Supplementary Information For

Supplementary Information for

A Genetic Analysis of the Gibraltar Neandertals

Bokelmann et al.

Lukas Bokelmann, Chris B. Stringer. E-mail: @[email protected], [email protected]

This PDF ﬁle includes: Supplementary text Figs. S1 to S9 Tables S1 to S11 References for SI reference citations

Bokelmannwww.pnas.org/cgi/doi/10.1073/pnas.1903984116 et al. 1 of 22 Supporting Information Text 1. Uracil-selective library preparation.

1.1 ‘A-tailed’ method. For uracil-selective library preparation with the ‘A-tailed’ method (Figure S2), between 1 and 3µl of DNA extract were used as input into a 45.6µl reaction containing 8µl T4 RNA ligase buffer (10x,New England Biolabs), 2µl Tween-20 (2% v/v) and 1µl FastAP (1U/ µl, Thermo Fisher Scientific). The dephosphorylation reaction was incubated for 10min at 37°C, followed by 2min at 95°C. Two 40µl oligonucleotide hybridization mixes (one with UN7 and UN13 for the 5’-end ligation, the other with TL150 and TL148 for the 3’-end ligation; see Table S7 for oligonucleotide sequences), each containing 4µl T4 RNA ligase buffer (10x, Thermo Fisher Scientific), 8µl splinter oligonucleotide (100 µM, TL148 or UN13), 4µl adapter oligonucleotide (100 µM, TL150 or UN7) and 24µl water, were incubated for 2min at 95°C and then cooled down to 15°C at 0.5°C/s to anneal the complementary adapter/splinter oligonucleotides. To the dephosphorylation reaction, additional reagents and water were then added to obtain a ligation reaction with a final volume of 80µl. These reagents were 32µl PEG 8000 (50% w/v), 0.4µl ATP (100mM, Thermo Fisher Scientific), 1µl annealed adapter-splinter mix (TL150/Tl148 (10/20 µM), see Table S7 for oligonucleotide sequences) and 1µl T4 DNA ligase (30U/µl, Thermo Fisher Scientific). The reaction was incubated for 1h at 37°C followed by inactivation of the ligase at 95°C for 1min and rapid cooling of the reaction mix on ice. 20µl of streptavidin-coated magnetic beads (Dynabeads MyOne Streptavidine C1, Thermo Fisher Scientific) were transferred into 1.5ml Eppendorf tubes and washed according to the manufacturer’s instructions before they were resuspended in 250µl 0.1xBWT+SDS buffer (100mM NaCl, 10mM Tris-HCl (pH 8), 1mM EDTA (pH 8), 0.05% v/v Tween-20, 0.5% v/v sodium dodecyl sulfate). After adding the ligation reaction, the bead suspension was rotated for 20min at room temperature, the beads pelleted using a magnetic rack and the supernatant discarded. The beads were then washed by resuspension in 200µl 0.1xBWT+SDS buffer, pelleted on a magnetic rack and the buffer discarded. An additional bead wash was performed in 100µl stringency wash buffer (0.1x saline sodium citrate buffer (pH 7), 0.1% v/v sodium dodecyl sulfate (SDS)), this time incubating the bead suspension for 3min at 45°C before pelleting the beads and discarding the supernatant. A final bead wash was performed with 200µl 0.1xBWT buffer (100mM NaCl, 10mM Tris-HCl (pH 8), 1mM EDTA (pH 8), 0.05% v/v Tween-20) at room temperature. Beads were resuspended in 45.5µl of a fill-in reaction mix containing 5µl Klenow buffer (10x, Thermo Fisher Scientific), 0.4µl dNTPs (25mM each), 1.25µl Tween-20 (2% v/v) and 1µl primer CL130 (100 µM) and 5µl ATP (10 mM, Thermo Fisher Scientific). The reaction mix was incubated at 65°C for 2min and rapidly chilled on ice before 2.5µl PNK (10 U/µl, Thermo Fisher Scientific) and 2µl Klenow fragment (10 U/µl, Thermo Fisher Scientific) were added to obtain a final fill-in reaction volume of 50µl. The reaction mix was incubated for 5min at 25°C and 25min at 35°C. Beads were pelleted using a magnetic rack and washed five times exactly as described above. For A-tailing, the washed beads were resuspended in a 50µl reaction mix containing 5µl Klenow buffer (10x, Thermo Fisher Scientific), 1.25µl Tween-20 (2% v/v), 2µl ATP (10 mM) and 2µl Klenow fragment exonuclease minus (5 U/µl, Thermo Fisher Scientific). After incubation for 30min at 35°C, beads were pelleted and washed three times as described above. The beads were then resuspended in a 100µl reaction mix containing 10µl T4 DNA ligase buffer (10x, Thermo Fisher Scientific), 10µl PEG-4000 (50% w/v), 1.25µl Tween-20 (2% v/v), 2µl annealed oligonucleotide mix UN7/UN13 (100 µM each, see Table S7 for oligonucleotide sequences) and 2µl T4 DNA ligase (5 U/µl, Thermo Fisher Scientific) and incubated for 1h at 22°C. Beads were again washed three times as described above. To remove incomplete ligation products that may have been created, for example due to molecules that escaped 5’ phosphorylation, as well as ancient molecules containing abasic sites or other lesions susceptible to cleavage by E. coli Endonuclease IV, the beads were resuspended in a 50µl reaction mix containing 5µl NEBuffer 3 (10x, New England Biolabs), 1.25µl Tween-20 (2% v/v), 0.5µl dNTPs (25mM each), 1µl E. coli Endonuclease IV (10 U/µl, New England Biolabs) and 2µl Bst 2.0 DNA polymerase (8 U/µl, New England Biolabs) and incubated for 15min at 37°C. Beads were pelleted using a magnetic rack, the supernatant discarded, and the beads washed with 200µl 0.1xBWT+SDS buffer and 200µl of 0.1xBWT buffer. For the final reaction, the beads were then suspended in a 50µl of reaction mix containing 5µl AccuPrime Pfx reaction buffer (10x, Thermo Fisher Scientific), an additional 1µl MgCl2 (50mM), 2µl E. coli Endonuclease IV (10 U/µl, New England Biolabs), 2µl Bst 2.0 DNA polymerase (8 U/µl, New England Biolabs) and 0.3µl uracil DNA N-glycosylase (UDG, 5 U/µl, New England Biolabs). The reaction mix was incubated for 1h at 37°C, the beads pelleted and the supernatant removed, which represented the uracil-enriched library fraction. One µl of the library supernatant was used to produce a 1:50 dilution of the library in TT buffer (10mM Tris-HCl (pH 8), 0.05% v/v Tween-20), which was used to determine library complexity by qPCR.

1.2 ’Simple’ method. For uracil-selective library preparation with the ’simple’ method (Figure S3), between 1 and 10µl of DNA extract were used as input into a 18µl reaction containing 2µl T4 DNA ligase buffer (10x, Thermo Fisher Scientific), which includes ATP. The reaction was heated to 95°C for 2min before rapid chilling on ice. After addition of 1µl T4 PNK (10 U/µl, Thermo Fisher Scientific), 5’ phosphorylation was performed for 30min at 37°C. Two 40µl hybridization mixes (one with TL166 and TL164 for the 5’-end ligation, the other with TL150 and TL159 for the 3’-end ligation; see Table S7 for oligonucleotide sequences), each containing 4µl T4 RNA ligase buffer (10x, Thermo Fisher Scientific), 8µl splinter oligonucleotide (100 µM, TL164 or TL159), 4µl adapter oligonucleotide (100 µM, TL166 or TL150), 2µl E. coli Endonuclease III (10 U/µl, New England Biolabs) and 2µl antarctic thermolabile UDG (1 U/µl, New England Biolabs), were incubated for 15min at 37°C, followed by 2min at 95°C to inactivate enzymes and a ramp to 15°C at 0.5°C/s to anneal the complementary adapter/splinter strands. UDG was used for the purpose of removing undesired uracils from the oligonucleotides. 21µl of ligation mix containing 1µl of annealed adapter-splinter oligonucleotide mixture (10/20µM) for the 5’ and 3’ end, respectively, 2µl T4 DNA ligase buffer (10x, Thermo Fisher Scientific) and 16µl PEG-8000 (50% w/v) was added to the 18µl phosphorylation reaction and mixed

2 of 22 Bokelmann et al. thoroughly. After addition of 1µl T4 DNA ligase (30 U/µl, Thermo Fisher Scientific) the ligation reaction was incubated for 2h at 37°C, followed by inactivation of the ligase for 2min at 90°C. 20µl of streptavidin-coated magnetic beads (Dynabeads MyOne Streptavidine C1, Thermo Fisher Scientific) were transferred into 1.5ml Eppendorf tubes, washed according to the manufacturer’s instructions, and resuspended in 250µl 0.1xBWT+SDS buffer. After addition of the ligation reaction mix, the bead suspension was rotated for 20min at room temperature, the beads pelleted, and the supernatant discarded. The beads were then washed three times exactly as described for the ‘A-tailed’ method above. A 49µl reaction mix containing 5µl Klenow buffer (10x, Thermo Fisher Scientific) 0.4µl dNTPs (25mM each), 1.25µl Tween-20 (1% v/v) and 1µl CL9 primer (100µM) were added to the beads. After heating to 65°C for 2min and cooling to room temperature, 1µl of Bst 2.0 DNA polymerase (8 U/µl, New England Biolabs) was added and the reaction incubated for 20min at 37°C. The beads were pelleted using a magnetic rack and the supernatant discarded. The beads were then washed once with 200µl 0.1xBWT buffer. 50µl of a reaction mix containing 5µl AccuPrime Pfx reaction buffer (10x, Thermo Fisher Scientific), 0.5µl E. coli Endonuclease IV (10 U/µl, New England Biolabs), 0.3µl UDG (5 U/µl, New England Biolabs) and 1µl Bst 2.0 DNA polymerase (8 U/µl, New England Biolabs) were added to the washed beads. The reaction was incubated for 20min at 37°C, the beads pelleted and the supernatant removed. One µl of the library supernatant was used to produce a 1:50 dilution of the library in TT buffer (10mM Tris-HCl (pH 8), 0.05% v/v Tween-20), which was used to determine library complexity by qPCR.

