg/µL Shroom3G59V plasmid. The transfer and plasmid solutions were allowed to sit for 5 minutes, and then a transfer reagent solution was added to each plasmid solution. The solutions were then incubated at room temperature for 45 minutes.

Cells were plated on Transwell plates (Corning) and cultured in 0.5 mL 10% FBS.

MDCK cells were maintained through the same cell culture protocol described in the Cell

Culture section. One third of the volume of the plasmid solutions described above was added to each of the appropriate wells. Two wells were transfected with the Shroom3wt plasmid and two wells were transfected with the Shroom3G59V plasmid. The well plates were then incubated at 37°C and 5% CO2 for 48 hours.

MDCK Cell Staining and Apical-Basal Area Analysis

Once the cells had reached 50% confluence, the 10% FBS growth media was aspirated and a new volume of 1.5 mL of 10% FBS was then added to the bottom chamber. The remaining growth media was then aspirated form each individual well, and

500 µL of PBS was then added. The well plates were shaken by hand for 5 seconds, and the PBS was then aspirated from each well. A volume of 500 µL of methanol was added to each well and left to sit for 10 minutes followed by aspiration. The primary antibody solution containing 1500 µL PBS, 60 µg dried milk, 1.5 µL N-term antibody (1:500,

Lang et al., 2014), and 3.0 µL β-catenin (1:500, Santa Cruz, sc-7199) was added to each well. The well plates were placed on a rocker with a gentle motion, in the dark, for 24 hours at 4°C.

After 24 hours, the primary antibody solution was aspirated from the plates and

500 µL of PBS-T was added. The plates were shaken by hand for 5 seconds, the PBS-T aspirated, and the wells were then put through three, 10-minute washes of PBS-T. After the final wash, the secondary antibody solution containing 1500 µL PBS, 60 µg dried milk, 1.5 µL Hoechst 33342 nuclear stain (Sigma, B-2261), and 1.5 µL 594 anti-rabbit

(1:1000, Life Technologies, A21207), and 1.5 µL 488 anti-mouse antibody (1:1000, Life

Technologies, A11001) was added to each well. The well plates were then placed on a rocker, in the dark, for 1 hour at room temperature, after which the plates were put through an additional three, 10-minute washes of PBS.

After the final PBS wash, the bottoms of the wells were removed using a scalpel.

Once removed, the well bottoms were placed on glass slides and cover-slipped with

Fluoro-Gel using the technique described earlier in the General

Histology/Immunofluorescent Labeling section. Immunofluorescent images of the apical and basal aspects of the MDCK cells were then taken using a Zeiss Observer.Z1 microscope and Zen imaging software. Apical and basal area were measured using Fiji software. The average apical area, as well as average apical to basal area ratio was then compared between the Shroom3wt cells (n=28) and the Shroom3G59V cells (n=23). β- catenin was used to visual cells junctions. The apical and basal areas of the Shroom3wt and Shroom3G59V MDCK cells were compared using an independent samples T-test.

Cornea Cell Staining and Apical-Basal Area Analysis

The cornea was isolated from E15.5 Shroom3+/- and Shroom3-/- embryos and subjected to whole-mount immunofluorescent labeling similar to the protocol described above in the MDCK Cell Staining and Apical-Basal Area Analysis section.

Immunofluorescent images of the apical and basal aspects of the corneal cells were then taken using a Zeiss Observer.Z1 microscope and Zen software. Fiji imaging software was used to measure the apical and basal areas of the cells. The average apical area, as well as average apical to basal area ratio was then compared between the Shroom3+/- corneal cells (n=12), the Shroom3-/- corneal cells (n=13). β-catenin was used to visual cells junctions. The apical and basal areas of the Shroom3+/- and Shroom3-/- corneal cells were compared using an independent samples T-test.

Transfection of SIRC Cells

SIRC cells (ATTC CCL-60) were transfected with a Shroom3wt plasmid,

Shroom3R1838C plasmid, and Shroom3G59V plasmid. The control cells were SIRC cells that were transfected with the reagents only, not any of the plasmids. The stock plasmid concentrations were 1829.6 ng/µL Shroom3wt, 1016.9 ng/µL Shroom3G59V, and 2169.9 ng/µL Shroom3R1838C. The stocks were diluted 1:1000 and volume of 0.5 µg of each resulting plasmid dilution was added to 12.5 µL serum-free DMEM and then combined with 3.0 µL of TransIT 293 (Mirus) and 12.5 µL DMEM to create each individual plasmid solution. The remaining transfection procedure followed the same protocol described earlier in the Transfection of MDCK Cells section.

RNA Extraction

After the SIRC cells had been successfully transfected, RNA extraction was performed. Cell plates were rinsed with PBS and then cells were loosened by adding 5.0 mL PBS and gently scraping the plates with a cell-scraper. A volume of 5.0 mL of PBS and cells was centrifuged at 1200 RPM for 10 minutes. The PBS was removed and 2.0 mL of Trizol (Fisher Scientific) was added to resulting pellet. The pellet and Trizol were vortexed until the pellet had dissolved and the cells had lysed. The suspension was incubated at room temperature for 5 minutes and centrifuged at 2400 RPM for 5 minutes at 4°C. A volume of 400 µL of chloroform was added and the suspension vortexed. The suspension was incubated at room temperature for 3 minutes. The suspension was then centrifuged at 2400 RPM for 15 minutes at 4°C. The clear aqueous phase containing the

DNA was removed. A volume of 1.0 mL of isopropyl alcohol was added and incubated at 24 room temperature for 10 minutes. The solution was then centrifuged at 2400 RPM for 10 minutes at 4°C. The supernatant was removed and 2.0 µL of 75% alcohol (made with

RNase-free water) was added. The solution was vortexed and the centrifuged at 2400

RPM for 5 minutes at 4°C. The 75% alcohol was removed and the resulting RNA pellet was left to dry for 1 minute. The pellet was then dissolved in 50 µL of RNase-free water.

The purities of the RNA samples were assessed using nanospectroscopy. The

Nanospectrometer was calibrated using RNase-free water. The control sample concentration was 54.9 ng/µL with an A260/280 ratio of 1.4, the Shroom3wt sample was

45.5 ng/µL with an A260/280 ratio of 1.52, the Shroom3R1838C sample was 62.7 ng/µL with an A260/280 ratio of 1.24, and the Shroom3G59V sample was 26.8 ng/µL with an

A260/280 ratio of 1.40. The ideal A260/280 ratio for RNA is ≥ 1.60 (Chomczynski and

Mackey, 1995). RNA samples were stored at -80°C until use.

cDNA Creation

RNA samples were retrieved form storage at -80°C and kept on ice. A Verso cDNA synthesis kit (Fisher Scientific) was used to create cDNA samples of the control,

Shroom3wt, Shroom3R1838C and Shroom3G59V SIRC cells. An RNA primer was created using 3.0 µL of random hexamers and 1.0 µL of oligonucleotides for each sample. Each sample was prepared by adding the previous mixture to the following: 4.0 µL of 5x cDNA buffer, 2.0 µL dNTP mix, 1.0 µL RNA primer (from random hexamer- oligonucleotide solution), 1.0 µL RNA RT enhancer, 1.0 µL Verso enzyme mix, 5.0 µL of the desired RNA sample, and 20 µL of RNase-free water. The solution was left to settle at room temperature. The samples were then put through the cDNA creation 25 program on the thermocycler. A volume of 50 µL of RNase-free water was then added to each sample.

