DOCSLIB.ORG

De Novo Mutations in EIF2B1 Affecting Eif2 Signaling Cause Neonatal/Early-Onset Diabetes and Transient Hepatic Dysfunction

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
De Novo Mutations in EIF2B1 Affecting Eif2 Signaling Cause Neonatal/Early-Onset Diabetes and Transient Hepatic Dysfunction Diabetes Volume 69, March 2020 477 De Novo Mutations in EIF2B1 Affecting eIF2 Signaling Cause Neonatal/Early-Onset Diabetes and Transient Hepatic Dysfunction Elisa De Franco,1 Richard Caswell,1 Matthew B. Johnson,1 Matthew N. Wakeling,1 Amnon Zung,2 Vu~ Chí Dung,~ 3 C^an Thi Bích Ngoc,3 Rajiv Goonetilleke,4 Maritza Vivanco Jury,5 Mohammed El-Khateeb,6 _ _ Sian Ellard,1 Sarah E. Flanagan,1 David Ron,7 and Andrew T. Hattersley1 Diabetes 2020;69:477–483 | https://doi.org/10.2337/db19-1029 GENETICS/GENOMES/PROTEOMICS/METABOLOMICS Permanent neonatal diabetes mellitus (PNDM) is caused the age of 6 months. A genetic cause is identified in 82% by reduced b-cell number or impaired b-cell function. of cases, resulting in improved treatment in almost Understanding of the genetic basis of this disorder high- 40% (1). lights fundamental b-cell mechanisms. We performed Thirty-nine percent of patients with PNDM have trio genome sequencing for 44 patients with PNDM a genetic etiology resulting in development of at least and their unaffected parents to identify causative de one extrapancreatic feature, alongside diabetes (1). The novo variants. Replication studies were performed in most common PNDM syndromic subtype is Wolcott- 188 patients diagnosed with diabetes before 2 years of Rallison syndrome, which is caused by autosomal re- age without a genetic diagnosis. EIF2B1 (encoding the cessive mutations in the EIF2AK3 gene. Individuals with a eIF2B complex subunit) was the only gene with novel Wolcott-Rallison syndrome usually develop diabetes in the de novo variants (all missense) in at least three patients. first year of life. They also present with repeated episodes of Replication studies identified two further patients with de hepatitis-like liver dysfunction, which eventually results novo EIF2B1 variants. In addition to having diabetes, four of in fatal liver failure, and skeletal dysplasia. The EIF2AK3 five patients had hepatitis-like episodes in childhood. The mutations in these patients are thought to result in EIF2B1 de novo mutations were found to map to the same protein surface. We propose that these variants render the disruption of the unfolded protein response and cell eIF2B complex insensitive to eIF2 phosphorylation, which death due to unregulated endoplasmic reticulum (ER) occurs under stress conditions and triggers expression of stress (2,3). Approximately 15% of individuals with syn- stress response genes. Failure of eIF2B to sense eIF2 dromic PNDM do not have a mutation in one of the known phosphorylation likely leads to unregulated unfolded pro- causative genes, suggesting the existence of novel genetic tein response and cell death. Our results establish de novo subtypes (4). EIF2B1 mutations as a novel cause of permanent diabetes Identifying novel genetic causes of PNDM is cru- and liver dysfunction. These findings confirm the impor- cially important to gain insights into human b-cell tance of cell stress regulation for b-cells and highlight development, function, and survival and could iden- EIF2B1’s fundamental role within this pathway. tify potential targets for novel therapies. We used a trio-based genome sequencing approach to identify heterozygous de novo EIF2B1 mutations as the Permanent neonatal diabetes mellitus (PNDM) is a genet- cause of a novel genetic syndrome characterized by PNDM/ ically and clinically heterogeneous condition diagnosed before early-onset diabetes and transient liver dysfunction. 1Institute of Biomedical and Clinical Science, University of Exeter Medical School, 7Cambridge Institute for Medical Research, University of Cambridge, Cambridge, Exeter, U.K. U.K. 2 Pediatric Endocrinology Unit, Kaplan Medical Center, The Hebrew University of Corresponding author: Elisa De Franco, [email protected] Jerusalem, Rehovot, Israel Received 11 October 2019 and accepted 18 December 2019 3Vietnam National Children’s Hospital, Hanoi, Vietnam 4Hinchingbrooke Hospital, Huntingdon, U.K. © 2019 by the American Diabetes Association. Readers may use this article as 5Hospital Roberto del Río, Universidad de Chile, Santiago, Chile long as the work is properly cited, the use is educational and not for profit, and the 6National Center for Diabetes Endocrinology and Genetics, Amman, Jordan work is not altered. More information is available at https://www.diabetesjournals .org/content/license. 