De Novo Mutations in EIF2B1 Affecting Eif2 Signaling Cause Neonatal/Early-Onset Diabetes and Transient Hepatic Dysfunction

Diabetes Volume 69, March 2020 477

De Novo Mutations in EIF2B1 Affecting eIF2 Signaling Cause Neonatal/Early-Onset Diabetes and Transient Hepatic Dysfunction

Elisa De Franco,1 Richard Caswell,1 Matthew B. Johnson,1 Matthew N. Wakeling,1 Amnon Zung,2 Vu~ Chí Dung,~ 3 C^an Thi Bích Ngoc,3 Rajiv Goonetilleke,4 Maritza Vivanco Jury,5 Mohammed El-Khateeb,6 _ _ Sian Ellard,1 Sarah E. Flanagan,1 David Ron,7 and Andrew T. Hattersley1

Diabetes 2020;69:477–483 | https://doi.org/10.2337/db19-1029 GENETICS/GENOMES/PROTEOMICS/METABOLOMICS

Permanent neonatal diabetes mellitus (PNDM) is caused the age of 6 months. A genetic cause is identified in 82% by reduced b-cell number or impaired b-cell function. of cases, resulting in improved treatment in almost Understanding of the genetic basis of this disorder high- 40% (1). lights fundamental b-cell mechanisms. We performed Thirty-nine percent of patients with PNDM have trio genome sequencing for 44 patients with PNDM a genetic etiology resulting in development of at least and their unaffected parents to identify causative de one extrapancreatic feature, alongside diabetes (1). The novo variants. Replication studies were performed in most common PNDM syndromic subtype is Wolcott- 188 patients diagnosed with diabetes before 2 years of Rallison syndrome, which is caused by autosomal re- age without a genetic diagnosis. EIF2B1 (encoding the cessive mutations in the EIF2AK3 gene. Individuals with a eIF2B complex subunit) was the only gene with novel Wolcott-Rallison syndrome usually develop diabetes in the de novo variants (all missense) in at least three patients. first year of life. They also present with repeated episodes of Replication studies identified two further patients with de hepatitis-like liver dysfunction, which eventually results novo EIF2B1 variants. In addition to having diabetes, four of in fatal liver failure, and skeletal dysplasia. The EIF2AK3 five patients had hepatitis-like episodes in childhood. The mutations in these patients are thought to result in EIF2B1 de novo mutations were found to map to the same protein surface. We propose that these variants render the disruption of the unfolded protein response and cell eIF2B complex insensitive to eIF2 phosphorylation, which death due to unregulated endoplasmic reticulum (ER) occurs under stress conditions and triggers expression of stress (2,3). Approximately 15% of individuals with syn- stress response genes. Failure of eIF2B to sense eIF2 dromic PNDM do not have a mutation in one of the known phosphorylation likely leads to unregulated unfolded pro- causative genes, suggesting the existence of novel genetic tein response and cell death. Our results establish de novo subtypes (4). EIF2B1 mutations as a novel cause of permanent diabetes Identifying novel genetic causes of PNDM is cru- and liver dysfunction. These findings confirm the impor- cially important to gain insights into human b-cell tance of cell stress regulation for b-cells and highlight development, function, and survival and could iden- EIF2B1’s fundamental role within this pathway. tify potential targets for novel therapies. We used a trio-based genome sequencing approach to identify heterozygous de novo EIF2B1 mutations as the Permanent neonatal diabetes mellitus (PNDM) is a genet- cause of a novel genetic syndrome characterized by PNDM/ ically and clinically heterogeneous condition diagnosed before early-onset diabetes and transient liver dysfunction.

