INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction.

In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.

Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order.

A Bell & Howell Information Company 300 North Zeeb Road. Ann Arbor. Ml 48106-1346 USA 313/761-4700 800/521-0600 ! EXPRESSION AND REGULATION OF THE TOBACCO ANIONIC PEROXIDASE GENE

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

By

Karen Lynn Klotz, B.A., M.S.

*****

The Ohio State University

1995

Dissertation Committee: Approved by L. M. Lagrimini M. Knee P. S. Jourdan Advisor Graduate Program m K. R. Davis Horticulture UMI Number: 9612212

Copyright 1995 by Klotz, Karen Lynn All rights reserved.

OMI Microform 9612212 Copyright 1996, by UMI Company. All rights reserved.

This microform edition is protected against unauthorized copying under Title 17, United States Code. UMI 300 North Zeeb Road Ann Arbor, MI 48103 Copyright by Karen Lynn Klotz 1995 To My Husband, Mark and My Parents ACKNOWLEDGEMENTS

I would like to express my sincere appreciation to my advisor Dr. L. Mark Lagrimini for his guidance and insight in this research. I would also like to thank the members of my guidance committee, Drs. Michael Knee, Pablo Jourdan, and Keith Davis for their comments and suggestions. I would like to thank the Department of Horticulture and the Ohio Agricultural Research and Development Center for financial support. Thanks also go to Drs. Fernando Finger and Vicki Gingas for their encouragement and friendship. VITA

September 30, 1961 Born - Toledo, OH 1983 B.A., Capital University Columbus, OH 1987 M.S., University of Minnesota, Minneapolis, MN 1985-1989 Research Chemist, The Upjohn Company, Kalamazoo, MI

PUBLICATIONS

Diaz-De-Leon, F., Klotz, K., Lagrimini, L. M. (1993). "Nucleotide Sequence of the Tobacco (Nicotiana tabacum) Anionic Peroxidase Gene." plant phisiol. , 101:1117-1118. Lagrimini, L. M., Vaughn, J., Finer, J., Klotz, K., Rubaihayo, P. (1992). "Expression of a Chimeric Tobacco Peroxidase Gene in Transgenic Tomato Plants." j . amer. soc. hort. sci., 117:1012-1016.

FIELDS OF STUDY

Major Field: Horticulture Plant Molecular Biology

iv TABLE OF CONTENTS

ACKNOWLEDGMENTS ...... iii V I T A ...... iv LIST OF T A B L E S ...... vii LIST OF FIGURES...... ix CHAPTER PAGE I. INTRODUCTION ...... 1 List of References...... 31 II. FURTHER MOLECULAR CHARACTERIZATION OF THE TOBACCO ANIONIC PEROXIDASE GENE 3 6 Introduction ...... 36 Materials and Methods ...... 39 Results and Discussion ...... 43 List of References...... 65 III. REGULATION OF TOBACCO ANIONIC PEROXIDASE GENE EXPRESSION ...... 71 Introduction ...... 71 Materials and Methods ...... 73 R e s u l t s ...... 87 Discussion...... 125 List of References 13 0 IV. REGULATORY REGIONS OF THE TOBACCO ANIONIC PEROXIDASE PROMOTER ...... 134 Introduction ...... 134 Materials and Methods 13 6 R e s u l t s ...... 143 Discussion...... 161 List of References...... 167

v V. HISTOLOGICAL AND DEVELOPMENTAL EXPRESSION OF THE TOBACCO ANIONIC PEROXIDASE GENE .... 170 Introduction ...... 170 Materials and Methods ...... 172 R e s u l t s ...... 176 Discussion...... 195 List of References...... 204 VI. DISCUSSION...... 208 LIST OF R E F E R E N C E S ...... 215 LIST OF TABLES

TABLE PAGE 1. Protein extraction buffers examined for their compatibility with GUS and CAT a s s a y s ...... 90 2. GUS and CAT activities of tobacco protoplasts transformed with pKK010593 or calf thymus DNA and extracted into different buffer systems ...... 90 3. Methods used to lyse p r o t o p l a s t s ...... 91 4. Yield of soluble protein and GUS activity from tobacco protoplasts transformed with pKK060992 and lysed by methods in Table 3 ...... 91 5. GUS and CAT activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN after 48 hrs. exposure to no hormones, IAA, BA, or ethylene...... 94 6. GUS activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN after 3 6 hrs. exposure to no hormones, IAA, NAA, BA or e t h y l e n e ...... 97 7. GUS activity of tobacco protoplasts transformed with pKK060992 and incubated with 0, 100, or 1000 ppm ethylene for 24 to 72 hrs...... 103 8. GUS activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN and incubated for 36 hrs. with PCIB, IAA, or IAA and P C I B ...... 105

vii 9. GUS activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN and incubated for 36 hrs. with GA, ABA, JA, SA, fungal cell wall elicitor, IAA, or subjected to a 41°C, 2 hr. heat shock treatment...... 108 10. GUS activity of roots from young N. sylvestris 601-19-L plants exposed to NAA, PCIB or no hormones for 48 hrs . . . . 112 11. GUS activity of young N. sylvestris 601-19-L plants exposed to no hormones, NAA or PCIB for 72 hrs. at 27°C in light or d a r k ...... 115 12. GUS activity of root cultures incubated for 48 hrs. on HF medium with 3 uM IBA or no added hormone...... 117 13. GUS activity of root cultures after 72 hrs. with no added hormones, 50 uM NAA or 100 uM P C I B ...... 118 14. GUS activity of tobacco protoplasts transformed with methylated or unmethylated pKK060992 or unmethylated pKK092093 and their response to auxin .... 123 15. GUS, CAT and GUS/CAT activity of tobacco protoplasts transiently transformed with tobacco anionic peroxidase promoter deletions fused to GUS and an equimolar amount of the full peroxidase promoter fused to CAT as an internal standard ...... 146 16. GUS, CAT and GUS/CAT activity of tobacco protoplasts transiently transformed with tobacco anionic peroxidase promoter deletions fused to GUS and a 0.9 equimolar amount of the full peroxidase promoter fused to CAT as an internal standard...... 153 17. GUS activity of tobacco protoplasts transiently transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and incubated with or without 100 uM IAA for 36 hrs. . . . 159

viii LIST OF FIGURES

Structures of the lignin precursors p- coumaryl alcohol, coniferyl alcohol and sinapyl alcohol ...... Formation of the free radical of p- coumaryl alcohol by peroxidase and hydrogen peroxide and its isomerization . . . Idealized structure of lignin showing several different types of covalent bonds ...... Structure of isodityrosine, a compound important in the cross-linking of cell wall glycoproteins ...... Restriction site map of the tobacco anionic peroxidase gene ...... Map of the transcription start site determined by primer extension ...... DNA sequence of the tobacco anionic peroxidase 5' regulatory region from -3146 bps to the translation start site . . . Comparison of the consensus sequence for the TATA element for plant genes and sequence of the TATA element of the tobacco anionic peroxidase promoter ...... Comparison of sequences containing the GATA motif from the promoter regions of the tobacco anionic peroxidase, CaMV 35S ribosome, and several chlorophyll a/b binding proteins ...... 10. Sequence of the four TC-rich repeats and their location in the tobacco anionic peroxidase promoter relative to the transcription start si t e ...... 57 11. Sequence and location of an auxin responsive element identified in PS- IAA4/5 and found in various auxin- regulated genes and the tobacco anionic peroxidase gene ...... 59 12. Conserved sequence elements found in auxin-responsive genes and the tobacco anionic peroxidase gene...... 61 13. Sequences within the tobacco anionic peroxidase 5' regulatory region with homology to known regulatory elements .... 63 14. Plasmid maps of pKK022592 and pKK040192 . . . 75 15. Plasmid maps of pKK060992 and pKK010594 . . . 77 16. Plasmid maps of pKK012594 and pKK120992 . . . 79 17. Plasmid map of pKK010593 80 18. Average CAT activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN and incubated for 48 hrs. with no hormones, 200 uM IAA, 2 mg/L BA or 1188 ppm e t h y l e n e ...... 95 19. Average GUS activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN and incubated for 48 hrs. with no hormones, 200 uM IAA, 2 mg/L BA or 1188 ppm e t h y l e n e ...... 96 20. Average GUS activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN and incubated for 3 6 hrs. with no hormones, IAA (10, 50, 100, 200 uM), NAA (10, 50, 100, 200 uM), BA (0.5, 2, 10 mg/L) or ethylene (10, 83, 1145 p p m ) ...... 99 21. Average GUS activity of pKK060992 transformed tobacco protoplasts as a function of IAA concentration...... 101

x 22. Average GUS activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN and incubated with 0, 100, or 1000 ppm ethylene for 24, 48 or 72 hrs...... 104 23. Average GUS activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN and incubated with no hormones, PCIB, IAA, or IAA and PCIB .... 106 24. Average GUS activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN and. incubated with no hormones, GA, ABA, JA, SA, fungal cell wall elicitor,IAA, or subjected to a 41° 2 hr. heat shock treatment ...... 109 25. Average GUS activity of N. sylvestris 601-19-L plants treated with 50 uM NAA, 100 uM PCIB, or no hormones for 48 hrs. in the d a r k ...... 113 26. Average GUS activity of roots from N. sylvestris 601-19-L plants treated with NAA, PCIB, or no hormones for 72 hrs. in either light or d a r k ...... 116 27. Average GUS activity of root cultures after 72 hrs. with no added hormones, 50 uM NAA, or 100 uM P C I B ...... 119 28. Average GUS activity of tobacco protoplasts transformed with equimolar amounts of methylated or unmethylated pKK060992 or unmethylated pKK092093 and their response to 30 uM I A A ...... 124 29. Plasmid maps of pKK092093 and pKK092193 . . . 137 30. Plasmid maps of pKK092293 and pKK092493 . . . 139 31. Plasmid maps of pKK102993 and pKK100693 . . . 141 32. Plasmid map of pKK113093 142 33. Map of the tobacco anionic peroxidase promoter showing the location of restriction enzyme sites used in making deletions and possible regulatory elements identified by DNA sequencing . . . . 144

xi 34. Average GUS/CAT activity of tobacco protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and the peroxidase promoter fused to CAT with or without 100 uM I A A ...... 147 35. Average CAT activity of tobacco protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and the full peroxidase promoter fused to CAT with or without 100 uM I A A ...... 149 36. Average GUS activity of tobacco protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and the full peroxidase promoter fused to CAT with or without 100 uM I A A ...... 150 37. Average GUS/CAT activity of tobacco protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and 0.9 equimolar amount of the full peroxidase promoter fused to CAT with or without 100 uM I A A ...... 154 38. Average CAT activity of tobacco protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and 0.9 equimolar amount of the full peroxidase promoter fused to CAT with or without 100 uM I A A ...... 155 39. Average GUS activity of tobacco protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and 0.9 equimolar amount of the full peroxidase promoter fused to CAT with or without 100 uM I A A ...... 156

40. Average GUS activity of tobacco protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS with or without 100 uM I A A ...... 160

xii 41. pKK060193 containing the tobacco anionic peroxidase promoter from -3146 to +71 bps fused to the GUS coding region and NOS terminator in the Agrobacterium tumefaciens plasmid, p B I 1 0 1 . 2 ...... 174 42. GUS activity and autofluorescence of stem and root cross-sections from N. sylvestris and N. tabacum cv. Xanthi plants transformed with the -3146 peroxidase promoter/GUS fusion ...... 178 43. GUS activity in flower and fruit of N. sylvestris and N. tabacum cv. Xanthi plants transformed with the -3146 peroxidase promoter/GUS fusion ...... 190

xiii CHAPTER I INTRODUCTION

Peroxidases (donor: hydrogen-peroxide oxidoreductase, EC 1.11.1.7) are a family of enzymes that are ubiquitous in the natural world. Peroxidases have been found in higher plants, fungi, yeast, algae, bacteria and animals (1) . Peroxidases have undergone the greatest study in higher plants. Peroxidases are found in all higher plants where they occur as a number of different isoenzymes (2,3). They are found in nearly all plant tissues during some stage of their development. The distribution of peroxidase isoenzymes in plants is developmentally regulated, tissue specific and affected by environmental factors (3) . Peroxidases are also widely distributed in animals (1). Peroxidases have been found in vertebrates and invertebrates. In vertebrates, peroxidases have been identified in a number of tissues and body fluids including brain, kidney, liver, bone marrow, spleen and lung tissues and blood, milk, saliva, cerebro­ spinal and intestinal fluids (1) . There is a long history of peroxidases in the scientific literature. References to peroxidase activity date back to

1 2 the 19th century, and a peroxidase enzyme was identified as early as 1903 (2). Since their discovery, peroxidases have been used extensively as enzyme markers in physiological, pathological and genetic studies due to their ease of detection and stability (2). In light of their ubiquity and their history, it is surprising how little is known about peroxidases. Peroxidases are heme-containing, monomeric glycoproteins that oxidize a variety of different compounds using hydrogen peroxide or molecular oxygen as a source of oxidizing potential (4). They contain a single Fe(III) protoporphyrin IX moiety that is found in the active site and is necessary for activity (5). Plant peroxidases are highly glycosylated by the covalent bonding of carbohydrate chains to the amide group of asparagine residues (6) . In horseradish, the richest source of peroxidase, all of the major isoenzymes contain 15 to 17% carbohydrate by weight. The size of the glycosyl chains ranges from 1600 to 3000 residues with mannose and glucosamine as the predominant sugars (6) . Calcium is also a part of the peroxidase enzyme. Calcium is necessary for the correct conformation of the apoprotein and contributes to the structural stability of the active site (7) . For the well-studied horseradish peroxidase c (HRPc), and presumably for other peroxidases, calcium is not required for catalytic activity. The enzyme, however, exhibits less thermal stability and decreased activity when calcium is 3 removed (2,5). Two of the better characterized peroxidases, horseradish peroxidase c and a cationic peanut peroxidase, both contain two moles of calcium per mole of peroxidase

(2 ,6 ). Peroxidases carry out one electron oxidations to form highly reactive radical species (2). They require both an oxidizing and a reducing substrate. As shown in equations 1- 4, peroxidase is first oxidized by hydrogen peroxide to form the activated compound I form of the enzyme. Compound I is formed by a single two electron oxidation and contains an additional oxygen atom. Compound I reacts with a reducing substrate (AH2) in a one electron reduction of compound I to compound II. The reducing substrate (AH2) is oxidized to a highly reactive free radical (AH). A second one electron reduction of compound II reduces the enzyme to its native state and oxidizes a second molecule of the reducing sub­ strate (AH2). Equation 4 shows the overall reaction (2).

1. POD + H202 - POD-I + H20

2. POD-1 + a h 2 - POD-II + *AH

3. POD-II + a h 2 - POD + *AH + h 20

4. h 2o 2 + 2 AH2 - 2 *AH + 2 H 20

Modified ping pong reaction kinetics makes this series of reactions irreversible. Hydrogen peroxide binds and water is released before the electron donor (AH2) is bound and 4 oxidized (2,8). Peroxidase is also capable of oxidase activity. Oxidase activity involves the oxidation of a substrate by an oxyperoxidase (compound III) form of the peroxidase enzyme. Compound III is formed during the reduction of molecular oxygen to superoxide radical by the native enzyme in the absence of hydrogen peroxide or by oxidation of compound II by H202 (2,5) . Peroxidase is a highly catalytic enzyme. It is unusual among enzymes, however, because it shows very little sub­ strate specificity. Peroxidases exhibit activity towards a wide range of different substrates in vitro, and many of their proposed functions are drawn from such in vitro data (4). It is not known, however, what the natural substrates of peroxidases are in vivo. There is strong evidence that peroxidase is involved in the polymerization of plant cell wall components. It is widely accepted that peroxidase reacts with the monolignols— coniferyl, p-coumaryl and sinapyl alcohols— to form lignin in the cell wall (5). The monolignols, shown in Figure 1, are phenolic compounds that are oxidized to free radicals with peroxidase. These free radicals rapidly isomerize (Figure 2), and couple with each other non-enzymatically to form lignin— a complex, random, insoluble polymer (9) . Figure 3 shows an idealized structure of lignin in which the monolignols are linked by both carbon- carbon and carbon—oxygen—carbon bonds in a number of ways. COOH COOH COOH

OCH, OCH OH

Figure 1: Structures of the lignin precursors (a) p-coumaryl alcohol, (b) coniferyl alcohol, (c) sinapyl alcohol.

CHjOH CH.OH CHjOH CHjOH CH.OH

Figure 2: Formation of the free radical of p-coumaryl alcohol by peroxidase and hydrogen peroxide and its isomeri­ zation (3) . 6

CH,OH CH,OH I HC—O HC—O — I HCOH HCH

CH,OH H C = 0 OCH, CH,0 CH.O HC—O

—

HCOH CH,OH CH CH,0

HOCH, HCOH OCH,

HCOH / ? C C H O H H C C H » CH.OH H f-i ? H,OH | V ,c—c=c-

HOCH, H0H^ CH,0

HCOH

CH,OH H,COH C H ,0 ' ' V ' 1 | | C H ,0 O ------CH HC-

HCOH C = 0

CH,0 OCH,

Figure 3: An idealized structure of lignin showing several different types of covalent bonds that are possible from the peroxidase-catalyzed, free radical polymerization of the monolicmols. D-coumaryl, coniferyl, and sinapyl alcohols (10). 7 It is also thought that peroxidases are responsible for the cross-links between pectin, hydroxyproline-rich glyco­ proteins, and lignin (3,11). Cell wall polysaccharides can be covalently bound to phenolic acids, such as p-coumaric acid, ferulic acid, and sinapic acid, through ester linkages. These linkages are specific for particular hydroxyl groups of particular sugar residues of particular polysaccharides (9) . »*. * It is believed that peroxidase catalyzes cross-links between these phenolic side chains and other similarly derivatized sugar residues, or with lignin (9). Cross-links among cell wall glycoproteins have also been attributed to cell wall-bound peroxidases. The formation of isodityrosine cross-links (Figure 4) in which two tyrosine residues are connected by a diphenyl ether bridge is believed to be a peroxidase-catalyzed reaction (9,12). Current evidence suggests that isodityrosine cross-links occur intramolecularly between tyrosine residues of a protein. Evidence for cross-linking of this type between different proteins is currently lacking. Tyrosine is a component of cell wall glycoproteins and is found in the repeating motifs of nearly every cell wall structural protein (9,13). Tyrosine is especially abundant in extensins where it can account for approximately five percent of the protein (9) . The evidence to support the role of peroxidase as a polymerization catalyst for cell wall materials is circum­ stantial but convincing. In vitro studies have shown that 8 COOH COOH NH NH

OH

Figure 4: Structure of isodityrosine, a compound important in the cross-linking of cell wall glycoproteins. peroxidase can catalyze the polymerization of monolignols, the formation of diferulates, and the formation of isodityrosine residues (14-17). Diferulates are thought to be important in the cross-linking of polysaccharides; isodityrosine residues intramolecularly cross-link glycoproteins. Peroxidases are primarily localized in the cell wall where these polymeriza­ tion and cross-linking reactions occur (18). In tobacco, anionic and moderately anionic peroxidase isoenzymes have been localized to the apoplast (19) . These cell wall peroxidases are found free in the apoplast or bound to the cell wall. It is thought that bound isoenzymes are ionically bonded to pectic components of the cell wall (21). The stage of development when peroxidases are expressed also supports their role in cross-linking cell wall 9 components. Apoplastic peroxidase isoenzymes are present at the time cross-links are forming in the cell wall (18) . Studies with tobacco mesophyll protoplasts undergoing cell wall regeneration have shown synthesis of moderately anionic peroxidases before and during primary wall synthesis (18). Primary cell wall polymers, except cellulose, are soluble (9) . Peroxidase is thought to aid cell wall formation by insolublization of polysaccharides and glycoproteins through cross-linking. Although these growing cell walls contain little or no lignin, phenolics are present which may also be utilized in cross-linking (9) . Further proof of peroxidases1 role comes from the use of peroxidase inhibitors, such as ascorbate, or free radical scavengers which decrease the insolublization of cell wall polymers (12,13). In the same tobacco mesophyll protoplast studies, anionic peroxidases were synthesized during and after secondary cell wall synthesis when cell expansion had ceased (18). Peroxidase is also thought to be involved in suberin biosynthesis. Suberin is a cell wall polymer composed of aromatic and aliphatic compounds. Like lignin, suberin contains the monolignols, p-coumaryl, coniferyl, and sinapyl alcohols. It also contains covalently attached omega-hydroxy fatty acids and dicarboxylic acids (21,22). Wounding or pathogen attack induces suberin biosynthesis coincidental with the expression of specific peroxidase isozymes. In tobacco, total peroxidase activity increased five to six fold 10 72 hours after wounding (11). The increase in activity was due to an increase in the level of cationic and moderately anionic isoenzymes (3) . Suberization is thought to be a defense response to limit pathogen entry and prevent desicca­ tion once the cuticle is damaged. Suberin is also found in specialized cell walls including those of cork, seed coats and the casparian strip of the endodermis (9). Another role in cell wall formation that has been ascribed to peroxidase is biosynthesis of hydrogen peroxide. It is postulated that an oxidase activity of the peroxidase enzyme is capable of producing hydrogen peroxide— the substrate required for initial oxidation of the enzyme and all subsequent reactions. Hydrogen peroxide is generated in the cell wall by the action of a peroxidase on NAD(P)H and molecular oxygen as shown in equation 6 (9,23). The NAD(P)H is generated by a cell wall-bound malate dehydrogenase which

5. Malate + NAD(P)+ — Oxaloacetate + NAD(P)H + H+ 6. NAD(P) H + H+ + 02 - NAD(P)+ + H202 uses malate from the cytoplasm for the reduction (equation 5) . Peroxidase is thought to have a role in IAA catabolism by oxidative decarboxylation of IAA (24). IAA is oxidized by peroxidase in vitro. The cationic peroxidase isoenzymes, located in the vacuole, are the most efficient in carrying 11 out this oxidation in vitro, although the anionic, apoplastic isoenzymes are also capable of decarboxylating IAA (25,26). Tobacco plants overproducing anionic peroxidases effectively catabolize exogenously applied auxin. Auxin catabolism by peroxidase, however is not universally accepted. Analysis of IAA degradation products from plants fed isotopically- labelled IAA have been inconclusive and/or contradictory as to the importance of peroxidase in IAA degradation (25). At present, a role for peroxidase in auxin catabolism has not been unequivocally established or disproven. Peroxidase has been implicated in other plant processes, although the evidence to support these proposed functions is somewhat limited. Ethylene biosynthesis has been attributed to peroxidases (27). It is not believed, however, to be a major pathway for ethylene production. It is possible that any peroxidase-associated ethylene production occurs non- enzymatically from peroxidase-produced active oxygen species such as hydrogen peroxide or superoxide anion (28) . Chloro­ phyll degradation and other senescence-related processes such as lipid peroxidation have also been ascribed to peroxidase (5) . The evidence for these proposed functions is purely correlative. An increase in peroxidase activity and a change in the expression pattern of peroxidase isoenzymes has been observed during senescence. Likewise, an increase in peroxidase activity was observed coincidentally with a decrease in chlorophyll levels. Oxidation of phenolic 12 compounds has also been attributed to peroxidases (29). Peroxidase-mediated reactions have important consequenc­ es for the normal development, growth, and life of a plant. As a catalyst for lignification and formation of other cell wall cross-links, peroxidase is important in providing strength to the cell wall, and, therefore, to the entire plant. Fibers and sclereids, whose primary function is to provide strength and support to the plant, obtain their strength from lignin. Even in non-lignified tissues, cell walls are strengthened by peroxidase-mediated cross-linking of cell wall components. Besides providing strength, lignification and suberization make cell walls impermeable to water— a necessity for xylem to be able to conduct water or for endodermis to be able to control water and mineral uptake. Peroxidase may also be important in regulating growth. The formation of cell wall cross-links forms a covalently bonded network of polymers that limits and eventually prevents cell expansion. Certainly, lignification prevents any further growth. Catabolism of IAA and formation of ethylene are other ways in which peroxidase may mediate growth. Several studies have shown that peroxidase activity increased at the time and location where growth rate was decreasing (12,30,31). Increased peroxidase levels have also been found in genetically-dwarfed plants and in slower- growing lines of tissue cultures (9,25). In dwarf plants the 13 increase in peroxidase has been attributed to an increase of extracellular isoenzymes (25). Peroxidase is thought to be important for a plant's defense against insect and pathogen attack as well as in wound healing. Peroxidase activity increases in response to viral, fungal, and bacterial infections as well as to wounds that may be created by insects (5,32). Several studies with several different plant species have shown that the increase in peroxidase activity upon pathogen attack is faster and greater in plants with greater resistance (33) . Plants more susceptible to pathogen attack exhibit slower and/or smaller increases in peroxidase activities (32) . Lignification, suberization and cell wall biosynthesis are thought to be important in repairing damaged cell walls, preventing dessication and creating a barrier to pathogen ingress (9,11). This barrier may also serve to protect the plant from pathogen enzymes, metabolites and toxins as well as prevent access to the plants nutrients. Peroxidases may also be involved in a plant's chemical defense against pathogens. Peroxidases can be toxic to pathogens by oxidizing microbial substrates that are important to the microbes metabolism or that create toxic products (32). A role for peroxidase in the production of phytoalexins— compounds produced by the plant that are toxic to invading pathogens— has been pro­ posed. An alternative role has also been proposed in which 14 peroxidase protects its host plant by detoxifying phytoalex­ ins (32) . Clearly, the exact functions of peroxidases in plants have not been defined. It is conceivable that peroxidases have other functions in planta than those mentioned above. It has been observed that peroxidase levels and isoenzyme patterns change upon exposure to ozone, pollution, radiation, nutritional disorders, stress, and salinity (5,11). The determination of peroxidase functions has been hampered by peroxidases' lack of substrate specificity. The number of peroxidase isoenzymes present in all plants has also made the assignment of functions difficult. As many as 35 isoenzymes have been found in higher plants (4). Different isoenzymes exhibit different reactivity to potential substrates, and have different patterns of expression and localization within the cell and plant (5) . It is therefore thought that different isoenzymes perform different functions within the plant. The tobacco peroxidase isoenzymes are among the most studied and best characterized. Tobacco (Nicotiana tabacum)

has at least 1 2 different isoenzymes which can be divided into three groups— anionic, moderately anionic and cationic— based on their isoelectric point [pi] (3) . The cationic

isoenzymes of tobacco, with a pi range of 8 . 1 to 1 1 , are localized in the central vacuole (3) . Although their actual function is unclear, catabolism of IAA, production of 15 hydrogen peroxide from NAD(P)H, and ethylene production have been attributed to them (3) . They are not believed to be involved in lignin formation due to their intracellular location and their relatively low activity toward lignin precursors. They are abundant in root and callus tissue. They are not found in healthy leaf or pith tissue (11) . Wounding induces these isozymes. This increase in activity

requires de novo synthesis of protein (1 1 ). The moderately anionic isoenzymes of tobacco include five peroxidase isoenzymes with isoelectric points between 4.5 and 6.5 (3). These isoenzymes are located in the cell wall and have a high affinity for pectin-rich areas (5) . They are found at low levels in leaf and pith tissues, and at high levels in root and callus (11). Their expression in stem tissue increases substantially after wounding of the pith and suggests a role in the suberization of wounded tissue (11). Pathogen infection also induces two of the five isoenzymes of this group. The isoenzymes with pis of 5.6 and