478 Congenital Syndrome and De Novo EIF2B1 Mutations Diabetes Volume 69, March 2020 RESEARCH DESIGN AND METHODS Bank) entry 3ECS (crystal structure of human eIF2Ba 4), Subjects except for the COOH-terminal extension, which was modeled Individuals with PNDM and individuals with early-onset ab initio. All structures were visualized in PyMOL (Molecular diabetes were recruited by their clinicians for genetic Graphics System v2.0; Schrödinger LLC). analysis in the Exeter Molecular Genetics Laboratory. The study was conducted in accordance with the Dec- Data and Resource Availability laration of Helsinki, and allsubjectsortheirparents EIF2B1 mutation details have been deposited in the De- gave informed consent for genetic testing. cipher database (https://decipher.sanger.ac.uk/). All other data sets generated and/or analyzed for this study are Genome Sequencing available from the corresponding author upon reasonable Genome sequencing was performed on DNA extracted request. from peripheral blood leukocytes of 44 probands diag- nosed with PNDM before the age of 6 months and their RESULTS unaffected, unrelated parents. Samples were sequenced on an Illumina HiSeq 2500 with a mean read depth of 30. The Genetic Analysis EIF2B1 fi sequencing data were analyzed using an approach based on was the only gene identi ed with de novo variants EIF2B1 the gatk (Genome Analysis Toolkit) best practices guide- in at least three patients. The three missense variants fi lines. Briefly, the reads were aligned to the hg19/GRCh37 identi ed, p.(Gly44Asp), p.(Gly44Val), and p.(Ser77Asn) human reference genome with BWA-MEM and Picard was (Table 1), were not listed in the GnomAD database (7). All used for duplicates removal and gatk IndelRealigner for affected residues are highly conserved across species (up fi local realignment. gatk HaplotypeCaller was used to iden- to zebra sh for p.Gly44, up to chicken for p.Ser77). No EIF2B1 tify variants, which were annotated using Alamut Batch deletions or duplications involving were detected. EIF2B1 1.8 (Interactive Biosoftware, Rouen, France). Variants that Sequencing of in 188 further patients without failed the QD2 VCF filter or had five or fewer reads a known genetic diagnosis who had developed diabetes fi supporting the variant were excluded. Copy number var- before the age of 2 years identi ed two additional EIF2B1 iations (CNVs) were called by SavvyCNV (5), which uses novel heterozygous variants, p.(Leu34Trp) and read depth to predict copy number. p.(*306Thrext*12). Parental testing showed that both variants had arisen de novo. Targeted Next-Generation Sequencing Replication studies were performed in a cohort of Clinical Features 188 patients diagnosed with diabetes before 2 years of age The clinical features of the five subjects with de novo in whom the 25 known genetic causes of neonatal diabetes EIF2B1 mutations are summarized in Table 1. All had been had been excluded. Patients were analyzed using a targeted diagnosed with permanent diabetes between the ages of next-generation sequencing assay, including the known 4 and 56 weeks and were treated with full replacement monogenic diabetes genes and additional candidate genes, insulin doses (range 0.46–1.00 units/kg/day). All four EIF2B1 fi such as (NM_001414.3). Variant con rmation and patients for whom data were available had low birth weight cosegregation in family members were performed by (,20th centile, SDS range 20.84 to 21.74) consistent Sanger sequencing. with reduced insulin secretion in utero. Four of the five patients had suffered episodes of Sanger Sequencing Confirmation hepatic dysfunction in childhood with hepatitis-like de- EIF2B1 exon 3 (NM_001414.3) was amplified using rangement of liver enzymes. The severity of these episodes in-house designed primers (F, TGTTCACTGATGTATCCCT was variable: for case subject 3, the first episode resulted in AGCA, and R, TCCTAGGAAGAAAAGAGCAAACT). PCR fatal acute liver failure, while the other three cases resolved products were sequenced on an ABI3730 capillary machine with return to normal liver function and enzymes. Case (Applied Biosystems) and analyzed using Mutation Sur- subject 1 presented once with elevated liver enzymes at the veyor, version 3.98 (SoftGenetics). The bioinformatics ageof38months.Casesubjects4and5experienced tools SIFT, PolyPhen-2, and Align GVGD were accessed multiple episodes requiring hospitalization between the through the Alamut Visual software (Interactive Biosoft- ages of 5 months and 5.5 years but have not experienced ware) to predict the effect of the variants. any further episodes (current ages 13 and 18 years). Variants are reported using the Human Genome Var- No severe neurological features were reported; how- iation Society (HGVS) nomenclature guidelines (6). ever, case subject 4 has a mild learning disability and case Molecular Modeling of the EIF2B1 Stop-Loss Variant subject 5 has attention deficit disorder. The predicted structure of the EIF2B1 stop-loss variant, c.915_916del, p.(*306Thrext*12), was modeled using the In Silico Protein Analysis Phyre2 Web server in intensive mode 3, with the full- EIF2B1 encodes for the a-subunit of the heterodecameric length sequence of variant eIF2Ba
Load more

Recommended publications
  • WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).