1Institute of Biomedical and Clinical Science, University of Exeter Medical School, 7Cambridge Institute for Medical Research, University of Cambridge, Cambridge, Exeter, U.K. U.K. 2 Pediatric Endocrinology Unit, Kaplan Medical Center, The Hebrew University of Corresponding author: Elisa De Franco, [email protected] Jerusalem, Rehovot, Israel Received 11 October 2019 and accepted 18 December 2019 3Vietnam National Children’s Hospital, Hanoi, Vietnam 4Hinchingbrooke Hospital, Huntingdon, U.K. © 2019 by the American Diabetes Association. Readers may use this article as 5Hospital Roberto del Río, Universidad de Chile, Santiago, Chile long as the work is properly cited, the use is educational and not for proﬁt, and the 6National Center for Diabetes Endocrinology and Genetics, Amman, Jordan work is not altered. More information is available at https://www.diabetesjournals .org/content/license. 478 Congenital Syndrome and De Novo EIF2B1 Mutations Diabetes Volume 69, March 2020

RESEARCH DESIGN AND METHODS Bank) entry 3ECS (crystal structure of human eIF2Ba 4), Subjects except for the COOH-terminal extension, which was modeled Individuals with PNDM and individuals with early-onset ab initio. All structures were visualized in PyMOL (Molecular diabetes were recruited by their clinicians for genetic Graphics System v2.0; Schrödinger LLC). analysis in the Exeter Molecular Genetics Laboratory. The study was conducted in accordance with the Dec- Data and Resource Availability laration of Helsinki, and allsubjectsortheirparents EIF2B1 mutation details have been deposited in the De- gave informed consent for genetic testing. cipher database (https://decipher.sanger.ac.uk/). All other data sets generated and/or analyzed for this study are Genome Sequencing available from the corresponding author upon reasonable Genome sequencing was performed on DNA extracted request. from peripheral blood leukocytes of 44 probands diagnosed with PNDM before the age of 6 months and their RESULTS unaffected, unrelated parents. Samples were sequenced on an Illumina HiSeq 2500 with a mean read depth of 30. The Genetic Analysis EIF2B1 fi sequencing data were analyzed using an approach based on was the only gene identi ed with de novo variants EIF2B1 the gatk (Genome Analysis Toolkit) best practices guide- in at least three patients. The three missense variants fi lines. Briefly, the reads were aligned to the hg19/GRCh37 identi ed, p.(Gly44Asp), p.(Gly44Val), and p.(Ser77Asn) human reference genome with BWA-MEM and Picard was (Table 1), were not listed in the GnomAD database (7). All used for duplicates removal and gatk IndelRealigner for affected residues are highly conserved across species (up fi local realignment. gatk HaplotypeCaller was used to iden- to zebra sh for p.Gly44, up to chicken for p.Ser77). No EIF2B1 tify variants, which were annotated using Alamut Batch deletions or duplications involving were detected. EIF2B1 1.8 (Interactive Biosoftware, Rouen, France). Variants that Sequencing of in 188 further patients without failed the QD2 VCF filter or had five or fewer reads a known genetic diagnosis who had developed diabetes fi supporting the variant were excluded. Copy number var- before the age of 2 years identi ed two additional EIF2B1 iations (CNVs) were called by SavvyCNV (5), which uses novel heterozygous variants, p.(Leu34Trp) and read depth to predict copy number. p.(*306Thrext*12). Parental testing showed that both variants had arisen de novo. Targeted Next-Generation Sequencing Replication studies were performed in a cohort of Clinical Features 188 patients diagnosed with diabetes before 2 years of age The clinical features of the five subjects with de novo in whom the 25 known genetic causes of neonatal diabetes EIF2B1 mutations are summarized in Table 1. All had been had been excluded. Patients were analyzed using a targeted diagnosed with permanent diabetes between the ages of next-generation sequencing assay, including the known 4 and 56 weeks and were treated with full replacement monogenic diabetes genes and additional candidate genes, insulin doses (range 0.46–1.00 units/kg/day). All four EIF2B1 fi such