6 . 1 were induced in tobacco leaves infected with tobacco mosaic virus (TMV). These two isoenzymes were not induced by wounding alone. Some induction of these isoenzymes was also observed in uninfected leaves of a TMV infected plant. This systemic induction suggests that these isoenzymes might have a role in systemic acquired resistance and/or containment of pathogens (11). The moderately anionic isoenzymes exhibit moderate activity toward lignin precursors (3). 16 The anionic isoenzymes of tobacco with pis of 3.5 to 4.0 are the best characterized of the peroxidase isoenzymes. N.

tabacum has 2 anionic isoenzymes with isoelectric points of 3.5 and 3.75 that are found in approximately equal amounts (4) . They are thought to be responsible for lignin formation and cross-linking other cell wall components (3) . The anionic peroxidases exhibit high activity toward lignin precursors (3). They are found in the cell wall and are the predominant isoenzymes in stem tissue. They are also found in root and leaf tissue. They have not been detected in callus tissue which is devoid of secondary walls (11). The anionic peroxidases are not induced by wounding (3). The differences in reactivity, localization, and expression of peroxidase isoenzymes demonstrates the hetero­ geneity of peroxidases. To understand the in planta function of peroxidases, peroxidase activity cannot be studied as a single uniform entity. Rather, it is necessary to understand the regulation, expression and function of each isoenzyme and/or group of isoenzymes. Unfortunately, this has not been possible by biochemical and physiological techniques. Biochemical analyses have been hindered by the lack of a reproducible, quantitative method of separating the isoenzymes, as well as by a lack of substrate specificity (11) . Physiological studies have been frustrated by the absence of a method to separate the activities of different isoenzymes. Molecular biology, however, has the potential to 17 clarify the roles of individual peroxidase isoenzymes. Manipulation of individual isoenzyme levels by overproduction or suppression of individual isoenzymes should provide clues to their in vivo functions. Reporter genes coupled to the genetic regulatory regions of individual isoenzymes should provide information on expression and regulation. Coupling molecular biology with biochemistry and plant physiology, it may be possible to definitively determine the function of peroxidases in plants. The gene for the tobacco (N. tabacum) anionic peroxidases with isoelectric points of 3.5 and 3.75 was isolated ariSFcloned by Lagrimini et al. (3). A single gene encodes both of these isoenzymes. The difference in isoelectric point is a result of post-translational modifica­ tion (4) . Based on the cDNA sequence, the peroxidase protein

is first synthesized as a preprotein with a 2 2 amino acid signal peptide at the amino terminal that is composed of primarily hydrophobic amino acids. The signal peptide directs the secretion of the protein to the extracellular space. The predicted molecular mass of this preprotein is 34.6 kDa. After loss of the signal peptide, the apoprotein is predicted to be 302 amino acids long with a molecular mass of 32.3 kDa. The apparent molecular masses of the two anionic peroxidase isoenzymes, as determined by SDS-PAGE, are

36 kDa and 37 kDa for POD3 5 and POD3 75 , respectively (3) . The difference between the predicted and the apparent molecular 18 masses is due, in part, to glycosylation. It is known that the anionic peroxidases are secreted into the cell wall as glycoproteins. The anionic peroxidases contain four poten­ tial sites for N-glycosylation. Another known post- translational modification of these two peroxidases is found at the amino end of the protein where a terminal glutamine residue is self-condensed into a pyroglutamate (3).

It is thought that the two anionic peroxidases, POD3 5

and POD3 7 5 , have the same function. Nicotiana tabacum has 4 copies of the anionic peroxidase gene and expresses both anionic peroxidases in egual amounts (4) . However, N. tabacum is an allotetraploid. It is believed to be an interspecific hybrid of N. sylvestris and N. tomentosiformis originating over a million years ago (3) . Both N. sylvestris and N. tomentosiformis have two copies of the anionic

peroxidase gene. N. sylvestris expresses only POD3 75 . N.

tomentosiformis expresses only POD3 5. Southern hybridization analysis demonstrates that the four genes of N. tabacum are derived from the two genes from N. sylvestris and the two genes from N. tomentosiformis (4) . Clearly, both peroxidase isoenzymes are not necessary in N. tabacum since both parent species function normally with only one anionic peroxidase isozyme (3). The anionic peroxidases are the predominant peroxidases in tobacco. Almost ninety percent of peroxidase activity in all tissues except root has been attributed to the anionic 19 peroxidases. They are the major peroxidase isoenzymes in healthy stem tissue (4,11). They are extracellular, and thought to be important for lignification. As a catalyst for lignification and other cell wall cross-linkages, the anionic peroxidases are important for normal growth and development of plants. It is not known, however, what other roles the anionic peroxidases may have. To confirm its role in lignification and to elucidate any other functions that the anionic peroxidase may have in planta, tobacco plants (N. tabacum and N. sylvestris) were genetically engineered to overproduce or underproduce these isoenzymes (4,26). The cDNA clone for the anionic peroxidase containing the entire coding region including the signal peptide that allows for secretion into the cell wall and the polyadenylation addition site was ligated to the cauliflower mosaic virus (CaMV) 35S promoter and terminator (4,34). The CaMV 35S promoter is a constitutive promoter that causes a high level of expression in all or nearly all tissues, during all stages of development (35). CaMV 35S-promoted expression has been reported to be greatest in epidermis and phloem (34) . This gene construct was inserted into an Agrobacterium tumefaciens binary vector containing a gene for neomycin phosphotransferase (NPTII) expression. Both genes, the peroxidase chimeric gene and the NPTII gene, were transformed into tobacco with Agrobacterium. NPTII allows for selection of transformed plants by their resistance to kanamycin. Two 20 subsequent generations were obtained by self-fertilization to

achieve homozygous R2 tobacco plants that had up to a ten­ fold increase in total peroxidase activity throughout the entire life cycle of the plant (4). Isoelectric focusing gels showed that the increase in total peroxidase activity was due to an increase in expression of only the anionic peroxidases (4). Tobacco plants that underexpress the anionic peroxidase gene were constructed using the technique of antisense RNA suppression. The 5' half of the tobacco cDNA clone was inserted between the CaMV 35S promoter and terminator in an inverted orientation (34). This gene chimera was cloned into an JVPTJJ-containing Agrobacterium binary vector and trans­ formed into tobacco plants using Agrobacterium. By inverting the orientation of the peroxidase coding region, the non­ coding or antisense strand of DNA was transcribed to yield antisense RNA. This antisense RNA was constitutively transcribed at high levels due to the use of the CaMV 35S promoter. The mechanism of antisense RNA suppression is unknown. It is thought that antisense RNA anneals to the natively produced peroxidase RNA transcripts because the two are complementary. This double stranded RNA moiety is incapable of being translated and may somehow be targeted for destruction (36). Plants transformed with the antisense construct were obtained that had three to twenty-fold less peroxidase activity (37) . Isoelectric focusing gels showed 21 that only the expression of the anionic peroxidases was suppressed (26) . Peroxidase overproducing and underproducing plants exhibited unigue and unexpected phenotypes that provide clues to the in vivo function of the anionic peroxidase. Prior to flowering, peroxidase overproducing plants were phenotypi- cally similar to wild type plants with a few exceptions (4). The leaves of peroxidase overproducers were slightly smaller and thirty percent thinner than those of wild type plants (4,26). The difference in leaf size was attributable to a difference in cell size. Leaf mesophyll cells were signifi­ cantly smaller and more densely packed in peroxidase overpro­ ducing plants than in wild type plants (26). The number of cells per leaf was unchanged. Internodes of peroxidase overproducing plants were also slightly shorter than control plants (4). At the onset of flowering, the phenotype of the overproducer was unmistakably different from wild type tobacco plants. The POD overproducing plants wilted severe­ ly, with all leaves wilting equally, regardless of their age (4). The plants regained turgor overnight, only to wilt again after sunrise. Wilting was less severe on overcast days. Increasing the frequency of watering did not alleviate the wilting. No wilting was seen in wild type plants or transformants with less than a two-fold increase in peroxi­ dase activity. Wilting was not a symptom of increased water 22 loss from the leaf surface. Microscopic examination of the epidermis and stomatal conductance measurements revealed that the stomates of the wilted plants were closed. The vascular tissue of the transformed plants also appeared normal in number and structure (4) . There is evidence to indicate that the wilting of peroxidase overproducing plants originates in the roots. Pressure bomb and xylem conductivity measurements show that the vascular tissue of the shoot is able to conduct water as efficiently as wild type plants (26) . Moreover, shoots from peroxidase overproducing plants grafted onto wild type root stocks did not wilt (26) . It appears that overproduction of peroxidase in the roots reduced or altered the development of the root system by some unknown mechanism. At the time of flowering, the root mass of peroxidase overproducing plants was one third the root mass of wild type tobacco plants (34) . The growth rate of roots of POD overproducing tobacco slowed considerably 40 days after germination. Shoot growth rate, however, was unaffected. The wilting phenotype may simply have been the result of a reduced root system that was incapable of meeting the water demands of a healthy and transpiring shoot. It was not surprising that the peroxidase overproducing plants had a higher lignin content than wild type controls. This was apparent, qualitatively, by staining leaves of POD overproducing and wild type tobacco plants for lignin with 23 phloroglucinol (26). The extent of lignification of cell walls and vascular tissues was directly proportional to the peroxidase level of the plant. Quantitatively, tobacco plants that overproduced the anionic peroxidases by ten-fold had a two to ten times higher lignin content depending on the tissue examined (38). Peroxidase overproducing plants also exhibited severe browning of wounded tissue (8,26). Browning involves the deposition of polyphenolic acids which can cross-link not only to other polyphenolic acids but also to

proteins and other cell wall constituents (8 ) . This reaction is important in the post-harvest quality of fruits and vegetables since it can cause an astringent flavor, decreased palatability, decreased digestibility and visual

unattractiveness (8 ) . Wound-induced browning had previously been attributed to polyphenol oxidases. Although the anionic peroxidase has no polyphenol oxidase activity, it is capable of polymerizing phenolic acids (34). Anionic peroxidase underproducing tobacco plants, like peroxidase overproducing plants, had unique characteristics. The plants were phenotypically similar to wild type plants. The leaves of POD underproducing plants, however, were 17% thicker than normal (26). The cells of these leaves were larger and more loosely packed than cells of wild type leaves. The number of cells in a leaf was unchanged. The lignin content was reduced by less than ten percent in plants with a twenty-fold reduction in total peroxidase activity 24 (37) . It is unknown at this time if the structure or size of the lignin polymers was altered by the reduction of anionic peroxidase isoenzymes. Peroxidase overexpressing and underexpressing plants tend to confirm a role for the anionic peroxidase in lignin formation. There is a direct correlation in the amount of anionic peroxidase and lignification. It is somewhat surprising, however, that lignin was reduced by less than ten percent in plants with a 95% reduction in peroxidase levels. Perhaps expression of the antisense construct by the CaMV 35S promoter does not occur at the proper level or correct developmental stage to suppress peroxidase adequately in the cells responsible for lignification. It is also possible that other peroxidase isoenzymes or other enzymes, such as laccase, are capable of lignin formation, especially in the absence, or near absence, of the anionic peroxidase isoen­ zyme. Lignification is of such importance to the development and life of a plant that plants may have evolved multiple genes and/or multiple enzymes with differential regulation to carry out this reaction. Further study is necessary to elucidate the role of the anionic peroxidase in lignin formation. The difference in leaf and cell size in plants with altered peroxidase levels also suggests a developmental role for the anionic peroxidase. Cell size may be controlled, in part, by cell wall extensibility. A role for the anionic 25 peroxidase in limiting cell wall extensibility by cross- linking of cell wall components can easily be envisioned. The possibility also exists that the anionic peroxidase may limit growth by catabolism of IAA. The anionic peroxidase can catabolize IAA in vitro as well as exogenously applied IAA in vivo (34). However, examination of IAA concentrations in wild type, TobAnPOD overproducing and TobAnPOD underpro­ ducing tobacco plants revealed no quantitative differences (26) . Although POD overproducing and underproducing plants have provided new clues to peroxidase function, a clear understanding of its in planta functions is still lacking. The use of the CaMV 35S promoter to over- or under-express the anionic peroxidase complicates the interpretation of the unique phenotypes of the transformed plants. It is not known whether the unusual characteristics observed in POD overpro­ ducing transformants were the consequence of an increased level of anionic peroxidase or due to the expression of this protein in cells, tissues or developmental states where it is not normally found. Likewise, it is unknown whether the antisense construct was able to suppress expression in all the tissues and developmental stages where anionic peroxidase expression occurs. The situation is further complicated by our ignorance of the in planta location and developmental time when the anionic peroxidase is expressed, as well as the environmental and developmental signals that regulate its 26 expression. Little is known about the expression patterns of peroxidases and their regulation. It is very likely that peroxidase levels and location of expression are tightly controlled since it is a highly catalytic enzyme and many of its reaction products are toxic to the cell (4) . Regulation of peroxidase expression can occur at many levels. Regula­ tion may occur at the level of gene expression, cellular location, availability of cofactors, or availability of substrates. The regulation of peroxidase at the level of gene expression is largely unknown. There is sufficient evidence, however, to believe that regulation at this level is impor­ tant for the peroxidases. The existence of unique patterns of peroxidase isoenzymes in different tissues, at different developmental stages, and in response to environmental or chemical stimuli attests to the regulation of peroxidases at the level of gene expression. Gene expression, however, is a multi-step process, and at what step(s) regulation occurs is unknown. Mohan et al. have shown that transcriptional regulation is important, at least for a tomato anionic peroxidase (39) . They demonstrated that gene promoter elements control tissue and developmental expression of this peroxidase. Environmental and chemical stimuli, such as wounding, and exposure to abscisic acid or a fungal elicitor also affected transcription of this peroxidase gene. There 27 is evidence that the tobacco anionic peroxidase gene is also regulated, at least in part, at the level of gene expression. Lagrimini et al. have shown by Northern hybridization analysis that there are differences in mRNA levels for this gene in different tissues. The difference in mRNA abundance may be due to differences in the rate of transcription of DNA into RNA or in the stability of the mRNA intermediate. It was also observed that the induction of certain tobacco peroxidase isoenzymes required de novo synthesis of protein (3,11) . This also is indicative of regulation at the genetic level. Translational regulation was observed for the wound- inducible peroxidases of cucumber (40). Cycloheximide, which inhibits translation of mRNA into proteins, inhibited the induction of peroxidases by wounding in detached cucumber hypocotyls. Actinomycin D, which inhibits transcription, had little inhibitory effect on the wound induction of the peroxidase isoenzymes. Controlling gene expression is not the only mechanism for control of peroxidase activity. Peroxidase activity can be controlled by the availability of cofactors. Peroxidase requires a heme moiety for activity. Biosynthesis of active peroxidase is, therefore, dependent on the coordinate

biosynthesis of the heme group (8 ) . The heme is synthesized in the mitochondria and its synthesis is dependent on the availability of soluble iron (8,26). 28 Calcium levels are also known to affect peroxidase activity. Calcium, although not a cofactor, is known to be important for stability and increased activity of peroxidase. Secretion of peroxidase into the cell wall is dependent on calcium levels (5,6). Increased calcium levels promote

secretion of extracellular peroxidases (6 ) . Conversely, gibberellic acid inhibits peroxidase secretion (41). Auxin has also been suggested as a regulator of peroxi­ dase activity directly or indirectly (3,42) . A direct effect was observed in pea epicotyls where exogenously applied IAA inhibited the appearance of newly synthesized peroxidases in the cell wall (42) . It is not known if IAA inhibited the synthesis or the secretion of peroxidases in this system. Indirectly, peroxidase activity may be regulated by auxin by altering the pH of the cell wall. The acid-growth theory asserts that auxin acidifies the extracellular matrix by stimulating hydrogen ion excretion (43). The kinetics and stability of peroxidase isoenzymes present in the cell wall are likely to be affected by any changes of pH. The availability of substrates may also regulate peroxidase activity. The importance of this regulatory mechanism, however, has not been proven for the peroxidases. Substrate availability is probably not important for peroxi­ dase-catalyzed lignin formation. An efflux of phenolic compounds, which presumably includes lignin precursors, is concurrent with peroxidase secretion into the cell wall (7) . 29 Clearly, the peroxidases are important in many aspects of plant life. Merely the ubiquity of peroxidases— no higher plants are known that lack peroxidase activity— is testimony to their importance. This alone makes them worthy of study. Peroxidases, however, also have important economic conse­ quences that make them of interest. From an agricultural standpoint, peroxidases may be important in stress tolerance and defense against insects and pathogens. It has been shown that elevated levels of peroxidase in plants are detrimental to insects (44) . It is possible that the use of chemical pesticides can be curtailed by manipulation of peroxidase levels in plants. Manipulation of peroxidase levels may also aid in increasing the digestibility of forage crops. Lignocellulose, thought to be formed by peroxidase action, interferes with the digestion and absorption of nutrients of agronomically-important animals. From an environmental perspective, the manipulation of peroxidases may lead to reduced pollution not only from chemical pesticides but also from paper and pulping mills. Lignin is a major problem for the paper pulping industry since it must be removed from wood prior to pulping. This process requires a large consumption of energy and causes pollution in lakes and rivers. A better understanding of peroxidase and its expression holds the promise of changing lignin levels and/or chemical structure to reduce the cost and pollution associated with paper production. 30 Any attempt to manipulate peroxidase levels, however, requires a much better understanding of the regulation, expression and function of the peroxidases. The unexpected and undesirable phenotypic characteristics of peroxidase over- and under-expressing plants attests to this. It is the purpose of the work presented in this thesis to provide a better understanding of the expression and regulation of the anionic peroxidase at the transcriptional level. Presented here is an extended characterization of the tobacco peroxi­ dase gene by restriction mapping and sequencing. Developmen­ tal and tissue specific expression, as well as environmental and hormonal regulation of this gene are examined in depth. It is hoped that an understanding of the expression and regulation of the tobacco anionic peroxidase gene will expand our knowledge of this peroxidase isoenzyme and its functions in plants. 31

LIST OF REFERENCES

1. Saunders, B. C. ; Holmes-Siedle, A. G. ; Stark, B. P. Peroxidase: The Properties and Uses of a Versatile Enzvme and of some Related Catalysts. Washington: Butterworth & Co., 1964. 2. Dunford, H. Brian. "Horseradish Peroxidase: Structure and Kinetic Properties." In Peroxidases in Chemistry and Biology, vol. 2, pp. 1-24. Edited by Johannes Everse, Kathleen E. Everse and Matthew B. Grisham. Boca Raton: CRC Press, 1991. 3. Lagrimini, L. Mark; Burkhart, William; Moyer, Mary; Rothstein, Steven (1987). "Molecular Cloning of Complementary DNA Encoding the Lignin-Forming Peroxidase from Tobacco: Molecular Analysis and Tissue-Specific Expression." Proc. Natl. Acad. Sci.. 84, pp. 7542-7546. 4. Lagrimini, L. Mark; Bradford, Sandra; Rothstein, Steven (1990). "Peroxidase-Induced Wilting in Transgenic Tobacco Plants." Plant Cell. 2, pp. 7-18. 5. Campa, Ana. "Biological Roles of Plant Peroxidases: Known and Potential Function." In Peroxidases in Chemistry and Biology, vol. 2, pp. 25-50. Edited by Johannes Everse, Kathleen E. Everse and Matthew B. Grisham. Boca Raton: CRC Press, 1991.

6 . Van Huystee, R. B. (1987). "Some Molecular Aspects of Plant Peroxidase Biosynthetic Studies." Annu. Rev. Plant Physiol.. 38, pp. 205-217. 7. Gaspar, Thomas; Penel, Claude; Castillo, Federico J.; Greppin, Hubert (1985). "A Two-Step Control of Basic and Acidic Peroxidases and its Significance for Growth and Development." Plant Physiol.. 64, pp. 418-423.

8 . Lagrimini, L. Mark (1991). "Wound-Induced Deposition of Polyphenols in Transgenic Plants Overexpressing Peroxi­ dase." Plant Physiol.. 96, pp. 577-583. 9. Fry, Stephen C. The Growing Plant Cell Wall: Chemical and Metabolic Analysis. Essex, UK: Longman Scientific and Technical, 1988. 32 10. Salisbury, Frank B.; Ross Cleon W. Plant Physiology. 4th ed. Belmont, CA: Wadsworth Publishing Co., 1992. 11. Lagrimini, L. Mark; Rothstein, Steven (1987). "Tissue Specificity of Tobacco Peroxidase Isozymes and Their Induction By Wounding and Tobacco Mosaic Virus Infec­ tion." Plant Phvsiol.. 84, pp. 438-442. 12. Taiz, Lincoln (1984). "Plant Cell Expansion: Regula­ tion of Cell Wall Mechanical Properties." Ann. Rev. Plant Phvsiol.. 35, pp. 585-657. 13. Waffenschmidt, Sabine; Woessner, Jeffrey P.; Beer, Karin; Goodenough, Ursula W. (1993). "Isodityrosine Cross-Linking Mediates Insolubilization of Cell Walls in Chlamydomonas." Plant Cell. 5, pp. 809-82 0. 14. Mader, M. ; Fussl, R. (1982). "Role of Peroxidase in Lignification of Tobacco Cells. II. Regulation by Phenolic Compounds." Plant Phvsiol.. 70, pp. 1132-1134. 15. Markwalder, H.-U.; Neukom, H. (1976). "Diferulic Acid as a Possible Crosslink in Hemicelluloses from Wheat Germ." Phytochemistry. 15, pp. 836-837. 16. Fry, S. C. (1987). "Formation of Isodityrosine by Peroxidase Isozymes." J. Exp. Bot.. 38, pp. 853-862.