    [Show full text]
  • 1 1 2 Pharmacological Dimerization and Activation of the Exchange
    1 2 3 Pharmacological dimerization and activation of the exchange factor eIF2B antagonizes the 4 integrated stress response 5 6 7 *Carmela Sidrauski1,2, *Jordan C. Tsai1,2, Martin Kampmann2,3, Brian R. Hearn4, Punitha 8 Vedantham4, Priyadarshini Jaishankar4 , Masaaki Sokabe5, Aaron S. Mendez1,2, Billy W. 9 Newton6, Edward L. Tang6.7, Erik Verschueren6, Jeffrey R. Johnson6,7, Nevan J. Krogan6,7,, 10 Christopher S. Fraser5, Jonathan S. Weissman2,3, Adam R. Renslo4, and Peter Walter 1,2 11 12 1Department of Biochemistry and Biophysics, University of California, San Francisco, United 13 States 14 2Howard Hughes Medical Institute, University of California, San Francisco, United States 15 3Department of Cellular and Molecular Pharmacology, University of California, San Francisco, 16 United States 17 4Department of Pharmaceutical Chemistry and the Small Molecule Discovery Center, University 18 of California at San Francisco, United States 19 5Department of Molecular and Cellular Biology, College of Biological Sciences, University of 20 California, Davis, United States 21 6QB3, California Institute for Quantitative Biosciences, University of California, San Francisco, 22 United States 23 7Gladstone Institutes, San Francisco, United States 24 25 * Both authors contributed equally to this work 26 27 28 Abstract 29 30 The general translation initiation factor eIF2 is a major translational control point. Multiple 31 signaling pathways in the integrated stress response phosphorylate eIF2 serine-51, inhibiting 32 nucleotide exchange by eIF2B. ISRIB, a potent drug-like small molecule, renders cells 33 insensitive to eIF2α phosphorylation and enhances cognitive function in rodents by blocking 34 long-term depression. ISRIB was identified in a phenotypic cell-based screen, and its mechanism 35 of action remained unknown.
    [Show full text]
  • Relevance of Translation Initiation in Diffuse Glioma Biology and Its
    cells Review Relevance of Translation Initiation in Diffuse Glioma Biology and its Therapeutic Potential Digregorio Marina 1, Lombard Arnaud 1,2, Lumapat Paul Noel 1, Scholtes Felix 1,2, Rogister Bernard 1,3 and Coppieters Natacha 1,* 1 Laboratory of Nervous System Disorders and Therapy, GIGA-Neurosciences Research Centre, University of Liège, 4000 Liège, Belgium; [email protected] (D.M.); [email protected] (L.A.); [email protected] (L.P.N.); [email protected] (S.F.); [email protected] (R.B.) 2 Department of Neurosurgery, CHU of Liège, 4000 Liège, Belgium 3 Department of Neurology, CHU of Liège, 4000 Liège, Belgium * Correspondence: [email protected] Received: 18 October 2019; Accepted: 26 November 2019; Published: 29 November 2019 Abstract: Cancer cells are continually exposed to environmental stressors forcing them to adapt their protein production to survive. The translational machinery can be recruited by malignant cells to synthesize proteins required to promote their survival, even in times of high physiological and pathological stress. This phenomenon has been described in several cancers including in gliomas. Abnormal regulation of translation has encouraged the development of new therapeutics targeting the protein synthesis pathway. This approach could be meaningful for glioma given the fact that the median survival following diagnosis of the highest grade of glioma remains short despite current therapy. The identification of new targets for the development of novel therapeutics is therefore needed in order to improve this devastating overall survival rate. This review discusses current literature on translation in gliomas with a focus on the initiation step covering both the cap-dependent and cap-independent modes of initiation.