The purities of the cDNA samples were assessed using nanospectroscopy. The

Nanospectrometer was calibrated using RNase-free water. The control sample concentration was 1024.6 ng/µL with an A260/280 ratio of 1.77, the Shroom3wt sample was 785.7 ng/µL with an A260/280 ratio of 1.78, the Shroom3R1838C sample was 1191.8 ng/µL with an A260/280 ratio of 1.77, and the Shroom3G59V sample was 1014.6 ng/µL with an A260/280 ratio of 1.77. Protein contamination was also assessed using the

A260/230 ratio. The control sample ratio was 1.98, the Shroom3wt sample ratio was 1.97, the Shroom3R1838C sample ratio was 1.96, and the Shroom3G59V ratio was 1.91. The desired A260/230 ratio range is 2.00-2.20, where 2.20 signifies no protein contamination

(Chomczynski and Mackey, 1995). RNA samples were stored at -80°C until use.

Collagen Primer Design and Creation

Rabbit (Oryctolagus cuniculus) collagen primers were created using the Primer-

BLAST program (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). Primers were designed for:

COL1A1 (forward 5’-CATAAAGGGTCACCGTGGCT, 154 base pairs),

COL1A2 (5’-CCATCTCGTTTGCCCTTCCT, 80 base pairs),

COL3A1 (5’-TTCAAATGGCTCCCCTGGAC, 102 base pairs),

COL4A1 (5’-TGCTTTACGTGCAAGGCAAC, 145 base pairs),

COL4A6 (5’-GGAGCCTCTTTCCCTTTGGG, 154 base pairs),

COL5A2 (5’-TAGGACTGATGCCTGGCTCT, 194 base pairs), 26

COL5A3 (5’-GTGCTACCTTTGCCCAGAGT, 100 base pairs),

COL6A2 (5’-GTTCCACGAGAAGCACGAGA, 186 base pairs),

COL6A3 (5’-GGACCTCGGGAGAAAAAGGG, 183 base pairs),

COL7A1 (5’-GACCCTGTGCAGAGCTTCTT, 147 base pairs),

COL8A1 (5’-GGCAGTACGTCCATTCCTCC, 197 base pairs), and COL8A2 (5’-GACCCCTCAACTGGACAGGAC, 189 base pairs).

PCR Procedure

For DNA analysis experiments, cDNA concentrations of 203.4 ng/µL Shroom3wt,

314.3 ng/µL Shroom3R1838C, 135.0 ng/µL Shroom3G59V, and 223.4 ng/µL control

(unaltered SIRC cell cDNA) were used. Collagen expression was analyzed for each of the samples. The collagen variants analyzed were COL1A1, COL1A2, COL3A1, COL4A1,

COL4A6, COL5A2, COL5A3, COL6A2, COL6A3, COL7A1, COL8A1, and COL8A2.

The experiments analyzed SHDA (succinate dehydrogenase complex flavoprotein subunit A), SHROOM3, COL1A1, COL2A2, COL3A1, COL4A1, COL4A6, COL5A2,

COL5A3, COL6A2, COL6A3, COL7A1, COL8A1, and COL8A2 expression. SHDA, which corresponds to an enzyme involved in the citric acid cycle, acted as a loading control as it should not be affected by Shroom3 (Courage et al., 2017). The stock primers were diluted 1:10 (10 µL of each specific forward and reverse primer plus 190 µL of

RNase free water). Each solution consisted of 112.8 µL of RNase free water, 18.0 µL red loading dye (Fisher Scientific), 15.0 µL Dream Buffer (Fisher Scientific), 12.0 µL 12mM dNTP mix (Fisher Scientific), 1.5 µL of the specific forward primer, 1.5 µL of the specific reverse primer, and 1.2 µL Dream Taq polymerase (Fisher Scientific). All 27 components were kept refrigerated or on ice while being used. This solution was added to

1.0 µL of Shroom3wt, Shroom3R1838C, Shroom3G59V and control corneal cell cDNA at the concentrations listed previously. After each sample solution was created, it was run through the CRE35 program on the PCR machine.

Electrophoresis gel was created by mixing 100 mL of TAE (Tris base, acetic acid and EDTA) and 1.0 g agarose powder (Biokeystone Company). The solution was then heated in a microwave for 90 seconds, and 5.0 µL of ethidium bromide was added. The solution was placed in a gel mold and left to settle. The electrophoresis chamber was filled with TAE. Each gel contained four sets of 4 lanes plus two individual lanes used for the ladder, so the expression of four genes of interest could be analyzed on one gel.

The lanes included the GeneRuler 100 BP molecular marker (Fisher Scientific), the

Shroom3wt, Shroom3R1838C, Shroom3G59V, positive control (unaltered SIRC cell), and negative control (RNase-free water) samples. After the CRE35 PCR cycle had finished, each well was filled with 20.0 µL of the appropriate sample and the molecular marker lane was loaded with 5.0 µL of GeneRuler. The gels were run at 150 volts for 35 minutes.

Gene expression was then visualized under UV-B light and images were captured using a UVP High Performance Transilluminator. The amount of expression was analyzed qualitatively based on light intensity and the size by comparing the sample to the GeneRuler. Images were captured using UVP imaging software.

Collagen Expression Analysis

Type I collagen expression was analyzed through immunofluorescent staining of cornea histology sections. Corneal tissue was collected from three Shroom3+/+ 28 homozygote mouse embryos and three mutant Shroom3-/- homozygote mouse embryos.

Histological slides were created and stained according to the protocol described earlier in the General Histology/Immunofluorescent Labeling section. The primary antibodies consisted of 2.0 µL mouse β-catenin (1:500, Santa Cruz, sc-7199) and 5.0 µL rabbit Col1

(1:200, Abcam, AB34710). The secondary antibodies consisted of 1.0 µL 488 anti-mouse

(1:1000, Life Technologies, A11001), 1.0 µL 594 anti-rabbit (1:1000, Life Technologies,

A21207), and 1.0 µL Hoechst 33342 (Sigma, B-2261).

Immunofluorescent images of the corneal sections were then taken using a Zeiss

Observer.Z1 microscope and Zen software. Fiji imaging software was used to analyze stromal Col1 expression. The staining intensity of Col1 was measured between the anterior and posterior stroma. To account for differences in overall image intensity, measured collagen intensities were normalized by taking the ratio of collagen intensity to empty background space. The empty black background space provided a baseline intensity for each individual image, and thus allowed for consistency when comparing intensities between images. The ratio of Col1 staining intensity to black background intensity was compared between Shroom3+/+ (13 images from 3 mice) and Shroom3-/- (12 images from 3 mice) anterior and posterior stroma sections. The intensities were compared between the Shroom3+/- and Shroom3-/- samples and within the same cornea type. The anterior and posterior stroma were determined by dividing the total thickness of the section in two, with the top 50% being anterior stroma and the bottom 50% posterior stroma. The Shroom3+/- and Shroom3-/- Col1 intensities was analyzed using an independent samples T-test to compare anterior to posterior stroma within the same

29 cornea type and an independent samples T-test when comparing anterior and posterior regions between Shroom3+/- and Shroom3-/- corneas. Levene’s test was used to assess equal variance amongst the samples.

Keratocytes Analysis and Central Stromal Thickness

Keratocyte counts were obtained from Shroom3+/- and Shroom3-/- corneal sections prepared with the same protocol and stained with the same antibodies as described in the

Collagen Expression Analysis section. Counts were obtained by counting the number of keratocytes that fell within an area of stroma that spanned a defined 150-micron length of central cornea in sections of Shroom3+/- (27 images from 4 mice) and Shroom3-/- (15 images from 3 mice) corneas. Areas defined as being central were kept consistent between sections by using the center of the lens (in terms of overall length) as a reference point and counting the keratocytes that fell 75 microns on either side of the central lens point to ensure that keratocytes were being measured in corresponding areas of the cornea between the sections. Vertical lines were then placed every 25 microns through the 150-micron section of cornea (7 total lines) and the number of keratocytes that fell on each line were counted. The number of keratocytes from each line were added together to get the total number of keratocytes found in the central region of each image. The total number of keratocytes that fell on each line were averaged to create an average keratocyte count for each of the 7 lines. The averages for each of the 7 lines were then also averaged together to generate the average number of keratocyte layers for each image. Thus, the number of layers was based on the average number of keratocytes that fell on the 7 vertical lines of each image. The Shroom3+/- and Shroom3-/- keratocyte cell 30 counts and layers of keratocytes were analyzed using an independent samples T-test.