as (NM_001414.3). Variant con rmation and patients for whom data were available had low birth weight cosegregation in family members were performed by (,20th centile, SDS range 20.84 to 21.74) consistent Sanger sequencing. with reduced insulin secretion in utero. Four of the five patients had suffered episodes of Sanger Sequencing Confirmation hepatic dysfunction in childhood with hepatitis-like de- EIF2B1 exon 3 (NM_001414.3) was amplified using rangement of liver enzymes. The severity of these episodes in-house designed primers (F, TGTTCACTGATGTATCCCT was variable: for case subject 3, the first episode resulted in AGCA, and R, TCCTAGGAAGAAAAGAGCAAACT). PCR fatal acute liver failure, while the other three cases resolved products were sequenced on an ABI3730 capillary machine with return to normal liver function and enzymes. Case (Applied Biosystems) and analyzed using Mutation Sur- subject 1 presented once with elevated liver enzymes at the veyor, version 3.98 (SoftGenetics). The bioinformatics ageof38months.Casesubjects4and5experienced tools SIFT, PolyPhen-2, and Align GVGD were accessed multiple episodes requiring hospitalization between the through the Alamut Visual software (Interactive Biosoft- ages of 5 months and 5.5 years but have not experienced ware) to predict the effect of the variants. any further episodes (current ages 13 and 18 years). Variants are reported using the Human Genome Var- No severe neurological features were reported; how- iation Society (HGVS) nomenclature guidelines (6). ever, case subject 4 has a mild learning disability and case Molecular Modeling of the EIF2B1 Stop-Loss Variant subject 5 has attention deficit disorder. The predicted structure of the EIF2B1 stop-loss variant, c.915_916del, p.(*306Thrext*12), was modeled using the In Silico Protein Analysis Phyre2 Web server in intensive mode 3, with the full- EIF2B1 encodes for the a-subunit of the heterodecameric length sequence of variant eIF2Ba as input. The resulting eIF2B complex, which modulates the activity of the eukary- structure was modeled entirely on PDB (Protein Data otic translation initiation factor 2 (eIF2) to regulate 479

Table 1—Patients’ clinical features Case subject number 12 3 4 5 Mutation c.131G.A, c.131G.T, c.230G.A, c.101T.G, c.915_916del, p.(Gly44Asp) p.(Gly44Val) p.(Ser77Asn) p.(Leu34Trp) p.(*306Thrext*12) De novo Yes Yes Yes Yes Yes Sex Male Male Female Male Male Current age (years) 5 5 Deceased 13 18 Country Vietnam Jordan Chile England Israel Birth weight (g) 2,600 3,000 2,986 2,920 3,600 Gestation (weeks) 39 N/A 40 40 42 Birth weight centile (SDS) 4th (21.74) N/A 18th (20.90) 7th (21.44) 20th (20.84) Diabetes features Age at onset 9 weeks 4 weeks 17 weeks 56 weeks 21 weeks Insulin treatment From diagnosis, From diagnosis, From diagnosis, From diagnosis, From diagnosis, 0.46 units/kg/day 0.8 units/kg/day 1.0 units/kg/day 0.7 units/kg/day 0.75 units/kg/day (at 2 months) Hepatic features Age at first episode of liver dysfunction 38 months None reported 16 months 18 months 5 months Outcome of first episode Resolved N/A Deceased Resolved Resolved Recurrent episodes No N/A N/A Yes, 8 episodes Yes, 2 episodes Age at last episode of liver dysfunction N/A N/A N/A 5.5 years 5.5 months Other features Neurological features None None None Mild learning disability Attention deficit disorder Additional comments Anemia Died at 16 months Renal failure at 14 years after respiratory infection and acute liver failure N/A, not available. diabetes.diabetesjournals.org De Franco and Associates 480 Congenital Syndrome and De Novo EIF2B1 Mutations Diabetes Volume 69, March 2020