    [Show full text]
  • 206584751.Pdf
    RESEARCH ARTICLE elifesciences.org Pharmacological dimerization and activation of the exchange factor eIF2B antagonizes the integrated stress response Carmela Sidrauski1,2*†‡, Jordan C Tsai1,2†, Martin Kampmann2,3, Brian R Hearn4,5, Punitha Vedantham4,5, Priyadarshini Jaishankar4,5, Masaaki Sokabe6, Aaron S Mendez2,3, Billy W Newton7, Edward L Tang7,8, Erik Verschueren7, Jeffrey R Johnson7,8, Nevan J Krogan7,8, Christopher S Fraser6, Jonathan S Weissman2,3, Adam R Renslo4,5, Peter Walter1,2* 1Department of Biochemistry and Biophysics, University of California, San Francisco, San Francisco, United States; 2Howard Hughes Medical Institution, University of California, San Francisco, San Francisco, United States; 3Department of Cellular and Molecular Pharmacology, University of California, San Francisco, San Francisco, United States; 4Department of Pharmaceutical Chemistry, University of California, San Francisco, San Francisco, United States; 5Small Molecule Discovery Center, University of California, San Francisco, San Francisco, United States; 6Department of Molecular and Cellular Biology, College of Biological Sciences, University of California, Davis, Davis, United States; 7QB3, California Institute for Quantitative Biosciences, University of California, San Francisco, San Francisco, United States; 8Gladstone *For correspondence: Institutes, San Francisco, United States [email protected] (CS); peter@ walterlab.ucsf.edu (PW) †These authors contributed equally to this work Abstract The general translation initiation factor eIF2 is a major translational control point. Multiple signaling pathways in the integrated stress response phosphorylate eIF2 serine-51, ‡ Present address: Calico LLC, inhibiting nucleotide exchange by eIF2B. ISRIB, a potent drug-like small molecule, renders cells South San Francisco, United insensitive to eIF2α phosphorylation and enhances cognitive function in rodents by blocking long- States term depression.
    [Show full text]
  • Stability of Endogenous Reference Genes in Postmortem Human Brains
    Int J Legal Med DOI 10.1007/s00414-012-0774-7 ORIGINAL ARTICLE Stability of endogenous reference genes in postmortem human brains for normalization of quantitative real-time PCR data: comprehensive evaluation using geNorm, NormFinder, and BestKeeper Qi Wang & Takaki Ishikawa & Tomomi Michiue & Bao-Li Zhu & Da-Wei Guan & Hitoshi Maeda Received: 10 July 2012 /Accepted: 14 September 2012 # Springer-Verlag Berlin Heidelberg 2012 Abstract In forensic molecular pathology, quantitative met standard efficiency criteria. Validation of their stability real-time polymerase chain reaction (RT-qPCR) provides and suitability as reference genes using geNorm suggested a rapid and sensitive method to investigate functional IPO8 and POLR2A as the most stable ones, and NormFinder changes in the death process. Accurate and reliable indicated that IPO8 and POP4 had the highest expression relative RT-qPCR requires ideal amplification efficien- stabilities, while BestKeeper highlighted ABL1 and cies of target and reference genes. However, the ampli- ELF1 as reference genes with the least overall variation. fication efficiency, changing during PCR, may be Combining these three algorithms suggested the genes overestimated by the traditional standard curve method. IPO8, POLR2A, and PES1 as stable endogenous refer- No single gene meets the criteria of an ideal endoge- ences in RT-qPCR analysis of human brain samples, nous reference. Therefore, it is necessary to select suitable with YWHAZ, PPIA, HPRT1, and TBP being the least reference genes for specific requirements. The present stable ones. These findings are inconsistent with those of study evaluated 32 potential reference genes in the human previous studies. Moreover, the relative stability of target and brain of 15 forensic autopsy cases using three different statis- reference genes remains unknown.