17. Fry, S. C. (1984). "Incorporation of [14C]Cinnamate into Hydrolase-Resistant Components of the Primary Cell Wall." Phytochemistry. 23, pp. 59-64. 18. Mader, M. "Compartmentation of Peroxidase Isoenzymes in Plant Cells." In Plant Peroxidases 1980-1990: Topics and Detailed Literature on Molecular. Biochemical, and Physiological Aspects, pp. 37-46. Edited by C. Penel, Th. Gaspar, H. Greppin. Geneva: University of Geneva, 1992 . 19. Birecka, H.; Miller, A. (1974). "Cell Wall and Proto­ plast Isoperoxidases in Relation to Injury, Indoleacetic Acid, and Ethylene Effects." Plant Phvsiol.. 53, pp. 569-574. 20. Barcelo, A. R.; Pedreno, M. A.; Munoz, R.; Sabater, F. (1988) . "Lupin Peroxidases. II. Binding of Acidic Peroxidases to Cell Walls." Phvsiol. Plant. 71, pp. 238-244. 33 21. Robb, Jane; Lee, Shin-Woo; Mohan, Royce; Kolattukudy, Pappachan E. (1991). "Chemical Characterization of Stress-Induced Vascular Coating in Tomato." Plant Phvsiol.. 97, pp. 528-536. 22. Sherf, Bruce A.; Bajar, Aslam M.; Kolattukudy, Pappachan E. (1993). "Abolition of an Inducible Highly Anionic Peroxidase Activity in Transgenic Tomato." Plant Phvsiol.. 101, pp. 201-208. 23. McDougall, Gordon J. (1992). "Changes in Cell Wall- Associated Peroxidases During the Lignification of Flax Fibres." Phytochemistry. 31, pp. 3385-3389. 24. McDougall, G. J. "Plant Peroxidases and Cell Differen­ tiation." In Plant Peroxidases 1980-1990; Topics and Detailed Literature on Molecular. Biochemical, and Physiological Aspects, pp. 101-115. Edited by C. Penel, Th. Gaspar, H. Greppin. Geneva: University of Geneva, 1992. 25. Barcelo, A. Ros; Munoz, R. "Peroxidases: Their Role in the Control of Plant Cell Growth." In Plant Peroxidases 1980-1990: Topics and Detailed Literature on Molecular. Biochemical, and Physiological Aspects, pp. 71-89. Edited by C. Penel, Th. Gaspar, H. Greppin. Geneva: University of Geneva, 1992. 26. Lagrimini, L. M. "Altered Phenotypes in Plants Trans­ formed with Chimeric Tobacco Peroxidase Genes." In Biochemical. Molecular, and Physiological Aspects of Plant Peroxidases, pp. 59-67. Edited by J. Lobarzewski, H. Greppin, C. Penel, Th. Gaspar. Lubin, Poland: University M. Curie-Sklodowska, 1991. 27. Boyer, N.; DeJaegher, G. "Direct or Indirect Role of Peroxidases in Ethylene Biosynthesis?" In Molecular and Physiological Aspects of Plant Peroxidases, pp. 47-60. Edited by H. Greppin, C. Penel, Th. Gaspar. Geneva: University of Switzerland, 1986. 28. Gaspar, Th.; Penel, C.; Hagege, D.; Greppin, H. "Peroxidases in Plant Growth, Differentiation, and Development Processes." In Biochemical. Molecular, and Physiological Aspects of Plant Peroxidases, pp. 249-280. Edited by J. Lobarzewski, H. Greppin, C. Penel, Th. Gaspar. Lubin, Poland: University M. Curie-Sklodowska, 1991. 34 29. Strivastava, O. P.? Van Huystee, R. B. (1977). "An Inter-Relationship among Peroxidase, IAA Oxidase, and Polyphenoloxidase from Peanut Cells." Can. J. Bot.. 55, pp. 2630-2635. 30. MacAdam, Jennifer W.; Sharp, Robert E.; Nelson, Curtis J. (1992). "Peroxidase Activity in the Leaf Elongation Zone of Tall Fescue. II. Spatial Distribution of Apoplastic Peroxidase Activity in Genotypes Differing in Length of the Elongation Zone." Plant Physiol.. 99, pp. 879-885. 31. MacAdam, Jennifer W.; Nelson, Curtis J.; Sharp, Robert E. (1992). "Peroxidase Activity in the Leaf Elongation Zone of Tall Fescue. I. Spatial Distribution of Ionically Bound Peroxidase Activity in Genotypes Differing in Length of the Elongation Zone." Plant Physiol.. 99, pp. 872-878. 32. Moerschbacher, B. M. "Plant Peroxidases: Involvement in Response to Pathogens." In Plant Peroxidases 1980- 1990: Topics and Detailed Literature on Molecular. Biochemical, and Physiological Aspects, pp. 91-99. Edited by C. Penel, Th. Gaspar, H. Greppin. Geneva: University of Geneva, 1992. 33. Graham, M. Y.; Graham, T. L. (1991). "Rapid Accumula­ tion of Anionic Peroxidasesand Phenolic Polymers in Soybean Cotyledon Tissues following Treatment with Phytophthora megasperma f. sp. Glycinea Wall Glucan." Plant Phvsiol.. 97, pp. 1445-1455. 34. Lagrimini, L. M. "Plant Peroxidases: Under- and Over- Expression in Transgenic Plants and Physiological Consequences." In Plant Peroxidases 1980-1990: Topics and Detailed Literature on Molecular. Biochemical, and Physiological Aspects, pp. 59-69. Edited by C. Penel, Th. Gaspar, H. Greppin. Geneva: University of Geneva, 1992. 35. Benfey, Phillip N.; Chua, Nam-Hai (1990). "The Cauli­ flower Mosaic Virus 35S Promoter: Combinatorial Regulation of Transcription in Plants." Science. 250, pp. 959-966. 36. Rothstein, S. J. ; Lagrimini, L. M. "Silencing Gene Expression in Plants." In Oxford Surveys of Plant Molecular and Cellular Biology, pp. 221-246. Edited by B. J. Miflin. Oxford: Oxford University Press, 1989. 37. Lagrimini, L. M. unpublished results. 35 38. Chabbert B. ; Liu, T. Y. ? Lagrimini, L. M. "Lignin Content and Composition in Transgenic Tobacco Plants with Altered Peroxidase Activity." In Proceedings of the Fifth International Conference of Biotechnology in the Pulp and Paper Industry. Kyoto, Japan, 1992. 39. Mohan, Royce; Vijayan, Perumal; Kolattukudy, Pappachan E. (1993). "Developmental and Tissue-Specific Expres­ sion of a Tomato Anionic Peroxidase (tapl) Gene by a Minimal Promoter, with Wound and Pathogen Induction by an Additional 5' Flanking Region." Plant Molecular Biology. 22, pp. 475-490. 40. Svalheim, O. ; Robertsen B. (1990). "Induction of Peroxidases in Cucumber Hypocotyls by Wounding and Fungal Infection." Phvsioloqia Plantarum. 78, pp. 261- 267. 41. Fry, Stephen C. (1980). "Gibberellin-Controlled Pectinic Acid and Protein Secretion in Growing Cells." Phytochemistry. 19, pp. 735-740. 42. Jones, R. L. "Gibberellic Acid and Auxin Influence the Secretion of Peroxidase." In Molecular and Physiologi­ cal Aspects of Plant Peroxidases, pp. 295-308. Edited by H. Greppin, C. Penel, Th. Gaspar. Geneva: Universi­ ty of Geneva, 1986. 43. Grignon, C. ; Sentenac, H. (1991). "pH and Ionic Conditions in the Apoplast." Annu. Rev. Plant Physiol.. 42, pp. 103-128. 44. Dowd, P. F.; Lagrimini, L. M. unpublished results. CHAPTER II FURTHER MOLECULAR CHARACTERIZATION OF THE TOBACCO ANIONIC PEROXIDASE GENE

Introduction Characterization of the tobacco anionic peroxidase gene was begun by Lagrimini et al. who first isolated this gene as a cDNA clone from Nicotians tabacum (Coker 176) leaf mRNA (1) . The coding region and 3' untranslated region were characterized by DNA sequencing of this clone and partial protein sequencing of the isolated peroxidase protein. This analysis revealed the DNA and amino acid composition and sequence of the peroxidase protein, and the presence of a hydrophobic amino acid signal sequence necessary for secretion of the protein into the extracellular space. It also identified potential sites for N-glycosylation as well as cysteine residues likely to be involved in protein secondary structure. Sequencing the 3' untranslated end of the cDNA clone revealed the presence of a consensus polyadenylation signal, AATAAA, located 218 bp downstream of

the translation stop codon and 38 nucleotides 5 1 to the site of poly (A) tail addition (2).

36 A genomic clone of the tobacco anionic peroxidase gene was also isolated by Diaz et al. This clone allowed

characterization of the introns and 5 1 regulatory region of this gene. Two introns are present in the peroxidase gene. Both are approximately 350 bp in length (3) . The splicing signals for this gene differ from the eukaryotic intron splicing consensus signal. Introns typically have -GT and

AG- dinucleotides at their 5' and 3 1 ends, respectively (4).

Introns I and II have 5' dinucleotides of -TA and -GT, and 3 1 dinucleotides of -GG and -AT, respectively. Divergence from the consensus splice signal has been observed by others (5) . Characterization of the 5' regulatory region was begun by Diaz (3) . A portion of the upstream regulatory region,

comprised of approximately 410 bp 5 1 of the translation start site, was sequenced. A TATA box, required for proper initiation of transcription, was identified based on sequence homology to the consensus TATA element of plant promoters and

its location within the gene (6 ) . A putative CAAT box, believed to be an important regulator of transcriptional activity, was also identified (4). A sequence immediately upstream of the putative CAAT box is similar to the as-2 box identified by Lam and Chua (7) . This element contains a repeated GATA motif found in several light-responsive promoters as well as the cauliflower mosaic virus 35S promoter. It is believed to direct leaf-specific expression. 38 This chapter describes the continuing molecular characterization of the tobacco anionic peroxidase gene. Initially, this characterization was to be limited to the 5' regulatory region of the gene. After numerous unsuccessful

efforts to further characterize the 5 1 regulatory region of this gene, the plasmids being used containing the putative 5' upstream region were sequenced to try to determine the source of the problem. Sequencing revealed that what was purported

to be the 5' end of the gene was in fact the 3 1 untranslated portion of the gene. Further investigation revealed that the previously determined restriction map of the peroxidase gene was seriously flawed. It was therefore necessary to remap the peroxidase gene prior to characterization of the 5' regulatory region. With the tobacco anionic peroxidase gene mapped, characterization of the 5' regulatory region of the tobacco anionic peroxidase gene was possible. The transcription start site was mapped and 3 kb of the peroxidase promoter region was sequenced. The promoter was examined for potential regulatory regions based on sequence homology with regulatory elements identified in other genes. The significance of these potential regulatory sites is discussed. 39 Materials and Methods Restriction enzyme mapping. A genomic clone of the tobacco anionic peroxidase gene (P0D3) was previously isolated and subcloned (3). Plasmid pPD102390-2 contains a

6 kb Xhol fragment from P0D3 in pBluescript KS (-). Plasmid pPD110790 contains an 11 kb BamHI fragment of P0D3 in pBS(+). These two plasmids were used for restriction site mapping of the peroxidase gene. The plasmid DNA was cut with restriction enzymes purchased from Gibco/BRL or Boehringer Mannheim and used according to manufacturers' instructions. Restriction fragments were separated on 0.7 to 1.0% Seachem agarose gels with IX TBE (0.09 M Tris, 0.09 M boric acid, 0.002 M EDTA, pH 8.0) and 0.4 ug/mL ethidium bromide. Fragment sizes were determined by comparison of their electrophoretic mobility to the fragments generated by BsfcEII digestion of lambda DNA. Plasmid construct. Plasmid pKK010692 was synthesized for mapping the transcription start site of the peroxidase gene. An approximately 600 bp fragment that spanned 415 bp upstream of the translation start site to 160 bp into the coding region was isolated from pPD110790 by digestion with

XJbal and Xhol and purification from a 1 .0 % low melt agarose gel. This fragment was ligated with T4 DNA ligase into pBluescript KS (-) which had previously been digested with Xbal and Xhol. The plasmid was transformed into E. coli strain JM109 by PEG-mediated transformation and its structure 40

confirmed by restriction enzyme digestion (8 ). RNA isolation (1). Total RNA was isolated from Nicotians tabacum cv. Xanthi stem tissue from which most of the pith had been removed. Approximately 50 g of tissue was

frozen in liquid N2 and ground in a Waring blender. The frozen tissue was added to 100 mL of grinding buffer (50 mM Tris-HCl, pH 8.0, 4% sodium p-amino-salicylic acid, 1% sodium naphthelene 1,5-disulfonic acid) and 100 mL of water saturated phenol. The tissue was further ground with a Brinkmann Homogenizer at highest speed, then agitated at 300 rpm for 10 minutes at room temperature. The mixture was extracted twice with CHC13. The aqueous layer was removed

and 8 M LiCl, 8 M urea and 0.5 mM EDTA, pH 8.0 were added to obtain final concentrations of 2 M LiCl, 2 M urea and 1 mM EDTA. The RNA was allowed to precipitate overnight at 4°C and was pelleted by centrifugation at 115,900 x g for 2 hours at 7°. The pellet was twice resuspended in a solution of 40 mM Tris-HCl, pH 7.5, 20 mM sodium acetate, 5 mM EDTA and 1%

sodium dodecyl sulfate and re-precipitated with 0 . 1 volumes of 3 M sodium acetate and 3 volumes of ethanol. RNA was resuspended in 0.1X TE (10 mM Tris, 1 mM EDTA, pH 8.0) and quantified spectrophotometrically (9) . Primer extension. Primer extension reactions were

carried out by a combination of two protocols (1 0 ,1 1 ). Oligonucleotides were purchased from Operon Technologies (Alameda, CA) . Oligo 120193 (GCT CCA AAA ATT GCA AC) was 41 purified by electrophoresis through a 19% polyacrylamide gel. The oligo was extracted from the polyacrylamide with diethyl pyrocarbonate-treated water at 37°C, overnight, with agitation. Oligo 013194 (GAA AAG AAT CGC ACC AAC) was synthesized and HPLC purified by Operon Technologies. The oligonucleotides were labelled at the 5' terminus by

reacting 5 pmoles of oligonucleotide, 75 uCi of 6 3 2 P-ATP (3000 Ci/mMole, 10 mCi/mL) , and 10 U of T4 polynucleotide kinase in 50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 5 mM DTT and 0.1 mM spermidine in a total volume of 25 uL at 37° for one hour. The labelled oligonucleotides were precipitated by addition of 11.5 uL TE, 27 uL of 5 M ammonium acetate, 10 ug of yeast RNA and 175 uL of ethanol and incubation at -70°. The oligonucleotides were resuspended in TE and reprecipitated with 0.1 volumes of 3 M sodium acetate and 2.5 volumes of ethanol. The pellets were washed once with 95% ethanol. The labelled oligonucleotides were resuspended in 25 mL of TE (approximately 0.1 pmole/uL). The labelled oligonucleotides were annealed to Nicotiana tabacum cv. Xanthi RNA. For each annealing reaction, 10 ug of total RNA, 1 uL of labelled oligonucleotide, 1 uL of RNasin (Promega), and 2 uL of 5X annealing buffer (1.25 M KC1, 10 mM Tris-HCl, pH 7.9, 1 mM EDTA) were combined. TE was added for a total volume of 10 uL. Annealing with each oligonucleotide was carried out at three different temperatures based on the Tm of the oligonucleotide, where Tm 42 is calculated as 4 x (the number of G + C residues) + 2 x (the number of A + T residues) . The ideal annealing temperature has been reported to be Tm - 10° (10). This temperature, as well as 3° above and below it, were used for annealing. Oligo 120193 was annealed to RNA at 35, 38 and 41° C. Oligo 013194 was annealled with RNA at 38, 41 and 45°

C. All oligo/RNA annealing reactions were carried out for 8 hours. The primers were extended by the addition of 23 uL of PE buffer (10 mM MgCl2, 5 mM DTT, 0.33 mM of each dNTP, 100 ug/mL actinomycin-D, 20 mM Tris-HCl, pH 8.3) and 10 U of AMV reverse transcriptase and incubation at 37° for 45 minutes. DNA was precipitated with 300 uL of ethanol at -70° and washed once with 70% ethanol. The size of the extended

primers was determined by electrophoresis on an 8 % denaturing polyacrylamide gel. Sequencing reactions using both primers and pKK010692 as the DNA template were also run on the gel as size standards. Sequencing was performed as described below

using Sequenase and 3 5 S-labelled dATP. DNA sequencing. Two different methods of DNA sequencing were employed. Both methods were modifications of the dideoxy-mediated chain-termination method of Sanger (12) . Double-stranded plasmid DNA was used as a template for both

methods. For sequencing using Sequenase and 3 5 S-labelled dATP, the plasmid DNA was prepared for sequencing by the method of Kraft et al. (13). Plasmid DNA (10 ug) was 43 dissolved in 20 uL water. The DNA was denatured for 5 minutes at room temperature by the addition of 2 uL of a solution of 2 N NaOH and 2 mM EDTA. The solution was

neutralized with 8 uL of 6 °C 1 N Tris-HCl, pH 4.5. The template was precipitated with 0.1 volumes of 3 M NaOAc and 2.5 volumes of ethanol and washed once with 70% ethanol. Sequencing with a Sequenase kit (United States Biochemical Corp.) was performed according to the manufacturer's instructions (14). The reactions were loaded onto a

denaturing polyacrylamide gel (6 % acrylamide, 0.3% bis-

acrylamide, 6 M urea, 0.9X TBE) and the populations of oligonucleotides were separated at 45 watts, constant power. Radiolabelled bands were detected by exposure to Kodak X-OMAT film. Sequencing was also carried out by cycle sequencing using Tag DNA polymerase and fluorescent dye-labelled primers or dye-labelled dideoxy dNTPs. Sequencing reactions were performed with Applied Biosystems sequencing kits according to manufacturer's instructions and analyzed with an Applied Biosystems model 373A automated DNA sequence analyzer (15).

Results and Discussion Restriction site mapping of the tobacco anionic

peroxidase gene. A region of approximately 8 kb that includes the peroxidase gene was restriction mapped using

single and double enzyme digests of a 6 kb Xhol and a 8 kb 44 BamRl genomic subclones derived from a 17 kb tobacco genomic clone of the peroxidase gene. The region mapped includes approximately 5.6 kb of the 5 # upstream region, the 1.6 kb peroxidase coding region including introns, and approximately 850 bp of the 3' downstream region. The restriction map is shown in Figure 5. Transcription start site. The transcription start site was determined by primer extension using two different primers to ensure accuracy. The transcription start site was mapped to a thymidine residue 70 base pairs upstream from the translation start signal and 34 base pairs downstream from

the putative TATA box (Figure 6 ) . Both primers mapped to this position. The location of the transcription start site

agrees with the consensus location for plant genes (6 ). The transcription start site for plant genes is typically 40 to 80 nucleotides upstream from the translation start site and 25 to 39 nucleotides downstream of the putative TATA box. It differs, however from the consensus sequence for plant genes of CTCATCA, where the transcription start site is underlined. The sequence surrounding the transcription start site for the peroxidase gene is AAATATA. DNA sequencing of the 5' regulatory region. Approximately 3 kb of the 5' regulatory region of the anionic peroxidase gene was sequenced. The promoter region was sequenced as far upstream as the EcoRI site located at -3146 bps. Sequencing was accomplished by a combination of Figure 5: Restriction site map of the tobacco anionic peroxidase gene. The coding region is represented as an open box. The introns are represented by solid boxes.

45 Tobacco Anionic Peroxidase Xhol EcoRI j BamHI StuI Ndel ] StuI EcoRI HinDIII Xbal ! BamHI l I I j I J—L Coding Region

2000 4000 6000 8000 I i i » I ■ i i I i i i I 1 i 1 L

Figure 5 Figure 6 : Map of the transcription start site determined by primer extension. Transcription start site is indicated by arrows.

47 Primer 120193 Primer 013194

Figure 6 CD Figure 7: DNA sequence of the tobacco anionic peroxidase 5' regulatory region from the EcoRI site at -3146 bps to the translation start site. TATA box is underlined. Transcription start site is double underlined.

49 50

GAATTCAATTTCATATG ATAAAGCTAA g t t c t t t a a c -3110 AAAAGTCAAA AAGTCAACAT CGAGCCCATA TCTCGGAATA -3070 AAATAAAATT AACAAAATCC GAATATTCAT TCANCAACGA -3030 GTCTAACCAT ACCAAAATTA CTCAATTCTG ATATCAAATC -2990 GGCACTAAAA TCCCCAAATCTACTCTCCAATCCCTAGTCC -2950 AAAAATTTCC CAAATTTCAC CTTAAAAACA CATAATTTAG -2910 GTGGGAAATT CAATGGGTAT CAATATTAATAAATCAAAAC -2870 AACCAAAAGT TGTTTACCTCTTGAAATCTA GTAAAACTCC -2830 TCTCAAAAAA TGCCTCCAAC CGAGCTTGCAAAGTTAAAAA -2790 ATGAAGAAAT CTCGAAAACC TTTGAATTTAACACACTGCT -2750 ATNTTTCGCA CTACGGAGTC AAAGGCCGCACCTGCGATTC -2710 GCTTTTGCGGAGAAATCTTC GCTTGTGNGAAGTCCACTTA -2670 AGCCCCGGAC CTAGCGNACT ACGGTCCCCT CTTCACACTG -2630 CGGAACCACATCTGCGGATC ACACCATCGC ATCTGCAATC -2590 CATGAGTCCC ACTGCCAAAC TCCGACTTTTGCGTGACAAC -2550 TTCGTGCATG CGCTANGTCC GCTTCTATGAATTTACATAC -2510 ACTACGCAACGTGCAGCTTT CCGAGCTGAC TTCTCCTTTT -2470 ACGCACCTGC GCGCAGCCTA CCGCTTCTGC GGGTCCGCAC -2430 CTGCGGCCAA TCCTTCCGCA GGTGCGATGA CACCAAACCT -2390 GAAGCACTTCAATATATCTT CTAAGTCCAT TTTCAATCCG -2350 TTAACCATCT CAATCCACCC GAAGCCCCCG AGACCTCAAC -2310 CAAGTATNTC AACAAATCTT AACTCACGAT ATGAACTTGG -2270 CCGAGGCCTC AAGTCACATC AAAAACACGA AGCACACTCC -2230 AATTCAAGCC TAAGGAACTA ATGAATTTTCAATTTCTACA -2190 ATCGATGCTA AAACATATCA AACCAACTGC GATTGACCTC -2150

Figure 7 51

AAATTTTGCA CACAATTCAT GAATGACATA AAGGACCTAT - 2 1 1 0 TCCTACTTCTGGAACCGAAA TTAGAGCCCG GTAACTATAA -2070 AGTCAACTCT CGGTCAAACT TCTCTACTCT GCAAACTTCA -2030 ACTTTTCCAG CTTTTGCCAA TTCAAGCCAT AATCATCTAC -1990 GGACCTCTAA ATCAATATCC GAACACACTT TCTAAGTCCA -1950 AAATTACCAT ACGGAGCTGT TGGAGCCATC AAAACTCCAT -1910 TTCGGAGCCA TTTACACATT AGTCAATATC CGGTCAACTC -1870 TTTCAACTTA AGCTTCCAAC CTTGGGACTA CGTGTCACAA -1830 CTCATTTTGA AACATCCTCG GAATTAAACC AACAACCCCG -1790 ACAAGTCACA TAACAACGAA TGATCATAGA ATAAGCAATA -1750 AATAGGGGAA CAAGGCTACA ATACTCAACACACTCGGCCA -1710 GTGGCGGATG TACATTATGG ATTATGGGTG CTTGAGCACC -1670 CATTACTTGT GGAGCCAAAC TTTATAGTTA TATAGAAAAA -1630 ACTAGTAAAT TATACAAATA TATTAATTAA GCACTCAGTC -1590 TCAGTAGTAA TTTTTAGATT AAAAATAATT GAGCATTCAT -1550 AATTTAAAAA TTTTGGATTT GGCGCTGTGA TCAGCCAAGT -1510 CGGTACAAAA ATATAGAAAAAAATATTCGTATAATAAAGG -1470 TTTTCTAACT GTCCAACGAT CTCGTACGCT AATCGTGGAT -1430 AAATTAAGCA CTCGAAAGAA GAAAAAATGA CACGAAAATA -1390 ATTTAGCTGC AAAGTGACAA TAGTTGTTAG TCTCTTTTTC -1350 TTTGTTTTCG ATAGACATTA TTCGACAGTC ACTTAAATTG -1310 TTGGGCCTAA CAAAAAGAAA AAAATCGTTC ATCTTTGTAG -1270 GTCTACACGT GCATTTGATA TTTTTTCAAC AAAATATAGA -1230 CACAGCTTTC ACGAAAATAA GTAGCTGGCC AATTTTCTAA -1190 ATACTTCTTA CCGTTTTTGT GATTGTAATT TATGATTAGG -1150