Figure 1—Heterozygous EIF2B1 variants in neonatal diabetes lie in the binding surface for phosphorylated eIF2a. A: Structure of human eIF2B in complex with phosphorylated eIF2a Ser51 (eIF2a[Ser51-P]) (PDB identification 6o9z [12]); the eIF2B complex is a heterodecamer comprised of two molecules each of subunits a, b, g, d, and e. B:AsinA but shown without phosphorylated eIF2a Ser51; positions of heterozygous missense variants in eIF2Ba identified in patients with neonatal diabetes are colored red and labeled in black font, the position of the homozygous p.(Leu49Arg) variant reported in a VWM patient is colored orange and labeled in blue font, and Leu305 (gray) is the COOH- terminal (C-terminal) residue of eIF2Ba. C: The stop-loss variant c.915_916del, p.(*306Thrext*12), is expected to result in the addition of 12 novel amino acids (Thr-Cys-Glu-Pro-Phe-Pro-Ala-Lys-Val-Gln-Leu-Thr) to the COOH-terminal of eIF2B; this COOH-terminal extension (dark red) was predicted to form a short helix extending from Leu305 lying across the surface bound by phosphorylated eIF2a Ser51. D:Asin A but zoomed and showing selected subunits (phosphorylated eIF2a Ser51and eIF2B subunits b, d, and a9) in ribbon format. Surface positions of heterozygous missense variants identified in patients with neonatal patients are colored red, and the position of the homozygous diabetes.diabetesjournals.org De Franco and Associates 481 translation initiation and protein synthesis in basal and supporting our hypothesis that the mutations identified in stress cell conditions. Under cell stress, serine 51 of eIF2a our patients do not result in complete loss of function of is phosphorylated by kinases of the integrated stress re- the eIF2B complex. sponse (ISR) (8). This phosphorylation results in altered eIF2B regulates translation initiation and protein syn- interaction with eIF2B to inhibit the rate of translation of thesis by modulating eIF2 activity. During protein syn- most mRNAs, with the exception of stress response gene thesis under normal conditions, eIF2B acts to recycle RNAs, which are able to circumvent this block to allow cell initiation factor eIF2 for further rounds of translation by recovery (9,10). The recent publication of the structures of promoting its dissociation from GDP, allowing replace- human eIF2B in complex with both phosphorylated and ment by GTP and subsequent association of GTP-bound nonphosphorylated eIF2 (11,12) showed that in its non- eIF2 with the initiator methionyl-tRNA. Under stress phosphorylated form, eIF2a makes contact with the conditions, specific kinases phosphorylate the serine 51 of eIF2Bb, g, and d subunits—but not with eIF2Ba. How- eIF2a (8) resulting in inhibition of GDP dissociation, ever, upon Ser51 phosphorylation, eIF2a binds tightly to attenuating recycling of eIF2 to its active GTP-bound form eIF2Ba, resulting in a markedly different orientation of through altered interaction with eIF2B and consequently eIF2 in the complex with eIF2B (Fig. 1A). inhibiting the rate of translation of most mRNAs (9,10) Mapping the heterozygous EIF2B1 variants from our (Fig. 2A). five case subjects shows that these all lie at the same Mapping the heterozygous EIF2B1 variants identified in surface as that occupied by phosphorylated eIF2a (Fig. the five case subjects we report shows that these all localize 1B). Moreover, one of these variants (identified in case at the same surface as that occupied by phosphorylated subject 3) occurs at p.Ser77 of eIF2Ba, which makes both eIF2a (Fig. 1B). Moreover one variant, p.(Ser77Asn), iden- hydrogen-bonded and nonbonded contacts with residues tified in case subject 3, occurs at a residue that directly of phosphorylated eIF2a. In the stop-loss variant identi- interacts with phosphorylated eIF2a. Two mutations, fied in case subject 5, the COOH-terminal extension to identified in case subjects 1 and 2, involve eIF2Ba p.Gly44. eIF2Ba is likely to sterically hinder the interaction of Previous experiments have shown that mutation of the eIF2a with eIF2Ba p.Leu305 as well as possibly occluding equivalent residue in GCN3, the yeast ortholog of EIF2B1, other parts of the interface (Fig. 1C). results in full cell viability under normal conditions but failure to respond to eIF2a phosphorylation under stress DISCUSSION (15). In contrast, most EIF2B1 variants that have been We report the identification of EIF2B1 heterozygous de reported in patients with VWM occur at interfaces with novo variants in five patients with PNDM/early-onset other eIF2B subunits (Fig. 1D), consistent with their diabetes and transient liver dysfunction. The variants, four reported effects on the formation and/or stability