    [Show full text]
  • The Mechanism of Eukaryotic Translation Initiation: New Insights and Challenges
    Downloaded from http://cshperspectives.cshlp.org/ on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press The Mechanism of Eukaryotic Translation Initiation: New Insights and Challenges Alan G. Hinnebusch1 and Jon R. Lorsch2 1Laboratory of Gene Regulation and Development, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892 2Department of Biophysics and Biophysical Chemistry, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205 Correspondence: [email protected]; [email protected] Translation initiation in eukaryotes is a highly regulated and complex stage of gene expres- sion. It requires the action of at least 12 initiation factors, many of which are known to be the targets of regulatory pathways. Here we review our current understanding of the molecular mechanics of eukaryotic translation initiation, focusing on recent breakthroughs from in vitro and in vivo studies. We also identify important unanswered questions that will require new ideas and techniques to solve. his work aims to present the current state of current paradigm outlined below (Hinnebusch Tour knowledge of the molecular mechanics et al. 2007; Pestova et al. 2007; Lorsch and Dever of translation initiation in eukaryotes. Wefocus 2010; Hinnebusch 2011; Parsyan et al. 2011). on advances that have taken place over the last Identification of the initiation codon by the few years and, because of space limitations, as- eukaryotic translational machinery begins with sume readers will be able to find referencesto the binding of the ternary complex (TC) consisting foundational literature for the field (published of initiator methionyl-tRNA (Met-tRNAi) and before 2000) in the more recent works that are the GTP-bound form of eukaryotic initiation cited here.
    [Show full text]
  • Csde1 Cooperates with Strap to Control Translation of Erythroid Transcripts
    bioRxiv preprint doi: https://doi.org/10.1101/203539; this version posted October 23, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Csde1 cooperates with Strap to control translation of erythroid transcripts Kat S. Moore1, Nurcan Yagci1, Floris van Alphen2, Alexander B. Meijer2,3, Peter A.C. ‘t Hoen4, Marieke von Lindern1* 1) Department of Hematopoiesis, Sanquin, and Landsteiner Laboratory AMC/UvA, Amsterdam, The Netherlands 2) Department of Research Facilities, Sanquin Research, Amsterdam, The Netherlands 3) Department of Biomolecular Mass Spectrometry and Proteomics, Utrecht Institute for Pharmaceutical Sciences, Utrecht University, Utrecht, The Netherlands 4) Department of Human Genetics, Leiden University Medical Center, Leiden, The Netherlands * To whom correspondence should be addressed. Tel: +31 20 512 3377; Fax: +31 20 512 3474; Email: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/203539; this version posted October 23, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Erythropoiesis is regulated at many levels, including control of mRNA translation. Changing environmental conditions, such as hypoxia, or the availability of nutrients and growth factors, require a rapid response enacted by the enhanced or repressed translation of existing transcripts. Csde1 is an RNA-binding protein required for erythropoiesis and strongly upregulated in erythroblasts relative to other hematopoietic progenitors. The aim of this study is to identify the Csde1-containing protein complexes, and investigate their role in regulating the translation of Csde1-bound transcripts.