2. Library quantification, amplification and sequencing. The number of unique molecules in each library was determined by quantitative PCR as described elsewhere (1). Regular single-stranded libraries were amplified using AccuPrime Pfx DNA polymerase (Thermo Fisher Scientific) (2) and barcoded with two sample-specific indices (3). Uracil-selected libraries were amplified by adding a 50µl PCR reaction mix containing 5µl of each indexing primer (10 µM), 5µl AccuPrime Pfx reaction buffer (10x, Thermo Fisher Scientific) and 1µl AccuPrime Pfx DNA polymerase (2.5 U/µl, Thermo Fisher Scientific) to each library. Cycling included an initial denaturation for 2min at 95°C, followed by 34 cycles of denaturation at 95°C for 20s, annealing at 60°C for 30s and elongation at 68°C for 1min, and a final elongation at 68°C for 5min. Following their purification with SPRI beads (4), libraries belonging to the same specimen were pooled and 500ng of the pooled DNA were used as template in a 100µl one-cycle PCR reaction containing 20µl Herculase II fusion buffer (5x, Agilent), 1µl dNTPs (25mM each), 4µl of primers IS5 and IS6 (5) (both 10 µM) and one µl of Herculase II Fusion DNA polymerase (2 U/µl, Agilent Technologies). The cycling profile consisted of an initial denaturation step at 95°C for 2min and 30s, an annealing step at 60°C for 30s and extension step at 72°C for 5min and 30s. The reaction was purified using the MinElute PCR purification kit (Qiagen) according to the manufacturer’s recommendations, and the DNA eluted in 20µl TE buffer (10mM Tris-HCl (pH 8), 1mM EDTA (pH 8)). After DNA quantification using a DNA 1000 chip on a Bioanalyzer 2100 (Agilent Technologies), library pools were sequenced on an Illumina HiSeq 2500 or an Illumina MiSeq using a recipe for 76bp paired-end sequencing with two 7bp index reads (3). For A-tailed U selected libraries primer IS14 was used for the first sequence read to accommodate differences in adapter design, whereas all other libraries were sequenced using CL72 (see Table S7 for oligonucleotide sequences) as described for single-stranded libraries (6). After initial shallow shotgun sequencing, the Devil’s Tower library pool was size selected and amplified for two rounds to enrich for fragments between 120 and 500bp (including the adapter sequences) to deplete primer dimers that had formed during amplification and library molecules with very short inserts. In addition, one Forbes’ Quarry library (D1243, see Table S3) was size selected for molecules between 160 and 230bp (see Figure S8 for size distribution) to increase the proportion of informative sequences (i.e. sequences with an insert size longer than 30bp). For this purpose, 500ng of amplified library were used as template in a one-cycle PCR and processed as described above. For the Forbes’ Quarry library D1243, 5µl of one-cycle PCR eluate were mixed with 15µl of water and run alongside a DNA ladder (containing PCR products of lengths 159bp, 199bp and 229bp) on a 4% EX E-gel (Thermo Fisher Scientific) for 30min at the recommended settings. The gel cassette was opened and an area between 160 and 230bp excised. Gel slices were dissolved and DNA extracted using the QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer’s specifications. DNA was eluted in 20µl TE buffer. 10µl of the eluate were reamplified in a 100µl PCR reaction containing 20µl Herculase II buffer (5x, Agilent Technologies), 1µl dNTPs (25mM each), 10µl of primers IS5 and IS6 (both 10µM) and 1µl of Herculase II DNA polymerase (2U/µl) (Agilent Technologies). Initial denaturation was 95°C for 2min, followed by 6 cycles of 95°C for 30s, annealing at 60°C for 30s and extension for 1min at 72°C. Final elongation lasted 5min at 72°C. The PCR product was purified using the MinElute PCR purification kit and the DNA eluted in 20µl TE buffer. For the Devil’s Tower pool, the 20µl eluate of the one-cycle PCR were mixed with 5µl DNA loading dye (6x, Thermo Fisher Scientific) and run alongside an Ultra-Low Range DNA ladder (Thermo Fisher Scientific) on a 2% agarose gel at 120V for 50min, DNA stained with SYBR Gold (Thermo Fisher Scientific) for 15min in TBE buffer (89mM Tris-HCl (pH 8), 89mM boric acid, 2mM EDTA (pH 8.2)) and fragments between 120bp and 500bp excised from the gel. DNA was subsequently isolated following the instructions of the MinElute Gel Extraction kit (Qiagen) and eluted in 20µl TE buffer. 5µl of this eluate were used as template in a 100µl PCR reaction containing 20µl Herculase II fusion buffer (5x) (Agilent), 1µl dNTPs (25mM each), 4µl of primers IS5 and IS6 (both 10µM) and one µl of Herculase II Fusion DNA polymerase (2 U/µl, Agilent). Cycling started with an initial denaturation step at 95°C for 2min, followed by 5 cycles of denaturation at 95°C for 30s, annealing at 60°C for 30s and extension at 72°C for 30s. The last step was a final elongation at 72°C for 5min. The reaction was purified using MinElute silica spin columns and DNA eluted in 20µl TE buffer. 500ng of this size selected library pool were subjected to a one-cycle PCR as described previously and the purified 20µl PCR eluate size selected and amplified for one more round before further sequencing.

Bokelmann et al. 3 of 22 3. Comparison of the modified uracil-enrichment to the existing methods. In order to compare the performance of the novel uracil-enrichment methods described here (see sections 1.1 and 1.2 above) to the previously described ’Gansauge’ method (7) and regular single-stranded library preparation (8), DNA was extracted from three undated cave bear bones from different sites (Vindija Cave in Croatia, Denisova Cave in Russia and Gamsulzen Cave in Austria). 25mg of bone powder were used to produce 50µl of DNA extract (1) for each specimen. An extraction negative control (ENC) without bone powder was also carried along. 2µl of either extract, ENC or water as a library preparation negative control (LNC) served as input for the different library preparation methods. Each library preparation method was conducted in technical triplicates for each specimen and the negative controls. A small modification was made to the original U-selection protocol by Gansauge et al. (7) in that the ligation of the 3’ adapter (CL78) was performed as described in ref. (8) using a splinter oligo (TL159) and T4 DNA ligase instead of CircLigase. After library preparation, 1µl of each library was diluted 1:50 in TT buffer (10mM Tris-HCl (pH 8), 0.05% v/v Tween-20) and the content of unique library molecules measured by qPCR (Maxima Probe qPCR master mix (Thermo Fisher Scientific)) with primers IS7/IS8 (0.2 µM) and probe IS10 (0.2 µM) (for oligonucleotide sequences see Table S7). 25µl of each library were amplified into plateau and double-indexed with 7bp unique barcodes using indexed primers and AccuPrime Pfx DNA polymerase as described above. Amplified libraries were purified, heteroduplices removed and quantified as described above and subjected to 75bp paired-end sequencing on an Illumina MiSeq. After mapping to the 1000 largest contigs of the ursMar0 (GenBank acc. no.: GCA_000687225.1) polar bear reference genome using Burrows Wheeler Aligner (BWA) (9) with ‘ancient’ parameters (10), sequences were overlap-merged using LeeHom (11). We then counted the number of sequences that could be overlap-merged, were at least 35bp in length, mapped to one of the 1000 largest contigs of the ursMar0 reference genome with a quality of at least 25, and exhibited at least one C-to-T difference to the reference in the first or last three alignment positions. The content of deaminated sequence in each library was extrapolated using the following formula: number of library molecules (qPCR count) x mapped deaminated sequences ≥ 35bp x average length of mapped deaminated fragments / number of raw sequences generated (Figure S4, Table S9). Because the ’simple’ method and ’Gansauge’ method produce two complementary DNA strands with qPCR priming sites, qPCR counts were divided by two for these methods.

4. Data processing. Sequences were filtered for perfect matches to the expected 7bp indices and overlapping pair-end reads merged using LeeHom (12). For the analysis of shotgun sequences, overlap-merged sequences were mapped to the human reference genome (hg19) using the Burrows Wheeler Aligner (BWA) (9) with parameters optimized for ancient DNA (‘–n 0.01 –o 2 –l 16500’) (10). To reduce reference mapping bias towards hg19, all sequences were additionally aligned to a modified human reference carrying substitutions found in the high-coverage genomes of archaic hominins, namely the Neanderthals from Denisova Cave in the Altai Mountains (12), Chagyrskaya Cave (13) and Vindija Cave (14), as well as a Denisovan individual (10). The two datasets were merged and one of the duplicated alignments discarded (15). Sequences that produced alignment to both references but in different locations were also discarded. PCR duplicates were removed using bam-rmdup (https://bitbucket.org/ustenzel/biohazard-tools). For the analysis of the Gibraltar Neanderthal sequences, we required a minimum sequence length of 30bp and minimum mapping quality of 25. In addition, to reduce the impact of spurious alignments of microbial sequences or artifacts of library preparation, we applied a coverage cutoff in the analysis of the Devil’s Tower sequences and removed all sequences overlapping positions with a coverage greater than 1. Further, to reduce the impact of present-day human DNA contamination in the analysis, sequences were required to carry at least one C-to-T substitution in one of the terminal three alignment positions. In summary, for the Forbes’ Quarry individual, 139.06 Mbp of sequence were generated from the uracil-enriched libraries, of which 72.69 Mbp carried at least one C-to-T substitution indicative of cytosine deamination in at least one of the three terminal nucleotides (Table S3). For the Devil’s Tower individual, sequences from both library types (single-stranded and uracil-enriched) were used in down-stream analyses. These sequences amounted to 5.67 Mbp of data, of which 0.39 Mbp showed signs of deamination in the terminal three alignment positions (Table S3). To allow comparisons between the sequences from the Gibraltar Neanderthals and those of other Neanderthals for which low-coverage genome-wide sequence data are available, the latter data were processed in the exact same way for the Scladina and Hohlenstein Stadel (16) Neanderthals, but with a minimal sequence length cut-off of ≥ 35bp for the Neanderthals from Les Cottés, Spy, Mezmaiskaya and Goyet (17). Nuclear DNA sequences of a Neanderthal from El Sidrón (17, 18), which were obtained by hybridization capture of chromosome 21 and the exome, were required to be at least 35bp long and have a mapping quality of at least 25. Because the latter data were obtained from libraries which were treated with an enzyme that excises uracils (UDG), no filtering for terminal C-to-T differences was applied. In addition, only chromosome 21 sequences of El Sidrón were used to compute the F(A|B) statistics. In order to reconstruct the mitochondrial genome of the Forbes’ Quarry individual, mitochondrial capture datasets were merged with the respective shotgun dataset of the same indexed library. Sequences shorter than 30bp were discarded to minimize bacterial misalignments to the reference genome. All sequences were aligned with BWA to the mitochondrial genome of the Hohlenstein Stadel Neanderthal (GenBank acc. no.: KY751400.2) (19) of which the first 480bp were copied to the end to account for the circularity of the sequence, allowing up to 4 mismatches to the reference (-n 4 -o 2 –l 16500). This allowed us to identify more sequences with deamination-induced C-to-T differences which are abundant in uracil-enriched libraries. Because contamination with modern human DNA was still high (32.9%, 95% C.I. 30.6-35.9%), further analyses were restricted to sequences showing signs of deamination in at least one of the 5 terminal positions, but allowing at most two non-C-to-T differences to the reference (20) to minimize the impact of spurious alignments. In addition, we applied an upper length cutoff of 70bp. PCR duplicates were removed using bam-rmdup with the circular (-z) option. At positions with a coverage higher than 40x, a stricter deamination filter was applied, requiring a C-to-T change in the first or last position of the