Levene’s test was used to assess equal variance amongst the samples.

The thickness of the central stroma of the same sections of Shroom3+/- (27 images from 4 mice) and Shroom3-/- (15 images from 3 mice) corneas was also measured (using the midpoint of the lens as a reference point). Fiji software was used to measure the stromal thickness of each image. Thicknesses were analyzed using an independent samples T-test. Levene’s test was used to assess equal variance amongst the samples.

Collagen Fibril Diameter Analysis

Collagen fibril diameter from thin histological sections from Shroom3+/+ and

Shroom3-/- E17.5 embryos prepared at the Campus Microscopy and Imaging Facility at

The Ohio State University was analyzed using transmission electron microscopy. Fibrils were measured from images of thirteen 250 nm squares from one Shroom3+/- sample and sixteen 250 nm squares from one Shroom3-/- sample. Diameters were measured across the shortest length of each fibril using Fiji software. The average diameter was then compared between the Shroom3+/- and the Shroom3-/- samples using an independent samples T-test.

Chapter 3: Results

Shroom3 Localization

Figure 2. X-gal staining reveals the location of Shroom3 expression (blue) in the mouse cornea. Shroom3 is expressed in the posterior stroma. The expression is more pronounced in the periphery than in the central stroma at E15.5.

Because it is hypothesized that Shroom3 may play a role in corneal development and collagen regulation, the expression of Shroom3 was evaluated. Previous studies have shown that Shroom3 is expressed in the embryonic lens (Plageman et al., 2010), however the localization of expression in the cornea had not yet been fully explored. To determine if Shroom3 mRNA is expressed in embryonic corneal tissue, X-gal staining was performed on histological sections of one E15.5 Shroom3+/- mouse embryo. The lacZ gene was inserted into the null allele of SHROOM3 in these mice and it produced beta- galactosidase in tissues that normally express Shroom3, which can be visualized

32 histologically as a blue stain upon X-gal staining (Hildebrand and Soriano, 1999). Thus,

X-gal staining was performed to identify the regions of the cornea where Shroom3 is localized by using beta-galactosidase expression as a proxy for where Shroom3 would normally be expressed. The staining revealed Shroom3 to be located in the central and peripheral cornea, particularly in the posterior stroma, at E15.5. However, Shroom3 expression was more pronounced in the periphery than the central stroma (Fig. 2). The presence of Shroom3 in the cornea suggests that the protein may influence the structure and function of the cornea.

Apical Constriction in MDCK Cells

Figure 3. Comparison of the apical and basal aspects of Shroom3wt and Shroom3G59V MDCK cells (A). There was no significant difference between apical and basal area between Shroom3wt and Shroom3G59V MDCK cells (B). Scale bars = 20µm.

Shroom3 has been shown to facilitate apical constriction in embryonic epithelial cells during morphogenesis and in cultured MDCK cells (Hildebrand, 2005; Plageman et al., 2010). To investigate the consequences of the keratoconus-associated mutation of

Shroom3, MDCK cells were transfected with Shroom3wt and the G59V mutant form of

Shroom3 (Shroom3G59V). The G59 position is located within the PDZ domain, a region shown to be dispensable for inducing apical constriction (Haigo et al., 2003; Hildebrand,

2005; Dietz et al., 2006). Thus, the G59V mutation was not expected to have any effect on apical constriction in MDCK cells. When comparing apical area between Shroom3wt

MDCK cells (n=28) and Shroom3G59V MDCK cells (n=23) there was no significant difference (p= 0.874) (Fig. 3A, B). Thus, the data from this experiment are consistent with these previous findings.

The absence the of any effect on MDCK apical constriction by the G59V mutation suggests that this mutation does not affect the known function of Shroom3, but in the context of a human patient, it may affect an unknown function. Given that the

G59V equivalent mutation in SHROOM3 has been associated with keratoconus, perhaps the mutation is altering the cornea through a novel mechanism involving the PDZ domain

(Tariq et al., 2011).

Apical Constriction in Corneal Cells

Figure 4. Shroom3 expression in persistent lens stalk epithelium visualized with X-gal staining (A). En face view of the corneal epithelium from Shroom3+/- and Shroom3-/- E11.0 embryos immunolabeled with a β-catenin antibody (B). Scale bars = 50µm. The graph represents the average apical area of corneal epithelial cells quantified from control and Shroom3 deficient embryos (C). The average apical area of Shroom3-/- cells was significantly larger than that of Shroom3+/- cornea cells, suggesting impaired apical constriction.

Shroom3 deficient embryos have abnormal ocular anterior segment development with the cornea and lens failing to entirely separate, which is reminiscent of Peters’ anomaly, a rare condition found in patients with congenital mutations of important genes expressed in the lens and cornea (Lang et al., 2014). Shroom3 is strongly expressed in the persistent lens stalk epithelium (Fig. 4A) suggesting that a failure of Shroom3-dependent apical constriction may contribute to the Peters’ anomaly-like phenotype in these mice.

To explore if Shroom3 facilitates apical constriction in corneal epithelial cells, as it does in neural and lens placodal epithelial cells (Hildebrand and Soriano, 1999; Haigo et al.,

2003; Plageman et al., 2010), corneal tissue was harvested from Shroom3+/- and

Shroom3-/- mice and subjected to whole-mount immunofluorescent labeling with a β- catenin antibody to visualize apical junctions. The apical and basal areas of the

Shroom3+/- and Shroom3-/- corneal cells were then measured and compared. There was a significant difference between the average apical areas of Shroom3+/- (n=12) and

Shroom3-/- (n=13) corneal cells (p = 4x10-4) (Fig. 4B, C). This suggests that Shroom3 also facilitates apical constriction in corneal epithelial cells, which supports the hypothesis that the lack of corneal-lens separation observed in Peters’ anomaly is due to faulty apical constriction secondary to abnormal Shroom3.

Corneal Thickness and Keratocyte Count

Figure 5. Hoechst nuclear staining of the central cornea from three different eyes of control and experimental E15.5 mouse embryos (A). There was a significantly lower keratocyte count over a 150-micron region of the central cornea in Shroom3-/- corneas compared to Shroom3+/- corneas. (B). There was no significant difference in direct thickness between the heterozygous and homozygous stromas (C). However, there was a significantly lower number of layers of keratocytes observed in the Shroom3-/- corneas compared to the Shroom3+/- corneas, which acts as an indirect measure of thickness (D). This suggests the mutation in Shroom3 may alter the number of keratocytes present in the cornea.

Keratocytes produce collagen in the stroma, and if Shroom3 regulates collagen in the cornea it may do so in keratocytes (Humphrey et al., 2014; Chen et al., 2015). To determine whether Shroom3 function is required in the developing corneal stroma the phenotype of Shroom3+/- and Shroom3-/- corneas were analyzed. First, the number of keratocytes was determined from histological sections of E15.5 Shroom3+/- (27 images from 4 mice) and Shroom3-/- (15 images from 3 mice) embryonic mouse corneas

36 immunofluorescently labeled to visualize the nuclei (Fig. 5A). Fiji imaging software was used to count the total number of keratocytes present over a 150-micron wide sections of the central cornea in each image. There was a significant difference in the total number of keratocytes observed in the Shroom3+/- and Shroom3-/- central cornea sections (p = 6x10-

10) (Fig. 5B). This suggests that a deficiency in Shroom3 reduces the number of keratocytes present in the cornea.