Figure 7 (continued) TGAGGCAAGT AAACCTGGAGTAAACTTAAG TCCATACCTA - 1 1 1 0 ATTGACAGTAGTGTAAAATC CAATCGAATTTATCTTGTCT -1070 TAATCATATT GTTTAGTCAA AGGTAAGTTT GACTTGTTCA -1030 CTTAAAGTCA TATGAAGCTA AAATAAATAA ATAAATAAAA -990 AGTCATATGA AGCTAAGTTA GATACAAATA TTCAGCTCCT -950 AATCTTGCGA ATTGTGATAC GTATGTACAT GTCGGATCTA -910 TCGTGTAATA TACGGATTCA CATGAATTTA GTAACCTGTG -870 TCCAGATTAT GTATATGTTTAAGAAATCTA ATGAACATCT -830 ACATATAATATCTGACTGTA AATTCAATTG TTATTGTATA -790 TTAACTTAAG GTCATTGTCGAAACTTTTAA ACTTCTAATC -750 TTGAATCTAC CTGTATGTATACAAATATAT ATCATACAAC -710 TTTTTTTTAT TCGCAATTCA TGTAACATAA CTACGTTCTC -670 GTAATCTACAATGTCGAGTA TATGTTTGTC ATATGTTCTC -630 TCCAATTATT CTTGTATATG TGCCCAATAT ACAATCTCTA -590 TAGTAAATAA TCTAAAACATTATGAAACTATTTTAGCAGT -550 GATTTTCATA ATCAATTATA GTTCCTATAT ATATATATAT -510 ATATATATTT TCTCGTTTGGATATATATCT ATCAAACTTC -470 AAAAGATTTA GACATTCCAT AATTATTTTC TACCGACAAT -430 ATAACATAGA CAACACGTGG ATAATTTTCG TTTTTCTCTT -390 GAAAACACAT CTCTTAATCA AAAATTTACT CTACTCTCTA -350 TTTATCTAGA AATCGTCTCC CCACATAACA AGTTGGAGCC -310 AATTAAAATC CTACGAGTTG ATCAATTATA TATTTGACTA -270 GTCGTCCACT GCCCAATCTT AGAGCTATTA TTAAATGCAC -230 AAAATTGAGA ATTTTCTAAC TAACTTGAAA AGAAAGCTAC -190 AAATAATTTTCTTCACTCGT TTTCTTACAA TTTAATAGTG -150

Figure 7 (continued) ACTGGCGGCT AATATTTGGC CTTTGTCTCC CTATTTTCTC -110 CACAATAATT ACTTTGATAA TGATGTTACT CTCAATAGCC -70 TCTAATCAAG GGGCTATATT TCCCACTTCT ACATTCTATA -30 AATACCAACC TAAAGTGACC ATTTAAAAA1 ATACAGAATC +11 AACTTTAATT TCTTGAGTAA TCTTGAAAAA TAAAAAAAAA +51 CTTTAAAAAG TTGTCAATCA TG +73

Figure 7 (continued) 54 subcloning of promoter fragments and primer walking. The sequence of the tobacco anionic peroxidase promoter up to and including the ATG of the translation start site is shown in Figure 7. The peroxidase promoter contains elements common to most eukaryotic promoters. The untranslated leader sequence from the transcription start site to the translation start site is

extremely A+T rich (80%), typical for eukaryotic genes (6 ). Joshi's review of 79 plant genes found that over 90% of the leader sequences of these genes were A+T rich. A TATA box, responsible for the correct initiation of transcription, is found at -33 bps upstream of the transcription start site. The sequence of the peroxidase TATA box is very similar to the consensus sequence reported for plants and shown in

Figure 8 . A CAAT box, another common regulatory element of

consensus TCACTATATATAG peroxidase ATTCTATAAATAC

Figure 8 : Comparison of the consensus sequence for the TATA element for plant genes and sequence of the TATA element of the tobacco anionic peroxidase promoter (6 ). eukaryotic genes, is also found in the peroxidase promoter. This element is located at -77 bps. Typically, CAAT boxes are found 50 to 100 bp upstream of the transcription start site (16). CAAT boxes have been implicated in controlling the level of gene expression as well as tissue specificity. The peroxidase promoter also contains ten other copies of the CAAT box element. These are found at -256, -310, -605, -627, -1089, -1200, -2012, -2230, -2422, and -2962 bps. Upstream CAAT boxes with regulatory activity have been observed in heat shock genes (17). It is thought that upstream CAAT boxes act synergistically with other upstream elements to enhance the activity of the associated element. There is no universal protein that binds to CAAT box elements. A number of proteins have been identified that are capable of binding to these elements. Different CAAT box-binding proteins are often found in the same cell (18). Other potential regulatory regions have been identified in the tobacco anionic peroxidase promoter. Just upstream of the CAAT box at -94 bps is a region that is similar in sequence and position to the as-2 box identified by Lam and Chua at -97 bp in the CaMV 35S promoter (7) . This element is also found in several light-responsive promoters, although it is not associated with light inducibility (7,19,20). Transformation of tobacco plants with a tetramer of this element fused to the -90 CaMV promoter directed expression in all cell types of leaves and may be responsible for shoot- specific expression (7). This sequence may be important in regulating expression of the tobacco anionic peroxidase gene, since this peroxidase isozyme is expressed primarily in the aerial portions of the plant (21). Figure 9 compares the 56 Tobacco anionic POD TTT GATA AT GATG TTAC CaMV 35S ATT GATG T GATA TCAT Petunia Cab 22L GTA GATA GA GATA TCAT 22R ATA GATA GT GATA TTCA 91R CAA GATA AT GATA TTCA 25 ACCGATAGT GATA TTCT Arabidopsis Cab 165 ACA GATA AA GATT ACTT 180 AGA GATA TA GATT ACTT 140 TCA GAGA TT GATA TTTC Tobacco Cab E GTAGATATA GATA CTCA C GTAGATAGAGATA CCAT F GTAGATAGA GATA TTAT Tomato Cab IB ATA CATA TA GATA TCAC 3C GCA GATA AT GATA TTCT Figure 9: Comparison of sequences containing the GATA motif from the promoter regions of the tobacco anionic peroxidase, CaMV 35S, and several chlorophyll a/Jb binding proteins (7,19,2 0). sequence of this putative as-2 element of the tobacco anionic peroxidase promoter with the as-2 element of the CaMV 35S promoter and the GATA motif found in light inducible promoters from several species. Putative G boxes are located at -416 and -12 64 bps. G boxes, with a core sequence of CACGTG, have been identified as binding sites for transcriptional regulatory proteins in a wide variety of plant species (22). The regulatory function of this element is unclear. G-boxes of different genes have been ascribed a number of different regulatory functions. G-boxes have been observed to act as major positive regulatory elements, have been implicated in spatial and temporal control of expression, and regulation by ABA, methyl jasmonate, and natural and UV light (23-28). The numerous regulatory roles ascribed to this element stem from 57 the number of DNA binding proteins that are capable of interacting with this element as well as the characteristics of that interaction. Izawa et al. identified ten proteins capable of binding to G boxes (29). The proteins identified by Izawa et al. all belong to the basic leucine zipper (bZip) class of regulatory proteins that bind to DNA elements as dimers. bZip proteins are capable of binding as homo- or hetero-dimers, thus allowing for great flexibility in the regulation of expression. Another protein that belongs to a different class of regulatory binding proteins is also capable of binding G-boxes. This protein belongs to the basic helix-loop-helix (bHLH) class of regulatory proteins (30) . The peroxidase promoter contains four nearly identical repeats of a TC-rich sequence located between -220 and -108 bps upstream of the transcription start site. Figure 10 shows the sequence of these repeats and their location in the peroxidase promoter. It is not known if these repeats have any regulatory significance. No DNA element has been identified to date with a similar sequence. TC-rich

- 2 2 0 AA TTTT CTA AC -185 AA TTTT CTT CA -172 CG TTTT CTT AC -118 TA TTTT CTC CA

Figure 10: Sequence of the four TC-rich repeats and their location in the tobacco anionic peroxidase promoter relative to the transcription start site. 58 sequences, however, have been identified as promoter elements in mammalian systems (31,32). Stretches of purine/pyrimidine asymmetry have been associated with altered chromatin structure (33,34) . These sequences are capable of taking the conformation of H-DNA, an intramolecular triplex/single­ stranded structure formed when a portion of the homopyrimidine strand folds back upon itself to form a triplex, leaving a portion of the homopurine strand as a single-stranded loop. The DNA helix is therefore opened up and provides a single stranded region that may be used by transcriptional regulatory factors. Another distinct area of the tobacco peroxidase promoter occurs at -524 bps. Eleven direct repeats of the two-base pair motif, TA, is found at this position. Similar repeats have been observed in soybean seed proteins and heat shock genes (17,35). TA-rich regions in general have been identified in numerous promoters as enhancers of transcription (17,28,36-38). Long stretches of intermixed adenine and thymidine residues appear to be the sole requirement for these elements. The absolute sequence is not critical (36). It has been proposed that these regions are attachment points to the nuclear scaffolding and as such have transcriptional enhancing activity (39,40). Several proteins that bind to these elements have been identified and show homology to the high mobility group (HMG) nuclear proteins (37,38,41). 59 The peroxidase promoter contains many sequences that are homologous to an identified auxin responsive element and to sequences common to auxin responsive genes. Balias et al. identified an auxin responsive sequence (AuxRE), t/ gg TCCCAT, in the 5' regulatory region of PS-IAA4/5, a nuclear protein of unknown function that is positively regulated by auxin at the transcriptional level (42). This element is also found in several other auxin regulated genes as well as twice in the distal portion of the peroxidase promoter (43-50). Figure 11 shows the sequence and location of this element in

V gGTCCCAT consensus -187 TGTCCCAT PS-IAA4/5 -193 TGTCCCAT PS-IAA6 -125 TGTCCCCA PS-IAA6 -143 TGTCCCCA GmAux22 -253 TGTCACAA GmAux28 -203 TGTCCCAT AtAux2-ll -47 GTTCCCAT AtAux2-27 CGTCCCAT rol b/c -330 GCGCCCAT GH3

- 2 0 2 GGTCCCAT Ach5 GGTCCCAT Saurl5 GGTCCCAT Saur6B TGTCCCAT SaurlOA GACCCCAT Saurl0A5 -215 TGTCCCGA OS-ACS1 -2647 GGTCCCCT TobAnPOD -3088 GAGCCCAT TobAnPOD

Figure 11: Sequence and location of an auxin responsive element identified in PS-IAA4/5 and found in various auxin- regulated genes and the tobacco anionic peroxidase gene (43- 50). No location is given for genes that have not had their transcription start site mapped. 60 auxin regulated genes and the peroxidase promoter. Other conserved sequences found in auxin-regulated genes are also found in the peroxidase promoter. The sequence, TGATAAAG, is found in two auxin-inducible genes of pea and two auxin- inducible genes of soybean (43,44). The peroxidase gene contains this same motif with a single base pair mismatch (Figure 12). Another conserved sequence, GACTATGAATATGTT, found in two auxin-inducible genes from Arabidopsis is found in the peroxidase promoter with 13 of 15 bases homologous (45) . DNase I footprinting identified this sequence as a protein binding site in the Arabidopsis genes. The third sequence motif shown in Figure 12 was first identified in the Pi sum sativum auxin-inducible genes, PS-IAA4/5 and PS-IAA6 (42). DNase I footprinting has shown this sequence to be a site for protein binding. This element has not been associated with auxin responsiveness. Rather, it is thought to have enhancer-type activity. Contained in this sequence

is a ten base pair palindrome, ACATGN0 _2 CATGT. All of the homologous regions identified in other auxin-responsive genes contain the first half site of the palindrome (44,45). Only some contain the second half site. The two homologous sequences identified in the peroxidase promoter contain only the first half site. One other sequence motif common to auxin-responsive genes was found in the peroxidase promoter. The sequence, TAGTN^CTGT, was identified by DNase I footprinting as a protein binding site on both the coding and 61

-467 TGATAAAT PS-IAA4/5 -428 TGATAAAG PS-IAA6 -398 TGATAAAG GmAux22 -475 TGATAAAG GmAux28 -3131 TGATAAGC TobAnPOD -542 GACTATGAATATGTT AtAux2-ll -367 GACCATGAATATGTT AtAux2-27 -865 GATTATGTATATGTT TobAnPOD -280 CACATGCTCATGTTTC PS-IAA4/5 -276 CACATGG CATGTTTC PS-IAA6 -269 CACATGG CATGTTTC GmAux22 -368 AACATGG AGTGTCCA GmAux28 -317 CACATG AGTGTACC AtAux2-ll -293 AACATGG GATGTCTA AtAux2-27 -891 CACATGA ATTTAGTA TobAnPOD -924 TACATG TCGGATCTA TobAnPOD -623* TAGTAACTGT GmAux28 -784 TAGTG CTGT GmAux28 -519* TACATACTGT GmAux22 -159 AAGTG CTGC AtAux2-ll -152 TGCTTACTGT AtAux2-ll -538* TAGTC TTTT AtAux2-ll -544* TTTTTTCTGT AtAux2-ll -307* TATGT CTGT AtAux2-27 AAGTC CTCT Saurl5A -730 TAGTCTTTGT Par -716* TAAAA CTGT Gmhsp26-A -46 TAGTC CTGA Gmhsp26-A -154 TAGTGACTGG TobAnPOD -531 TAGTTCCTAT TobAnPOD -677* TAGTT ATGT TobAnPOD -881 TAGTAACCTGT TobAnPOD -1316* AAGTGACTGA TobAnPOD -1362 TAGTCTCTTT TobAnPOD -2506* TAGTGTATGT TobAnPOD

Figure 12: Conserved sequence elements found in auxin- responsive genes and the tobacco anionic peroxidase gene (42- 45,49,52-53). Location of sequence elements are given with respect to the transcription start site. No location is given for genes for which the transcription start site has not been mapped. ‘Indicates that the sequence element was found on the anti-coding strand. 62 anti-coding strands of the GmAux28 promoter of soybean (51). This motif is found in several auxin-regulated genes as shown in Figure 12 (44-45,49,52-53). The tobacco anionic peroxidase contains seven copies of this motif with a single base pair mismatch, four copies of which appear on the coding strand, three on the anti-coding strand. Other potential regulatory elements in the tobacco anionic peroxidase promoter include three copies of a positive regulatory element, CACCTG, identified in the bean storage protein, B-phaseolin gene (28). This motif is found at -2432, -2466 and -2721 bps in the peroxidase promoter. A negative regulatory element, CATATG, found in the bean B- phaseolin gene is also found in the peroxidase promoter at - 986, -1021, and -3135 bps. Other features of the peroxidase promoter include a 10 bp palindrome, ATTCATGAAT, located at - 2135 bps and an 18 bp repeat of AAAGTCATATGAAGCTAA found at - 991 and -1026 bps. A summary of potential regulatory regions of the peroxidase promoter and their locations relative to each other is shown in Figure 13. Numerous potential regulatory elements have been identified in the tobacco anionic peroxidase gene based on sequence homology. The number of potential elements suggests that expression of this gene is complex and highly regulated. The potential regulatory sites are distributed throughout the

entire 3 kb of the 5 1 regulatory region, including a number of potential regulatory sites located in the distal regions 63

-3135 negative element of B-phaseolin -3131 auxin-regulated gene common sequence I -3088 AuxRE -2962 CAAT box -2721 positive element of B-phaseolin -2647 AUXRE -2506 auxin-regulated gene common sequence IV -2466 positive element of B-phaseolin -2432 positive element of B-phaseolin -2422 CAAT box -2230 CAAT box -2135 10 bp palindrome -2012 CAAT box -13 62 auxin-regulated gene common sequence IV -1316 auxin-regulated gene common sequence IV -1264 G box -1200 CAAT box -1089 CAAT box -1026 18 bp repeat

- 1 0 2 1 negative element of 6 -phaseolin -991 18 bp repeat -986 negative element of B-phaseolin -924 auxin-regulated gene common sequence III -891 auxin-regulated gene common sequence III -881 auxin-regulated gene common sequence IV -865 auxin-regulated gene common sequence II -677 auxin-regulated gene common sequence IV -627 CAAT box -605 CAAT box -531 auxin-regulated gene common sequence IV -524 TA repeats -416 G box -310 CAAT box -256 CAAT box -220 TC-rich repeat -185 TC-rich repeat -172 TC-rich repeat -154 auxin-regulated gene common sequence IV -118 TC-rich repeat -94 as-2 element -77 CAAT box -33 TATA box

Figure 13: Sequences within the tobacco anionic peroxidase 5' regulatory region with homology to known regulatory elements. The location of the sequences relative to the transcription start site is given. 64 of the promoter. The regulatory significance of these identified sequence elements is unknown. DNase I footprinting to determine protein binding sites and deletion analysis of potential regulatory regions are required to determine functionality. The number of sequences within the peroxidase promoter that are homologous with sequence elements identified in auxin responsive genes, including a cluster of these sequence elements between -650 and -950 bps, is also notable, and raises the possibility that peroxidase expression is mediated by auxin. 65

LIST OF REFERENCES

1. Lagrimini, L. Mark; Burkhart, William; Moyer, Mary; Rothstein, Steven (1987). "Molecular Cloning of Complementary DNA Encoding the Lignin-Forming Peroxidase from Tobacco: Molecular Analysis and Tissue-Specific Expression." Proc. Natl. Acad. Sci. USA. 84, pp. 7542- 7546. 2. Joshi, C. P. (1987). "Putative Polyadenylation Signals in Nuclear Genes of Higher Plants: A Compilation and Analysis." Nucl. Acids Res.. 15, pp. 9627-9640. 3. Diaz de Leon, Francisco G. "Characterization of the Tobacco Anionic Peroxidase Gene: Sequence and Expression Analysis." M.S. dissertation. Ohio State University, 1993. 4. Waugh, R.; Brown, J. W. S. "Plant Gene Structure and Expression." In Plant Genetic Engineering, pp. 1-38. Edited by Don Grierson. Glasgow: Blackie & Sons, Ltd., 1991. 5. Muchhal, U. S.; Schwartzbach, S. D. (1992). "Characterization of a Euglena Gene Encoding a Polyprotein Precursor to the Light-Harvesting Chlorophyll a/b-Binding Protein of Photosystem II." Plant Mol. Biol.. 18, pp. 287-300.

6 . Joshi, C. P. (1987). "An Inspection of the Domain Between Putative TATA Box and Translation Start Site in 79 Plant Genes." Nucl. Acids Res.. 15, pp. 6643-6653. 7. Lam, Eric; Chua, Nam-Hai (1989). "ASF-2: A Factor that Binds to the Cauliflower Mosaic Virus 35S Promoter and a Conserved GATA Motif in Cab Promoters." Plant Cell. 1, pp. 1147-1156.

8 . Chung, C. T. ; Niemela, Suzanne L. ; Miller, Roger H. (1989). "One-Step Preparation of Competent Escherichia coli: Transformation and Storage of Bacterial Cell in

the Same Solution." Proc. Natl. Acad. Sci. USA. 8 6 , pp. 2172-2175. 66 9. Sambrook, J.; Fritsch, E. F.; Maniatis, T. Molecular Cloning; A Laboratory Manual. 2nd ed. Plainview, NY: Cold Spring Harbor Laboratory Press, 1989. 10. Dunsmuir, Pamela; Bond, Diane; Lee, Kathleen; Gidoni, David; Townsend, Jeffrey. "Stability of Introduced Genes and Stability in Expression." In Plant Molecular Biology Manual. pp. Cl: 5-7. Edited by Stanton B. Gelvin, Robbert A. Schilperoort, and Desh Pal S. Verma. Dordrecht, Belgium: Kluwer Academic Publishers, 1988. 11. Promega Protocols and Application Guide. 2nd ed.. pp. 150-152. Madison, WI: Promega Corp., 1991. 12. Sanger, F.; Nicklen, S.; Coulson, A. R. (1977). "DNA Seguencing with Chain-Terminating Inhibitors." Proc. Natl. Acad. Sci. USA. 74, pp. 5463-5467. 13. Kraft, R.; Tardiff, J.; Krauter, K. S.; Leinwand, L. A. (1988) . "Using Mini-Prep Plasmid DNA for Sequencing Double Stranded Templates with Sequenase."

Biotechnigues. 6 , pp. 544-549. 14. Sequenase Version 2.0 kit instructions, United States Biochemical Corp. 1990. 15. Cycle sequencing protocol from Instruction Manual for the Applied Biosvstems Model 370A/373A DNA Seguencing System. 16. Johnson, Peter F. ; McKnight, Steven L. (1989). "Eukaryotic Transcriptional Regulatory Proteins." Annu. Rev. Biochem.. 58, pp. 799-839. 17. Rieping, M. ; Schoffl, F. (1992). "Synergistic Effect of Upstream Sequences, CCAAT Box Elements, and HSE Sequences for Enhanced Expression of Chimaeric Heat Shock Genes in Transgenic Tobacco." Mol. Gen. Genet.. 231, pp. 226-232. 18. Williams, Simon C.; Cantwell, Carrie A. ; Johnson, Peter F. (1991). "A Family of C/EBP-Related Proteins Capable of Forming Covalently Linked Leucine Zipper Dimers In Vitro." Genes & Develop.. 5, pp. 1553-1567. 19. Castresana, C.; Staneloni, R.; Malik, V.; Cashmore, A. (1987). "Molecular Characterization of Two Clusters of Genes Encoding the Type I CAB Polypeptides of PSII in Nicotians plumbaginifolia." Plant Mol. Biol.. 10, pp. 117-126. 67 20. Gidoni, D.; Brosia, P.; Bond-Nutter, D.; Bedbrook, J.; Dunsmuir, P. (1989). "Novel Cis-Acting Elements in Petunia Cab Gene Promoters." Mol. Gen. Genet.. 215, pp. 337-344. 21. Lagrimini, L. Mark; Rothstein, Steven (1987) . "Tissue Specificity of Tobacco Peroxidase Isozymes and Their Induction by Wounding and Tobacco Mosaic Virus Infection." Plant Physiol.. 84, pp. 438-442. 22. Williams, Mary E. ; Foster, Randy; Chua, Nam-Hai (1992). "Sequences Flanking the Hexameric G-Box Core CACGTG Affect the Specificity of Protein Binding." Plant Cell. 4, pp. 485-496. 23. Donald, R. G. K. ; Cashmore, A. R. (1990). "Mutation of Either G Box or I Box Sequences Profoundly Affects Expression from the Arabidopsis rbcS-lA Promoter." EMBO J.. 9, pp. 1717-1726. 24. Schulze-Lefert, P.; Becker-Andre, M.; Schulz, W.; Hahlbrock, K.; Dangl, J. L. (1989). "Functional Architecture of the Light-Responsive Chalcone Synthase Promoter from Parsley." Plant Cell. 1, pp. 707-714. 25. Marcotte, W. R., Jr.; Russell, S. H.; Quatrano, R. S. (1989). "Abscisic Acid-Responsive Sequence from the Em Gene of Wheat." Plant Cell. 1, pp. 969-976. 26. Kim, S. R. ; Choi, J. L. ; Costa, M. A.; An, G. (1992). "Identification of G-Box Sequence as an Essential Element for Methyl Jasmonate Response of Potato Proteinase Inhibitor II Promoter." Plant Phvsiol.. 99, pp. 627—631. 27. Kawagoe, Y.; Murai, N. (1992). "Four Distinct Nuclear Proteins Recognize in vitro the Proximal Promoter of the Bean Seed Storage Protein B-Phaseolin Gene Conferring Spatial and Temporal Control." Plant J.. 2, pp. 927- 936. 28. Kawagoe, Y.; Campbell, B. R.; Murai, N. (1994). "Synergism between CACGTG (G-Box) and CACCTG cis Elements is Required for Activation of the Bean Seed Storage Protein B-Phaseolin Gene." Plant J. . 5, pp. 885-890. 29. Izawa, Takeshi; Foster, Randy; Chua, Nam-Hai (1993). "Plant bZip Protein DNA Binding Specificity." J . Mol. Biol.■ 230, pp. 1131-1144. 68 30. Kawaoka, A.; Kawamoto, T. ; Sekine, M. ; Yoshida, K? Takano, M.; Shinmyo, A. (1994). "A Cis-Acting Element and a Trans-Acting Factor Involved in the Wound-Induced Expression of a Horseradish Peroxidase Gene." Plant J. .