4 of 22 Bokelmann et al. sequence alignments. After filtering, modern human contamination reduced to 9.7% (95% CI 7.7-12.3%). A consensus was called requiring a minimum of five observations per site and a consensus support of at least 80%. In this way 13982bp (84.4%) of the Forbes’ Quarry mitochondrial genome were reconstructed. The resulting consensus was aligned to 25 modern human mitochondrial genomes from 5 continents, 23 Neanderthal genomes, 4 Denisovans, the Sima de los Huesos specimen and the chimpanzee mitochondrial genome (see Table S4 for acc. no. of specimens and differences to the Forbes’ Quarry mitochondrial genome) with MAFFT (21). The best substitution model was determined to be GTR+I+G using jModelTest (22) and a maximum likelihood tree was constructed using PhyML (23). Branch support was estimated with 100 bootstrap replicates. In order to obtain an upper estimate of present-day human contamination of the mitochondrial data, processing was repeated using the revised Cambridge reference mitochondrial genome as reference (GenBank acc. no. NC_012920.1). Contamination was quantified by counting sequences that showed the Neanderthal and the modern human state at ‘diagnostic sites’ in the mitochondrial genome where 23 Neanderthal mitochondrial genomes differ from 99% of a set of 311 present-day human mitochondrial genomes. To reduce the impact of deamination induced C-to-T changes in this analysis, Ts were converted to Ns at the at the terminal three alignment positions (Table 1).

Bokelmann et al. 5 of 22 Fig. S1. Schematic overview of the uracil-enrichment library preparation method described by Gansauge and Meyer (2014). (1) Ancient DNA molecules (grey) are dephosphorylated (not shown) and heat-denatured before biotinylated single-stranded adapter molecules (red) are ligated to their 3’-ends using CircLigase. Ligated molecules are immobilized on streptavidin-coated magnetic beads (big red spheres). (2) An extension primer anneals to the adapter sequence and is extended by Bst polymerase. The resulting ends are made blunt using T4 DNA polymerase (not shown) and the ancient DNA template strand is phosphorylated on its 5’-end (not shown). (3) A second, double-stranded adapter (blue) is attached to the ancient DNA strand via blunt-end ligation. (4) The second adapter strand is ﬁlled-in by strand-displacement with Bst DNA polymerase. (5) Uracil bases (green) in the ancient DNA insert are excised by the combined action of uracil-N-glycosylase, E. coli Endonuclease VIII and T4 polynucleotide kinase. The 3’-hydroxyl group in the resulting one nucleotide gap serves as the starting point for polymerization by the strand-displacing Bst DNA polymerase. This reaction releases library molecules produced from uracil-containing DNA strands into the supernatant, while uracil-free molecules remain bound to the beads. (6) Magnetic beads are separated from the supernatant using a magnetic rack.

6 of 22 Bokelmann et al. Fig. S2. Schematic overview of the ’A-tailed’ uracil-enrichment library preparation method. (1) Ancient DNA molecules (grey) are dephosphorylated (not shown) and heat-denatured. (2) A biotin-containing adapter (red) is ligated to the 3’-end of the molecules in the presence of a partially complementary splinter oligonucleotide with a random base overhang (also red). Ligated molecules are immobilized on streptavidin-coated magnetic beads (big red spheres). (3) Splinter oligonucleotides are washed away. An extension primer anneals to the adapter sequence and is extended by the Klenow fragment of E. coli DNA polymerase I to copy the ancient molecule. (4) Excess primers are washed away and the newly synthesized strand is A-tailed by Klenow exo- DNA polymerase. (5) A double-stranded Y-shaped adapter with a T-overhang is ligated to the immobilized DNA molecules using T4 DNA ligase. The lower, 5’-phosphorylated strand of the adapter does not carry the priming site for library amplification and is protected against extension on its 3’-end by five consecutive mismatches to the upper adapter strand and a terminal 3’-phosphate. Five phosphorothioate linkages in the mismatched tail are meant to protect against nuclease activities of E. coli Endonuclease IV. (6) Excess adapters are washed away. Unspecific release of molecules into the supernatant in the presence of Bst DNA polymerase and E. coli Endonuclease IV but without a uracil-excising enzyme reduces artifactual molecules in the final library. (7) Uracils (green) are excised by uracil-DNA glycosylase, and the resulting abasic site is incised by E. coli Endonuclease IV. The resulting 3’ hydroxyl group serves as a template for extension by the strand-displacing Bst DNA polymerase. This reaction releases library molecules produced from uracil-containing DNA strands into the supernatant, while uracil-free molecules remain bound to the beads. (8) Magnetic beads are separated from the supernatant using a magnetic rack.

Bokelmann et al. 7 of 22 Fig. S3. Schematic overview of the ’simple’ uracil-selection library preparation method. (1) Ancient DNA molecules (grey) are heat-denatured and their 5’-ends are phosphorylated by T4 polynucleotide kinase. (2) Adapters (blue and red) are simultaneously ligated to 5’ and 3’ ends of the ancient DNA molecules. This reaction is promoted by splinter oligonucleotides with random base overhangs. Ligated molecules are immobilized on streptavidin-coated magnetic beads (big red spheres) via the biotin that is present on the 3’ end of one of the adapters. (3) Splinter oligonucleotides are washed away. A primer hybridized to the 3’ adapter is extended by Bst DNA polymerase to copy the ancient molecule. (4) Uracils (green) are excised by uracil-DNA glycosylase, and the resulting abasic site is incised by E. coli Endonuclease IV. The resulting 3’ hydroxyl group serves as a template for extension by the strand-displacing Bst DNA polymerase. This reaction releases library molecules produced from uracil-containing DNA strands into the supernatant. (5) Magnetic beads are separated from the supernatant using a magnetic rack.

8 of 22 Bokelmann et al. Cave bear - Vindija Cave Cave bear - Denisova Cave Cave bear - Gamsulzen Cave

1600 3000 400

1400 2500 1200 300 2000 1000

800 1500 200

600 1000 400 * 100 500 200

0 0 0 Deaminated sequence content [Mbp] content sequence Deaminated Deaminated sequence content [Mbp] content sequence Deaminated Deaminated [Mbp] content sequence Simple A-tailed Gansauge Non-selective Simple A-tailed Gansauge Non-selective Simple A-tailed Gansauge Non-selective U-selection U-selection U-selection method U-selection U-selection U-selection method U-selection U-selection U-selection method

Fig. S4. Deaminated sequence content in uracil-enriched and regular single-stranded libraries prepared from 3 cave bear DNA extracts, inferred from the number of unique molecules in the library (determined by qPCR), the number of sequences that were generated, and the number sequences that were ≥ 35bp in length, mapped to the polar bear reference genome with a map quality ≥ 25 and that showed a C-to-T difference to the reference at the ﬁrst or last alignment position. Black bars indicate standard deviations of technical triplicates of library preparation. * One technical replicate dropped out in qPCR, error bars calculated from duplicates instead.

Cave bear - Vindija Cave Cave bear - Denisova Cave Cave bear - Gamsulzen Cave

100 100 100

80 80 80

60 60 60

40 40 40

20 20 20

0 0 0 Simple U-selection A-tailed U-selection Gansauge U-selection Simple U-selection A-tailed U-selection Gansauge U-selection Simple U-selection A-tailed U-selection Gansauge U-selection Sequences with C-to-T substitution [%] substitution C-to-T with Sequences Sequences with C-to-T substitution [%] substitution C-to-T with Sequences Sequences with C-to-T substitution [%] substitution C-to-T with Sequences

Fig. S5. Comparison of the percentage of sequences that derive from putatively deaminated fragments among the 3 uracil-enrichment methods. Putatively deaminated fragments were identiﬁed by the presence of a C-to-T substitution at any position in the sequence alignment to the polar bear reference genome. Black bars indicate standard deviations of technical triplicates of library preparation.

Bokelmann et al. 9 of 22 Forbes' Quarry Devil's Tower 100 100

80 80

60 60

40 40

20 20 Spurious alignments [%] Spurious alignments [%] 0 0

20 25 30 35 40 45 50 20 25 30 35 40 45 50

Sequence length [bp] Sequence length [bp]

Fig. S6. Estimate of the percentage of spurious alignments in the sequence data of the Forbes’ Quarry and Devil’s Tower Neanderthals depending on the lower length cut-off used, calculated as described in de Filippo et al. (2018). 95% conﬁdence intervals are depicted in grey.

10 of 22 Bokelmann et al. Forbes' Quarry Devil's Tower 0.05 female ● ● all fragments deaminated

0.04 ●

0.03

male

X/(X+autosomes) 0.02

0.01

0.00

Fig. S7. Sex determination of the Forbes’ Quarry and Devil’s Tower Neanderthals. The X/(X+autosomes) ratio was calculated based on the numbers of sequences aligning to the X chromosome and the autosomes. Open circles denote sequences showing signs of deamination in the terminal three bases. Dotted lines represent expected ratios for males or females. Black bars indicate 95% conﬁdence intervals.

Bokelmann et al. 11 of 22 Fig. S8. Sequence length distribution obtained from sequencing a size selected library (D1243) generated from the Forbes’ Quarry specimen. The solid line provides the length distribution of all overlap-merged sequences, the dashed line that of mapped sequences.