The stroma in keratoconus in known to be thinner (Haque et al, 2006). Thus, the central thickness of the stroma was directly measured using Fiji imaging software. There results showed no significant difference in stromal thickness between the Shroom3+/- and

Shroom3-/- corneas (p = 0.195) (Fig. 5C). Thickness was also indirectly measured by counting the number of layers of keratocytes present in the corneas. This analysis revealed a significant difference in number of keratocyte layers between the Shroom3+/- and Shroom3-/- corneas (p = 6x10-10) (Fig. 5D).

Differences in Anterior and Posterior Collagen Expression

Figure 6. Imaging of Collagen I (red) and nuclei (blue) in Shroom3+/- and Shroom3-/- mouse corneas with dashed line demarcating the approximate anterior and posterior stroma (A). The intensity of normalized Col1 staining was significantly different when comparing the anterior stroma and posterior stroma (defined as the top 50% and bottom 50% of the section’s thickness) of Shroom3-/- corneas and when comparing the posterior regions of Shroom3+/- and Shroom3-/- corneas (B). The reduction in Col1 staining intensity in the posterior stroma of the Shroom3-/- cornea suggests altered Col1 expression in the cornea lacking Shroom3. There was no significant difference in Col1 staining intensity when comparing the anterior stromas of the Shroom3+/- and Shroom3-/- corneas or between the anterior and posterior regions of the Shroom3+/- corneas (B). Scale bars = 20µm.

Previous experiments have shown that in kidney cells collagen expression is regulated by Shroom3 (Menon et al., 2015). Thus, it was hypothesized that collagen expression in the corneas of Shroom3 deficient mice may be reduced. To determine this, histological sections of E15.5 embryonic corneas of Shroom3+/- (13 images from 3 mice) and Shroom3-/- (12 images from 3 mice) mice were analyzed following immunofluorescent labeling with an antibody for collagen I and imaging. The intensity of collagen I staining was quantified using Fiji imaging software. The intensities of Col1 staining were normalized by taking the ratio of Col1 intensity to the intensity of blank, black background to account for overall intensity differences between images. The intensities of Co11 staining in the anterior and posterior stroma were measured (with the

38 anterior and posterior regions defined as top 50% and bottom 50% of the section’s thickness, respectively). The anterior and posterior Col1 intensities were compared within the Shroom3+/- and Shroom3-/- corneas, and the anterior sections and posterior sections were also compared between the Shroom3+/- and Shroom3-/- corneas.

There was no significant difference in the intensity of collagen I expression between the anterior and posterior stroma in Shroom3+/- corneas (p = 0.972), but there was a significant difference between the two regions in the Shroom3-/- corneas (p = 2x10-

4) (Fig. 6A, B). There was no significant difference between intensity of staining when comparing the anterior stroma of the Shroom3+/- corneas and the anterior stroma of the

Shroom3-/- corneas (p = 0.170), whereas there was a significant difference between the collagen staining intensity between the posterior stroma of the corneas (p = 0.038) (Fig.

6A, B). The reduced staining intensity observed in the posterior stroma suggests that

Shroom3 plays a role in the regulation or development collagen in the stroma, specifically the posterior stroma. This difference observed between the unaffected anterior stroma and the reduced collagen expression in the posterior stroma suggests that the function of Shroom3 may be localized the posterior stroma.

Fibril Diameter

Figure 7. TEM images of Shroom3+/- and Shroom3-/- stromal collagen fibrils (A). Distribution of stromal collagen fibril diameters in Shroom3+/- and Shroom3-/- corneas (B). There was a significant difference in the average fibril diameter between the Shroom3+/- and Shroom3-/- fibrils, with the Shroom3-/- fibrils being larger. This suggests that Shroom3 plays a role in regulating fibril size, as precise fibril diameter is required for corneal transparency.

Precise collagen fibril diameter is required to maintain corneal transparency, with the normal diameter range being 25-31 nm and larger fibril diameters being incompatible with transparency (Funderburgh, 2010; Chen et al., 2015; Hassell and Birk, 2010;

Chakravarti et al., 2006). To investigate if Shroom3 plays a role in fibril size, TEM imaging of Shroom3+/- and Shroom3-/- stromal collagen fibrils was performed. The diameters of fibrils from Shroom3+/- and Shroom3-/- corneas were measured using Fiji software. These measurements revealed a difference in the distribution of fibril diameters observed between WT and Shroom3 mutant corneas, as well as a difference in average fibril diameter (Fig. 7A). The mean fibril size observed for Shroom3+/- corneas was 22.02 nm compared to 24.01 nm for Shroom3-/- corneas (Fig. 7B). There was a significant difference in average fibril diameter between the Shroom3+/- corneas and Shroom3-/-

40 corneas (p = of 3.89x10-8). Overall, the fibril diameters observed in the Shroom3+/- stroma skewed towards smaller diameters whereas the diameters seen in the Shroom3-/- stroma skewed toward larger diameters (Fig. 7B). This suggests that Shroom3 plays a role in regulating fibril diameter, and that a mutation in Shroom3 could lead to a lack of corneal transparency.

Differences in Collagen Subtype Expression

Figure 8. SDHA, Shroom3, Col1a1 and Col4a1 expression in Shroom3wt, Shroom3R1838C, and Shroom3G59 samples visualized using UV-C light. Col1a1 expression was reduced in the Shroom3 mutant samples (R1838C mutation and G59V), whereas Col4a1 expression was increased in the mutant samples and reduced in the Shroom3wt sample.

There are several collagen genes expressed in the cornea including: COL1A1,

COL2A2, COL3A1, COL4A6, COL5A2, COL5A3, COL6A2, COL6A3, COL7A1,

COL8A1, and COL8A2 (Robert et al., 2001). Thus, if Shroom3 affects collagen expression in the cornea, it would be valuable to know if Shroom3 regulates all subtypes of collagen found in the cornea or only specific subtypes. Therefore, corneal cells were

41 transfected with different SHROOM3 gene variants including: Shroom3wt (increases the amount of Shroom3 present), Shroom3R1838C (a mutation which inhibits Rho-kinase binding to Shroom3 which disrupts the mechanism behind Shroom3’s known function of apical constriction), and Shroom3G59V (the keratoconus-associated mutation). RNA was extracted from each experimental group and RT-PCR was performed to observe expression of each collagen type in the different Shroom3 variants.

There was no noticeable qualitative difference in Shroom3 expression between the three variants, which verified the presence of the Shroom3 in each sample. The

Shroom3wt cells expressing exogenous Shroom3 had increased Col1a1 expression compared to the control cells, whereas Col4a1 expression was similar to that of the control cells (Fig. 8). The effect on Col1a1 expression was abrogated by the G59V mutation as cells that transgenically expressed Shroom3G59V did not have higher Col1a1 expression, and in fact seemed to have reduced levels compared to non-transgenic cells.

Surprisingly, Shroom3-induced Col1a1 expression was also attenuated by the R1838C mutation suggesting that Rho-kinase interaction with Shroom3 is also required to regulate collagen expression. In contrast to the effect on Col1a1 expression, Col4a1 expression was higher in the Shroom3R1838C and Shroom3G59V variants relative to Shroom3wt (Fig. 8).

This difference was not observed when analyzing other collagen subtypes.

Chapter 4: Discussion

Shroom3 Localization and Apical Constriction in Corneal Epithelial Cells

Figure 9. Positive immunofluorescent-labeling of Shroom3 protein (as indicated by arrows) in epithelial junctions within the region of lens vesicle and surface ectodermal separation.