6 , pp. 87-97. 31. Boldyreff, Brigitte; Wehr, Klaus; Hecht, Roland; Issinger, Olaf-Georg (1992). "Identification of Four Genomic Loci Highly Related To Casein-Kinase-2-a cDNA and Characterization of a Casein Kinase-2-a Pseudogene Within the Mouse Genome." Biochem. Bioohvs. Res. Commun.. 186, pp. 723-730. 32. Takimoto, Masato; Tomonaga, Takeshi; Matunis, Michael; Avigan, Mark; Krutzsch, Henry; Dreyfuss, Gideon; Levens, David (1993). "Specific Binding of Heterogeneous Ribonucleoprotein Particle Protein K to the Human c-myc Promoter, in Vitro." J. Biol. Chem.. 268, pp. 18249- 18258. 33. Kolluri, Rukmini; Torrey, Ted Albert; Kinniburgh, Alan J. (1992). "A CT Promoter Element Binding Protein: Definition of a Double-Strand and a Novel Single-Strand DNA Binding Motif." Nucl. Acids Res.. 20, pp. 111-116. 34. Bernues, J.; Beltran, R.; Casasnovas, J. M.; Azorin, F. (1989). "Structural Polymorphism of Homopurine- Homopyrimidine Sequences: the Secondary DNA Structure

Adopted by a d(GA.CT) 22 Sequence in the Presence of Zinc Ions." EMBO J .. 8, pp. 2087-2094. 35. Laux, T.; Seurinck, J. ; Goldberg, R. B. (1991). "A Soybean Embryo cDNA Encodes a DNA Binding Protein with Histone and HMG-Protein-Like Domains." Nucl. Acids Res.. 19, 4768. 36. Bustos, M. M. ; Guiltinan, M. J. ; Jordano, J. ; Begum, D. ; Kalkan, F. A.; Hall, T. C. (1989). "Regulation of B- Glucuronidase Expression in Transgenic Tobacco Plants by an A/T-Rich, cis-Acting Sequence Found Upstream of a French Bean B-Phaseolin Gene." Plant Cell. 1, pp. 839- 853. 37. Jourdano, J.; Amloguera, C.; Thomas, T. L. (1989). "A Sunflower Helianthinin Gene Upstream Sequence Ensemble Contains an Enhancer and Sites of Nuclear Protein Interaction." Plant Cell. 1, pp. 855-866. 69 38. Fiedler,U. ; Filistein, R. ; Wobus, U. ; Baumlein, H. (1993). "A Complex Ensemble of cis-Regulatory Elements Controls the Expression of a Vicia faba Non-Storage Seed Protein Gene." Plant Mol. Biol.. 22, pp. 669-679. 39. Boulikas, T.; Kong, C. F. (1993). "Multitude of Inverted Repeats Characterizes a Class of Anchorage Sites of Chromatin Loops to the Nuclear Matrix." J. Cell. Biochem.. 53, pp. 1-12. 40. Boulikas, T. (1993)."Nature of DNA Sequences at the Attachment Regions of Genes to the Nuclear Matrix." J. Cell. Biochem.. 52, pp. 14-22. 41. Lessard, P. A.; Allen, R. D.; Fujiwara, T.; Beachy, R. N. (1993) . "Upstream Regulatory Sequences from Two 13- Conglycinin Genes." Plant Mol. Biol.. 22, pp. 873-885. 42. Balias, N. ; Wong, L.-M.; Theologis, A. (1993). "Identification of the Auxin-Responsive Element, AuxRE, in the Primary Indoleacetic Acid-Inducible Gene, PS- IAA4/5, of Pea (Pisum sativum) ." J. Mol. Biol.. 233, pp. 580-596. 43. Oeller, P. W.; Keller, J. A.; Parks, J. E.; Silbert, J. E.; Theologis, A. (1993). "Structural Characterization of the Early Indoleacetic Acid-Inducible Genes, PS- IAA4/5 and PS-IAA6, of Pea (Pisum sativum L.)." J . Mol. Biol.. 233, pp. 789-798. 44. Ainley, W. M. ; Walker, J. C. ; Nagao, R. ; Key, J. L. (1988). "Sequence and Characterization of Two Auxin- Regulated Genes from Soybean." J. Biol. Chem. . 263, pp. 10658-10666. 45. Conner, T. W.; Goekjian, V. H.; LaFayette, P. R.; Key, J. L. (1990). "Structure and Expression of Two Auxin- inducible Genes from Arabidopsis." Plant Mol. Biol.. 15, pp. 623—632. 46. Slightom, J. L. ; Durand-Tardif, M. ; Jouanin, L. ; Tepfer, D. (1986). "Nucleotide Sequence Analysis of TL-DNA of Agrobacterium rhizogenes Agropine Type Plasmid." J. Mol. Biol.. 261, pp.108-121. 47. Hagen, G.; Martin, G.? Li, Y.; Guilfoyle, T. J. (1991). "Auxin-Induced Expression of the Soybean GH3 Promoter in Transgenic Tobacco Plants." Plant Mol. Biol.. 17, pp. 567-579. 70 48. Korber, H.; Strizhov, N.; Staiger, D.; Feldwisch, J.; Olsson, O. ; Sanberg, G.; Palme, K.; Schell, J.; Konez, C. (1991). "T-DNA Gene 5 of Agrobacterium Modulates Auxin Response by Autoregulated Synthesis of a Growth Hormone Antagonist in Plants." EMBO J.. 10, pp. 3983- 3991. 49. McClure, B. A.; Hagen, G.; Brown, C. S.; Gee, M. A. ; Guilfoyle, T. J. (1989). "Transcription, Organization and Sequence of an Auxin-Regulated Gene Cluster in Soybean." Plant Cell. 1, pp. 229-239. 50. Zarembinski, T.; Theologis, A. (1993). "Anaerobiosis and Plant Growth Hormones Induce Two Genes Encoding 1- Aminocyclopropane-l-Carboxylate Synthase in Rice (Oryza sativa L.)." Mol. Biol. Cell. 4, pp. 363-373. 51. Nagao, R. T.; Goekjian, V. H.; Hong, J. C.; Key, J. L. (1993). "Identification of Protein-Binding DNA Sequences in an Auxin-Regulated Gene of Soybean." Plant Mol. Biol.. 21, pp. 1147-1162. 52. Takahashi, Y. ; Niwa, Y. ; Machida, Y. ; Nagata, T. (1990) . "Location of the Cis-Acting Auxin-Responsive Region in the Promoter of the Par Gene from Tobacco Mesophyll Protoplasts." Proc. Natl. Acad. Sci.. USA. 87, pp. 8013-8016. 53. Czarnecka, E.; Nagao, R. T.; Key, J. L.; Gurley, W. B. (1988). "Characterization of Gmhsp26-A, a Stress Gene Encoding a Divergent Heat Shock Protein of Soybean: Heavy-Metal-Induced Inhibition of Intron Processing."

Mol. Cell. Biol.. 8 , pp. 1113-1122. CHAPTER III REGULATION OF TOBACCO ANIONIC PEROXIDASE GENE EXPRESSION

Introduction Very little is known about the regulation of gene expression for the tobacco anionic peroxidase. Lagrimini et al. have shown that this isozyme is not induced by wounding or tobacco mosaic virus infection (1) . This was confirmed by Ward et al. who also showed that salicylic acid had no effect on steady state mRNA levels of this gene (2). Transient expression studies with tobacco protoplasts were used to elucidate the chemical and environmental factors controlling transcription of the tobacco anionic peroxidase gene. For the experiments in this chapter, the coding region

of 6 -glucuronidase (GUS), a reporter gene, was put under the control of approximately 3 kb of the tobacco anionic peroxi­ dase promoter, and the terminator from the nopaline synthase (NOS) gene. The transient expression of this chimeric gene construct was examined in protoplasts of tobacco mesophyll cells in the presence and absence of chemical and environmen­ tal factors. The chemical and environmental factors included plant hormones (auxin, an anti-auxin, gibberellic acid, ethylene, cytokinin, abscisic acid, and jasmonic acid),

71 72 environmental stresses (heat shock, and a fungal elicitor) and salicylic acid, a compound thought to be important in the induction of systemic acquired resistance. The GUS coding region is derived from a bacterial gene and is widely used for promoter studies in plants (3). Transient gene expression in protoplasts is a valuable tool in an analysis of transcriptional regulation (4,5). It allows for a relatively rapid comparison of activity of different promoter constructs. It also provides a means to analyze the effects of different chemicals or environmental factors in a controlled manner. Since the protoplasts from leaf tissue are almost exclusively mesophyll cells, the experiments are performed on a very uniform cell population. Treatments are also very uniform and controlled. The problem of transport through the cell wall and between cells, and the possible degradation or formation of concentration gradients during the transport process that occurs when working with whole plants is eliminated with protoplasts. All cells are exposed to equal and easily controllable concentrations of chemicals or other environmental stimuli. Protoplast experiments, however, must be interpreted with caution and may not be completely indicative of in planta gene expres­ sion. Protoplasts are wounded and stressed cells. Any signalling or regulatory mechanism that involves components of the cell wall or intercellular connections or communica­ tions is lost. It is also known that the isolation and 73 culture of protoplasts results in fundamental changes in

protein expression patterns (6 ). Changes in transcription and steady state mRNA levels are believed to be the underly­ ing cause behind most of these expression differences.

Materials and Methods Plasmid pCaMVCN containing the coding region for chloramphenicol acetyl transferase (CAT) under the control of the cauliflower mosaic virus 35S promoter was purchased from Stratagene. Plasmid pHGl containing the GUS coding region under the control of the 35S CaMV promoter was a gift from Dr. John Finer. Cellulysin and macerase were obtained from Calbiochem (San Diego, CA) . Driselase was obtained from

Plenum Scientific (Hackensack, NJ). [1 4 C]Acetyl-coenzyme A (NEC—313L, 4.0 mCi/mmole) was purchased from DuPont NEN (Boston, MA) . Jasmonic acid was prepared from methyl jasmonate (Bedoukian Research, Danbury CT) by the method of Farmer et al (7) . The fungal elicitor was a cell wall glucan isolated from Phytophthora megasperma var. sojae which was

dissolved in water and autoclaved for 3 hours (8 ) . The elicitor was used at a final concentration of 100 ug/mL. The isolated cell wall glucan was a gift from Dr. Terry Graham. Plasmid constructs. Plasmid pKK022592 was prepared for use as a template for site-directed mutagenesis. pPD102390

containing a 6 kb Xhol genomic fragment in pBluescript KS (-) was digested with EcoRI and Xhol and a 3.2 kb fragment 74

spanning approximately 3 kb of the 5 1 upstream regulatory region of the tobacco anionic peroxidase gene to 160 bp into the coding region was isolated. This fragment was ligated into pBluescript KS (+) that had been digested with EcoRl and

Xhol to create pKK022592 (Figure 14a). The plasmid was transformed into E. coli strain JM109 and the construct was confirmed by analysis of fragment sizes after restriction enzyme digestions. Site-directed mutagenesis was carried out on pKK022592 to create a Bglll site at the translation start site by the method of Kunkel as modified by Zhou et al. (9,10). pKK022592 was transformed into E. coli strain CJ236, a dut' ung~ strain, by PEG-mediated transformation (11). Single stranded, uracil-containing copies of pKK022592 were synthe­ sized with the aid of VCSM13 helper phage (12). Incubation times were increased from the original protocol to increase yield of ssDNA. Cells were grown for 5 hours prior to

addition of the helper phage then grown for an additional 2 hours prior to addition of kanamycin. Mutagenesis was carried out as described by Zhou et al. using a 39 base mutagenic oligonucleotide (TAA AAA GTT GTC AAT CAG ATC TTT TTT AAG ATT TGT TGG) with 2 mismatched bases to create a new Bglll site (10). After synthesis of the complementary DNA strand, the DNA was transformed into JM109 and 12 colonies were selected and their plasmids screened for the addition of the new restriction enzyme site. All colonies that were 75

A B

P stI Smal PstI, BamHl Small Spel BamHl! X bal S pell SacII Xbal I Sac! EcoRI SacII I SacI lEcoRI

,S tu I S tu I

6000

5000 AMP r 5000 1000 PK K 022592 HinD3 AMP r pKK040192 6100 bps 2000 6100 bps 4000 2000 3000 3000

POD POD X bal K pnll X bal Apal] K pal BfI2 X hol A pal Xhol

Figure 14s Plasmid maps of pKK022592 (a) and pKK040192 (b). a. Map of pKK022592 containing approximately 3 kb of the peroxidase 5 1 regulatory region and 160 bp of the coding region in pBluescript KS (+) . b. Map of pKK040192 contain­ ing approximately 3 kb of the peroxidase 5' regulatory region and 153 bp of the coding region in pBluescript KS (+) . A mutagenic Bgl2 site was inserted at the translation start site. 76 examined contained the plasmid with the mutagenic Bglll site. One colony was arbitrarily chosen, and its plasmid was isolated and sequenced to confirm its identity (13). This plasmid, pKK040192, is shown in Figure 14b. Plasmid pKK060992 was prepared for transient expression assays in protoplasts and contains the tobacco anionic peroxidase promoter fused to the GUS coding region and NOS terminator in a pBluescript plasmid. The peroxidase promoter was obtained as a 3 kb BcoRI, Bglll fragment from pKK040192 and ligated for 4 hours at 16° to pBluescript KS (+) that had been digested with BcoRI. A 2.1 kb fragment containing the GUS coding region and NOS terminator obtained from BamHl and BcoRI digestion of pHGl was added to the ligation mixture and the ligation was continued overnight. After transformation into JM109 and isolation of plasmids from individual bacteri­ al colonies, the correct structure of the plasmid was confirmed by digestion with several restriction enzymes and analysis of the resulting fragment sizes. A map of pKK060992 is shown in Figure 15a. Plasmid pKK012594 was synthesized for use as an internal standard for protoplast experiments. This plasmid contains 3 kb of the peroxidase promoter fused to the CAT coding region and NOS terminator. This plasmid was constructed in a two-step process. The CAT coding region and NOS terminator were excised from pCaMVCN as a BamHl, HinDIII fragment and were ligated into pBluescript KS (+) which had been digested 77

EcoRS EcoRS HinD3 HinD3 Cla! Sal! Xhol Apal Kpnl EcoRI EcoRI

S tu I pBluescnptM HmD3

HinD3

A M P r PKK010593 2000 “ P.ll Soli P .tl EcoRI 4000 X bal

SacI GUS Sm al Sae2 X bal Spel i EcoRI BamHl, HinD3 Small Patlj EcoRI S stl Stml

Figure 15: Plasmid maps of pKK060992 (a) and pKK010594 (b). a. Map of pKK060992 containing 3 kb of the peroxidase 5' regulatory region fused to the fi-D-glucuronidase coding region and nopaline synthase terminator in pBluescript KS (+) . b. Map of pKKO10594 containing the chloramphenicol acetyltransferase coding region and nopaline synthase terminator in pBluescript KS (+). 78 with the same two enzymes to create pKK010594 (Figure 15b) . The peroxidase promoter was obtained as a 3 kb SacI, Bglll fragment from pKK040192 and ligated into pKK010594 which had been digested with SacI and BamHl to create pKK012594 (Figure 16a) . Plasmid pKK120992 contains the GUS gene under the control of the peroxidase promoter and a promoterless CAT gene (Figure 16b). The CAT coding region and NOS terminator were isolated as a BamHl, Bglll fragment from pCaMVCN. This fragment was ligated into pKK060992 which had been digested with BamHl and de-phosphorylated with bacterial alkaline phosphatase to prevent re-circularization. The presence and orientation of the insert were determined by examining fragment sizes after digestion with restriction enzymes and separation on an agarose gel. Plasmid pKK010593 contains GUS and CAT coding regions under the control of the tobacco anionic peroxidase promoter (Figure 17). The peroxidase promoter was obtained as a 3 kb BamHl, Bglll fragment from pKK040192. This fragment was ligated into pKK120992 which had been digested with BamHl and de-phosphorylated with calf intestinal alkaline phosphatase. The presence and orientation of the insert were determined by examining fragment sizes after digestion with restriction enzymes and separation on agarose gels. Plasmid DNA preparation. All plasmid DNA used for protoplast experiments was prepared by an alkaline plasmid 79

PstI Smal BamHl Spel Xbal H in03 N otl Sac2 SacI EcoRI X pnllE coR I S till

p&luescripiM 7000 HinD3

HinD3 p ro taem

3000 2000 pKK120992

3000

E pnl EcoRI Apal Xhol Sail EcoRI C lal BamHl HinD3 Sm al X bal PstI B fl2 EcoRI P itl S stI Sail HinC2 P stI

Figure 16: Plasmid maps of pKK012594 (a) and pKK 120992 (b) . a. Map of pKK012594 containing 3 kb of the peroxidase 5 1 regulatory region fused to the coding region of chlorampheni­ col acetyltransferase and the terminator of nopaline synthase in pBluescript KS (+) . b. Map of pKK120992 containing 3 kb of the peroxidase 5' regulatory region fused to the B- glucuronidase coding region and nopaline synthase terminator and a promoterless chloramphenicol acetyltransferase coding region with nopaline synthase terminator in pBluescript KS (+) • 80

SpcI X bal N otl S«c2 BamHl Sael EcoRI P stI >HinC2 Js.II I P I tl CAT I .B fl2 f IX b .I 4000 ' iH ioD 3 , sClal i fS a ll I I Xhol NOS Ur. Apal pKK010594 ILlpal " 3000 4000 bps 1000

3000

Figure 17: Plasmid map of pKK010593 containing two genes which code for B-glucuronidase and chloramphenicol acetyltransferase both under the control of 3 kb of the peroxidase 5' regulatory region and terminated by nopaline synthase terminators in pBluescript KS (+). 81 preparation procedure followed by a PEG precipitation. Briefly, a 50 ml overnight culture was resuspended in 2 ml of a solution of 50 mM glucose, 25 mM Tris, 10 mM EDTA, pH 8.0. To this was added 4 ml of a 0.2N NaOH, 1% SDS solution and incubated for 5 minutes at room temperature. 5 M KOAc, pH 4.8 (3 ml) was added and incubated for 10 minutes at 0°.

After centrifugation for 20 minutes at 25,000 x g at 4°, 8 ml of the supernatant was removed, warmed to room temperature and the DNA precipitated with 4.8 ml of isopropanol. The DNA was pelleted by centrifugation at 13,000 x g for 20 minutes. The pellet was washed with 70% EtOH, dried in vacuo, and resuspended in 1.5 ml TE (10 mM Tris, 1 mM EDTA, pH 8.0). This solution was extracted once with Tris-saturated phenol,

twice with 1:1 Tris-saturated phenol: CH2 C12, and twice with

CH2 C12. Any contaminating RNA was precipitated by the

addition of 1.5 ml of cold 7.5 M NH40AC, incubation at 0°, and centrifugation at 25,000 x g. DNA was precipitated from the supernatant by the addition of 2.5 volumes of 95% ethanol. The pellet was resuspended in 2 ml TE and incubated at 37° for 30 minutes with 2 ul of Rnase A (10 mg/ml). The DNA was precipitated overnight at 0° by the addition of 635 ul of 5

M NaCl and 940 ul of 30% PEG6 0 0 0 . After pelleting the DNA by centrifugation at 13,000 x g for 30 minutes, the DNA was washed with 70% ethanol and dried in vacuo. The pellet was resuspended in TE. DNA concentration and purity were determined by absorbance at 260 and 280 nm. Concentration 82 and purity were confirmed by measuring fluorescence at 460 nm after binding the DNA to bis-benzimidazole and, visually, by its ultraviolet-induced fluorescence when intercalated with

ethidium bromide after running in a 0 .8 % agarose gel. For protoplast experiments that required unmethylated DNA, plasmids were transformed into E. coli strain SCS110 by PEG-mediated transformation (9) and plasmid DNA was prepared as described above. Protoplast isolation (4,15). Young, healthy leaves

(approximately 1 0 - 1 2 cm in length) of greenhouse-grown Nicotiana tabacum cv. Xanthi were washed with soap to remove dirt and pesticides, rinsed several times with water, and surface sterilized by incubating sequentially for 30 seconds in 70% EtOH, and 4 minutes in 10% commercial bleach with a drop of Triton X-100. The leaves were rinsed three times in

sterile water and sliced into approximately 1 mm wide strips. Leaves were incubated overnight at 23° in a 1:2 solution of enzyme B (2% Cellulysin, 0.5% Driselase, and 1% Macerase in 0.2 M mannitol, 80 mM CaCl2, pH 5.6): SCM (0.5 M sorbitol, 10 mM CaCl2, 5 mM MES, pH 6.0) with slight agitation (25 rpm). Cell debris was removed by filtration through a 53 urn filter. Protoplasts were pelleted from solution by centrifugation at 200 x g. They were resuspended in a small amount of SCM and floated on a solution of 0.5 M sucrose, 5 mM MES, pH 5.8 over which a small amount of SCM was layered. The protoplasts were washed three times with W5 (5 mM KC1, 125 mM caCi2, 154 83 mM NaCl, 50 mM glucose, pH 6.0). Yield of protoplasts was determined by counting an aliquot in a Fuchs-Rosenthal counting chamber. Protoplasts were typically kept in W5 for

3 to 4 hours at 6 ° prior to transformation. Protoplast transformation (4) . Protoplasts were pelleted at 150 x g and resuspended in a solution of 0.5 M mannitol, 15 mM MgCl2, and 0.1% MES, pH 5.6 to a density of

1.6 x 106 protoplasts/ml. Transformation of protoplasts that used the same plasmid DNA construct were carried out in a single sterile polypropylene tube. After transformation, the protoplasts were divided into different treatments with four replications per treatment. For each replicate, 480,000 protoplasts (0.3 ml) were mixed with 4 ug of pKK060992 and 10 ug of sheared calf thymus DNA. In most experiments, 2 ug of pCaMVCN or pKK012594 per replicate was also included. An

equivalent volume of 40% PEG4 000 in 0.4 M mannitol, 0.1 M Ca(N03)2, pH 8.0 was added and the mixture was incubated for 30 minutes at 2 3° with occasional mixing. Aliquots (0.6 ml) of the protoplast transformation mixture were gently dis­ pensed into sterile 15 ml polypropylene screw capped test tubes that contained 3 ml of K3 (4) media with or without an added chemical treatment. The contents of the tubes were mixed carefully and incubated at 27° in the dark for 36 hours, unless otherwise stated. For ethylene treatments, the cap of the polypropylene test tubes containing each replicate was replaced with sterile aluminum foil that had been 84 punctured many times to permit air exchange. The tubes were placed in 2.1 L glass mason jars with tight fitting lids that contained a rubber septum. Ethylene was injected into the jars via a gas-tight syringe. Ethylene content of the jars was measured at the beginning and end of the incubation. Ethylene was measured by gas chromatography by the procedure of Knee (16). A control treatment was carried out in a similar manner for each protoplast experiment except no plasmid DNA was added to the protoplast transformation mixture. Instead, only sheared calf thymus DNA (16 ug) was added. Enzyme and protein assays. At the conclusion of the incubation period, approximately 7 ml of W5 was added to aid in pelleting the protoplasts. The protoplasts were pelleted for 5 minutes at 1000 x g, the supernatant was removed and 100 ul of CAT buffer (40 mM Tris, 5 mM EDTA, 5 mM cysteine, pH 7.8) was added (17). A small amount of acid-washed sand was added and vortexed for 60 seconds. Cell debris was

pelleted by centrifugation at 1 0 0 0 x g. GUS assays were carried out at 37° by the addition of 30 ul of protein extract to 470 ul of 2 mM 4-methyl J3-D-

umbelliferyl glucuronide in 50 mM NaHP04, 10 mM 6 -

mercaptoethanol, 10 mM Na2 EDTA, 0.1% sodium lauryl sarcosine, 0.1% Triton X-100, pH 7.0. Aliquots (100 ul) were removed

every 5 minutes and added to 1.9 ml of 0.2 M Na2 C03. Fluores­ cence at 460 nm was measured with a TKO 100 Dedicated Mini 85 Fluorometer which was calibrated with 4-methyl umbelliferone (18,19) . CAT assays were performed as described by Peach and Velten (17). The protein extract (30 ul) was added to 220 ul of 100 mM Tris, 5 mM chloramphenicol, 250 uM acetyl coenzyme

A (0.8 mCi/mmole, [1 4 C] labeled on the acetyl group) overlaid

with 6 ml of Sigma-Fluor, and counted in a Beckman LS3801 scintillation counter. The reaction was carried out at room temperature. Five time points were taken for each sample. Total protein was determined using 20 ul of protein extract and the Bio-Rad protein assay dye reagent concentrate according to the manufacturer's directions. Bovine serum albumin was used as a protein standard. Auxin experiments with whole plants. Homozygous N. sylvestris 601-19-L plants were grown in vitro on MS medium with 3% sucrose and 0.25% phytagar (20). Young plants were placed in 250 ml culture flasks and floated on 50 ml of half strength MS with no added hormone, NAA or PCIB. The medium of the second experiment also included 1.5% sucrose. The flasks were capped loosely and wrapped with Parafilm. Plants of the first experiment were incubated at 27°C in the dark for 48 hours with slight agitation (50 rpm). Plants of the second experiment were incubated at 27°C for 72 hours with agitation. Half of the plants of the second experiment were kept in the dark, the other half were kept under fluorescent lighting. At the conclusion of the incubation period, plants 86 were washed off and the roots were excised from shoots. Roots were ground in a mortar and pestle with 400 ul of GUS

extraction buffer (50 mM NaHP04, 10 mM 6 -mercaptoethanol, 10

mM Na2 EDTA, 0.1% sodium lauryl sarcosine, 0.1% Triton X-100, pH 7.0) and a small amount of sand. Shoots were ground with a Polytron in 1.0 ml of GUS extraction buffer. Enzyme extracts were cleared of cell debris by centrifugation. GUS assays were performed as described above. Auxin experiments with root cultures. Root cultures of N. sylvestris 601-19-L and N. sylvestris wild type were initiated and grown on HF medium with 3% sucrose and 3 uM isobutyric acid as described by Hibi et al. (21). Cultures were grown for 14 days at 23°C in the dark at 90 rpm. By the end of two weeks, roots had proliferated and grown together to form a tangled mass. In the first of two experiments with root cultures, this mass was washed with HF medium with 3% sucrose and divided approximately in half. Half of each of three cultures was incubated in fresh HF medium containing 3% sucrose and 3 uM IBA for 48 hours at 23° in the dark at 90 rpm. The remaining halves were incubated in fresh HF medium containing 3% sucrose and no added hormones in a similar fashion. Roots were analyzed for GUS activity as previously described. In the second experiment, two week old root cultures were transferred to fresh HF medium with 3% sucrose and 50 uM NAA and incubated for an additional four days at 23° in the dark with agitation. Root cultures were washed 87 with HF medium with 3% sucrose and each of the two cultures was divided into nine equal portions. The divided root cultures were incubated in HF medium with 3% sucrose contain­ ing either no added hormones, 50 uM NAA or 100 uM PCIB for 72 hours in the dark at 23°, and were subsequentially assayed for GUS activity.