12 of 22 Bokelmann et al. A Devil's Tower

Unique sequences mapping to hg19, MQ 25 Unique sequences mapping to hg19, MQ 25 Unique sequences mapping to hg19, MQ 25, terminally deaminated Unique sequences mapping to hg19, MQ 25, terminally deaminated

4E05 5E03

3E05 4E03

3E03 2E05 2E03 1E05 1E03

0E00 0E00 40 60 80 100 120 140 40 60 80 100 120 140

Fig. S9. Size distributions of the sequences retrieved from the Forbes’ Quarry and Devil’s Tower Neanderthals. A) Size distributions of all overlap merged sequences (solid line) and those mapping to the human reference genome hg19 (dotted line). B) Size distributions of unique sequences mapping to the human genome with a mapping quality of at least 25 and a minimum length to 30bp (solid line) and those showing evidence for deamination in the terminal three positions (dotted line).

Bokelmann et al. 13 of 22 Table S1. Neanderthal specimens from which nuclear genomic data have been used in this study.

Specimen Site Age estimate References Gibraltar 1 (Forbes’ Quarry Neanderthal) Forbes’ Quarry, Gibraltar - Buck and Stringer 2015 (24) Gibraltar 2 (Devil’s Tower Neanderthal) Mousterian rock shelter, Gibraltar - Buck and Stringer 2015 (24) Mezmaiskaya 1 Mezmaiskaya cave, Russia 60 - 70 ka Skinner et al. 2005 (25), Prüfer et al. 2013 (12) Mezmaiskaya 2 Mezmaiskaya cave, Russia 43 - 45 ka Pinhasi et al. 2011 (26), Hajdinjak et al. 2018 (16) Denisova 5 (Altai Neanderthal) Denisova Cave, Russia 117 - 129 ka Prüfer et al. 2013 (12), Prüfer et al. 2017 (14) Vindija 33.19 Vindija Cave, Croatia 50 - 63 ka Prüfer et al. 2017 (14) Hohlenstein-Stadel Hohlenstein-Stadel cave, Germany 62 - 183 ka Posth et al. 2017 (19) Scladina I-4A Scladina cave, Belgium 76 - 168 ka Toussaint and Bonjean 2014 (27), Peyrégne et al. 2019 (15) Goyet Q56-1 Troisiéme caverne, Goyet, Belgium 42 - 43 ka Rougier et al. 2016 (28), Hajdinjak et al. 2018 (16) Spy 94a Spy cave, Belgium 38 - 39 ka Semal et al. 2009 (29), Hajdinjak et al. 2018 (16) Les Cottés Z4-1514 Les Cottés cave, France 43 - 44 ka Hajdinjak et al. 2018 (16) Chagyrskaya 8 Chagyrskaya Cave, Russia 71 - 87 ka Derevianko et al. 2013 (30), Mafessoni et al. 2018 (31), Mafessoni et al. 2019 (13) El Sidrón 1253 El Sidrón cave, Spain 45 - 52 ka Wood et al. 2013 (32), Castellano et al. 2014 (18), Kuhlwilm et al. 2016 (17) Denisova 3 Denisova Cave, Russia 77 - 92 ka Meyer et al. 2012 (10), Prüfer et al. 2017 (14)

14 of 22 Bokelmann et al. Table S2. Sequencing summary statistics of initial single-stranded libraries generated from the Forbes’ Quarry and Devil’s Tower Nean- derthals. Library molecules were quantiﬁed using digital droplet PCR (ddPCR). ENC denotes the extraction negative control.

C-to-T substitution frequencies (%), (95% C.I.) Conditional C-to-T substitution frequencies (%), (95% C.I.) Specimen Amount Extract ID Extract used Library ID # Library # # # Sequences % Sequences 5’ end 3’ end 5’ end 3’ end powder used for library molecules Sequences Sequences mapped to mapping to in extraction preparation (ddPCR) generated ≥ 35bp hg19 with map hg19 (mg) (µL) quality ≥ 25

Forbes’ Quarry 14.6 E3103 10 R5293 1.17E+09 2,278,584 1,114,908 32,308 2.90 2.3 (2.0-2.7) 3.1 (2.6-3.6) 41.4 (23.5-61.1) 42.9 (24.5-62.8) Devil’s Tower 20.1 E5435 10 R5073 1.43+07 1,904,864 275,314 32,109 11.66 4.2 (3.8-4.8) 7.5 (6.7-8.3) 46.8 (34-59.9) 48.3 (33.7-60) ENC - E3110 10 R5300 7.70E+07 17,052 5,815 85 1.46 0 (0-16.8) 0 (0-26.5) NA NA

Table S3. Sequencing summary table of shotgun libraries generated from the Forbes’ Quarry and Devil’s Tower Neanderthals. DNA was extracted either as described by Dabney et al. (33) (D) or Glocke and Meyer (1) (G). LNC denotes library negative control.

C-to-T substitution frequencies (%), (95% C.I.) Description Amount Extraction Extract ID Library preparation method Extract Library ID # Library # # # Sequences % # Unique Average Average size 5’ end 3’ end Sequence powder method used for molecules Sequences Sequences ≥ 30bp Sequences sequences sequence deaminated data used in library (qPCR) generated ≥ 30bp mapped to mapped to ≥ 30bp, duplicates sequences generated extraction prepara- hg19 with hg19 terminally (bp) (Mbp) (mg) tion map quality deaminated (µL) ≥ 25

LNC 0 - - A-tailed U-selection 0 D1170 6.60E+04 3253 382 8 2.09 0 1 NA 0 (0.0-70.8) 0 (0.0-70.8) 0 Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 1 D1175 1.93E+07 35183652 12221291 271111 2.22 98700 1.46 38.5 63.5 (63.1-63.9) 59.9 (59.4-60.3) 7.438 Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1176 5.90E+07 20984075 7688129 160117 2.08 78168 1.09 38.6 56.7 (56.3-57.2) 59.8 (59.3-60.3) 5.871 Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1190 5.46E+07 31096094 10944736 218811 2 103772 1.12 38.6 64.7 (64.3-65.1) 59.5 (59.1-60.0) 7.881 Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1191 7.24E+07 33926366 12281482 247193 2.01 116199 1.13 38.5 62.7 (62.3-63.1) 59.6 (59.2-60.0) 8.814 Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1192 7.42E+07 44570365 16228111 315143 1.94 141888 1.16 38.5 64.7 (64.4-65.1) 59.8 (59.5-60.2) 10.872 Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1193 7.32E+07 44943809 16645488 329972 1.98 151417 1.17 38.7 61.5 (61.2-61.8) 59.6 (59.2-59.9) 11.319 Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1194 7.86E+07 65538387 23412569 499134 2.13 210137 1.27 38.5 67.8 (67.5-68.1) 59 (58.7-59.3) 15.757 Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1195 7.63E+07 35747355 12579012 252686 2.01 119357 1.13 38.4 65.5 (65.1-65.9) 60.3 (59.9-60.7) 8.944 Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1196 7.38E+07 48466316 18052393 370789 2.05 165231 1.19 38.6 61.5 (61.2-61.8) 59.9 (59.6-60.3) 12.47 Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1197 7.28E+07 38573525 13751216 282020 2.05 131868 1.14 38.4 62.1 (61.8-62.5) 60.3 (59.9-60.7) 9.904 Forbes’ Quarry 14.6 D E3103 Single-stranded library 10 R5293 1.17E+09 2278584 1471226 36571 2.49 714 1 47.6 2.6 (2.3-3.0) 3.8 (3.3-4.3) 2.253 LNC 0 - - Single-stranded library 0 R5303 NA 15687 1254 62 4.94 1 1.02 32 0 (0.0-26.5) 0 (0.0-45.9) 0.003 Forbes’ Quarry 10.2 G E5435 Simple U-selection 3 D1243 4.18E+08 157582677 88840947 1979996 2.23 528043 1.97 38.1 67.2 (67.1-67.4) 61.4 (61.2-61.6) 39.787 LNC 0 - - Simple U-selection 0 D1246 7.69E+07 5469 207 13 6.28 0 1 NA 0 (0.0-43.4) 0 (0.0-56.2) 0 LNC 0 - - Simple U-selection 0 D1275 7.98E+07 21144 1256 62 4.94 2 1.29 52 0 (0.0-35.4) 9.1 (0.0-25.9) 0.002 Devil’s Tower 20.1 D E2935 A-tailed U-selection 1 D1174 1.66E+05 629759 176433 5651 2.43 707 3.2 40.8 28 (24.8-31.2) 34.5 (30.8-38.2) 0.114 LNC 0 - - A-tailed U-selection 0 D1184 8.88E+04 6115 455 6 1 1 1.32 53 0 (0.0-79.3) 0 (0.0-65.8) 0 Devil’s Tower 20.1 D E2935 A-tailed U-selection 2 D1185 3.35E+05 2049408 408304 15114 3.36 1577 3.7 39.4 36.5 (33.9-39.1) 38.1 (35.3-40.7) 0.201 Devil’s Tower 20.1 D E2935 A-tailed U-selection 2 D1186 3.17E+05 1351880 276428 10232 2.61 1440 3.7 39.5 38.5 (35.7-41.3) 41 (37.9-43.9) 0.178 Devil’s Tower 20.1 D E2935 A-tailed U-selection 2 D1187 3.58E+05 686152 108733 4066 1.69 870 3.74 39.2 37.8 (34.2-41.5) 41.8 (38.1-45.6) 0.108 Devil’s Tower 20.1 D E2935 A-tailed U-selection 2 D1188 3.23E+05 890285 142984 5560 2.02 971 3.89 39.2 37.6 (34.3-41.0) 38.7 (35.1-42.1) 0.123 Devil’s Tower 20.1 D E2935 A-tailed U-selection 2 D1189 2.13E+05 406325 84151 2991 1.45 792 3.55 39.9 39.1 (35.0-43.0) 41 (37.0-45.2) 0.092 Devil’s Tower 20.1 D E2935 Single-stranded library 1 A9256 5.03E+07 3526799 235664 9277 1.12 277 3.94 40.8 4 (3.1-5.0) 5.8 (4.5-7.1) 0.44 Devil’s Tower 20.1 D E2935 Single-stranded library 2 A9257 5.03E+07 3055968 277599 15120 1.1 428 5.45 41.9 4 (3.3-4.8) 6.6 (5.5-7.6) 0.751 Devil’s Tower 20.1 D E2935 Single-stranded library 3 A9258 5.78E+07 4074576 276286 18898 1.1 665 6.84 42.1 5.3 (4.6-6.1) 8.7 (7.6-9.9) 0.905 Devil’s Tower 20.1 D E2935 Single-stranded library 1 R1248 5.42E+07 1160670 203667 5947 1.02 77 2.92 45.6 1.1 (0.6-1.8) 2.5 (1.7-3.4) 0.318 Devil’s Tower 20.1 D E2935 Single-stranded library 3 R1249 6.75E+07 1060286 199643 8485 1.01 138 4.25 42.9 2.5 (1.8-3.3) 2.1 (1.5-2.9) 0.447 Devil’s Tower 20.1 D E2935 Single-stranded library 10 R5073 1.17E+09 1904864 376053 450 1.06 1455 10.45 42.4 4.9 (4.5-5.4) 8.8 (8.0-9.6) 2.018 LNC 0 - - Single-stranded library 0 A9283 3.98E+07 422430 46514 585 1.06 12 1.26 37.3 0.9 (0.0-3.2) 4.1 (0.6-8.7) 0.025 LNC 0 - - Single-stranded library 0 R1253 9.50E+07 240145 43156 450 1.04 3 1.04 58 1.3 (0.0-4.6) 1.1 (0.0-4.2) 0.023 LNC 0 - - Single-stranded library 0 R5082 6.90E+06 15530 5 0 NA 0 0 NA NA NA 0

Bokelmann et al. 15 of 22 Table S4. Mitochondrial genomes used in this study.