The X-gal-based experiments presented here demonstrate that Shroom3 is expressed in cells within the posterior stroma of the central and peripheral cornea. These data also suggest Shroom3 facilitates apical constriction in the corneal epithelium during lens vesicle separation. However, it is worth noting that while the superficial corneal epithelial cells were larger and apical constriction appeared to be altered, this finding is not consistent with a lack of detectable Shroom3 in the epithelium per the results of the

X-gal staining experiment. The most likely explanation for this discrepancy is that the X- gal staining procedure used was not sensitive enough to detect or allow visualization of low amounts of Shroom3 expression. Supporting this hypothesis is the observation of positive immunofluorescent-labeling of the epithelial junctions within and surrounding the separation region indicating the presence of Shroom3 protein (Fig. 9). So, the absence 43 of Shroom3 in the corneal epithelium in the X-gal experiments does not does not necessarily mean Shroom3 is not expressed in the cells, especially because of the observed phenotype in the protein’s absence. These data show that Shroom3 is present in corneal epithelial cells, but a better temporal analysis through immunofluorescent labeling and possibly western blots would aid in the understanding of the localization of

Shroom3 during this time.

Shroom3 and Peters’ Anomaly

The lack of separation between the developing lens and cornea observed in

Peters’ Anomaly may be due to a lack of apical constriction secondary to the absence of

Shroom3 expression. Beyond the fact that this abnormality is associated with mutations that affect the lens, the cause and underlying mechanism of this phenomenon is unknown.

Shroom3 could be functioning in the final step of lens vesicle separation by directing the contraction of a ring of actomyosin that “pinches-off” and separates the lens and corneal tissues. A lack of apical constriction may be suggestive of a failure of corneal and lens epithelial cells to undergo actomyosin contraction during the final step of closure. The presence of a contractile actomyosin ring has already been shown to play a critical role in wound repair of epithelial cells, as the contraction of the ring pulls epithelial cells together to seal the wound (Brugués et al., 2014). Thus, this actomyosin ring may also serve an important role in separating the cornea and lens epithelium during development via Shroom3 induced apical constriction.

Shroom3 and Stromal Thickness

Because the SHROOM3 gene has been associated with keratoconus (Tariq et al.,

2011), Shroom3 deficient corneas were analyzed for phenotypes observed in the pathology of this corneal ectasia. One of the observations made in keratoconus is a reduction in stromal thickness (Haque et al, 2006). Thus, stromal thickness was analyzed in central sections of corneal tissue. The stromal thicknesses of Shroom3+/- and Shroom3-

/- mice were compared, but the difference was not significant. However, it is challenging to directly measure stromal thickness because the antibody staining process alters the hydration of the tissue. Therefore, these stromal thickness data may be subject to some variability due to these differences in hydration. Although, if the same preparation process was used on both the Shroom3+/- and Shroom3-/- tissues, any changes to hydration would be expected to be relatively consistent between samples. However, when layers of keratocytes were compared as a proxy for thickness, there was a significant difference with Shroom3-/- corneas displaying fewer layers. Using layers of keratocytes to measure thickness bypasses the concerns associated with thickness alteration due to hydration changes induced by the tissue staining process. This indirect measurement may also be a more accurate representation of stromal thickness, as previous research has suggested that the reduction of keratocytes observed in keratoconus may be due to the fact that the stroma is thinner, and thus has less space for keratocytes (Takahashi et al., 1990).

Therefore, in the context of this previous hypothesis, the observed reduction in layers of keratocytes in Shroom3-/- corneas suggests that the stroma may indeed be thinner in the corneas lacking Shroom3. Non-histology based assays that can measure corneal

45 thickness, such as OCT designed for small animals, could be employed to more directly answer this question.

The cornea in keratoconus also has a reduced keratocyte density (Ku et al., 2008;

Hollingsworth et al., 2005). This is also similar to the observed changes in Shroom3-/- corneas, as the total number of keratocytes in the central cornea was significantly reduced in the corneas lacking Shroom3. Because keratocytes are responsible for secreting ECM, it is possible that a reduction in keratocytes leads to a thinner stroma in adults. The stromal thickness in Shroom3 deficient adult corneas could be expected to be reduced due to fewer keratocytes and reduced collagen I expression. This could not directly be tested because Shroom3-/- mice do not survive birth due to severe neural tube defects. A future experiment that would address this issue would be the use of conditional genetics to remove Shroom3 specifically from stromal tissue. Using a Shroom3 floxed allele in combination with a stromal specific cre-expressing line would have the potential to bypass embryonic lethality and permit the analysis of adult Shroom3-deficient corneas.

Fibril Diameter Analysis

The average diameter of collagen fibrils is reduced in the stroma of keratoconic corneas and the quantitative distribution of the diameters is altered with fibril sizes skewing smaller (Akhtar et al., 2008). Thus, fibril diameter in Shroom3+/- and Shroom3-/- corneas were compared. While there was an altered distribution observed, fibrils from

Shroom3-/- corneas had a larger average and the population was shifted toward larger diameters. It is known that there is a slight increase in fibril diameter in the posterior stroma compared to the anterior stroma in mouse corneas (Chakravarti et al., 2006). The 46 present analysis of fibril diameter looked at sections of the cornea from the anterior stroma. Thus, it would be beneficial to isolate and compare specific regions of the cornea to ascertain if the diameter changes observed are purely due to alterations to Shroom3, or if they are partially due to regional differences. Because this analysis used embryonic tissues instead of adult tissue, the alterations to collagen fibril diameter observed in these experiments may not reflect what occurs in mature corneas. The use of conditional genetics to bypass the embryonic lethality of the Shroom3-/- mutation would be beneficial for this analysis as well.

Shroom3 and Collagen Expression

Shroom3 increases Col1a1 expression in kidney epithelial cells, and the results presented here suggest that it regulates collagen expression in the cornea as well (Menon et al., 2015). There are also several other collagens found in the cornea including type II,

III, IV, V, VI, VII, and VIII, so the expression of these other collagens was analyzed as well (Robert et al., 2001). Of all the collagens analyzed, a difference was noted with type

I and IV. When exogenous Shroom3 expression was introduced in corneal SIRC cells an increase in Col1a1 expression was observed when compared with control SIRC cells, while there was no difference in Col4a1 expression. Because a reduction in collagen type

I expression in the posterior stroma of corneas lacking Shroom3 was also observed, it strongly supports the hypothesis that Shroom3 regulates collagen expression in the cornea, particularly in the posterior region where Shroom3 is strongly expressed.

While SIRC cells were used to model stromal keratocytes it is worth noting that these cells are best classified as “corneal cells” rather than keratocytes. Even though they 47 are structurally similar to fibroblasts (Niederkorn et al., 1990), they often exhibit behavior more reminiscent of corneal epithelial cells, and have been used to model corneal epithelium in other studies (Reichl, 2008; Reichl and Becker, 2008). This could lead to different interpretations of the results. For example, Col4a1 expression was increased in SIRC cells exogenously expressing mutant variants of Shroom3 however,

Col4a1 is not usually present in the stroma (Ishizaki et al., 1997). The increased Col4a1 expression is only unusual if the SIRC cells are viewed as fibroblasts, whereas this expression would be considered normal if the SIRC cells are viewed as epithelial cells.

However, differential collagen expression was observed in these cells depending on whether they contained mutations in Shroom3 or not, suggesting that Shroom3 does indeed affect collagen expression in the cornea regardless of if SIRC cells are more keratocyte or epithelium-like. This does, however, mean these experiments cannot definitively determine if Shroom3 regulates collagen expression in the stroma or in the corneal epithelium due to the nature of the SIRC cells used. It would be useful to repeat the collagen expression analysis of Shroom3+/- and Shroom3-/- corneas with Col4a1 to see if the results were similar to the RT-PCR results. This could help determine if the changes to Col4a1 expression are occurring in corneal epithelial cells or the stroma.