of the missense and one stop-loss, are all predicted to map to the eIF2B complex (16). Taken together, this evidence strongly same protein surface, and in silico modeling suggests that suggests that the EIF2B1 variants identified in our patients they are likely to disrupt the interaction of the EIF2Ba are likely to result in formation of the eIF2B complex and subunit (encoded by EIF2B1) with phosphorylated EIF2a support translation under normal conditions but impair during the cell ISR. eIF2B binding to phosphorylated eIF2a under stress Our patients’ clinical features are markedly different conditions. from those reported in patients with leukoencephalopathy Impaired cellular stress response is a known b-cell with vanishing white matter (VWM), a rare pediatric dysfunction mechanism and is involved in other genetic neurological disease caused by recessive loss-of-function subtypes of PNDM, including Wolcott-Rallison syndrome, EIF2B1 mutations (13). VWM is a progressive condition, the most common syndromic form of the disease (17). usually fatal in childhood. Extraneurological features are Wolcott-Rallison syndrome is characterized by PNDM/ generally not present, although diabetic ketoacidosis at early-onset diabetes, severe liver dysfunction (presenting 8 months was reported in one patient with a homozygous with transient episodes of acute liver failure), and skeletal p.(Leu49Arg) variant in EIF2B1 (14). None of the five dysplasia and is caused by recessive mutations in the patients we report had severe neurological features; how- EIF2AK3 gene, encoding the pancreatic eIF2-a kinase ever, case subject 4 has a mild learning disability and case (PERK) (18). EIF2AK3 loss-of-function variants in Wolcott- subject 5 has attention deficit disorder. The parents of Rallison syndrome disrupt the ISR, thereby limiting the individuals with VWM, who are heterozygous carriers for response to ER stress, impairing the cell’s ability to re- EIF2B1 loss-of-function mutations, are unaffected, thereby cover, and leading to cell death (Fig. 2B).

p.(Leu49Arg) VWM variant is colored orange, as in B; positions of other homozygous variants identiﬁed in VWM patients are colored yellow and labeled in blue font (Tyr275, the site of the p.Tyr275Cys variant, is not visible in these views but is surface accessible at the junction of the interfaces with subunits d and a9; Asn208, which was substituted by glutamate in a case of VWM, is not accessible at the eIF2Ba surface). The light-green residue in the eIF2a ribbon indicates the position of phosphorylated serine 51. 482 Congenital Syndrome and De Novo EIF2B1 Mutations Diabetes Volume 69, March 2020

Figure 2—Different forms of monogenic neonatal diabetes affect steps in the ISR pathway. A: Stress conditions induce activation of four kinases of the ISR. Pancreatic eIF2-a kinase (PERK) responds mainly to ER stress and is of particular importance in maintaining liver and pancreatic b-cells; other kinases of the IRS are protein kinase R (PKR), GCN2, and heme‐regulated eIF2a kinase (HRI), which respond to double-strand RNA, amino acid deprivation, and heme deprivation, respectively. Phosphorylation (P) of Ser51 of eIF2a results in a tight interaction with eIF2Ba, which inhibits the GDP dissociation activity mediated primarily by the g and e subunits of eIF2B and thus arrests translation of most mRNAs, except for speciﬁc mRNAs associated with the stress response program. B: In Wolcott-Rallison syndrome, homozygous or compound heterozygous loss-of-function variants in EIF2AK3, the gene encoding PERK, prevent phosphorylation of eIF2a Ser51 in response to ER stress; the lack of an appropriate stress response ultimately leads to a prolonged unfolded protein response and cell death. C: The dominant eIF2B1 variants identiﬁed in neonatal patients all lie in the binding surface for phosphorylated eIF2a and likely prevent effective sensing of Ser51 phosphorylation by eIF2B. This defect would be expected to affect the response to all kinases of the ISR, potentially explaining differences in the phenotype compared with that of Wolcott-Rallison syndrome and the dominant nature of the disease.