    [Show full text]
  • Fifteen Novel EIF2B1-5 Mutations Identified in Chinese Children with Leukoencephalopathy Withvanishingwhitematterandalongterm Follow-Up
    RESEARCH ARTICLE Fifteen Novel EIF2B1-5 Mutations Identified in Chinese Children with Leukoencephalopathy withVanishingWhiteMatterandaLongTerm Follow-Up Haihua Zhang1, Lifang Dai1, Na Chen1, Lili Zang1, Xuerong Leng1,LiDu1, Jingmin Wang1, Yuwu Jiang1, Feng Zhang2, Xiru Wu1,YeWu1* 1 Department of Pediatrics, Peking University First Hospital, Beijing, China, 2 School of Life Sciences, Fudan University, Shanghai, China * [email protected] Abstract Leukoencephalopathy with vanishing white matter (VWM) is one of the most prevalent in- OPEN ACCESS herited childhood white matter disorders, which caused by mutations in each of the five sub- EIF2B1-5 Citation: Zhang H, Dai L, Chen N, Zang L, Leng X, units of eukaryotic translation initiation factor 2B ( ). In our study, 34 out of the 36 Du L, et al. (2015) Fifteen Novel EIF2B1-5 Mutations clinically diagnosed children (94%) were identified to have EIF2B1-5 mutations by sequenc- Identified in Chinese Children with ing. 15 novel mutations were identified. CNVs were not detected in patients with only one Leukoencephalopathy with Vanishing White Matter mutant allele and mutation-negative determined by gene sequencing. There is a significant- and a Long Term Follow-Up. PLoS ONE 10(3): EIF2B3 e0118001. doi:10.1371/journal.pone.0118001 ly higher incidence of patients with mutations compared with Caucasian patients (32% vs. 4%). c.1037T>C (p.Ile346Thr) in EIF2B3 was confirmed to be a founder mutation Academic Editor: Zhi-Ying Wu, Huashan Hospital, Fudan University, CHINA in Chinese, which probably one of the causes of the genotypic differences between ethnici- ties. Our average 4.4 years-follow-up on infantile, early childhood and juvenile VWM chil- Received: September 3, 2014 dren suggested a rapid deterioration in motor function.
    [Show full text]
  • EIF2B1 Gene Eukaryotic Translation Initiation Factor 2B Subunit Alpha
    EIF2B1 gene eukaryotic translation initiation factor 2B subunit alpha Normal Function The EIF2B1 gene provides instructions for making one of five parts of a protein called eIF2B, specifically the alpha subunit of this protein. The eIF2B protein helps regulate overall protein production (synthesis) in the cell by interacting with another protein, eIF2. The eIF2 protein is called an initiation factor because it is involved in starting (initiating) protein synthesis. Under some conditions, eIF2B increases protein synthesis by helping to recycle molecules called GTP, which carry energy to the initiation factor. Under other conditions, it slows protein synthesis by binding tightly to the initiation factor, which converts the eIF2B protein into an inactive form and prevents recycling of GTP. Proper regulation of protein synthesis is vital for ensuring that the correct levels of protein are available for the cell to cope with changing conditions. For example, cells must synthesize protein much faster if they are multiplying than if they are in a resting state. Health Conditions Related to Genetic Changes Leukoencephalopathy with vanishing white matter Mutations in the EIF2B1 gene have been identified in a few people with leukoencephalopathy with vanishing white matter. These mutations cause partial loss of eIF2B function. Impairment of eIF2B function makes it more difficult for the body's cells to regulate protein synthesis and deal with changing conditions and stress. Researchers believe that cells in the white matter (nerve fibers covered by a fatty substance called myelin that insulates and protects nerves) may be particularly affected by an abnormal response to stress, resulting in the signs and symptoms of leukoencephalopathy with vanishing white matter.
    [Show full text]
  • Eukaryotic Translation Initiation Factors As Promising Targets in Cancer Therapy
    Hao et al. Cell Communication and Signaling (2020) 18:175 https://doi.org/10.1186/s12964-020-00607-9 REVIEW Open Access Eukaryotic translation initiation factors as promising targets in cancer therapy Peiqi Hao1,2†, Jiaojiao Yu1†, Richard Ward3, Yin Liu2, Qiao Hao2,SuAn2* and Tianrui Xu2* Abstract The regulation of the translation of messenger RNA (mRNA) in eukaryotic cells is critical for gene expression, and occurs principally at the initiation phase which is mainly regulated by eukaryotic initiation factors (eIFs). eIFs are fundamental for the translation of mRNA and as such act as the primary targets of several signaling pathways to regulate gene expression. Mis-regulated mRNA expression is a common feature of tumorigenesis and the abnormal activity of eIF complexes triggered by upstream signaling pathways is detected in many tumors, leading to the selective translation of mRNA encoding proteins involved in tumorigenesis, metastasis, or resistance to anti-cancer drugs, and making eIFs a promising therapeutic target for various types of cancers. Here, we briefly outline our current understanding of the biology of eIFs, mainly focusing on the effects of several signaling pathways upon their functions and discuss their contributions to the initiation and progression of tumor growth. An overview of the progress in developing agents targeting the components of translation machinery for cancer treatment is also provided. Keywords: eIF, mRNA translation, Cancer, MAPK, PI3K/Akt, mTOR Background eukaryotes utilize many more initiation factors than do pro- The regulation of gene expression in eukaryotes can occur karyotes, reflecting the greater biological complexity of at different stages including gene transcription and mRNA eukaryotic translation.