Results Development of transient expression protocol. Consider­ able effort was spent optimizing the protoplast isolation, transformation, and enzyme extraction procedures. Since protoplast transient expression experiments required a large number of protoplasts, it was necessary to modify the protoplast isolation procedure to achieve maximum yield. Likewise, transformation and enzyme extraction protocols were optimized for greatest expression and activity since the amount of tissue per replication was relatively small. It was also necessary to identify an enzyme extraction buffer that was compatible with both GUS and CAT assays. Initially, protoplasts were isolated from in vitro-grown N. tabacum cv. Xanthi. Plants were grown from seed on MS medium with 3% sucrose and 0.25% phytagar (20). In all attempts to isolate protoplasts from in vitro-grown tissue, the yield was insufficient and the protoplasts appeared to be highly stressed. Concentration of the cell wall-degrading enzymes, length of exposure and temperature were varied 88 without a significant improvement in the yield and quality of the protoplasts. Yields varied between 150,000 to 700,000 per leaf. In general, the protoplasts were irregularly shaped, the chloroplasts were often concentrated to one side of the cell, and significant browning of the protoplasts and solution was observed. When greenhouse-grown tobacco plants were used as the source of leaf tissue, the yield of protoplasts increased substantially and the protoplasts appeared to be less stressed based on their spherical shape, evenly distributed chloroplasts, and lack of browning. Yield

of protoplasts per leaf ranged from 5.5 x 106 to 29.5 x 106,

and averaged 1 2 . 6 x 1 0 6. Preliminary protoplast transformation experiments showed that there was no clear difference in GUS expression between protoplasts transformed with circular or linear DNA using pKK060992 or pHGl. In all subsequent protoplast transforma­ tion experiments circular DNA was used. It was necessary to find an enzyme extraction buffer that was compatible with both the GUS and CAT assays. It has

been reported that 2 -mercaptoethanol, which is typically a component of GUS extraction buffers, interferes with CAT assays by creating a high background activity (22). We therefore tested a number of protein extraction buffers to find one that would give the greatest activity for both GUS and CAT. The buffers tested were based on permutations of recommended extraction buffers for GUS and CAT (3,1/). The 89 composition of the extraction buffers that were tested are shown in Table 1. Protoplasts were transformed with pKK010593 which contained the coding regions for GUS and CAT under the control of the peroxidase promoter. After trans­ formation, the protoplasts were incubated for 42 hours and proteins extracted into one of the buffers in Table 1 by bursting the protoplasts by repeated freeze/thaw cycles and centrifuging to remove cell debris. GUS and CAT activity were determined with all extraction buffers (Table 2) . Buffer #7 (CAT buffer), originally recommended for CAT assays (17) and containing 40 mM Tris, 5 mM EDTA and 5 mM cysteine at pH 7.8, was chosen for giving the greatest activity for both GUS and CAT assays while avoiding the use of 2- mercaptoethanol. Optimizing the yield of protein extracted from the protoplasts was also important due to the small amount of tissue available for each replicate as well as the potential­ ly low levels of GUS and CAT activity. Several methods for bursting of protoplasts were examined. Protoplasts were isolated and transformed with pKKQ60992 as described in Materials and Methods. Protoplasts were incubated for 46 hours after transformation. The methods of lysing the protoplasts are shown in Table 3 and included passing the protoplasts through a 25 gauge 5/8 needle, cycles of freezing and thawing, grinding with a teflon pestle, vortexing in the presence of a small amount of acid-washed sand, and Table l: Protein extraction buffers examined for their compatibility with GUS and CAT assays. aGUS extraction buffer (3) bCAT extraction buffer (17)

Reducing agent Chelating agent Detergent Surfactant Buffer Buffering agent PH P 50 mM NaHPO, 7.0 10 mM ii-ME 10 mM EDTA 0 . 1% sarcosyl 0 . 1% Triton X-100 2 50 mM NaHPO, 7.0 10 mM EDTA 0 . 1% sarcosyl 0 . 1%Triton X-100 3 50 mM NaHPO, 7.0 5 mM cystein e 10 mM EDTA 0 . 1% sarcosyl 0 . 1% Triton X-100 4 50 mM NaHPO, 7.0 10 mM cystein e 10 mM EDTA 0 . 1% sarcosyl 0 . 1% Triton X-100 5 50 mM NaHPO, 7.0 10 mM EDTA 6 50 mM NaHPO, 7.0 5 mM cysteine 10 mM EDTA T 40 mM Tris 7.8 5 mM cystein e 5 mM EDTA

Table 2: GUS and CAT activities of tobacco leaf mesophyll protoplasts transformed with pKK010593 or calf thymus DNA and extracted into different buffer systems.

Buffer DNA GUS activity CAT activity (nM MU/min/ug) (cpm/min/ug) 1 pKK0lO593 0.939 16.0 2 pKK010593 0.123 0.85 3 pKK010593 0.086 0.69 4 pKK010593 0.240 1.41 5 pKK010593 0.537 10.2 6 pKK010593 0.319 0.73 7 pKK010593 0.749 2.88 7 c a lf thymus DNA 0.104 1.08 VD o 91

Table 3: Methods used to lyse protoplasts.

Method Buffer Treatment 1 "■“TDTTul CAT passed multiple times through 25 5/8 gauge needle

2 100 ul CAT two cycles o f freezing at -20°C and thawing

3 100 ul CAT g r o u n dwith teflon pestle on electric d r ill (Sears Craftsman) at 0°C

4 100 ul CAT sonicated for 15 minutes + 0,.1% Triton X-100

5 90 ul 5 mM cysteine sonicated for 15 minutes, then 10 ul 400 mM T ris, 50 mM EDTA, pH 7.8 added

Table 4: Yield of soluble protein and GUS activity from tobacco leaf mesophyll protoplasts transformed with pKK060992 and lysed by the methods presented in Table 3. As a negative control, protoplasts were transformed with calf thymus DNA only.

Sample Method of Protein GUS Activity■ (nM MU/min/ug) lysis (ug/ul) Replicate AVG STD 1 1 5.14 0. 690 2 1 6.25 0.915 0.868 0.130 3 1 6.21 0.999

4 2 5.75 0.718 5 2 4.29 1.003 0.865 0.117 6 2 3.99 0.875

7 3 2.23 1.275 8 3 5.28 0.874 1.018 0.182 9 3 4.80 0.906

10 4 5.02 1.037 11 4 1.99 1.180 1.169 0.104 12 4 3.67 1.291

13 5 8.99 0.228 14 5 9.44 0.230 0.238 0.013 15 5 6.59 0.257 control 1 5.08 0.007 con trol 1 4.51 0.007 0.013 0.009 con trol 1 5.24 0.026 92 sonication. For all methods except sonication, the protoplasts were suspended in 100 ul of CAT buffer. For treatments involving sonication, the protoplasts were dissolved in 100 ul of CAT buffer with 0.1% Triton X-100 or 90 ul of 5 mM cysteine followed by the addition of 10 ul 400 mM Tris, 50 mM EDTA, pH 7.8 after sonication. Table 4 shows the amount of soluble protein extracted and GUS activity for each method with three replications per method. Overall, vortexing the protoplasts after the addition of a small amount of sand resulted in the greatest GUS activity. Other methods for extracting proteins either did not as adequately lyse the cells or were detrimental to the maintenance of GUS activity. Chemical and environmental effects on peroxidase expression. With a workable transient expression system, it was possible to determine the effects of a number of chemical and environmental stimuli on the tobacco anionic peroxidase promoter. In the first of several transient expression experiments, protoplasts were isolated from leaf tissue of a non-flowering plant, transformed en masse with equimolar amounts of pKK060992 and pCaMVCN and split into treatments containing no added hormone, 200 uM IAA, 2 mg/1 benzyladenine, or 1188 ppm ethylene. Protoplasts were incubated for 48 hours. It was immediately obvious from the enzyme assays that pCaMVCN, containing the CaMV 35S promoter fused to the CAT coding region, was not suitable as an 93 internal standard. CAT activity per ug of protein was not constant for all treatments (Table 5, Figure 18) . CAT activity under the control of the CaMV 35S promoter decreased by approximately 33% in the presence of 200 uM IAA and increased by approximately 30% in the presence of 1188 ppm of ethylene. Benzyladenine (2 mg/L) had no effect on the activity of the 35S promoter. GUS activity, under the control of 3 kb of the tobacco anionic peroxidase promoter, responded similarly to that of CAT controlled by the 35S promoter (Table 5, Figure 19). GUS activity was lower in the IAA treated protoplasts and elevated in the ethylene treated protoplasts. Benzyladenine appeared to have no effect on the peroxidase promoter. To further examine the effects of auxin, cytokinin and ethylene on the peroxidase promoter the previous experiment was repeated and expanded upon. Auxin treatments included four concentrations of IAA (10, 50, 100 and 200 uM) as well as four concentrations of NAA (10, 50, 100 and 200 uM) . Benzyladenine was incubated with protoplasts in three concentrations (0.5, 2 and 10 mg/L) and three different concentrations of ethylene were applied (10, 83, 1145 ppm). Although protoplasts were transformed with both pKK060992 and pCaMVCN to maintain consistency, only GUS activity was

assayed. Table 6 and Figure 20 show the results from this experiment. Auxin, in the form of IAA or NAA, significantly suppressed expression of GUS activity in a dose responsive Table 5: GUS and CAT activity of tobacco mesophyll protoplasts transformed with pKK060992 and pCaMVCN after 48 hrs. exposure to no hormones, IAA, BA or ethylene. The control treatment was protoplasts transformed with only calf thymus DNA.

Treatment GUS Activity (nM MU/min/ug) CAT Activity (CEM/min/ug) GUS/CAT Activity jc 100 Replicate AVG STD Replicate AVG STD Replicate AVG STD none 1.46 1.53 0.11 48.89 58.19 6.17 2.99 2.66 0.33 1. 63 56.61 2.89 1.63 62.19 2.62 1.39 65.05 2.13

IAA (200uM) 0.23 0.69 0.49 13.90 18.72 5.13 1.63 3.33 1.73 0.26 16.60 1.58 0.83 17.00 4.85 1.44 27.37 5.26

BA (2mg/L) 1. 87 2.06 0.13 56.48 53.15 4.69 3.31 3.91 0.42 2.01 45.54 4.41 2.21 53.08 4.16 2.15 57.50 3.74

C2H4 (1188ppm) 3.35 4.41 1.25 71.81 74.42 6.52 4.67 5.83 1.18 3.06 65.97 4.64 5.14 76.04 6.75 6.07 83.87 7.24 control 0.07 0.06 0.01 0.09 0.05 0.16 0.07 -0.04 0.06 -0.14 0.04 0.28 95

no hormone 2 mg/L BA 11B8ppm C2H4 control Treatments

Figure 18s Average CAT activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN and incubated for 48 hours in the presence of no hormones, 200 uM IAA, 2 mg/L BA or 1188 ppm ethylene. 96

no horm one 2 mg/L BA 118 8 pp m C2H4 control Treatments

Figure 19: Average GUS activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN and incubated for 48 hours in the presence of no hormones, 200 uM IAA, 2 mg/L BA or 1188 ppm ethylene. Control was the GUS activity of protoplasts transformed with only calf thymus DNA. Table 6 : GUS activity of tobacco mesophyll protoplasts transformed with pKK060992 and pCaMVCN after 36 hours exposure to no hormones, IAA, NAA,BA or ethylene of varying concentrations. The control treatment was protoplasts transformed with only calf thymus DNA.

97 Table 6

Treatment GUS Activity (nM MU/min/ug) Treatment GUS Activity (nM MU/min/ug) Replicate AVG STD Replicate AVG STD No hormones 77U------J7WL------0.42 BA (0.5 m g/L)------TTZ1------27 22------CT752 2.83 1.79 3.26 2.10 3.03 1.73 IAA (10 uM) 1.90 2.08 0.27 BA (2 m g/L) 2.10 2.17 0.20 1.79 1.88 2.50 2.38 2.13 2.33 IAA (50 uM) 1.00 1.09 0.19 BA (10 m g/L) 2.07 2.29 0.40 1.20 2.75 1.34 2.59 0.84 1.74 IAA (100 uM) 0.77 0.77 0.10 Ethylene (10 ppm) 2.68 2.64 0.25 0.92 2.96 0.72 2.26 0.65 2.66 IAA (200 uM) 0.45 0.35 0.07 Ethylene (83 ppm) 2.71 2.59 0.29 0.38 2.93 0.31 2.13 0.26 2.58 NAA (1 0 uM) 2.37 2.00 0.22 Ethylene (1145 ppm) 2.62 2.60 0.11 1.77 2.67 1.91 2.42 1.95 2.69 NAA (5 0 uM) 0.58 0.60 0.09 C o n tr o l -0.12 -0.06 0.05 0.75 0.00 0.56 0.04 0.52 0.01 NAA (1 0 0 uM) 0.20 0.32 0.10 0.26 0.46 0.37 NAA (200uM) 0.41 0.26 0.09 0.19 0.21 vo 0.22 oo 99

_ 3.00-

t— !-“ i t i i r i I i BA ethylene control (10,50,100,2001*1) (10,50,100,200 LW) (0.6,2,10 mgIL) (10,63,1145 ppm)

Figure 20: Average GUS activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN and incubated for 36 hours in the presence of no hormones, IAA (10, 50, 100, 200 UM) , NAA (10, 50, 100, 200 UM) , BA (0.5, 2, 10 mg/L) or ethylene (10, 83, 1145 ppm). Control was the GUS activity of protoplasts transformed with only calf thymus DNA. 100 manner. The extent of suppression was similar for either IAA or NAA. Even at the highest concentration of auxin— 200 uM— there was still a low level of expression of GUS, although the activity was reduced eight to eleven fold. Figure 21 shows that the suppression of GUS activity was a linear function of the logarithm of the auxin concentration. GUS activity was reduced to half of its maximum value by 3 0 uM IAA. This experiment also confirmed that benzyladenine did not influence the activity of the peroxidase promoter as observed in the previous experiment. Ethylene at 10, 83 and 1145 ppm did not alter GUS expression. The effect of ethylene on the peroxidase promoter was unclear from these two experiments. In the first of these experiments, ethylene appeared to slightly stimulate expres­ sion from the peroxidase promoter (Figure 19) . However, this was not observed in the more extensive second experiment (Figure 20) . The only apparent difference in protocol between these two experiments was the length of the incuba­ tion period after transformation of the protoplasts. In the first experiment, the transformed protoplasts were incubated for 48 hours prior to assaying for GUS activity. In the second experiment, protoplasts were incubated for 36 hours. To ensure that a time-dependent ethylene effect was not overlooked, protoplasts were transformed as before and the

effect of 1 0 0 and 1 0 0 0 ppm of ethylene over time was exam­ ined. GUS activity was assayed at 24, 48 and 72 hours after iue 1 Aeae U atvt o pK692 transformed pKK060992 of activity GUS Average 21: Figure x-axis is plotted logarithymically. isplotted The x-axis of IAA function concentration. as a protoplasts tobacco

Average GUS activity (nM MU/min/ug) 0.5- 2.5 1.5- 2 - R squared = 0.998 = Rsquared 10 IAA concentration (uM)IAA concentration 100 1000 101 102 transformation. Table 7 and Figure 22 demonstrate that neither concentration of ethylene had a significant effect on the peroxidase promoter at any of the times assayed. For all treatments, GUS activity increased over time. The increase in activity, however, was equivalent for untreated and ethylene treated protoplasts. Ethylene did not influence expression from the peroxidase promoter. Auxin suppression of the peroxidase promoter was also investigated further. Since GUS activity was effectively suppressed by auxin, the ability of an anti-auxin to restore or induce GUS activity was investigated. p- Chlorophenoxyisobutyric acid (PCIB) is a competitive inhibi­ tor of IAA and has no auxin-like activity (23) . Tobacco leaf

protoplasts transformed with pKK060992 were incubated for 3 6 hours with no hormones, the anti-auxin PCIB (10, 100, or 500 uM), IAA (50 uM) or a combination of 100 uM PCIB and 50 uM IAA. The GUS activity of protoplasts exposed to these

treatments is shown in Table 8 and Figure 23. GUS activity

was approximately 1 0 % higher in transformed protoplasts treated with 10 uM PCIB compared to protoplasts that received no hormone treatment. Protoplasts treated with 100 uM PCIB exhibited a 40% increase in GUS activity. This increased activity was most likely due to competition with endogenous auxin of the protoplasts. 500 uM PCIB was inhibitory of GUS expression; GUS activity was reduced nearly three-fold. Toxicity of PCIB may have been a factor at this higher 103

Table 7: GUS activity of tobacco mesophyll protoplasts transformed with pKK060992 and incubated with 0, 100 or 1000 ppm of ethylene for 24 to 72 hours.

Incubation Ethylene conc. GUS activity (nM MU/min/ug) time (hrs)______(ppm)______Replicate_____AVG______STD ... 5 _14 .... 24 0 4.87 ...... ■■"-DT53' 4.41 5.59 5.70 24 . 100 4.66 4.54 0.42 3.83 4.92 4.76 24 1 0 0 0 3.99 4.41 0.47 3.99 5.12 4.53

48 0 13.18 13.36 1.56 12.00 15.97 12.31 48 100 11.65 14.00 1.39 15.17 14.34 14.83 48 1 0 0 0 10.78 11.89 0.83 12.25 13.00 11.53

72 0 18.65 15.94 1.70 15.37 13.97 15.77 72 100 22.20 17.16 3.82 15.05 19.17 12.22 72 1 0 0 0 12.83 14.26 1.46 14.48 13.18 16.56 iue 2 Aeae U atvt o tbco protoplasts tobacco of activity GUS Average 22: Figure transformed with pKK060992 and pCaMVCN and incubated with 0, with incubated and and pCaMVCN pKK060992 with transformed 100, 1000 ppm ethylene for 24, 48 or 72 hours.72 or 4824, for ethylene ppm 1000 100,

Average GUS activity (nM MU/min/ug) 0

24 hours 24 1

00

1

000

Ethylene concentration (ppm) concentration Ethylene 0

48 hours 48 1

00

1

000

0

72 hours 72 1

00

1

000 104 105

Table 8: GUS activity of tobacco leaf mesophyll protoplasts transformed with pKK060992 and pCaMVCN and incubated for 36 hours with PCIB, IAA., or IAA and PCIB. Control treatment was protoplasts transformed with only calf thymus DNA.

Treatment GUS activity (nM MU/min/ug) ______Replicate AVG _____ STD no horm one 9.04 9:33 0.28 9.72 9.49 9.08

10 uM PCIB 9.21 10.31 1.07 9.41 10.77 11.83

100 uM PCIB 13.98 13.14 1.41 14.88 11.20 12.49

500 uM PCIB 2.55 3.36 0.55 3.71 3.20 3.99

50 uM IAA 7.38 6.96 0.48 6.29 6.71 7.46

50 uM IAA + 9.45 10.18 1.94 100 uM PCIB 11.87 9.23

c o n t r o l -0.10 -0.06 0.02 -0.07 -0.04 -0.04 106

no hormones control

Figure 23: Average GUS activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN and incubated with no hormones, PCIB, IAA, or IAA and PCIB. Control was protoplasts transformed with calf thymus DNA. 107 concentration. As observed in previous experiments, protoplasts treated with 50 uM IAA had reduced GUS activity. When treated with both 50 uM IAA and 100 uM PCIB, GUS activity was not only restored but enhanced slightly provid­ ing further evidence that PCIB functions as an anti-auxin. Other agents capable of altering gene expression were examined for their effect on the tobacco anionic peroxidase promoter. These included gibberellic acid (1, 30 uM) , abscisic acid (20, 100 uM), jasmonic acid (10 uM), salicylic acid (0.05%), a fungal cell wall elicitor (100 ug/mL), and a heat shock (41°C, 2 hours) . Also included in this experiment were IAA treatments of 0.1, 1 and 50 uM to test the sensitiv­ ity of the peroxidase promoter to auxin treatment. Table 9 and Figure 24 show the results of this experiment. Suppres­ sion by auxin was reconfirmed and was evident even at 0.1 uM IAA. Gibberellic acid, abscisic acid or a 2 hour 41° heat shock had no significant effect on GUS expression. Jasmonic acid was slightly inhibitory. Surprisingly, the fungal cell wall elicitor from Phytophthora megasperma var. sojae reduced GUS activity by half. A decrease in expression was unexpect­ ed since pathogen infection induces lignification of cell walls near a site of infection (24) . Peroxidase has been thought to be involved in this defense response. A decrease in steady state mRNA levels of the tobacco anionic peroxi­ dase, however, has also been observed in tobacco mosaic virus-infected plants, although the decrease in mRNA levels 108 Table 9: GUS activity of tobacco leaf mesophyll protoplasts transformed with pKK060992 and pCaMVCN and incubated for 36 hours with gibberellic acid, abscisic acid, jasmonic acid, salicylic acid, fungal cell wall elicitor, IAA or subjected to a 41°C 2 hour heat shock treatment. Control treatment was protoplasts transformed with only calf thymus DNA. Treatment Average GUS activity (nM MU/min/ug) Replicate AVG STD n o n e------T7TO------TTSS---- UTZZ------1.91 2.18 2.00 1 uM GA 1.57 1.98 0.46 2.46 1.49 2.42 30 uM GA 1.74 1.78 0.41 1.75 2.39 1.25 20 uM ABA 2.04 1.60 0.60 1.11 2.34 0.92 100 uM ABA 0.76 1.24 0.33 1.16 1.39 1.65 10 uM JA 1.25 1.37 0.17 1.15 1.51 1.56 0.05% SA 0.04 0.02 0.02 0.00 0.02 0.02 fungal elicitor 0.83 0.80 0.03 0.76 0.81 0.79 41° h e a t s h o c k 1.17 1.43 0.20 1.69 1.32 1.53 0.1 uM IAA 1.97 1.66 0.19 1.46 1.57 1.63 1 uM IAA 1.71 1.58 0.26 1.75 1.74 1.14 50 uM IAA 0.81 0.77 0.13 0.68 0.96 0.62 c o n t r o l 0.00 0.00 0.00 0.00 0.00 109

notrm 1 iW 30 uM 20 iM 100iM 10 lM 005% lungal heal 01 iM 1 iM 60 uM QA GA ABA ABA JA 8A eictor shock IAA IAA IAA

Figure 24: Average GUS activity of tobacco protoplasts transformed with pKK060992 and pCaMVCN and incubated with no hormones, gibberellic acid, abscisic acid, jasmonic acid, salicylic acid, fungal cell wall elicitor, IAA or a 41° 2 hour heat shock treatment. 110 was not evident until nine days after infection (2) . Most surprising was the effect of 0.05% salicylic acid. Expres­ sion of GUS was completely suppressed. It is possible that the amount of salicylic acid used with the tobacco protoplasts was too great and the absence of GUS activity was due to toxicity. In contrast, Ward et al. have shown no effect by salicylic acid on the steady state mRNA levels of the tobacco anionic peroxidase over 48 hours in leaves of tobacco plants treated with 50 mM salicylic acid (2). The absence of an effect on mRNA levels by salicylic acid may stem from the stability of the anionic peroxidase transcript and does not exclude the possibility of salicylic acid suppression of the peroxidase promoter. Clearly, the effect of salicylic acid on the tobacco anionic peroxidase promoter is uncertain and requires further study. Auxin effects on peroxidase expression in intact tissue. The transient expression experiments with tobacco protoplasts clearly indicated that expression of the tobacco anionic peroxidase gene was suppressed by auxin. The possibility exists, however, that transient expression in protoplasts may not accurately reflect expression in planta. It is known that isolation of protoplasts results in some changes in gene

expression (6 ). It was desirable, therefore, to confirm auxin suppression of the peroxidase gene in intact plants. Experiments were carried out with whole plants or root cultures of tobacco plants stably transformed with the full Ill peroxidase promoter fused to the GUS coding region and NOS terminator. In general, plants or root cultures exhibited a reduction in GUS activity when exposed to auxin. However, the results, in all experiments, were not statistically significant. These experiments were confounded by signifi­ cant variability between plants and large differences in GUS expression between different tissues of the same organ. The stability of the GUS protein also was problematic and made observation of the suppression of newly expressed GUS activity difficult. Young plants of N. sylvestris 601-19-L were floated on solutions of half strength MS medium with no added hormone, 50 uM NAA or 100 uM PCIB for 48 hours at 27° in the dark with slight agitation. The roots and shoot of each plant were separated from each other and individually assayed for GUS activity. Table 10 and Figure 25 show the outcome of this experiment. GUS activity in roots declined with added auxin and increased with the addition of the anti-auxin, PCIB. The results, however, were not statistically significant due to the variability of GUS activity in the plants treated with no hormones. No clear effect of auxin or anti-auxin on shoots could be deduced because of the variability within treat­ ments . This auxin experiment with whole plants was repeated and enlarged. Two concentrations of NAA (50 and 100 uM) and two concsritrst ions of PCIB (100 and 200 uM) were used as well as 112

Table 10: GUS activity of young N. sylvestris 601-19-L plants exposed to NAA, PCIB or no hormones for 48 hours.