Our results are consistent with the hypothesis that the It is possible that the level of attenuation of the ISR and EIF2AK3 variants in Wolcott-Rallison syndrome and the the context for the attenuation caused by heterozygous novel EIF2B1 variants identified in our cases affect differ- mutations in EIF2B1 are enough to cause b-cell dysfunc- ent steps within the same ER stress response pathway (Fig. tion and diabetes but not enough to result in the severe 2C), highlighting the importance of this pathway in pan- liver and skeletal phenotype. creatic b-cell and liver cell function and integrity (19). The In summary, we report a novel genetic syndrome of convergence of both EIF2B1 and EIF2AK3 on the ISR neonatal/early-onset diabetes and transient liver dysfunc- provides an explanation for the phenotypic overlap be- tion caused by dominant de novo EIF2B1 mutations that tween Wolcott-Rallison syndrome and the disease caused disrupt the ability of the eIF2B complex to sense eIF2 by dominant EIF2B1 variants, consisting of neonatal/ phosphorylation and likely result in severe ER stress. early-onset diabetes and liver dysfunction. However, These results further highlight the importance of ER stress whereas liver symptoms appear to resolve with age in the regulation for b-cell function, adding another key gene to patients with EIF2B1 variants, prognosis in Wolcott-Rallison the list of ER stress regulators that, when mutated, cause syndrome is poor and most patients die of liver failure. syndromic forms of diabetes (4,20–27). This knowledge is Additionally, individuals with Wolcott-Rallison syndrome crucialtoinformcurrenteffortsaimedatdeveloping have skeletal dysplasia, a feature not observed in the case targeted therapies for patients with syndromic forms of subjects with EIF2B1 variants we report. It has been pro- diabetes caused by ER stress dysregulation (28,29) but also posed that the skeletal manifestations in Wolcott-Rallison for patients with type 2 (30) and type 1 (31) diabetes, as ER syndrome arise specifically from a developmental defect in stress is known to play a key role in the pathogenesis of osteoblasts due to absence of PERK activity (2,3) rather these more common diabetes subtypes. than from the ER stress regulation defect that is thought to cause PNDM and liver failure. Another possible explanation for the differences in the extrapancreatic pheno- Acknowledgments. The authors thank the families for participating in the types in case subjects with Wolcott-Rallison syndrome and study. The authors are also grateful to Rebecca Ward (Exeter Genomics the individuals with EIF2B1 de novo variants we report Laboratory, Royal Devon and Exeter Hospital) for technical assistance, Dr. Thomas could be the existence of quantitative differences in Laver (University of Exeter Medical School) for critical review of the manuscript, strength of signal or in its specific relationship to ER stress. and Dr. Ethel Codner (Institute for Mother and Child Research, University of Chile) diabetes.diabetesjournals.org De Franco and Associates 483