    [Show full text]
  • Autocrine IFN Signaling Inducing Profibrotic Fibroblast Responses By
    Downloaded from http://www.jimmunol.org/ by guest on September 23, 2021 Inducing is online at: average * The Journal of Immunology , 11 of which you can access for free at: 2013; 191:2956-2966; Prepublished online 16 from submission to initial decision 4 weeks from acceptance to publication August 2013; doi: 10.4049/jimmunol.1300376 http://www.jimmunol.org/content/191/6/2956 A Synthetic TLR3 Ligand Mitigates Profibrotic Fibroblast Responses by Autocrine IFN Signaling Feng Fang, Kohtaro Ooka, Xiaoyong Sun, Ruchi Shah, Swati Bhattacharyya, Jun Wei and John Varga J Immunol cites 49 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130037 6.DC1 This article http://www.jimmunol.org/content/191/6/2956.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 23, 2021. The Journal of Immunology A Synthetic TLR3 Ligand Mitigates Profibrotic Fibroblast Responses by Inducing Autocrine IFN Signaling Feng Fang,* Kohtaro Ooka,* Xiaoyong Sun,† Ruchi Shah,* Swati Bhattacharyya,* Jun Wei,* and John Varga* Activation of TLR3 by exogenous microbial ligands or endogenous injury-associated ligands leads to production of type I IFN.
    [Show full text]
  • Vaccine-Increased Seq ID Unigene ID Uniprot ID Gene Names
    BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Vaccine-Increased Seq ID Unigene ID Uniprot ID Gene Names 1_HSPA1A_3303 Hs.274402 P0DMV8 HSPA1A HSP72 HSPA1 HSX70 100_AKAP17A_8227 Hs.522572 Q02040 AKAP17A CXYorf3 DXYS155E SFRS17A XE7 1000_H2AFY_9555 Hs.420272 O75367 H2AFY MACROH2A1 1001_ITPK1_3705 Hs.308122 Q13572 ITPK1 1002_PTPN11_5781 Hs.506852 Q06124 PTPN11 PTP2C SHPTP2 1003_EIF3J_8669 Hs.404056 O75822 EIF3J EIF3S1 PRO0391 1004_TRIP12_9320 Hs.591633 Q14669 TRIP12 KIAA0045 ULF 1006_YEATS2_55689 Hs.632575 Q9ULM3 YEATS2 KIAA1197 1007_SEL1L3_23231 Hs.479384 Q68CR1 SEL1L3 KIAA0746 1008_IDH1_3417 Hs.593422 O75874 IDH1 PICD 101_HSPH1_10808 Hs.36927 Q92598 HSPH1 HSP105 HSP110 KIAA0201 1010_LDLR_3949 Hs.213289 P01130 LDLR 1011_FAM129B_64855 Hs.522401 Q96TA1 NIBAN2 C9orf88 FAM129B 1012_MAP3K5_4217 Hs.186486 Q99683 MAP3K5 ASK1 MAPKKK5 MEKK5 1013_NEFH_4744 Hs.198760 P12036 NEFH KIAA0845 NFH 1014_RAP1B_5908 Hs.369920 P61224 RAP1B OK/SW-cl.11 1015_MCCC1_56922 Hs.47649 Q96RQ3 MCCC1 MCCA 1017_MT1E_4493 Hs.534330 P04732 MT1E 1022_TXNDC5_81567 Hs.150837 Q8NBS9 TXNDC5 TLP46 UNQ364/PRO700 1023_STRA13_201254 Hs.37616 O14503 BHLHE40 BHLHB2 DEC1 SHARP2 STRA13 1024_NPEPPS_9520 Hs.443837 P55786 NPEPPS PSA 1025_YIPF6_286451 Hs.82719 Q96EC8 YIPF6 1026_CLIP1_6249 Hs.524809 P30622 CLIP1 CYLN1 RSN 1027_SRSF7_6432 Hs.309090 Q16629 SRSF7 SFRS7 103_RPS25_6230 Hs.512676 P62851 RPS25 1031_SOCS7_30837
    [Show full text]