Comparative data Accession no. Differences to Forbes’ Quarry mtDNA Comparative data Accession no. Differences to Forbes’ Quarry mtDNA Present-day humans Neanderthals San AF347008 102 Mezmaiskaya 1 FM865411 6 Mbuti AF346998 97 Mezmaiskaya 2 MG025537 13 South African AY195780 91 Feldhofer 1 FM865407 16 Mandenka AF346995 92 Feldhofer 2 FM865408 13 Morocco AF381988 93 Vindija 33.25 FM865410 16 Japanese AF346990 89 Vindija 33.16 AM948965 16 Taiwan Aborigine AY289097 92 Vindija 33.17 KJ533544 15 Malay AY963581 90 Vindija 33.19 (Vindija 87) MG025539 16 PNG Coast AY289082 96 El Sidrón 1253 FM865409 13 Chinese AF346973 91 Altai Neanderthal KC879692 12 Australian AF346964 97 Okladnikov 2 KF982693 10 Australian AY289059 97 Goyet Q57-2 KX198088 16 Australian AY289066 95 Goyet Q305-4 KX198087 14 Australian AY289067 96 Goyet Q305-7 KX198086 18 Australian AY289064 97 Goyet Q374a1 KX198085 18 MixtecaBaja AY195786 93 Goyet Q56-1 KX198084 18 Native American AY195749 93 Goyet Q57-1 KX198082 16 Native American AY195759 91 Goyet Q57-3 KX198083 16 Native American AY195748 89 Hohlenstein-Stadel KY751400 49 Navajo AY195787 91 Scladina I-4A MK123269 13 Italian AY963586 88 Denisova 11 KU131206 8 German AF346983 94 Les Cottés Z4-1514 MG025536 23 Spanish AY882401 97 Spy 94a MG025538 18 French AF346981 86 Outgroup Finnish AY195779 90 Pan troglodytes X93335 1061 Denisovans / Middle Pleistocene hominins Denisova 2 KX663333 201 Denisova 3 NC013993 215 Denisova 4 FR695060 215 Denisova 8 KT780370 201 Sima de los Huesos Femur XIII KF683087 174

16 of 22 Bokelmann et al. Table S5. D-statistics calculated using AdmixTools. Datasets contained either all sequences or only those showing evidence for deamination in the terminal three base pairs (deam). To exclude inﬂuence of deamination-induced C-to-T substitutions, only transversions were considered in the analysis.

Population 1 Population 2 Population 3 Population 4 D Z-score #BABA #ABBA #SNPs SD (D-statistics/Z-score) Altai Vindija 33.19 Forbes’ Quarry deam Mbuti -0.2652 -10.575 484 834 1343690 0.02508 Altai Vindija 33.19 Forbes’ Quarry deam Pan troglodytes -0.2455 -10.099 516 851 1324622 0.02431 Altai Denisova Forbes’ Quarry deam Mbuti 0.8704 100 4907 340 1343030 0.0087 Altai Denisova Forbes’ Quarry deam Pan troglodytes 0.87 100 5069 352 1323969 0.0087 Altai Chagyrskaya 8 Forbes’ Quarry deam Mbuti -0.2303 -9.646 504 806 1343708 0.02388 Altai Chagyrskaya 8 Forbes’ Quarry deam Pan troglodytes -0.2266 -9.074 521 827 1324638 0.02497 Chagyrskaya 8 Vindija 33.19 Forbes’ Quarry deam Mbuti -0.0453 -1.483 493 540 1343623 0.03055 Chagyrskaya 8 Vindija 33.19 Forbes’ Quarry deam Pan troglodytes -0.0252 -0.944 524 551 1324555 0.02669 Altai Vindija 33.19 Forbes’ Quarry Mbuti -0.2374 -13.648 991 1608 2538746 0.01739 Altai Vindija 33.19 Forbes’ Quarry Pan troglodytes -0.2346 -12.908 1020 1646 2502604 0.01817 Altai Denisova Forbes’ Quarry Mbuti 0.7856 100 8635 1037 2537494 0.00786 Altai Denisova Forbes’ Quarry Pan troglodytes 0.7813 99.924 9005 1106 2501373 0.00782 Altai Chagyrskaya 8 Forbes’ Quarry Mbuti -0.1822 -10.071 1035 1496 2538773 0.01809 Altai Chagyrskaya 8 Forbes’ Quarry Pan troglodytes -0.1915 -10.725 1049 1546 2502630 0.01786 Chagyrskaya 8 Vindija 33.19 Forbes’ Quarry Mbuti -0.0738 -3.526 974 1129 2538596 0.02093 Chagyrskaya 8 Vindija 33.19 Forbes’ Quarry Pan troglodytes -0.0584 -3.003 1015 1141 2502449 0.01945 Altai Vindija 33.19 HST deam Pan troglodytes -0.1066 -4.157 549 680 1210186 0.02564 Altai Chagyrskaya 8 HST deam Pan troglodytes -0.0622 -2.484 566 641 1210159 0.02504 Altai Denisova HST deam Pan troglodytes 0.8673 94.605 4726 336 1209577 0.00917 Chagyrskaya 8 Vindija 33.19 HST deam Pan troglodytes -0.0548 -1.993 436 486 1210143 0.0275 Altai Vindija 33.19 Spy deam Pan troglodytes -0.5222 -48.858 2440 7775 8732694 0.01069 Altai Chagyrskaya 8 Spy deam Pan troglodytes -0.3215 -26.114 3145 6126 8732561 0.01231 Altai Denisova Spy deam Pan troglodytes 0.8794 100 33486 2148 8727716 0.00879 Chagyrskaya 8 Vindija 33.19 Spy deam Pan troglodytes -0.2976 -23.493 2798 5170 8732575 0.01267 Altai Vindija 33.19 Spy deam Pan troglodytes -0.5222 -48.858 2440 7775 8732694 0.01069 Altai Chagyrskaya 8 Spy deam Pan troglodytes -0.3215 -26.114 3145 6126 8732561 0.01231 Altai Denisova Spy deam Pan troglodytes 0.8794 100 33486 2148 8727716 0.00879 Chagyrskaya 8 Vindija 33.19 Spy deam Pan troglodytes -0.2976 -23.493 2798 5170 8732575 0.01267 Altai Vindija 33.19 Mez1 deam Pan troglodytes -0.3498 -33.971 4887 10144 14190167 0.0103 Altai Chagyrskaya 8 Mez1 deam Pan troglodytes -0.3274 -30.22 5018 9903 14190312 0.01083 Altai Denisova Mez1 deam Pan troglodytes 0.8834 100 55256 3421 14182216 0.00883 Chagyrskaya 8 Vindija 33.19 Mez1 deam Pan troglodytes -0.0321 -2.701 5686 6062 14189994 0.01188 Altai Vindija 33.19 Mez2 deam Pan troglodytes -0.4561 -37.635 3810 10201 12458575 0.01212 Altai Chagyrskaya 8 Mez2 deam Pan troglodytes -0.3066 -23.031 4535 8548 12458592 0.01331 Altai Denisova Mez2 deam Pan troglodytes 0.8887 100 49110 2893 12452059 0.00889 Chagyrskaya 8 Vindija 33.19 Mez2 deam Pan troglodytes -0.2144 -17.713 4322 6682 12458355 0.0121 Altai Vindija 33.19 Goyet deam Pan troglodytes -0.5241 -53.51 3087 9886 10782426 0.00979 Altai Chagyrskaya 8 Goyet deam Pan troglodytes -0.3054 -26.326 4056 7621 10782143 0.0116 Altai Denisova Goyet deam Pan troglodytes 0.8789 100 42821 2761 10776424 0.00879 Chagyrskaya 8 Vindija 33.19 Goyet deam Pan troglodytes -0.3196 -25.227 3436 6663 10782057 0.01267 Altai Vindija 33.19 Les Cottés deam Pan troglodytes -0.4698 -53.954 5878 16295 19963852 0.00871 Altai Chagyrskaya 8 Les Cottés deam Pan troglodytes -0.3239 -30.788 7018 13743 19963816 0.01052 Altai Denisova Les Cottés deam Pan troglodytes 0.8889 100 77288 4546 19952540 0.00889 Chagyrskaya 8 Vindija 33.19 Les Cottés deam Pan troglodytes -0.2153 -19.463 6774 10492 19963642 0.01106 Altai Vindija 33.19 Scladina deam Pan troglodytes -0.1855 -3.529 125 182 275209 0.05256 Altai Chagyrskaya 8 Scladina deam Pan troglodytes -0.1903 -3.701 110 161 275196 0.05142 Altai Denisova Scladina deam Pan troglodytes 0.8283 47.46 1009 95 275061 0.01745 Chagyrskaya 8 Vindija 33.19 Scladina deam Pan troglodytes -0.0467 -0.824 113 124 275198 0.05667 Dinka French Forbes’ Quarry deam Pan troglodytes -0.074 -4.377 857 994 1306245 0.01691 Dinka Mbuti Forbes’ Quarry deam Pan troglodytes 0 -0.002 1005 1005 1311837 0 Han French Forbes’ Quarry deam Pan troglodytes 0.0227 1.099 802 767 1308380 0.02066 Han Mbuti Forbes’ Quarry deam Pan troglodytes 0.0857 5.215 1162 979 1314208 0.01643 HST deam Mez2 deam Forbes’ Quarry deam Mbuti -0.0799 -0.303 9 10 10623 0.2637 Scladina deam Mez2 deam Forbes’ Quarry deam Mbuti 0.0755 0.398 10 9 2681 0.1897 Dinka French Forbes’ Quarry Pan troglodytes -0.0867 -6.676 1602 1906 2467321 0.01299 Dinka Mbuti Forbes’ Quarry Pan troglodytes 0.0239 2.157 1940 1849 2477802 0.01108 Han French Forbes’ Quarry Pan troglodytes 0.0123 0.785 1520 1483 2471633 0.01567 Altai Vindija 33.19 El Sidrón Pan troglodytes -0.4572 -24.249 513 1378 1827116 0.01885 Altai Denisova El Sidrón Pan troglodytes 0.8647 100 6473 470 1826333 0.00865 Altai Chagyrskaya 8 El Sidrón Pan troglodytes -0.3135 -14.251 614 1174 1827039 0.021998 Chagyrskaya 8 Vindija 33.19 El Sidrón Pan troglodytes -0.209 -9.917 576 880 1826883 0.021075