for assistance with clinical data collection. Whole-genome data analysis was run 12. Kenner LR, Anand AA, Nguyen HC, et al. eIF2B-catalyzed nucleotide exon the University of Exeter ISCA high-performance computing facility. change and phosphoregulation by the integrated stress response. Science 2019; Funding. E.D.F. is a Diabetes UK RD Lawrence Fellow (19/005971) and the 364:491–495 recipient of a European Foundation for the Study of Diabetes Rising Star Fellowship 13. van der Knaap MS, Leegwater PA, Könst AA, et al. Mutations in each of the (2018). E.D.F. has also received funding from the DRWF (Diabetes Research & five subunits of translation initiation factor eIF2B can cause leukoencephalopathy Wellness Foundation). A.T.H. and S.E. are the recipients of a Wellcome Trust with vanishing white matter. Ann Neurol 2002;51:264–270 Senior Investigator award (grant WT098395/Z/12/Z). A.T.H. is employed as a core 14. Alamri H, Al Mutairi F, Alothman J, Alothaim A, Alfadhel M, Alfares A. Diabetic member of staff within the National Institute for Health Research (NIHR)-funded ketoacidosis in vanishing white matter. Clin Case Rep 2016;4:717–720 Exeter Clinical Research Facility and is an NIHR senior investigator. S.E.F. has a Sir 15. Pavitt GD, Yang W, Hinnebusch AG. Homologous segments in three subunits Henry Dale Fellowship jointly funded by the Wellcome Trust and the Royal Society of the guanine nucleotide exchange factor eIF2B mediate translational regulation (grant number 105636/Z/14/Z). D.R.’s research is supported by a Wellcome Trust by phosphorylation of eIF2. Mol Cell Biol 1997;17:1298–1313 Principal Research Fellowship (Wellcome Trust 200848/Z/16/Z). 16. Wortham NC, Proud CG. Biochemical effects of mutations in the gene en- Duality of Interest. No potential conflicts of interest relevant to this article coding the alpha subunit of eukaryotic initiation factor (eIF) 2B associated with were reported. Vanishing White Matter disease. BMC Med Genet 2015;16:64 Author Contributions. E.D.F., A.T.H., S.E., and S.E.F. participated in study 17. Gupta S, McGrath B, Cavener DR. PERK (EIF2AK3) regulates proinsulin conception and design. E.D.F., S.E.F., M.B.J., and S.E. performed the genetic trafficking and quality control in the secretory pathway. Diabetes 2010;59:1937– analysis. A.T.H. analyzed the clinical data. M.N.W. and R.C. performed bioinfor- 1947 matics analysis. D.R. participated in data analysis and interpretation. E.D.F. wrote 18. Delépine M, Nicolino M, Barrett T, Golamaully M, Lathrop GM, Julier C. the first draft of the manuscript. R.C., A.T.H., and D.R. participated in manuscript EIF2AK3, encoding translation initiation factor 2-alpha kinase 3, is mutated in improvement. A.Z., V.C.D., C.T.B.N., R.G., M.V.J., and M.E.-K. collected patients’ patients with Wolcott-Rallison syndrome. Nat Genet 2000;25:406–409 samples and clinical data. All authors reviewed the manuscript. E.D.F. is the 19. Cnop M, Toivonen S, Igoillo-Esteve M, Salpea P. Endoplasmic reticulum guarantor of this work and, as such, had full access to all the data in the study and stress and eIF2a phosphorylation: the Achilles heel of pancreatic b cells. Mol takes responsibility for the integrity of the data and the accuracy of the data Metab 2017;6:1024–1039 analysis. 20. Poulton CJ, Schot R, Kia SK, et al. Microcephaly with simplified gyration, epilepsy, and infantile diabetes linked to inappropriate apoptosis of neural pro- References genitors. Am J Hum Genet 2011;89:265–276 1. De Franco E, Flanagan SE, Houghton JA, et al. The effect of early, com- 21. Skopkova M, Hennig F, Shin BS, et al. EIF2S3 mutations associated with prehensive genomic testing on clinical care in neonatal diabetes: an international severe X-linked intellectual disability syndrome MEHMO. Hum Mutat 2017;38: cohort study. Lancet 2015;386:957–963 