While the mechanism by which Shroom3 is regulating collagen is unknown, the data presented here suggest that both the PDZ and Rho-kinase binding domain are important. In RPE (retinal pigment epithelial) cells, collagen type I synthesis was reduced when the Rho-kinase pathway was inhibited (Itoh et al., 2007). Another study has shown that Col1a1 mRNA expression was reduced in fibroblasts when ROCK was inhibited

(Akhmetshina et al., 2008). Given that Shroom3 has been shown to function through use of the Rho-kinase pathway (Hildebrand, 2005; Plageman et al., 2011a; Nishimura and

Takeichi, 2008) and that Rho-kinase regulates collagen expression in RPE cells and fibroblasts, it is possible that Shroom3 may also use the Rho-kinase pathway to regulate collagen expression in corneal epithelial cells and stromal keratocytes.

The PDZ domain is a conserved domain found in the SHROOM3 gene of multiple species and other Shroom family proteins. To date, the function of this domain has not been investigated. The data presented here show that the keratoconus-associated mutation

(G59V), which is located within the PDZ domain, can disrupt the ability of Shroom3 to positively regulate Col1a1. Interestingly, Col4a1expression was increased in the presence of this mutant protein compared to the cells expressing wild-type Shroom3. This suggests that Shroom3 may also inhibit Col4a1 expression in the cornea and that the G59 amino acid within the PDZ domain is essential for this function. It is possible that the PDZ domain may bind to a protein that regulates collagen expression. To determine what protein(s) the PDZ domain may interact with, immunoprecipitation with a Shroom3 antibody followed by mass spectrometry to identify proteins associated with the domain could be performed.

Shroom3 is also a part of the Wnt/β-catenin pathway, in which it is regulated by

TGF-β1 (Menon et al., 2015). TGF-β plays a vital role in regulating the stromal ECM and maintaining its proper architecture (Zhou et al., 2017). It has been shown that introducing

TGF-β increases both protein and mRNA expression of Shroom3 (Menon et al., 2015).

TGF-β also stimulates collagen expression, specifically Col1a1 expression (Menon et al.,

2015; Humphrey et al., 2014). In the cornea, TGF-β can stimulate keratocytes to secrete collagen in the stroma (Funderburgh, 2010). Upon exposure to TGF-β, keratocytes not only secrete ECM products but also express alpha-smooth muscle actin as contractile myofibroblasts (Funderburgh, 2010). This opens the possibility of Shroom3 regulating collagen through either the ASD2 domain or a novel mechanism, including a potential interaction between keratocytes and the PDZ domain.

Because the G59V equivalent mutation of the PDZ domain has been observed in a patient with keratoconus (Tariq et al., 2011) and that this mutation disrupts the ability of

Shroom3 to regulate collagen it is tempting to speculate that this mutation is causative.

Consistent with this hypothesis, are the data that indicate that a reduction in collagen type

I expression has been observed in patients with keratoconus (Peters et al., 1993) and the first corneal changes observed in keratoconus occur posteriorly in the region where

Shroom3 is expressed (Amsler, 1961; Belin and Khachikian, 2009; Naderan et al., 2017;

Awad et al., 2017). To test whether this mutation is causative, a homozygous G59V mutation could be introduced into mice using CRISPR gene editing. The stromal tissue thickness could be directly observed and compared to the keratoconic phenotype. This could help determine if the G59V mutation is directly associated with stromal thinning, as well as help determine the function of the PDZ domain in which the G59V mutation occurs. If a homozygous G59V mouse model did exhibit a thinned or altered corneal stroma, it would suggest the PDZ is involved in stromal collagen regulation and strengthen the association between Shroom3 and keratoconus.

Chapter 5: Conclusion

Previous research has shown that Shroom3 is responsible for apical constriction of epithelial cells, but is also capable of regulating collagen expression. However, the potential role of Shroom3 in regulating corneal collagen had not yet been explored. Even though the basics of corneal development are known, many of the specific mechanisms that regulate collagen expression are not well understood. Additionally, genetic analysis has revealed a potential association between keratoconus, a condition that disrupts collagen, and a mutation to Shroom3. Given this information, the possibility that

Shroom3 may be a novel player in regulating collagen in the corneal stroma was explored. Therefore, experiments were created to investigate if Shroom3’s known function of apical constriction also occurs in the cornea and to test whether Shroom3 affects collagen structure and function and the cornea. This research specifically looked at how Shroom3 affects stromal collagen in the cornea in several different areas including overall collagen expression, fibril size, stromal thickness, keratocyte number, anterior and posterior stromal differences and Shroom3 localization.

The results showed that Shroom3 is found in the cornea, it affects apical constriction in corneal epithelial cells, and that it does appear to affect collagen expression as well. When stromal thickness was directly measured, there was not difference between corneas expressing Shroom3 and those lacking the protein, however there was a reduced number of layers of keratocytes present in the corneas lacking

Shroom3 which was an indirect measure of thickness. Analysis of corneal tissues and cells with a mutation to Shroom3 revealed a reduced number of keratocytes, a difference 51 in Col1 expression between the anterior and posterior cornea, and an increase in collagen fibril diameter were observed. There was also increased Col1 expression in Shroom3 enhanced cells, and a reduction in Col1 expression but increase in Col4 expression in

Shroom3 mutant cells. These results support the hypothesis that Shroom3 regulates collagen in the cornea.

Although the initial results of this research are promising, these experiments were carried out on relatively small samples and would benefit from being replicated on a larger scale. Replicating these findings would help add valuable data as well as aid in future research involving Shroom3’s role in the cornea. While the results of this research show various ways that Shroom3 appears to be affecting stromal collagen expression, the exact pathway through which Shroom3 is acting is not yet known. Future research should be done to investigate the specific mechanisms by which Shroom3 is acting to present a fuller picture of the protein’s action in the structure and function of the cornea.

Ultimately, this research could lead to a better understanding of the regulation of corneal collagen and the development of the stroma. This knowledge is valuable given that numerous corneal pathologies arise from a disruption of stromal collagen, such as keratoconus.

References

Akhmetshina A., Dees C., Pileckyte M., et al. (2008). Rho-associated kinases are crucial for myofibroblast differentiation and production of extracellular matrix in scleroderma fibroblasts. Arthritis Rheum. 58, 2553-64. Akhtar S., Bron A.J., Salvi S.M., Hawksworth N.R., Tuft S.J., Meek K.M. (2008). Ultrastructural analysis of collagen fibrils and proteoglycans in keratoconus. Acta Ophthalmol. 86, 764-72. Aldave A.J., Yellore V.S., Salem A.K., et al. (2006). No VSX1 gene mutations associated with keratoconus. Invest Ophthalmol Vis Sci. 47, 2820-2. Amsler M. (1961). The "forme fruste" of keratoconus. Wien Klin Wochenschr. 73, 842-3. Asbell P. and Brocks D. (2010). Cornea Overview. In Encyclopedia of the Eye (ed. Dartt D.A., Besharse J.C., Dana R.) pp. 522-531. San Diego, CA: Elsevier. Awad E.A., Abou samra W.A., Torky M.A., El-kannishy A.M. (2017). Objective and subjective diagnostic parameters in the fellow eye of unilateral keratoconus. BMC Ophthalmol. 17, 186. Belin M.W., Khachikian S.S. (2009). An introduction to understanding elevation-based topography: how elevation data are displayed - a review. Clin Experiment Ophthalmol. 37, 14-29. Benedek G.B. (1971). Theory of transparency of the eye. Appl Opt. 10, 459-73. Blochberger T.C., Vergnes J.P., Hempel J., Hassell J.R. (1992). cDNA to chick lumican (corneal keratan sulfate proteoglycan) reveals homology to the small interstitial proteoglycan gene family and expression in muscle and intestine. J Biol Chem. 267, 347- 52. Boote C., Hayes S., Jones S., et al. (2008). Collagen organization in the chicken cornea and structural alterations in the retinopathy, globe enlarged (rge) phenotype--an X-ray diffraction study. J Struct Biol. 161, 1-8. Brugués A., Anon E., Conte V., et al. (2014). Forces driving epithelial wound healing. Nat Phys. 10, 683-690. Bykhovskaya Y., Li X., Epifantseva I., et al. (2012). Variation in the lysyl oxidase (LOX) gene is associated with keratoconus in family-based and case-control studies. Invest Ophthalmol Vis Sci. 53, 4152-7. Bykhovskaya Y., Margines B., Rabinowitz Y.S. (2016). Genetics in Keratoconus: where are we?. Eye Vis (Lond). 3, 16. Chakravarti S. (2006). Focus on molecules: keratocan (KERA). Exp Eye Res. 82, 183-4. Chakravarti S., Zhang G., Chervoneva I., Roberts L., Birk D.E. (2006). Collagen fibril assembly during postnatal development and dysfunctional regulation in the lumican-deficient murine cornea. Dev Dyn. 235, 2493-506. Chen S., Mienaltowski M.J., Birk D.E. (2015). Regulation of corneal stroma extracellular matrix assembly. Exp Eye Res. 133, 69-80. Chomczynski P, Mackey K. (1995) Short technical report. Modification of the Trizol reagent procedure for isolation of RNA from Polysaccharide-and proteoglycan- rich sources. Biotechniques 19, 942-5. 53