Hormone GUS Activity (nM MU/min/ug) Treatment Replicate AVG STD roots------51) 'uH""H5K------hT55----- (T755---- 07T5- 0.55 0.86

100 uM PCIB 3.23 2.52 0.50 2.12 2.22

N one 1.06 1.11 0.56 0.46 1.82

SHOOTS 50 uM NAA 4.46 5.16 0.59 5.14 5.89

100 UM PCIB 3.44 3.96 0.53 3.76 4.68

N one 4.82 3.47 1.16 1.98 3.60 plants treated with 50 uM NAA, 100 uM PCIB, or no hormones hormones no or PCIB, uM 100 NAA, uM 50 with treated plants Figure 25: Average GUS activity of activity GUS Average 25: Figure for 48 hours in the dark. inthe hours 48for

GUS Activity (nM MU/min/ug) . sylvestrisN. None 601-19-L 113 114 a treatment with no added hormones. The incubation time for treatments was increased from 48 to 72 hours. Half of the plants for each hormone treatment were kept in the dark as before. The remainder were incubated under fluorescent lights. The same general trend observed in the first experiment was also observed in this experiment (Table 11, Figure 26). The average GUS activity of roots was lower in those plants treated with auxin. The average GUS activity in roots was higher in PCIB treated plants. The variation between plants within a treatment, however, was large and all results were statistically insignificant. Light had no obvious effect on GUS expression. The response of the tobacco anionic peroxidase promoter to auxin was also examined in root cultures. Root cultures were generated from plants stably transformed with the peroxidase promoter/GUS coding region gene chimera. Root cultures were grown for two weeks in the presence of 3 uM isobutyric acid (IBA). It was hoped that roots obtained from root culture would be more uniform than roots of whole plants. It was also hoped that initial GUS activity would be minimized since root cultures were grown in the presence of auxin. After two weeks of growth with 3 uM IBA, auxin was removed from half of the cultures for 48 hours and GUS activity was measured. The average GUS activity was slightly greater when auxin was removed from the root cultures (Table 12). Considerable GUS activity, however, was measured in Table 11: GUS activity of roots from young N. sylvestris 601-19-L plants exposed to no hormones, NAA or PCIB for 72 hours at 27°C in either the light or dark.

Light Dark GUS Activity (nM MU/min/ug) GUS Activity (nM MU/min/ug) Treatment Replicate AVG_____ STD_____ Replicate AVG STD none ""11.02 S. 09 3'. 47 7 : i 0...... n o 3.05 4.01 7.20 2.81 1.18 2.51 0.92

50 uM NAA 5.19 2.41 1.62 8.31 4.14 2.74 1.63 4.89 1.77 1.88 1.07 1.49

100 uM NAA 2.72 1.74 0.76 4.96 2.79 1.48 2.24 3.34 1.02 1.44 0.97 1.42

100 uM PCIB 8.68 8.24 1.35 6.84 6.51 1.59 10.21 8.76 7.42 6.08 6.65 4.34

200 uM PCIB 4.94 5.54 1.08 8.34 6.69 1.88 7.32 8.10 4.47 6.72 5.43 3.61 hours in either the light or dark.or light the either in hours Figure 26: Average GUS activity of roots from from of roots activity GUS Average 26:Figure 601-19-L plants treated for PCIB, or with treated NAA,72plants no 601-19-L hormones

GUS Activity (nM MU/min/ug) omoe ouM i oouM M u o io M u o io M u so one horm o A NA CB PCIB PCIB NAA NAA no 0 0 2 uM omoe ouM M u so one horm oNA A PI PCIB PCIB NAA no NAA 10011 M N. sylvestris 10011 M 0 0 2 uM 116 117 Table 12: GUS activity of root cultures incubated for 48 hours on HF medium with 3 uM IBA or no added hormone. Cultures were grown for two weeks with 3 uM IBA before treatments.

GUS Activity (nM MU/min/ug) Treatment Replicate AVG_____ STDSTD 3 UM IBA 5.03 4.92 0.17 4.67 5.06 none 5.46 5.30 0.40 4.75 5.68

root cultures that were maintained on 3 uM IBA. The experiment was repeated with root cultures of N. sylvestris 601-19-L that were grown for two weeks with 3 uM IBA followed by four days with 50 uM NAA. The additional NAA treatment was an attempt to reduce the initial GUS activity of the cultures before dividing them into different treat­ ments. From the previous experiment, it appeared that 3 uM IBA was not sufficient to inhibit expression from the peroxidase promoter. Root cultures were treated for 72 hours with no added hormone, 50 uM NAA or 100 uM PCIB. Removal of auxin from root cultures desuppressed the peroxidase promoter (Table 13, Figure 27). Root cultures removed from auxin had an average GUS activity that was nearly 40% greater than those cultures that remained on NAA. The average GUS activity of root cultures treated with 100 uM PCIB, however, was similar to those treated with 50 uM NAA. It is likely that the concentration of PCIB used in this exp 118

Table 13: GUS activity of root cultures after 72 hours with no added hormones, 50 uM NAA or 100 uM PCIB. Cultures were grown for two weeks with 3 uM IBA and four days with 50 uM NAA before treatments.

Hormone GUS Activity (nM MU/min/ug) Treatment ReDlicate AVG STD none 4.58 6.01 0.68 6.23 6.06 6.11 6.39 6.72 50 uM NAA 3.89 4.36 0.54 4.71 5.06 4.73 3.47 4.26 100 UM PCIB 4.13 4.02 0.48 4.68 4.37 3.91 3.14 3.92 119

No hormones

Figure 27: Average GUS activity of root cultures after 72 hours with no added hormones, 50 uM NAA or 100 uM PCIB. Cultures were grown for two weeks with 3 uM IBA and four days with 50 uM NAA before treatments. 120 too great. Although 100 uM PCIB induced GUS activity in tobacco leaf xnesophyll cells, this concentration was probably inhibitory to roots. Roots are more sensitive to auxin than shoots (25). Burstrom has shown 100 uM PCIB to be toxic to roots of wheat (26). Suppression of GUS activity by exces­ sive concentrations of PCIB was consistent with observations made with tobacco leaf protoplasts exposed to high concentra­ tions of PCIB. 100 and 200 uM PCIB induced GUS activity in mesophyll protoplasts. 500 uM PCIB, however, suppressed activity. Although auxin, in general, suppressed expression of the tobacco anionic peroxidase promoter in leaf protoplasts and roots, induction of expression was observed in a very

specific region of roots. Young N. sylvestris 601-19-L plants, transformed with the peroxidase promoter/GUS gene, were incubated for 48 hours in the dark at 27° in half strength MS medium with or without 50 uM NAA. Whole plants were stained with X-gluc overnight at 37°. Roots of NAA exposed plants exhibited staining in the epidermis, just behind the root cap. Plants that were not exposed to NAA showed no staining in this region. No other differences in GUS staining were observed between plants treated with NAA and those treated with only MS medium. Effect of DNA methylation on transient expression. Most

of the E. coli strains commonly used for DNA cloning are

dam+, dcm+ and will methylate adenosine and cytosine residues 121 when they occur in certain sequence motifs. Eukaryotic cells also contain methylases, although their reactivity differs. The pattern of DNA methylation is, therefore, different in prokaryotes and eukaryotes. It has been reported that the use of methylated DNA isolated from dam*, dcm+ strains of E. coli can affect promoter activity in transient expression assays (27). Torres et al. observed approximately ten-fold higher basal activity for several different plant gene promoter/GUS constructs when the DNA used for transformation into parsley protoplasts was isolated from dam*, dcm+ strains of E. coli than from a dam", dcm' E. coli strain. DNA methylation also affected the extent to which these promoters could be induced by environmental factors such as light or fungal elicitors. Although induction was still evident when bacterially-methylated DNA was used, the magnitude of the induction was not as great as that observed when unmethylated

DNA was used in the transient expression assay. Torres et al. suggest that DNA methylation may partially deregulate promoter activity. The effect of DNA methylation on the activity of the tobacco anionic peroxidase promoter was examined in the tobacco protoplast transient expression system. Methylated

DNA was isolated from E. coli strain JM109. Unmethylated DNA was cloned in SCSI 10, a dam', dcm' strain of E. coli (Stratagene). Protoplasts were transformed with methylated or unmethylated pKK060992 containing 3 kb of the peroxidase 122 promoter fused to GUS. Also transformed into protoplasts was unmethylated pKK092093, the first of six promoter deletions to be examined. pKK092093 contains the peroxidase promoter deleted to -1859 bps and fused to the GUS coding region. In all transformations an equimolar amount of unmethylated pKK012594 containing 3 kb of the peroxidase promoter fused to the CAT coding region and NOS terminator was included as an internal control. Transformed protoplasts for all constructs and methylation states were incubated with and without 3 0 uM IAA. The effect of DNA methylation on the peroxidase promoter was similar to that observed by Torres et al. GUS activity of the full promoter was reduced by nearly ten-fold when the DNA was unmethylated (Table 14, Figure 28). This sizable decrease in activity was problematic. When unmethylated DNA was used, CAT activity— intended as an internal standard— was too low to be accurately determined. GUS activity, although measurable, was extremely low. Unmethylated DNA was not used in any subsequent protoplast experiments. Any decline in activity from the low initial activity observed with unmethylated DNA would be difficult or impossible to detect. The sensitivity of the GUS assay limits the ability to accurately measure GUS activity at low levels. All treat­ ments of interest, however, caused a decline in activity. Decreased GUS expression was also expected with 5' promoter deletions, described in the following chapter. Therefore, 123

Table 14: GUS activity of tobacco leaf mesophyll protoplasts transformed with methylated or unmethylated pKK060992 or unmethylated pKK092093 and their response to auxin. All treatments included unmethylated pKK012594. Methylated and unmethylated DNA were isolated from E. coli strains JM109 and SCS110, respectively.

DNA DNA IAA GUS Activity (nM MU/min/ug) ______Methylated___ (uM)____Replicate AVG_____ STD pKK060992 yes 0 2. 10 3.03 0.24 2.90 3.28 3.24 pK K 060992 y e s 30 2.72 2.64 0.30 2.76 2.93 2.14 pKK060992 no 0 0.30 0.32 0.02 0.35 0.32 0.31 pK K 060992 no 30 0.34 0.30 0.03 0.28 0.26 0.30 pK K 092093 no 0 0.30 0.32 0.02 0.33 0.34 0.30 pK K 092093 no 30 0.32 0.37 0.06 0.36 0.47 0.33 calf thymus 0 - 0 . 0 2 - 0 . 0 0 0.01 - 0 . 0 1 0.02 0.00 124

3.5

- no IAA added to Incubation media

+ 30 uM IAA added to Incubation media

T 1------1----- T- PKK0609S2 pKK060992 PKK 092093 calf thymus m ethylated unmethylated unmethylated DNA

Figure 28: Average GUS activity of tobacco protoplasts transformed with equimolar amounts of methylated or unmethylated pKK060992 or unmethylated pKK092093 and their response to 30 uM IAA. All treatments included unmethylated pKK012594. Methylated and unmethylated DNA were isolated from E. coli strains J.Ml09 and SCS110, respectively. Calf thymus DNA was used as a negative control. 125 methylated DNA was used in all subsequent protoplast experi­ ments .

Discussion The regulation of the tobacco anionic peroxidase gene was investigated for potential internal or external effec­ tors. Plant hormones and environmental stresses were examined for their effect on the expression of a peroxidase promoter/GUS coding region gene fusion in a transient expression assay using tobacco mesophyll protoplasts. Of the plant hormones tested, only auxin affected expression from the peroxidase promoter. The peroxidase promoter was suppressed by auxin. Ethylene, gibberellic acid, cytokinin, abscisic acid and jasmonic acid had little or no effect on peroxidase regulated expression. Salicylic acid and a fungal elicitor derived from Phytophthora megasperma var. sojae suppressed expression. No alteration in expression was observed when a 41°C, two hour heat shock was applied. Auxin was effective in down regulating expression of the tobacco anionic peroxidase gene. Half maximal suppression was observed at 30 uM IAA or NAA. The suppressive effect of auxin was observed in transiently transformed tobacco protoplasts as well as in stably transformed root cultures. The suppression was dose responsive and was directly propor­ tional to the logarithm of the applied auxin concentration. It is typical of hormone regulated responses to be linear 126 functions of the logarithm of the applied hormone concentra­ tion (28) . Activity of the peroxidase promoter could be restored by the addition of the anti-auxin, PCIB. Treatment with PCIB alone increased activity above untreated controls. Suppression by auxin was not entirely surprising. Auxin suppression of peroxidase activity has been reported previ­ ously. As early as 1966 auxin suppression of a peroxidase isoenzyme in dwarf pea stem segments was described (29) . Only one of eight isoenzymes observed was affected by auxin. A previous study by Wiese, although not definitive, suggested suppression of the anionic peroxidase by auxin (3 0). A decline in steady state mRNA levels was observed in tobacco leaf discs exposed to auxin. It is not known whether auxin suppression of the anionic peroxidase was caused by alter­ ation of transcription rate or stability of the transcript. Auxin suppression has been reported for several other genes. The products of many of these genes, however, are unknown (28,31). It is interesting that some of these auxin suppressed genes encode putative cell wall proteins. A glycine-rich protein was expressed in strawberry fruit when auxin was removed (32) . Its accumulation was correlated with a cessation of growth. In auxin-treated tobacco mesophyll protoplasts, nine proline-rich proteins were suppressed (28) . These proteins also have been implicated in cell wall formation. Other auxin suppressed genes that have been identified include a potato proteinase inhibitor and two 127 tobacco genes involved in nicotine biosynthesis (21,33). Of the other potential regulators of gene expression that were examined, only salicylic acid and a fungal cell wall elicitor derived from Phytophthora megasperma var. sojae had any significant effect on expression regulated by the peroxidase promoter. Salicylic acid (0.05%) completely suppressed expression from the peroxidase promoter in protoplast transient expression assays. It is possible, however, that the salicylic acid concentration used in this experiment was toxic to tobacco protoplasts. In contrast, Ward et al. observed no change in steady state mRNA levels of the anionic peroxidase in tobacco plants treated with 50 mM salicylic acid over 48 hours (2). Clearly, further study is required to determine the effect of salicylic acid on peroxidase expression. Understanding the effect of salicylic acid on peroxidase gene expression is necessary to elucidate possible roles for the anionic peroxidase in plant defense responses. Endogenous salicylic acid concentrations have been shown to increase 20 fold in TMV resistant cultivars of tobacco, such as the N. tabacum cultivar, Xanthi, that was used in these protoplast experiments, upon inoculation with TMV (34). Susceptible cultivars of tobacco did not exhibit a change in salicylic acid levels. It is also interesting that salicylic acid has been shown to suppress expression of proteinase inhibitors, defense-related proteins, in tomato (34) . 128 A cell wall glucan from Phytophthora megasperma var. sojae reduced expression from the peroxidase promoter by approximately half. In general, treatment with fungal elicitors has been associated with an increase in peroxidase activity (35). An increase in peroxidase activity upon infection is thought to be a defense mechanism for most plants (35) . It is very likely that this increase in peroxidase activity is from isoenzymes other than the anionic peroxidase. Suppression of anionic peroxidase expression by fungal elicitors is supported by the work of Messner et al (36). Suspension cultures of spruce cells exhibited a 150% increase in peroxidase activity after treatment with a fungal elicitor. Extracellular peroxidase activity, however, decreased rapidly upon addition of the elicitor. Beyond indicating possible regulators of peroxidase gene expression, these experiments also highlight the value of transient expression assays. Transient expression of a promoter/reporter gene fusion in protoplasts provided a relatively simple and quick method to screen for potential regulatory factors. The numerous auxin experiments of this chapter demonstrate the reproducibility of this assay method. Although absolute activity of the reporter gene varied between experiments, relative activity for different treat­ ments remained constant. These experiments also revealed the previously unreported sensitivity of the cauliflower mosaic virus 35S promoter to plant hormones. Results from a single 129 experiment indicate that the CaMV 35S promoter is suppressed by auxin, induced by ethylene and unaffected by benzyladenine. 130

LIST OF REFERENCES

Lagrimini, L. Mark; Rothstein, Steven (1987). "Tissue Specificity of Tobacco Peroxidase Isoenzymes and Their Induction by Wounding and Tobacco Mosaic Virus Infec­ tion." Plant Phvsiol.. 84, pp. 438-442. Ward, Eric R.; Uknes, Scott J.; Williams, Shericca C.; Dincher, Sandra S.; Wiederhold, Deanna L.; Alexander, Danny C. ; Ahl-Goy, Patricia; Metraux, Jean-Pierre; Ryals, John A. (1991). "Coordinate Gene Activity in Response to Agents that Induce Systemic Acquired Resistance." Plant Cell. 3, pp. 1085-1094. Jefferson, Richard A. (1987). "Assaying Chimeric Genes in Plants: The GUS Fusion System." Plant Mol. Bio. Reporter. 5, pp. 387-405. Shillito, R. D.; Saul, M. W. "Protoplast Isolation and Transformation." In Plant Molecular Biology: A Practical Approach, pp. 161-186. Edited by C. H. Shaw. Oxford: IRL Press, 1988. Lepetit, Marc; Ehling, Martine; Gigot, Claude; Hahne, Gunther (1991). "An Internal Standard Improves the Reliability of Transient Expression Studies in Plant Protoplasts." Plant Cell Reports. 10, pp. 401-405. Marty, Isabelle; Brugidou, Christophe; Chartier, Yvette; Meyer, Yves (1993) . "Growth-Related Gene Expression in Nicotiana tabacum Mesophyll Protoplasts." Plant Journal. 4, pp. 265-278. Farmer, Edward E.; Johnson, Russell R.; Ryan, Clarence A. (1992). "Regulation of Expression of Proteinase Inhibitor Genes by Methyl Jasmonate and Jasmonic Acid." Plant Phvsiol.. 98, pp. 995-1002. Ayers, Arthur R.; Ebel, Jurgen; Valent, Barbara; Albersheim, Peter (1976). "Host-Pathogen Interactions X. Fractionation and Biological Activity of an Elicitor Isolated from the Mycelial Walls of Phytophthora megasperma var. sojae." Plant Phvsiol.. 57, pp. 760- 765. 131 9. Kunkel, T. A. "Oligonucleotide-Directed Mutagenesis Without Phenotypic Selection." In Current Protocols in

Molecular Biology, pp 8 .1.1-8.1.6. Edited by F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moor, J. G. Seidman, J. A. Smith and K. Stouhl. New York: John Wiley & Sons, 1987. 10. Zhou, Chen; Abaigar, Lee; Jong, Ambrose Y. (1990). "A Protocol for Using T7 DNA Polymerase in Oligonucleotide Site-Directed Mutagenesis." Biotechnicrues. 8, p. 503. 11. Chung, C. T. ; Niemela, Suzanne L. ; Miller, Roger H. (1989). "One-Step Preparation of Competent Escherichia coli: Transformation and Storage of Bacterial Cells in

the Same Solution." Proc. Natl. Acad. Sci. USA. 8 6 , pp. 2172-2175. 12. pBluescript instruction manual. Stratagene, La Jolla, California. 13. Instruction manual for the Applied Biosystems Model 370A/373A DNA Sequencing System. 14. Sambrook, J.; Fritsch, E. F.; Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd ed. Plainview, NY: Cold Spring Harbor Laboratory Press, 1989. 15. Jourdan, P. S.; Earle, E. D. (1989). "Genotypic Variability in the Frequency of Plant Regeneration from Leaf Protoplasts of Four Brassica spp. and of Raphanus sativus." J. Amer. Soc. Hort. Sci.. 114, pp. 343-349. 16. Knee, Michael (1991). "Role of Ethylene in Chlorophyll Degradation in Radish Cotyledons." J. of Plant Growth Regulation. 10, pp. 157-162. 17. Peach, Cindy; Velten, Jeff (1992). "Application of the Chloramphenicol Acetyltransferase (CAT) Diffusion Assay to Transgenic Plant Tissues." BioTechnigues. 12, pp. 181-186.

18. "Fluorometric 6 -Glucuronidase Assay Using the TKO 100 Fluorometer." Technical Bulletin #138. Hoefer Scien­ tific Instruments. San Francisco, CA. 19. Shaw, C. H. , ed. Plant Molecular Biology: A Practical Approach. pp. 301-303. Oxford: IRL Press, 1988. 20. Murashige, T.; Skoog, S. (1962). "A Revised Medium for Rapid Growth and Bioassays with Tobacco Tissue Cul­ tures." Phvsiol. Plant.. 15, pp. 473—497. 132 21. Hibi, Naruhiro; Higashiguchi, Shinji; Hashimoto, Takashi; Yamada, Yasuyuki (1994). "Gene Expression in

Tobacco Low-Nicotine Mutants." Plant Cell. 6 , pp. 723- 735. 22. Shepard, Allan R. ; Eberhardt, Norman L. (1992). "Thiols Interfere with Chloramphenicol Acetyltransferase Assays." BioTechnicnjes. 13, pp. 702-704. 23. McRae, D. Harold; Bonner, James (1953). "Chemical

Structure and Antiauxin Activity." Phvsiol. Plant.. 6 , pp. 485-510. 24. Vance, C. P.; Kirk, T. K.; Sherwood, R. T. (1980). "Lignification as a Mechanism of Disease Resistance." Annu. Rev. Phvtooathol.. 18, pp. 259-288. 25. Devlin, Robert M. ; Witham, Francis H. Plant Physiology. 4th ed. Boston; Willard Grant Press, 1983. 26. Burstrom, Hans (1950). "Studies on Growth and Metabo­ lism of Roots IV. Positive and Negative Auxin Effects on Cell Elongation." Phvsiol. Plant.. 3, pp. 277-292. 27. Torres, Jorge Tovar; Block, Annette; Hahlbrock, Klaus; Somssich, Imre E. (1993). "Influence of Bacterial Strain Genotype on Transient Expression of Plasmid DNA in Plant Protoplasts." Plant Journal. 4, pp. 587-592. 28. Theologis, Athanasios (1986) . "Rapid Gene Regulation By Auxin." Ann. Rev. Plant Phvsiol.. 37, pp. 407-438. 29. Ockerse, R. ; Siegel, B. Z.; Galston, A. W. (1966) . "Hormone-Induced Repression of a Peroxidase Isozyme in Plant Tissue." Science. 18, pp. 452-453. 30. Wiese, Sandra. "Phenotypic Characterization of Tobacco Transformed to Constitutively Underproduce Anionic Peroxidase." M.S. dissertation. Ohio State University, 1993. 31. Datta, Neeraj; LaFayette, Peter R.; Kroner, Philip A.; Nagao, Ronald T.; Key, Joe L. (1993). "Isolation and Characterization of Three Families of Auxin Down- Regulated cDNA Clones." Plant Mol. Biol.. 21, pp. 859- 869. 32. Reddy, A. S. N.; Poovaiah, B. W. (1987). "Accumulation of a Glycine Rich Protein in Auxin-Deprived Strawberry Fruits." Biochem. Biophvs. Res. Commun.. 147, pp. 885- 891. /

133 33. Kernan, Andrea; Thornburg, Robert W. (1989). "Auxin Levels Regulate the Expression of a Wound-Inducible Proteinase Inhibitor II— Chloramphenicol Acetyl Trans­ ferase Gene Fusion in vitro and in vivo.” Plant Phvsiol.. 91, pp. 73-78. 34. Malamy, Jocelyn; Klessig, Daniel F. (1992). "Salicylic Acid and Plant Disease Resistance." Plant Journal. 2, pp. 643-654. 35. Gaspar, Th.; Penel, C.; Hagege, D.; Greppin, H. "Peroxidases in Plant Growth, Differentiation, and Development Processes." In Biochemical. Molecular, and Physiological Aspects of Plant Peroxidases, pp. 249-280. Edited by J. Lobarzewski, H. Greppin, C. Penel, Th. Gaspar. Lubin, Poland: University M. Curie-Sklodowska, 1991. 36. Messner, Burkhard; Boll, Meinrad (1993). "Elicitor- Mediated Induction of Enzymes of Lignin Biosynthesis and Formation of Lignin-Like Material in a Cell Suspension Culture of Spruce (Picea abies)." Plant. Cell. Tiss. Ora. Cult.. 34, pp. 261-269. CHAPTER IV REGULATORY REGIONS OF THE TOBACCO ANIONIC PEROXIDASE PROMOTER

Introduction The tobacco anionic peroxidase gene is likely to be highly and specifically regulated. Both substrate and products of this enzyme are toxic and highly reactive. Peroxidases utilize a reactive oxygen species, hydrogen peroxide, to produce highly reactive free radicals. Controlling the level of substrate and product is likely to be important for the life and health of the plant. Promoter sequencing and protoplast transient expression experiments (Chapters II and III) provided the first evidence that this gene is tightly regulated. Sequencing identified numerous potential regulatory regions based on sequence homology with known regulatory elements from other genes. Transient expression assays with tobacco mesophyll protoplasts also revealed several chemical and environmental factors which regulate expression of this gene. Auxin suppressed expression from the TobAnPOD promoter. Salicylic acid, jasmonic acid and a fungal cell wall elicitor also suppressed TobAnPOD gene expression.