Bokelmann et al. 17 of 22 Table S6. F(A|B) statistics and resulting split time estimates for putatively deaminated sequences from the Forbes’ Quarry Neanderthal. 95% conﬁdence intervals are given in parentheses.

Population A Population B F(A|B) Branch shortening (ka) Split time (ka) (95% C.I.) Forbes’ Quarry Altai Neanderthal (Denisova 5) 36.9 122.4 141.2 (131.8 – 161.5) Forbes’ Quarry Chagyrskaya 8 35.6 80.7 101.6 (87.2 – 121.9) Forbes’ Quarry Vindija 33.19 31.6 51.8 93.8 (70.8 – 108.9) Forbes’ Quarry Denisova 3 15.3 72 345 (303.7 – 402.8) Forbes’ Quarry Mbuti 17.6 0 522.3 (476.3 – 574.2)

Table S7. Sequences of oligonucleotides used in library preparation, ampliﬁcation and hybridization capture. Stars denote phosphorothioate linkages, square brackets denote 2’ O-methyl RNA nucleotides, curly braces denote locked nucleic acids (LNAs).

ID Description Sequence (5’-3’) 5’ Mod. 3’ Mod. Puriﬁcation Supplier UN7 5’ Adapter, A-tailed U-selection ACACTCTTTCCCTACACGACGCTCTTCCACCTTGTTCTCT - - HPLC Sigma Aldrich UN13 5’ Adapter, A-tailed U-selection GAGAACAAGGTGGAAGAGC*C*C*C*C*C Phosphate Phosphate HPLC Sigma Aldrich CL9 Extension primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT - - HPLC Sigma Aldrich CL49 5’ Adapter U-Gansauge ACACTCTTTCCCTACACGACGCTCTTCC - - HPLC Sigma Aldrich CL50 5’ Adapter U-Gansauge GGAAGAGCGTCG - - HPLC Sigma Aldrich CL53 5’ Adapter ssPrep CGACGCTCTTC-ddC - - HPLC Sigma Aldrich CL72 Fw sequencing primer ACACTCTTTCCCTACACGACGCTCTTCC - - HPLC Sigma Aldrich CL73 5’ Adapter ssPrep GGAAGAGCGTCGTGTAGGGAAAGAG*T*G*T*A Phosphate - HPLC Sigma Aldrich CL78 3’ Adapter ssPrep AGATCGGAAG Phosphate [C3Spacer]10[TEG-biotin] Desalted Biospring CL130 Extension primer GTGACTGGAGTTCAGACGTGTGCTCTTCC*GA*TC*T - - HPLC Sigma Aldrich TL148 3’ Splinter (8N) [A][A][A]CTTCCGATCTNNNNNNNN SpacerC12 AmC6 Desalted Eurogentec TL150 3’ Adapter AGATCGGAAG[A][A][A][A][A][A][A][A][A][A] Phosphate TEG-Btn Desalted Eurogentec TL159 3’ Splinter (8N) [A][A][A]CTTCCGATCTNNNNNNNN[A] SpacerC12 AmC6 Desalted Eurogentec TL164 5’ Splinter (9N) NNNNNNNNNGGAAGAGCGTCGTGTAGGG AmC12 AmC3 HPLC Sigma Aldrich TL166 5’ Adapter ACACTCTTTCCCTACACGACGCTCTT/5me-dC/5me-dC AmC12 - HPLC IDT IS5 Fw primer one-cycle PCR AATGATACGGCGACCACCGA - - HPLC Sigma-Aldrich IS6 Rev primer one-cycle PCR AGCATACGGCAGAAGACGAAC - - HPLC Sigma-Aldrich IS7 Fw primer qPCR ACACTCTTTCCCTACACGAC - - HPLC Sigma-Aldrich IS8 Rev primer qPCR GTGACTGGAGTTCAGACGTGT - - HPLC Sigma-Aldrich IS10 Detection probe for qPCR A{G}A{T}C{G}GAAGAGC{A}CAC FAM BHQ HPLC Eurogentec IS14 Fw sequencing primer, A-tailed U-selection ACACTCTTTCCCTACACGACGCTCTTCCACCTTGTTCTCT - - HPLC Sigma Aldrich BO4 Blocking oligo capture GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT - Phosphate HPLC Sigma Aldrich BO6 Blocking oligo capture CAAGCAGAAGACGGCATACGAGAT - Phosphate HPLC Sigma Aldrich BO8 Blocking oligo capture GTGTAGATCTCGGTGGTCGCCGTATCATT - Phosphate HPLC Sigma Aldrich BO11 Blocking oligo capture GGAAGAGCGTCGTGTAGGGAAAGAGTGT - Phosphate HPLC Sigma Aldrich BO12 Blocking oligo capture, A-tailed U-selection AGAGAACAAGGTGGAAGAGCGTCGTGTAGGGAAAGAGTGT - Phosphate HPLC Sigma Aldrich

18 of 22 Bokelmann et al. Table S8. Sequencing summary table of mitochondrial capture libraries generated from the Forbes’ Quarry Neanderthal. DNA was extracted either as described by Dabney et al. (33) (D) or Glocke and Meyer (1) (G). LNC denotes library negative control.

C-to-T substitution frequencies (%), (95% C.I.) Description Amount Extraction Extract ID Library preparation Extract Shotgun 2nd round Capture probe set # Se- #Sequences # Se- # Unique # Unique % Se- Average Average 5’ end 3’ end powder method method used library ID capture quences ≥ 30bp quences se- sequences quences sequence size used in (µL) library ID generated ≥ 30bp quences ≥ 30bp mapped duplicates mapped extraction mapped ≥ 30bp terminally to rCRS sequences (mg) to rCrs mapped deaminated (bp) to rCrs Forbes’ Quarry 10.2 G E5435 Simple U-selection 3 D1243 B11620 Human MT 312906 118311 78640 306 121 66.47 256.99 45.7 37 (25.6-47.1) 40.5 (30.6-51.2) LNC 0 - - Simple U-selection 0 D1246 B11621 Human MT 296026 14778 4670 18 0 31.6 259.44 39.6 0 (0.0-49.0) 0 (0.0-35.4) LNC 0 - - Simple U-selection 0 D1275 B11622 Human MT 519932 34162 9234 64 7 27.03 144.28 55.3 10.5 (2.9-31.4) 11.1 (0.0-29.9) Forbes’ Quarry 10.2 G E5435 Simple U-selection 6 D1283 B11623 Human MT 957396 436865 283678 1074 406 64.94 264.13 47.3 43.1 (37.7-48.8) 38 (32.5-43.3) Forbes’ Quarry 10.2 G E5435 Simple U-selection 6 D1284 B11624 Human MT 554454 239077 153704 909 330 64.29 169.09 49.5 43.5 (37.7-49.5) 36.4 (31.1-42.1) Forbes’ Quarry 10.2 G E5435 Simple U-selection 6 D1284 D1421 Neanderthal MT 251069 159950 65109 748 305 40.71 87.04 42.9 58.1 (51.2-63.9) 43.8 (37.6-50.1) Forbes’ Quarry 10.2 G E5435 Simple U-selection 3 D1243 D1445 Neanderthal MT 267403 124123 60861 304 148 49.03 200.2 43.7 53.8 (41.6-63.3) 50.7 (39.3-62.0) Forbes’ Quarry 10.2 G E5435 Simple U-selection 6 D1283 D1446 Neanderthal MT 237415 131791 62714 724 345 47.59 86.62 42.5 58 (51.0-63.8) 44 (37.2-51.1) Forbes’ Quarry 10.2 G E5435 Simple U-selection 6 D1284 D1447 Neanderthal MT 243750 146794 84641 703 322 57.66 120.4 43.7 55.6 (48.9-62.0) 46.5 (39.6-52.5) LNC 0 - - Simple U-selection 0 D1246 D1480 Neanderthal MT 22231 14778 51 13 1 0.76 3.92 35.5 0 (0.0-79.3) 33.3 (0.0-56.2) LNC 0 - - Simple U-selection 0 D1275 D1481 Neanderthal MT 19299 34162 36 12 0 0.61 3 41.5 0 (0.0-79.3) 0 (0.0-65.8) LNC 0 - - Simple U-selection 0 D1455 D1482 Neanderthal MT 18904 6914 103 8 0 1.49 12.88 45.2 0 (0.0-65.8) 0 (0.0-56.2) Forbes’ Quarry 11.8 G E10219 Simple U-selection 10 D1457 D1483 Neanderthal MT 236548 89463 46739 872 390 52.24 53.6 45.3 59.6 (53.4-65.5) 41.9 (35.6-47.7) Forbes’ Quarry 11.8 G E10219 Simple U-selection 10 D1458 D1484 Neanderthal MT 279539 120136 64488 888 413 53.68 72.62 44.4 54.3 (48.4-60.0) 41.2 (35.5-46.5) Forbes’ Quarry 11.8 G E10219 Simple U-selection 10 D1459 D1485 Neanderthal MT 174120 67908 36620 698 316 53.93 52.46 42.8 51.7 (45.4-57.9) 43.9 (36.7-50.4) Forbes’ Quarry 11.8 G E10219 Simple U-selection 10 D1460 D1486 Neanderthal MT 218454 86953 43510 825 378 50.04 52.74 45.3 57.9 (51.4-63.4) 42.7 (36.4-49.2) Forbes’ Quarry 11.8 G E10219 Simple U-selection 10 D1461 D1487 Neanderthal MT 168858 72485 38031 810 383 52.47 46.95 44.6 57.1 (51.1-62.9) 46.2 (40.1-52.6) Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 1 D1175 D1435 Neanderthal MT 48829 31708 14054 64 34 44.32 219.59 43.1 57.7 (38.9-74.5) 34.6 (16.5-50.0) Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1176 D1436 Neanderthal MT 48861 31650 11517 116 60 36.39 99.28 40.8 60.9 (44.3-71.7) 51.9 (30.7-66.0) Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1190 D1437 Neanderthal MT 62773 30164 7960 142 80 26.39 56.06 41.5 66.7 (52.1-78.6) 56.1 (41.0-70.1) Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1191 D1438 Neanderthal MT 59063 38999 16653 167 84 42.7 99.72 42.8 54.7 (41.5-67.3) 44.2 (28.4-56.7) Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1192 D1439 Neanderthal MT 53139 33234 12330 176 84 37.1 70.06 43.5 46.2 (33.3-59.5) 53.2 (37.2-64.7) Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1193 D1440 Neanderthal MT 51149 34092 13660 173 91 40.07 78.96 39.9 49.1 (36.6-61.7) 56.5 (44.1-68.1) Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1194 D1441 Neanderthal MT 77146 54166 28336 178 81 52.31 159.19 43.4 54 (41.8-65.7) 38.3 (24.0-50.5) Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1195 D1442 Neanderthal MT 52038 32295 13366 155 80 41.39 86.23 39.5 57.7 (44.2-70.1) 48.9 (35.3-62.8) Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1196 D1443 Neanderthal MT 63207 39214 14461 154 85 36.88 93.9 38.8 50 (36.9-63.1) 53.2 (37.2-64.7) Forbes’ Quarry 10.2 G E5435 A-tailed U-selection 3 D1197 D1444 Neanderthal MT 57714 37327 16547 183 90 44.33 90.42 43.3 54.3 (38.1-65.9) 49 (35.9-62.3) LNC 0 - - A-tailed U-selection 0 D1170 D1478 Neanderthal MT 6201 845 28 1 1 3.31 28 33 NAN/A NANA LNC 0 - - A-tailed U-selection 0 D1184 D1479 Neanderthal MT 10658 7797 0 0 0 0 NA NA NAN/A NANA Forbes’ Quarry 10.2 G E5435 Single-stranded library 5 F3803 D9743 Human MT 431475 246346 191728 2908 246 77.83 65.93 53.9 11.6 (9.3-14.0) 8.8 (7.0-11.0) LNC 0 - - Single-stranded library 0 F3760 D9700 Human MT 29881 4412 4105 13 0 93.04 315.77 61.1 0 (0.0-65.8) 0 (0.0-65.8) Forbes’ Quarry 14.6 D E3103 Single-stranded library 10 R5293 L5454 Human MT 2643656 1677715 46337 14150 165 2.76 3.27 62.8 1.1 (0.8-1.6) 1.3 (0.9-1.8) LNC 0 - - Single-stranded library 0 R5303 L5462 Human MT 425248 35625 955 52 3 2.68 18.37 52.8 75 (30.1-95.4) 0 (0.0-43.4)