Cintron C., Covington H., Kublin C.L. (1983). Morphogenesis of rabbit corneal stroma. Invest Ophthalmol Vis Sci. 24, 543-56. Cornuet P.K., Blochberger T.C., Hassell J.R. (1994). Molecular polymorphism of lumican during corneal development. Invest Ophthalmol Vis Sci. 35, 870-7. Corpuz L.M., Funderburgh J.L., Funderburgh M.L., Bottomley G.S., Prakash S., Conrad G.W. (1996). Molecular cloning and tissue distribution of keratocan. Bovine corneal keratan sulfate proteoglycan 37A. J Biol Chem. 271, 9759-63. Coulombre A.J., Coulombre J.L. (1958). Corneal development. I. Corneal transparency. J Cell Comp Physiol. 51, 1-11. Courage C., Jackson C.B., Hahn D., et al. (2017). SDHA mutation with dominant transmission results in complex II deficiency with ocular, cardiac, and neurologic involvement. Am J Med Genet A. 173, 225-230. Dawes-Hoang R.E., Parmar K.M., Christiansen A.E., Phelps C.B., Brand A.H., Wieschaus E.F. (2005). Folded gastrulation, cell shape change and the control of myosin localization. Development. 132, 4165-78. Dietz M.L., Bernaciak T.M., Vendetti F., Kielec J.M., Hildebrand J.D. (2006). Differential actin-dependent localization modulates the evolutionarily conserved activity of Shroom family proteins. J Biol Chem. 281, 20542-54. Funderburgh J.L. (2010). The Corneal Stroma. In Encyclopedia of the Eye (ed. Dartt D.A., Besharse J.C., Dana R.) pp. 515-521. San Diego, CA: Elsevier. Funderburgh J.L., Caterson B., Conrad G.W. (1986). Keratan sulfate proteoglycan during embryonic development of the chicken cornea. Dev Biol. 116, 267-77. Funderburgh J.L., Corpuz L.M., Roth M.R., Funderburgh M.L., Tasheva E.S., Conrad G.W. (1997). Mimecan, the 25-kDa corneal keratan sulfate proteoglycan, is a product of the gene producing osteoglycin. J Biol Chem. 272, 28089-95. Gage P.J., Rhoades W., Prucka S.K., Hjalt T. (2005). Fate maps of neural crest and mesoderm in the mammalian eye. Invest Ophthalmol Vis Sci. 46, 4200-8. Godefrooij D.A., De wit G.A., Uiterwaal C.S., Imhof S.M., Wisse R.P. (2017). Age- specific Incidence and Prevalence of Keratoconus: A Nationwide Registration Study. Am J Ophthalmol. 175, 169-172. Gonzalez V., McDonnell P.J. (1992). Computer-assisted corneal topography in parents of patients with keratoconus. Arch Ophthalmol. 110, 1413-4. Haigo S.L., Hildebrand J.D., Harland, R.M., Wallingford, J.B. (2003). Shroom induces apical constriction and is required for hingepoint formation during neural tube closure. Curr Biol. 13, 2125-37. Hammerstein W. (1974). Genetics of conical cornea (author's transl). Albrecht Von Graefes Arch Klin Exp Ophthalmol. 190, 293-308. Haque S., Simpson T., Jones L. (2006). Corneal and epithelial thickness in keratoconus: a comparison of ultrasonic pachymetry, Orbscan II, and optical coherence tomography. J Refract Surg. 22, 486-93. Hassell J.R., Birk D.E. (2010). The molecular basis of corneal transparency. Exp Eye Res. 91, 326-35.

Hayashida Y., Akama T.O., Beecher N., et al. (2006). Matrix morphogenesis in cornea is mediated by the modification of keratan sulfate by GlcNAc 6-O- sulfotransferase. Proc Natl Acad Sci USA. 103, 13333-8. Hildebrand J.D. (2005). Shroom regulates epithelial cell shape via the apical positioning of an actomyosin network. J Cell Sci. 118, 5191-203. Hildebrand J.D., Soriano P. (1999). Shroom, a PDZ domain-containing actin-binding protein, is required for neural tube morphogenesis in mice. Cell. 99, 485-97. Hollingsworth J.G., Efron N., Tullo A.B. (2005). In vivo corneal confocal microscopy in keratoconus. Ophthalmic Physiol Opt. 25, 254-60. http://www.ncbi.nlm.nih.gov/tools/primer-blast/ Humphrey J.D., Dufresne E.R., Schwartz M.A. (2014). Mechanotransduction and extracellular matrix homeostasis. Nature reviews. Molecular cell biology. 15, 802-12. Ishizaki M., Shimoda M., Wakamatsu K., et al. (1997). Stromal fibroblasts are associated with collagen IV in scar tissues of alkali-burned and lacerated corneas. Curr Eye Res. 16, 339-48. Itoh Y., Kimoto K., Imaizumi M., Nakatsuka K. (2007). Inhibition of RhoA/Rho- kinase pathway suppresses the expression of type I collagen induced by TGF- beta2 in human retinal pigment epithelial cells. Exp Eye Res. 84, :464-72. Jester J.V. (2008). Corneal crystallins and the development of cellular transparency. Semin Cell Dev Biol. 19, 82-93. Jester J.V., Moller-pedersen T., Huang J., et al. (1999). The cellular basis of corneal transparency: evidence for 'corneal crystallins'. J Cell Sci. 112, 613-22. Kao W.W., Funderburgh J.L., Xia Y., Liu C.Y., Conrad G.W. (2006). Focus on molecules: lumican. Exp Eye Res. 82, 3-4. Karolak J.A., Kulinska K., Nowak D.M., et al. (2011). Sequence variants in COL4A1 and COL4A2 genes in Ecuadorian families with keratoconus. Mol Vis. 17, 827- 43. Kenney C.M., Brown D.J. (2003). The cascade hypothesis of keratoconus. Cont Lens Anterior Eye. 26, 139-46. Khaled M.L., Helwa I., Drewry M., Seremwe M., Estes A., Liu Y. (2017). Molecular and Histopathological Changes Associated with Keratoconus. Biomed Res Int. 2017:7803029. Khalili H., Sull A., Sarin S., et al. (2016). Developmental Origins for Kidney Disease Due to Shroom3 Deficiency. J Am Soc Nephrol. 27, 2965-2973. Ku J.Y., Niederer R.L., Patel D.V., Sherwin T., Mcghee C.N. (2008). Laser scanning in vivo confocal analysis of keratocyte density in keratoconus. Ophthalmology. 115, 845-50. Kymes S.M., Walline J.J., Zadnik K., Gordon M.O. (2004). Quality of life in keratoconus. Am J Ophthalmol. 138, 527-35. Lang R.A., Herman K., Reynolds A.B., Hildebrand J.D., Plageman T.F. (2014). p120-catenin-dependent junctional recruitment of Shroom3 is required for apical constriction during lens pit morphogenesis. Development. 141, 3177-87.