409–425 2. Wei J, Sheng X, Feng D, McGrath B, Cavener DR. PERK is essential for 22. Støy J, Edghill EL, Flanagan SE, et al.; Neonatal Diabetes International neonatal skeletal development to regulate osteoblast proliferation and differen- Collaborative Group. Insulin gene mutations as a cause of permanent neonatal tiation. J Cell Physiol 2008;217:693–707 diabetes. Proc Natl Acad Sci USA 2007;104:15040–15044 3. Zhang P, McGrath B, Li S, et al. The PERK eukaryotic initiation factor 2 alpha 23. Abdulkarim B, Nicolino M, Igoillo-Esteve M, et al. A missense mutation in kinase is required for the development of the skeletal system, postnatal growth, PPP1R15B causes a syndrome including diabetes, short stature, and micro- and the function and viability of the pancreas. Mol Cell Biol 2002;22:3864–3874 cephaly. Diabetes 2015;64:3951–3962 4. De Franco E, Flanagan SE, Yagi T, et al. Dominant ER stress-inducing WFS1 24. Amr S, Heisey C, Zhang M, et al. A homozygous mutation in a novel zinc- mutations underlie a genetic syndrome of neonatal/infancy-onset diabetes, finger protein, ERIS, is responsible for Wolfram syndrome 2. Am J Hum Genet congenital sensorineural deafness, and Congenital Cataracts. Diabetes 2017;66: 2007;81:673–683 2044–2053 25. Bonnycastle LL, Chines PS, Hara T, et al. Autosomal dominant diabetes 5. Laver TW, De Franco E, Johnson MB, et al. SavvyCNV: genome-wide CNV arising from a Wolfram syndrome 1 mutation. Diabetes 2013;62:3943– calling from off-target reads [article online], 2019. Available from https://www 3950 .biorxiv.org/content/10.1101/617605v2.full. Accessed 10 September 2019 26. Inoue H, Tanizawa Y, Wasson J, et al. A gene encoding a transmembrane 6. den Dunnen JT, Dalgleish R, Maglott DR, et al. HGVS recommendations for protein is mutated in patients with diabetes mellitus and optic atrophy (Wolfram the description of sequence variants: 2016 update. Hum Mutat 2016;37:564–569 syndrome). Nat Genet 1998;20:143–148 7. Karczewski KJ, Francioli LC, Tiao G, et al. Variation across 141,456 human 27. Synofzik M, Haack TB, Kopajtich R, et al. Absence of BiP co-chaperone exomes and genomes reveals the spectrum of loss-of-function intolerance across DNAJC3 causes diabetes mellitus and multisystemic neurodegeneration. Am J human protein-coding genes [article online], 2019. Available from https://www Hum Genet 2014;95:689–697 .biorxiv.org/content/10.1101/531210v2. Accessed 10 September 2019 28. Abreu D, Urano F. Current landscape of treatments for Wolfram Syndrome. 8. Pakos-Zebrucka K, Koryga I, Mnich K, Ljujic M, Samali A, Gorman AM. The Trends Pharmacol Sci 2019;40:711–714 integrated stress response. EMBO Rep 2016;17:1374–1395 29. Ryno LM, Wiseman RL, Kelly JW. Targeting unfolded protein response 9. Jennings MD, Pavitt GD. A new function and complexity for protein translation signaling pathways to ameliorate protein misfolding diseases. Curr Opin Chem Biol initiation factor eIF2B. Cell Cycle 2014;13:2660–2665 2013;17:346–352 10. Holcik M. Could the eIF2a-independent translation be the Achilles heel of 30. Ozcan U, Cao Q, Yilmaz E, et al. Endoplasmic reticulum stress links obesity, cancer? Front Oncol 2015;5:264 insulin action, and type 2 diabetes. Science 2004;306:457–461 11. Kashiwagi K, Yokoyama T, Nishimoto M, et al. Structural basis for eIF2B 31. Engin F. ER stress and development of type 1 diabetes. J Investig Med 2016; inhibition in integrated stress response. Science 2019;364:495–499 64:2–6