Bokelmann et al. 19 of 22 Table S9. Sequencing summary table of shotgun libraries generated from bear DNA extracts from three different sites using different library preparation methods. Each condition was tested in technical triplicates starting from the same extract. Extract input volume was 2µl for each sample. * Deaminated sequence content in library was calculated as follows: # Deaminated sequences / # Generated sequences x Library molecules x Average size deaminated sequences / 1000000. ** For ’Gansauge’ method and ’simple’ method, qPCR values were divided by two to account for differences in amount of ampliﬁable strands produced per input molecule. LNC denotes library negative control. ENC denotes extraction negative control.

C-to-T substitution frequencies (%), (95% C.I.) Description Library preparation Index Library # # # Sequences # Unique % Se- Average Average size Deaminated 5’ end 3’ end method library ID molecules Sequences Sequences ≥ 35bp sequences ≥ quences sequence deaminated sequence (qPCR)** generated ≥ 35bp mapped to 35bp mapped mapping duplicates sequences content in ursMar0 with to ursMar0 to (bp) library (Mbp) map quality ≥ terminally ursMar0 25 deaminated LNC Simple U selection D1350 4.25E+07 3771 113 0 0 0 NA NA 0 NA NA LNC Simple U selection D1351 4.57E+07 2563 76 0 0 0 NA NA 0 NA NA LNC Simple U selection D1352 4.08E+07 2677 87 1 0 1.15 1 NA 0 NA NA ENC Simple U selection D1353 4.65E+07 4234 94 1 0 1.06 1 NA 0 0 (0.0-79.3) NA ENC Simple U selection D1354 4.62E+07 3925 127 1 0 0.79 1 NA 0 NA NA ENC Simple U selection D1355 4.67E+07 4423 107 3 0 2.8 1 NA 0 0 (0.0-79.3) 0 (0.0-79.3) Cave bear - Vindija Cave Simple U selection D1356 8.53E+09 616937 200184 2192 810 1.1 1 45.9 1391.3 49.3 (44.3-54.4) 50.3 (45.3-55.2) Cave bear - Vindija Cave Simple U selection D1357 8.20E+09 658156 213370 2351 851 1.1 1 46 1347 46.3 (41.6-51.0) 49 (44.1-53.6) Cave bear - Vindija Cave Simple U selection D1358 1.04E+10 751278 242901 2724 1012 1.12 1 46.3 1747.7 46.2(41.8-50.3) 55.3 (50.9-59.6) Cave bear - Denisova Cave Simple U selection D1359 2.25E+09 626162 254383 19708 6887 7.75 1 50.7 3586.5 43.4 (41.8-45.0) 46.5 (44.9-48.1) Cave bear - Denisova Cave Simple U selection D1360 2.21E+09 618824 260559 19972 6916 7.67 1 51.1 3648.7 43.3 (41.7-44.8) 46 (44.4-47.7) Cave bear - Denisova Cave Simple U selection D1361 1.69E+09 796659 326916 24922 8738 7.62 1 50.5 2667.8 44.3 (42.9-45.7) 46.4 (45.0-47.8) Cave bear - Gamsulzen Cave Simple U selection D1362 8.77E+08 508998 211013 5271 1775 2.5 1 48 436 41.7 (38.6-44.8) 42.1 (39.0-45.1) Cave bear - Gamsulzen Cave Simple U selection D1363 8.02E+08 628658 245464 6392 2095 2.6 1 48.4 394.7 39.1 (36.3-41.9) 43.4 (40.5-46.1) Cave bear - Gamsulzen Cave Simple U selection D1364 8.63E+08 649865 259893 6540 2242 2.52 1 48.8 423.6 39.7 (36.9-42.4) 44.8 (42.0-47.5) LNC A-tailed U selection D1365 6.66E+07 0 0 0 NA NA NA 0 NA NA LNC A-tailed U selection D1366 3.52E+07 1 0 0 0 NA NA NA 0 NA NA LNC A-tailed U selection D1367 3.23E+07 0 0 0 NA NA NA 0 NA NA ENC A-tailed U selection D1368 5.41E+06 1 0 0 0 NA NA NA 0 NA NA ENC A-tailed U selection D1369 1.85E+07 0 0 0 NA NA NA 0 NA NA ENC A-tailed U selection D1370 3.78E+07 1 0 0 0 NA NA NA 0 NA NA Cave bear - Vindija Cave A-tailed U selection D1371 5.20E+09 56095 25621 490 263 1.91 1 47 2133.9 67.7 (59.2-75.2) 67.9 (58.5-76.0) Cave bear - Vindija Cave A-tailed U selection D1372 4.48E+09 9590 4575 106 59 2.32 1 47.9 2373.8 62.5 (45.3-77.1) 61.5 (38.9-74.5) Cave bear - Vindija Cave A-tailed U selection D1373 4.65E+09 148379 69807 1333 661 1.91 1 47.5 1983.4 70.1 (65.0-74.8) 57 (51.2-62.6) Cave bear - Denisova Cave A-tailed U selection D1374 8.79E+08 1366 776 134 62 17.27 1 52 4483.2 52.6 (34.8-65.2) 54.5 (35.2-67.5) Cave bear - Denisova Cave A-tailed U selection D1375 9.73E+08 3592 2054 369 161 17.97 1 52.9 5287.7 46 (36.3-54.3) 49.4 (39.0-59.8) Cave bear - Denisova Cave A-tailed U selection D1376 1.11E+09 56587 32210 6792 2977 21.09 1 51.3 6823.4 53.3 (51.0-55.6) 44.2 (41.8-46.7) Cave bear - Gamsulzen Cave A-tailed U selection D1377 4.38E+08 1288 730 33 13 4.52 1 47.9 537.4 40 (16.8-68.7) 20 (5.7-51.0) Cave bear - Gamsulzen Cave A-tailed U selection D1378 5.57E+08 9218 5194 264 110 5.08 1 51.3 819 46.4 (35.0-55.9) 36.4 (25.8-48.4) Cave bear - Gamsulzen Cave A-tailed U selection D1379 2.84E+08 1192 793 43 23 5.42 1 47.1 483.1 40 (16.8-68.7) 41.7 (19.3-68.0) LNC Gansauge U selection D1380 2.51E+05 1634 14 0 0 0 NA NA 0 NA NA LNC Gansauge U selection D1381 1.95E+05 202 4 0 0 0 NA NA 0 NA NA LNC Gansauge U selection D1382 3.04E+05 674 13 0 0 0 NA NA 0 NA NA ENC Gansauge U selection D1383 2.63E+05 539 17 0 0 0 NA NA 0 NA NA ENC Gansauge U selection D1384 1.58E+05 693 0 0 0 NA NA NA 0 NA NA ENC Gansauge U selection D1385 2.86E+05 665 21 1 0 4.76 1 NA 0 NA 0 (0.0-79.3) Cave bear - Vindija Cave Gansauge U selection D1386 2.80E+09 646085 262746 2992 1054 1.14 1 48.4 628.4 49.8 (45.8-53.9) 39 (34.8-42.9) Cave bear - Vindija Cave Gansauge U selection D1387 1.31E+02 18138 3571 37 11 1.04 1.12 42.6 0 0 (0.0-49.0) 66.7 (20.8-93.9) Cave bear - Vindija Cave Gansauge U selection D1388 3.35E+09 652600 282146 2767 957 0.98 1 47.7 676.9 46.6 (42.0-50.8) 40.4 (36.2-44.8) Cave bear - Denisova Cave Gansauge U selection D1389 7.28E+08 583591 338479 29167 9469 8.62 1 53.8 1956.6 44.8 (43.5-46.1) 36.8 (35.5-38.1) Cave bear - Denisova Cave Gansauge U selection D1390 7.44E+08 472257 265200 22605 7337 8.52 1 54.5 1940.4 43.5 (41.9-44.9) 35.6 (34.2-37.1) Cave bear - Denisova Cave Gansauge U selection D1391 8.27E+08 500640 268873 23897 7894 8.89 1 53.5 2112.2 45.4 (43.9-46.8) 35 (33.6-36.4) Cave bear - Gamsulzen Cave Gansauge U selection D1392 3.85E+08 564618 321474 8676 2651 2.7 1 51.9 307.1 39.3 (36.9-41.7) 34.4 (32.0-36.6) Cave bear - Gamsulzen Cave Gansauge U selection D1393 3.89E+08 498468 259570 6957 2210 2.68 1 49.5 268.9 44.7 (41.9-47.3) 31.2 (28.8-33.8) Cave bear - Gamsulzen Cave Gansauge U selection D1394 3.46E+08 644390 332674 9004 2777 2.71 1 51.3 248.2 41.3 (39.0-43.6) 30 (27.9-32.2) Cave bear - Vindija Cave Single-stranded library A12394 1.98E+10 648999 249329 2430 903 0.98 1 47.5 3520 63.2 (58.9-67.0) 52.9 (48.1-57.2) Cave bear - Vindija Cave Single-stranded library A12395 2.35E+10 689055 262265 2395 912 0.91 1 47.4 3867 69.7 (65.5-73.6) 51.8 (46.9-56.2) Cave bear - Vindija Cave Single-stranded library A12396 2.15E+10 686371 262232 2428 929 0.93 1 48 3657.8 65.8 (61.5-69.6) 50.3 (45.4-54.8) Cave bear - Denisova Cave Single-stranded library A12397 2.96E+09 312891 128581 17299 4597 13.45 1 53 8661 41.4 (39.8-42.9) 32.1 (30.5-33.6) Cave bear - Denisova Cave Single-stranded library A12398 2.90E+09 575482 233989 31997 8556 13.68 1 53 8550.6 42.6 (41.4-43.7) 31.2 (30.0-32.3) Cave bear - Denisova Cave Single-stranded library A12399 3.05E+09 390168 159622 21812 5958 13.67 1 53.1 9055.4 43 (41.6-44.3) 32.4 (31.0-33.8) Cave bear - Gamsulzen Cave Single-stranded library A12403 2.14E+09 528334 207291 6550 1569 3.16 1 50.4 1339.7 39.6 (37.1-42.1) 24.3 (22.1-26.6) Cave bear - Gamsulzen Cave Single-stranded library A12404 2.38E+09 335637 133795 4366 1029 3.26 1 51.9 1605.1 36.5 (33.5-39.5) 24.6 (21.9-27.4) Cave bear - Gamsulzen Cave Single-stranded library A12405 2.39E+09 395786 154057 4962 1185 3.22 1 51.5 1540.1 38.6 (35.7-41.5) 25.3 (22.7-28.1)