Lecuit T., Lenne P.F. (2007). Cell surface mechanics and the control of cell shape, tissue patterns and morphogenesis. Nat Rev Mol Cell Biol. 8, 633-44. Lee C., Le M.P., Wallingford J.B. (2009). The shroom family proteins play broad roles in the morphogenesis of thickened epithelial sheets. Dev Dyn. 238, 1480-91. Lee C., Scherr H.M., Wallingford J.B. (2007). Shroom family proteins regulate gamma-tubulin distribution and microtubule architecture during epithelial cell shape change. Development. 134, 1431-41. Li X., Rabinowitz Y.S., Tang Y.G., et al. (2006). Two-stage genome-wide linkage scan in keratoconus sib pair families. Invest Ophthalmol Vis Sci. 47, 3791-5. Li W., Vergnes J.P., Cornuet P.K., Hassell J.R. (1992). cDNA clone to chick corneal chondroitin/dermatan sulfate proteoglycan reveals identity to decorin. Arch Biochem Biophys. 296, 190-7. Loebel D.A., Plageman T.F., Tang T.L., Jones V.J., Muccioli M., Tam P.P. (2016). Thyroid bud morphogenesis requires CDC42- and SHROOM3-dependent apical constriction. Biol Open. 5, 130-9. Lu Y., Vitart V., Burdon K.P., et al. (2013). Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. Nat Genet. 45, 155-63. Mas Tur V., MacGregor C., Jayaswal R., O'brart D., Maycock N. (2017). A review of keratoconus: Diagnosis, pathophysiology, and genetics. Surv Ophthalmol. 62, 770-783. Maurice D.M. (1957). The structure and transparency of the cornea. J Physiol (Lond). 136, 263-86. Maurice D.M. (1970). The transparency of the corneal stroma. Vision Res. 10, 107-8. McMonnies C.W. (2015). Inflammation and keratoconus. Optometry and vision science: official publication of the American Academy of Optometry. 92, 35-41. Meek K.M., Knupp C. (2015). Corneal structure and transparency. Prog Retin Eye Res. 49, 1-16. Menon M.C., Chuang P.Y., Li Z., et al. (2015). Intronic locus determines SHROOM3 expression and potentiates renal allograft fibrosis. J Clin Invest. 125, 208-21 Midura R.J., Hascall V.C., Maccallum D.K., et al. (1990). Proteoglycan biosynthesis by human corneas from patients with types 1 and 2 macular corneal dystrophy. J Biol Chem. 265, 15947-55. Musselmann K., Hassell J.R. (2006). Focus on molecules: CHST6 (carbohydrate sulfotransferase 6; corneal N-acetylglucosamine-6-sulfotransferase). Exp Eye Res. 83, 707-8. Naderan M., Jahanrad A., Farjadnia M. (2017). Ocular, corneal, and internal aberrations in eyes with keratoconus, forme fruste keratoconus, and healthy eyes. Int Ophthalmol. Niederkorn J.Y., Meyer D.R., Ubelaker J.E., Martin J.H. (1990). Ultrastructural and immunohistological characterization of the SIRC corneal cell line. In Vitro Cell Dev Biol. 26, 923-30.

Nishimura T., Takeichi M. (2008). Shroom3-mediated recruitment of Rho kinases to the apical cell junctions regulates epithelial and neuroepithelial planar remodeling. Development. 135, 1493-502. Peters D.P., Harrison D.A., Brandt C.R. (1993). Heterogeneity of type I collagen expression in human corneal keratoconus fibroblasts. Ophthalmic Res. 25, 273-9. Piatigorsky J. (1998). Multifunctional lens crystallins and corneal enzymes. More than meets the eye. Ann N Y Acad Sci. 842, 7-15. Piatigorsky J. (2000). Review: A case for corneal crystallins. J Ocul Pharmacol Ther. 16, 73- 80 Plageman T.F., Chauhan B.K., Yang C., et al. (2011). A Trio-RhoA-Shroom3 pathway is required for apical constriction and epithelial invagination. Development. 138, 5177-88. Plageman T.F., Chung M.I., Lou M., et al. (2010). Pax6-dependent Shroom3 expression regulates apical constriction during lens placode invagination. Development. 137, 405-15. Plageman T.F., Zacharias A.L., Gage P.J., Lang R.A. (2011). Shroom3 and a Pitx2-N- cadherin pathway function cooperatively to generate asymmetric cell shape changes during gut morphogenesis. Dev Biol. 357, 227-34. Rabinowitz Y.S. (1998). Keratoconus. Survey of ophthalmology. 42, 297-319. Rada J.A., Cornuet P.K., Hassell J.R. (1993). Regulation of corneal collagen fibrillogenesis in vitro by corneal proteoglycan (lumican and decorin) core proteins. Exp Eye Res. 56, 635-48. Rada J.A., Fini M.E., Hassell J.R. (1996). Regionalized growth patterns of young chicken corneas. Invest Ophthalmol Vis Sci. 37, 2060-7. Reichl S. (2008). Cell culture models of the human cornea - a comparative evaluation of their usefulness to determine ocular drug absorption in-vitro. J Pharm Pharmacol. 60, 299-307. Reichl S., Becker U. (2008). Cell culture models of the corneal epithelium and reconstructed cornea equivalents for in vitro drug absorption studies. In Drug absorption studies (ed. C. Ehrhardt, K.J. Kim), pp. 283–306. New York: Springer US. Robert L., Legeais J.M., Robert A.M., Renard G. (2001). Corneal collagens. Pathologie-biologie. 49, 353-63. Romero-Jiménez M., Santodomingo-rubido J., Wolffsohn J.S. (2010). Keratoconus: a review. Cont Lens Anterior Eye. 33, 157-66. SIRC [Statens Seruminstitut Rabbit Cornea] (ATCC® CCL60™) Product sheet Takahashi A., Nakayasu K., Okisaka S., Kanai A. (1990). Quantitative analysis of collagen fiber in keratoconus. Nippon Ganka Gakkai Zasshi. 94, 1068-73. Tariq M., Belmont J.W., Lalani S., Smolarek T., Ware S.M. (2011). SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing. Genome biology. 12, R91. Toole B.P., Trelstad R.L. (1971). Hyaluronate production and removal during corneal development in the chick. Dev Biol. 26, 28-35.

Ye F., Zhang M. (2013). Structures and target recognition modes of PDZ domains: recurring themes and emerging pictures. Biochem J. 455, 1-14. Young R.D., Gealy E.C., Liles M., Caterson B., Ralphs J.R., Quantock A.J. (2007). Keratan sulfate glycosaminoglycan and the association with collagen fibrils in rudimentary lamellae in the developing avian cornea. Invest Ophthalmol Vis Sci. 48, 3083-8. Zhou H.Y., Cao Y., Wu J., Zhang W.S. (2017). Role of corneal collagen fibrils in corneal disorders and related pathological conditions. Int J Ophthalmol. 10, 803- 811. Zhou L., Sawaguchi S., Twining S.S., Sugar J., Feder R.S., Yue B.Y. (1998). Expression of degradative enzymes and protease inhibitors in corneas with keratoconus. Invest Ophthalmol Vis Sci. 39, 1117-24.