20 of 22 Bokelmann et al. Table S10. F(A|B) population split times of Neanderthal populations from Vindija 33.19.

Specimen Split time from Vindija 33.19 (ka) Lower CI Upper CI Reference Altai Neanderthal (Denisova 5) 140 130 145 Prüfer et al. 2017 (14) Chagyrskaya 8 - 90 100 Mafessoni et al. 2018 (31) Scladina I-4A 105 69 170.9 This study, genetic data from Peyregne et al. 2019 (15) Hohlenstein-Stadel 100.8 80.2 122.4 This study, genetic data from Peyregne et al. 2019 (15) Forbes’ Quarry 93.8 70.8 108.9 This study Mezmaiskaya 1 78.9 70.8 81.2 This study, genetic data from Hajdinjak et al. 2018 (16) El Sidrón 1253 66.9 60.1 80.2 This study, genetic data from Castellano et al. 2014 (18), Kuhlwilm et al. 2016 (17) Mezmaiskaya 2 61.2 59.1 63.8 This study, genetic data from Hajdinjak et al. 2018 (16) Spy 94a 56.7 53.1 59.3 This study, genetic data from Hajdinjak et al. 2018 (16) Les Cottés Z4-1514 63.8 61.7 66.1 This study, genetic data from Hajdinjak et al. 2018 (16) Goyet Q56-1 56.7 53.3 59.1 This study, genetic data from Hajdinjak et al. 2018 (16)

Table S11. Molecular ages obtained by branch shortening for three high-quality Neanderthal genomes.

Specimen Branch shortening estimate (ka) Lower CI Upper CI Reference Vindija 33.19 56.7 50.1 63.3 Prüfer et al. 2017 (14) Chagyrskaya 8 - 71 87 Mafessoni et al. 2018 (31) Altai Neanderthal (Denisova 5) 123 116.6 129.4 Prüfer et al. 2017 (14)

Bokelmann et al. 21 of 22 References 1. Glocke I, Meyer M (2017) Extending the spectrum of DNA sequences retrieved from ancient bones and teeth. Genome Research 27(7):1230–1237. 2. Dabney J, Meyer M (2012) Length and GC-biases during sequencing library amplification: A comparison of various polymerase-buffer systems with ancient and modern DNA sequencing libraries. BioTechniques 52:87–94. 3. Kircher M, Sawyer S, Meyer M (2012) Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform. Nucleic Acids Research 40(1):e3. 4. Rohland N, Reich D (2012) Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Research 22(5):939–946. 5. Meyer M, Kircher M (2010) Illumina sequencing library preparation for highly multiplexed target capture and sequencing. Cold Spring Harbor protocols 2010:pdb.prot5448. 6. Gansauge MT, Meyer M (2013) Single-stranded DNA library preparation for the sequencing of ancient or damaged DNA. Nature protocols 8:737–748. 7. Gansauge MT, Meyer M (2014) Selective enrichment of damaged DNA molecules for ancient genome sequencing. Genome research 24. 8. Gansauge MT, et al. (2017) Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase. Nucleic Acids Research 45:gkx033. 9. Li H, Durbin R (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics (Oxford, England) 25:1754–60. 10. Meyer M, et al. (2012) A high-coverage genome sequence from an archaic Denisovan individual. Science 338(6104):222–226. 11. Renaud G, Stenzel U, Kelso J (2014) LeeHom: Adaptor trimming and merging for Illumina sequencing reads. Nucleic acids research 42. 12. Prüfer K, et al. (2013) The complete genome sequence of a Neandertal from the Altai mountains. Nature 505. 13. Mafessoni F (2018) High coverage Chagyrskaya Neandertal. Exported from https://www.eva.mpg.de/genetics/genome- projects/chagyrskaya-neandertal/home.html?Fsize=0Svea-Developmental on 29. January 2019. 14. Prüfer K, et al. (2017) A high-coverage Neandertal genome from Vindija Cave in Croatia. Science 358(6363):655–658. 15. Peyrégne S, et al. (2019) Nuclear DNA from two early Neandertals reveals 80,000 years of genetic continuity in Europe. Science Advances 5(6):eaaw5873. 16. Hajdinjak M, et al. (2018) Reconstructing the genetic history of late Neanderthals. Nature 555. 17. Kuhlwilm M, et al. (2016) Ancient gene flow from early modern humans into eastern Neanderthals. Nature 530. 18. Castellano S, et al. (2014) Patterns of coding variation in the complete exomes of three Neandertals. Proceedings of the National Academy of Sciences 111(18):6666–6671. 19. Posth C, et al. (2017) Deeply divergent archaic mitochondrial genome provides lower time boundary for African gene flow into Neanderthals. Nature communications 8. 20. Meyer M, et al. (2013) A mitochondrial genome sequence of a hominin from Sima de los Huesos. Nature 505. 21. Katoh K, Misawa K, Kuma Ki, Miyata T (2002) MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic acids research 30:3059–66. 22. Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: More models, new heuristics and parallel computing. Nature Methods 9:772–772. 23. Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic biology 52:696–704. 24. Buck LT, Stringer CB (2015) A rich locality in South Kensington: the fossil hominin collection of the Natural History Museum, London. Geological Journal 50(3):321–337. 25. Skinner AR, et al. (2005) Esr dating at Mezmaiskaya Cave, Russia. Appl Radiat Isot 62(2):219–24. 26. Pinhasi R, Higham TFG, Golovanova LV, Doronichev VB (2011) Revised age of late Neanderthal occupation and the end of the Middle Paleolithic in the northern Caucasus. Proceedings of the National Academy of Sciences 108(21):8611–8616. 27. Toussaint M, Bonjean D (2014) The Scladina I-4A juvenile Neandertal, Andenne, Belgium. Palaeoanthropology and Context. 28. Rougier H, et al. (2016) Neandertal cannibalism and Neandertal bones used as tools in Northern Europe. Scientific Reports 29005. 29. Semal P, et al. (2009) New data on the late Neandertals: Direct dating of the Belgian Spy fossils. American Journal of Physical Anthropology 138(4):421–428. 30. Derevianko A, et al. (2013) Chagyrskaya cave: A Middle Paleolithic site in the Altai. Archaeology, Ethnology and Anthropology of Eurasia 41(1):2 – 27. 31. Mafessoni F, et al. (2018) A high-coverage Neandertal Genome from Chagyrskaya Cave in The Origins of the Upper Paleolithic in Eurasia and the Evolution of the Genus Homo - Proceedings of the International Symposium. (IAET SB RAS Publishing), pp. 51–54. 32. Wood R, et al. (2013) A new date for the Neanderthals from El Sidrón Cave (Asturias, northern Spain). Archaeometry 55:148–158. 33. Dabney J, et al. (2013) Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments. Proceedings of the National Academy of Sciences 110(39):15758–15763.

22 of 22 Bokelmann et al.