134 135 The tobacco anionic peroxidase promoter contains many sequences similar to known regulatory elements of other genes. The peroxidase promoter contains a sequence homologous to the as-2 box that was first identified in the cauliflower mosaic virus 35S promoter (1). This element has been correlated with shoot specific expression and may be important in the regulation of the TobAnPOD gene since the tobacco anionic peroxidase is expressed primarily in the aerial portions of the plant (2). TC-rich repeats, 10 bps in length, may also have regulatory significance. Repeated sequence motifs have commonly been identified as regulators of gene expression (3). A string of eleven repetitions of the two base pair motif, TA, is also found in the peroxidase promoter. AT-rich regions, in general, have been identified as regulatory elements in other genes where they exhibit enhancer-like activity. (4-6). Sequencing also revealed the presence of two G-boxes as well as thirteen sequence motifs common to auxin-regulated genes. Potential positive and negative regulatory elements were also identified. Promoter deletions are often used as the first step in identifying regulatory regions in a promoter. The promoter of interest is fused to the coding region of a reporter gene and a series of deletions, initially from the 5' end, are made. The gene constructs are expressed in either transient expression assays or in stably transformed plants. Differences in expression before and after a deletion are 136 used to identify regions containing potential regulatory elements.

This chapter describes the creation of 5 1 promoter deletions of the tobacco anionic peroxidase promoter and their differences in expression in a transient expression assay. Surprisingly, potential regulatory regions were found interspersed throughout the entire 3 kb of the peroxidase promoter. Positive as well as negative regulatory regions were observed. Changes in expression of promoter deletions in response to auxin were examined to delineate a region of the promoter responsible for auxin suppression. Also described are the anomalous results obtained when two genes, both under the control of the peroxidase promoter, were co­ transformed into tobacco protoplasts.

Materials and Methods Plasmid constructs. A nested series of 5' promoter deletion constructs were synthesized using restriction enzyme sites within the peroxidase promoter. Promoter fragments

were coupled to the 6 -glucuronidase (GUS) coding region and nopaline synthase (NOS) terminator in pBluescript KS (+). The first promoter deletion construct, pKK092093 (Figure 29a) , was made by digestion of pKK060992 (Figure 15a) with

HinDlll and recircularization of the 6 . 6 kb fragment with T4 DNA ligase. This construct contained the peroxidase promoter from -1859 to +71 bps fused to the GUS coding region and NOS 137

A B

Cl.I Sail Clal Xhol Sail Apal Xhol Kpnl HinD3 Apal Kpnl

,S m aI

X bal

5000 .Smal pKK092093 1000 A M P r MOO pKK092193 6600 bps 2000 5800 bps GUS A M P / 4000 2000

3000 GU5 3000

N O S Ur. N O S Ur.

SacI S itl Sac2 EcoRI E afI Pali N otl Smal Xbal BamHI Spel Spel BamHI X bal Smal N otl PstI E a*I EeoRI (Sae2 S a t ! SacI

Figure 29: Plasmid maps of pKK092093 (a) and pKK092193 (b). a. pKK092093 containing the peroxidase 5' regulatory region deleted to -1859 bps and fused to the 6 -glucuronidase coding region and nopaline synthase terminator in pBluescript KS (+). b. pKK092193 containing the peroxidase 5' regulatory region deleted to -638 bps and fused to the 6 -glucuronidase coding region and nopal ine synthase terminator in pBluescript K S ( + ) . 138 terminator. A second deletion was made using the NdeI site at -638 bps. pKK0609992 was digested with Nde I and HinDIII and the

fragment ends were blunted by the addition of 2 mM of each dNTP and 2 U of the Klenow fragment of DNA polymerase I (7). The 5.8 kb fragment was circularized with T4 DNA ligase to make pKK092193 (Figure 29b). The promoter was deleted to -344 bps in pKK092293 (Figure 30a). pKK060992 was digested with Xbal and a 2.5 kb fragment containing the peroxidase promoter from -343 bp, the GUS coding region and the NOS terminator were isolated from a 0.7% agarose gel . This fragment was ligated into pBluescript KS (+) that had been digested with Xbal. The orientation of the insert was determined by restriction enzyme digestions. For synthesis of the last three deletions, it was first necessary to insert the GUS coding region and the NOS terminator in pBluescript KS (+) . The GUS coding region and NOS terminator were isolated from pHGl as a BamHI, EcoRI fragment. This fragment was ligated into BamHI, EcoRI digested pBluescript KS (+) to create pKK092493 (Figure 3 0b) . The promoter region from an Apol restriction site located at -220 bps to the mutagenic Bgill site at the translation start site was isolated from pKK040192 (Figure 14b) by digestion with Apol, creation of blunt ends by filling in with the Klenow fragment of DNA polymerase I, 139

BamHI

EcoRI Smal. EcoRS BamHI Spel HmD3 X bal N o tll E a g ll S ac2| Kpnl I Xbal SacI I

POD jxreaotcr pBluescript(

3000 GUS pKK092293 pKK092493 A M P r 5500 bps 5100 bps A M P r

3000 ano

NOS N O S ttr S atl

I EcoRI EcoRI [EcoRS [ HinD3 [C lal BamHI Sail [Xhol [Apal K pal

Figure 30: Plasmid maps of pKK092293 (a) and pKK 092493 (b) . b. pKK092293 containing the peroxidase 5' regulatory region deleted to -344 bps and fused to the 6 -glucuronidase coding region and nopaline synthase terminator in pBluescript KS (+). b. pKK092493 containing a promoterless B-glucuronidase coding region and nopaline synthase terminator in pBluescript KS (+) . 140 digestion with Bglll, and isolation from an agarose gel. This fragment was ligated into pKK092493 which had been digested with Xbal, filled in with Klenow fragment to create blunt ends and digested with BamHI. The structure of this plasmid, pKK102993 was confirmed by sequencing (Figure 31a) . The peroxidase promoter was deleted to -136 bps in pKK100693 (Figure 31b). pKK040192 was digested with SspI and Bglll, and a 200 bp fragment was isolated by agarose gel electrophoresis. This fragment was ligated into pKK092493 which had been digested with Xbal, filled in with Klenow to create blunt ends and digested with BamHI. The structure of this plasmid was confirmed by sequencing. The last deletion, pKK113093, contained the promoter from -60 bps to the translation start site fused to the GUS coding region and NOS terminator (Figure 32). pKK040192 was digested with Mnll, blunt ended with T4 DNA polymerase, and digested with Bglll. The desired 130 bp fragment was isolated from a 5% polyacrylamide gel after electrophoresis. This fragment was ligated into pKK092493 that had been digested with Xbal, blunt ended with Klenow, and digested with BamHI. The structure of the plasmid was confirmed by sequencing. pKK012594 (Figure 16a) containing 3 kb of the peroxidase promoter, the coding region of chloramphenicol acetyl transferase (CAT) and the NOS terminator in pBluescript KS (+) was used as an internal standard in transient expression 141

A B

N o il E a fl Sac2 SacI Smal ,SmaI

sooo

GUS pKK100693 GUS A M P r 4000 5250 bps

3000 3000

S ail

EcoRI I EcoRI EcoR5 lE coR S HinD3 |H in D 3 Clal I Clal Sail [S ail Xhol X hol Apal [Apal Kpol K pal

Figure 31: Plasmid maps of pKK102993 (a) and pKK100693 (b). a. pKK102993 containing the peroxidase 5' regulatory region deleted to - 2 2 0 bps and fused to the 6 -glucuronidase coding region and nopaline synthase terminator in pBluescript KS (+). b. pKK100693 containing the peroxidase 5' regulatory region deleted to -136 bps and fused to the 6 -glucuronidase coding region and nopaline synthase terminator in pBluescript KS (+) . /

142

Sm al

POD

5000

„ G U S

A M P t 4000

2000 3000

S «tl

EcoRI EcoR5 HinD3 GUI Sail X hol |A paI Xpal

Figure 32: Plasmid map of pKK113093 containing the peroxidase 5' regulatory region deleted to -60 bps and fused to the 6 -giucuroniaase coding region and nopaline synthase terminator in pBluescript KS (+). 143 assays. Its synthesis is described in Chapter III. DNA preparation, protoplast isolation and transformation, and enzyme and protein assays were performed as previously described (Chapter III).

Results 5' deletions were made of the 3 kb tobacco anionic peroxidase promoter. These deletions were fused to the GUS coding region and NOS terminator and their expression determined in transiently transformed tobacco mesophyll protoplasts. The deletions were designed to span the entire 3 kb of the promoter as well as to circumscribe possible regulatory regions that were identified by DNA sequencing.

Six deletions from the 5 1 end of the peroxidase promoter were made using available restriction enzyme sites. The deletions are shown in Figure 3 3 with respect to their distance from the transcription start site. Also shown are possible regulatory elements identified by sequence homology to known elements of other genes and the TATA box required for transcription initiation. Initial deletions from the 5' end removed large fragments of the peroxidase promoter. Deletions approaching the 3' end were more closely spaced since most regulatory regions are commonly found in the 3' end of a promoter. The promoter deletions were fused to the GUS coding region and NOS terminator and cloned in pBluescript KS (+). -638 -344 -220 -136 -60

B TA repeats G box AS-2 TAT, TC repeats CAAT /

-3146 -1859

B B G box j coding region untranslated leader

Figure 33: Map of the tobacco anionic peroxidase promoter showing the location of the restriction enzyme sites used in making deletions and possible regulatory elements identified by DNA sequencing. A and B are sequences common to auxin regulated genes (8,9). C is a sequence homologous to an auxin-responsive element (10). Potential positive and negative regulatory elements are identified as + and respectively (1 1 ). H 145 The expression from the promoter deletions was examined in a transient expression assay with tobacco leaf mesophyll protoplasts. The peroxidase promoter deletions fused to GUS were transformed into tobacco protoplasts and subsequently

incubated for 3 6 hours in the presence or absence of 100 uM IAA. Protoplasts were incubated with or without IAA in the hope of defining a region of the peroxidase promoter that contained an auxin responsive element. GUS activity was measured after the incubation period as an indication of the transcriptional activity of the promoter construct. Transient expression assays with an internal standard. Initial transient expression assays with the promoter deletions were carried out with an internal standard. Protoplast transformation efficiency has been reported to vary as much as 20 fold between experiments (12) . An internal standard was used to compensate for possible differences in transformation efficiency and allow comparison of transformations with different promoter constructs. Each transformation contained a peroxidase promoter deletion fused to the GUS coding region and an equimolar amount of the full (-3146 kb) peroxidase promoter fused to the CAT coding region. Any variation in CAT activity between transformations was due, theoretically, to variation in transformation efficiency. The results of this experiment are shown in Table 15 and Figure 34. GUS activity was expressed as a function of CAT Table 15: GUS, CAT and GUS/CAT activity of tobacco mesophyll protoplasts transiently transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and an equimolar amount of the full peroxidase promoter fused to CAT as an internal standard. Protoplasts were incubated with and without 100 uM IAA for 36 hours. Each treatment contained four replications.

Promoter IAA GUS (nM MU/min/ug) CAT (cpm/min/ug) GUS/CAT(nM MU/cpm) Length (100 uM) AVG STD AVG STD AVG STD control - 0.02 0.00 0.34 0.04 0.053 O.0O5 + 0.02 0.00 0.32 0.01 0.076 0.003

-3146 bps _ 12.94 1.27 9.89 0.28 1.306 0.102 + 17.59 0.37 9.32 0.35 1.889 0.038

-1859 bps — 3.85 0.34 8.73 0.65 0.441 0.011 + 4.36 0.38 9.09 0.64 0.480 0.019

-638 bps _ 0.03 0.00 10.15 0.25 0.003 0.000 + 0.04 0.01 10.94 0.36 0.003 0.001

-344 bps _ 1.18 0.09 8.64 0.35 0.136 0.005 + 1.28 0.07 8.70 0.53 0.148 0.003

-220 bps _ 1.91 0.07 9.53 0.36 0.201 0.011 + 2.64 0.16 8.68 0.27 0.304 0.017

-136 bps - 0.42 0.03 10.40 0.48 0.040 0.001 + 0.71 0.03 9.14 0.57 0.078 0.003

-60 bps _ 0.60 0.04 10.71 0.32 0.056 0.003 + 1.09 0.05 10.88 0.71 0.101 0.003 Q\ 147

- contains no added IAA + contains 100 uM IAA

control -3146 bp -1859 bp -€38 bp -344 bp -220 bp -136 bp -60 bp

Figure 34: Average GUS/CAT activity of tobacco mesophyll protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and the full peroxidase promoter fused to CAT with or without 100 uM IAA. Control was the GUS/CAT activity of protoplasts transformed with calf thymus DNA. 148 activity to correct for differences in transformation efficiency. Auxin-treated protoplasts transformed with the full peroxidase promoter or any of the promoter deletions had significantly higher GUS/CAT activity than those that received no added auxin. Previous to this experiment, the full 3 kb of the peroxidase promoter had been effectively and reproducibly suppressed by auxin in transient expression assays with tobacco protoplasts. IAA at a concentration of 100 uM had previously suppressed GUS activity to less than 30% of the activity of untreated transformed protoplasts. To try to understand the results of this experiment, GUS and CAT activity were examined separately (Table 15, Figures 35 and 36) . Quite surprisingly, it appeared that the two different reporter genes under the control of the same promoter were regulated differently. Figure 35 shows the average CAT activity for the different protoplast transformations. All transformations used the same quantity of pKK012594, a plasmid containing 3 kb of the peroxidase promoter fused to the CAT coding region and NOS terminator. Only the peroxidase promoter fused to the GUS coding region varied in length in these transformations. No significant change in CAT activity was observed upon exposure to 100 uM IAA. In fact, CAT activity was relatively constant for all transformations and treatments. This indicates not only that the peroxidase promoter fused to CAT did not respond to

auxin^ but disc tlicit transformation efficiency was s2 .iuij.ar 149

- contains no added IAA + contains 100 uM IAA

3O) C 'E E Col

§

control -3146 bp -1859 bp -638 bp -344 bp -220 bp -136 bp -60 bp

Figure 35: Average CAT activity of tobacco mesophyll protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and the full peroxidase promoter fused to CAT with or without 100 uM IAA. Control was the CAT activity of protoplasts transformed with calf thymus DNA. 150

2 0

18-1 - contains no added IAA D) + contains 100 uM IAA i 16H 14-

s 124

10-

- ( 0 8 1 5 o (D 6 o> (0 L. a> 4-

2- - +

0 I T i n* I I I I iTlT I T I ITIT I'TT I T V V control -3146 bp -1859 bp -638 bp -344 bp -220 bp -136 bp -60 bp

Figure 36s Average GUS activity of tobacco mesophyll protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and the full peroxidase promoter fused to CAT with or without 100 uM IAA. Control was the GUS activity of protoplasts transformed with calf thymus DNA. 151 for different transformation events with protoplasts from the same isolation. GUS activity (Figure 36) , however, increased on exposure to IAA in protoplasts transformed with the full promoter as well as with all deletion constructs. It is strange that not only were two genes, under the control of the same promoter, responding differently to auxin but also that the response was reversed when two genes with the same promoter were transiently transformed into protoplasts as opposed to a single gene. Protoplasts transformed with only the peroxidase gene fused to GUS exhibited reduced GUS activity when treated with auxin. This same gene was induced by auxin when co-transformed with a gene containing the same promoter but a different coding region. Despite the strange response to auxin exhibited by the co-transformed protoplasts, this experiment provided the first indication of possible regulatory regions within the peroxidase promoter. Deletion from -3 kb to -1859 bps of the peroxidase promoter caused a 70% decrease in GUS activity. Further deletion from -1859 bps to -638 bps resulted in the loss of all activity. Some activity was regained with deletion of the promoter to -344 bps. Deletion to -220 bps restored more GUS activity but only to 15% of the activity of the -3 kb promoter. Further deletion to -136 bps and -60 bps caused a reduction in GUS activity from that observed at -220 bps. 152 The protoplasts used in this experiment were obtained from young leaves as in previous experiments. The plants from which these leaves were taken, however, were old, post- anthesis plants. It was thought that the age of the plants might be responsible for the reversal in response to auxin by the peroxidase promoter observed in this experiment. Therefore, the experiment was repeated with young leaves taken from young, approximately 30 cm tall, tobacco plants. Protoplasts were transformed and treated as in the previous experiment except pKK012594 was co-transformed with the promoter deletions at slightly less than equimolar amounts. Each transformation contained a promoter deletion fused to GUS and 0.9 equivalents of the full peroxidase promoter fused to CAT as an internal standard. The co-transformed protoplasts were incubated for 36 hours in the presence or absence of 100 uM IAA as in the previous experiment. The results of this experiment were very similar to those of the previous experiment (Table 16, Figures 37-39). Auxin enhanced GUS expression from the full peroxidase promoter as well as for all promoter deletions when GUS activity was expressed as a function of CAT activity (Figure 37) . The two reporter genes again responded differently to the presence of auxin. CAT expression under the control of the full peroxidase promoter was suppressed by auxin (Figure 38) . CAT activity was reduced by an average of 35% when protoplasts were incubated with 100 uM IAA. This suppression Teible 16: GUS, CAT and GUS/CAT activity of tobacco mesophyll protoplasts transiently transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and a 0.9 equimolar amount of the full peroxidase promoter fused to CAT as an internal standard. Protoplasts were incubated with and without 100 uM IAA for 36 hours. Each treatment contained four replications.

Promoter IAA. GUS (nM MU/min/ug) CAT (cpm/min/ug) GUS/CAT (nM MU/cpm) Length (100 uM) AVG STD AVG STD AVG STD control - 0.033 0.026 1. 83 0.64 0.018 O.dIO + 0.032 0.052 2.20 1.22 0.025 0.032

-3146 bps _ 7.161 1.350 13.17 0.67 0.541 0.078 + 10.063 1.183 8.05 0.31 1.256 0.195

-1859 bps - 3.536 0.202 9.90 0.56 0.358 0.022 + 3.093 0.293 5.63 0.72 0.553 0.046

-638 bps _ 0.019 0.024 9.81 0.68 0.002 0.002 + 0.014 0.012 6.39 0.41 0.002 0.002

-344 bps _ 1.511 0.299 9.14 0.66 0.164 0.024 + 0.901 0.154 4.90 1.00 0.189 0.045

-220 bps _ 1.256 0.193 8.06 0.92 0.158 0.032 + 1.891 0.382 6.74 0.66 0.279 0.041

-136 bps _ 0.446 0.108 10.10 1.15 0.043 0.006 + 0.649 0.255 6.28 0.81 0.110 0.056

-60 bps - 0.604 0.099 9.00 0.76 0.067 0.006 + 0.881 0.18 6.27 2.15 0.157 0.052 154

- contains no added IAA + contains 100 uM IAA

control -3146 bp -1859 bp -638 bp -344 bp -220 bp -136 bp -60 bp

Figure 37: Average GUS/CAT activity of tobacco mesophyll protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and 0.9 equimolar amount of the full peroxidase promoter fused to CAT with or without 100 uM IAA. Control was the GUS/CAT activity of protoplasts transformed with calf thymus DNA. 155

- contains no added IAA + contains 100 uM IAA 14-

12- 3o> E 10- E Q. S 8 -

o < H- < O

control -3146 bp -1859 bp -638 bp -344 bp -220 bp -136 bp -60 bp

Figure 38: Average CAT activity of tobacco mesophyll protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and 0.9 equimolar amount of the full peroxidase promoter fused to CAT with or without 100 uM IAA. Control was the CAT activity of protoplasts transformed with calf thymus DNA. 156

- contains no added IAA + contains 100 uM IAA

T"T i T T f f i t t — i Tf i i T i control -3146 bp -1859 bp -638 bp -344 bp -220 bp -136 bp -60 bp

Figure 39: Average GUS activity of tobacco mesophyll protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and 0.9 equimolar amount of the full peroxidase promoter fused to CAT with or without 100 uM IAA. Control was the GUS activity of protoplasts transformed with calf thymus DNA. 157 was much less dramatic than the auxin suppression previously observed in protoplasts transformed with only a single gene. GUS expression, in contrast, was induced by auxin (Figure 39) . Higher GUS activities were observed for the full peroxidase promoter and all but two of the deletions when IAA was added to the incubation medium. Clearly, the apparent enhancement of GUS activity by auxin and the differential expression of the two reporter genes were reproducible phenomena that occurred when two different genes under the control of the same promoter were co-transformed into tobacco protoplasts. The age of the plant from which the protoplasts were obtained was not responsible for the anomalous results. Also reproducible was the effect of the 5' deletions on the expression of the tobacco anionic peroxidase promoter/GUS gene chimera. Identical changes in GUS activity with each successive deletion from the 5' end of the peroxidase promoter were observed for both experiments. Apparent positive and negative regulatory regions were the same as previously observed. As before, the construct containing the smallest portion of the peroxidase promoter still responded to auxin. Transient expression assays without an internal standard. It was obvious from the previous two experiments that unusual results were occurring as a consequence of co­ transformation of protoplasts with two genes containing the same peroxidase promoter fused to two different reporter 158 genes. To avoid this problem, the peroxidase promoter deletions fused to GUS were transformed into protoplasts singly, without the additional peroxidase promoter/CAT construct. It was observed previously that an internal standard was not necessary since transformation efficiency was relatively uniform with protoplasts from the same isolation (Figure 35) . This has also been reported by others. Lepetit et al. reported consistent results when DNA

and protoplasts were from the same isolation (1 2 ). Table 17 and Figure 40 show the result of the transient expression assays using only the peroxidase promoter deletions fused to GUS in the presence or absence of 100 uM IAA. Suppression of GUS expression by auxin was evident for all peroxidase promoter constructs. Auxin suppression for each deletion was two to three fold. Even the construct containing the smallest portion of the peroxidase promoter responded to auxin. The extent of suppression was comparable to that seen in previous experiments with protoplasts transformed with only a single gene comprised of the full 3 kb of the peroxidase promoter and the GUS coding region

(Chapter III). The effect of each deletion on GUS activity was similar to that observed previously in transient expression assays that contained an internal standard. Figure 40 shows the change in GUS activity for each deletion in the presence or absence of 100 uM IAA, expressed as a percentage of the 159

Table 17: GUS activity of tobacco mesophyll protoplasts transiently transformed with the tobacco anionic peroxidase promoter deletions fused to GUS and incubated with or without 100 uM IAA for 36 hours. Each treatment contained four replications. Control treatment was protoplasts transformed calf thymus DNA.

Promoter IAA GUS Activity (nM MU/min/ug) length (lOOuM) AVG STD control - o.ooO ...... - “"O'. 0'42" + -0.014 0.030

-3146 bps _ 0.800 0.129 + 0.266 0.076

-1859 bps - 0.352 0.064 + 0.077 0.054

-638 bps _ 0.043 0.033 + 0.026 0.016

-344 bps - 0.234 0.028 + 0.078 0.027

-220 bps - 0.792 0.042 + 0.363 0.034

-136 bps - 0.173 0.042 + 0.129 0.042

-60 bps _ 0.308 0.113 + 0.076 0.014 160

120 - contains no added IAA + contains 100 uM IAA

80-

60-

40-

20 -

control -3146 bp -1859 bp -638 bp -344 bp -220bp -136bp -60 bp

Figure 40: Average GUS activity of tobacco mesophyll protoplasts transformed with the tobacco anionic peroxidase promoter deletions fused to GUS with or without 100 uM IAA and expressed as a percentage of the activity of the -3146 bp promoter without IAA. Control was the GUS activity of protoplasts transformed with calf thymus DNA. 161 activity of the full promoter in the absence of IAA. The most significant difference between this experiment and previous experiments with the internal standard was the magnitude of increased GUS activity upon deletion from -344 to -220 bps. With this deletion, GUS activity increased from approximately 30% to 100% of the activity of the -3 kb promoter. In previous experiments containing the peroxidase promoter fused to CAT as an internal standard, activity increased with this deletion, but only from 10% to 15% of the activity of the -3 kb promoter.

Discussion Expression of the tobacco anionic peroxidase gene is complexly regulated at the transcriptional level. 5' deletions of the TobAnPOD promoter revealed multiple regulatory regions throughout the entire 3 kb of the promoter. Transcriptional activity changed significantly with each deletion, suggesting that each of the deleted fragments contained at least one regulatory element. It was surprising that transcriptional activity was altered with the first deletion of the promoter from -3146 to -1859 bps. Regulatory elements so far removed from the transcription start site have seldom been reported. In fact, most promoter studies do not extend beyond one or possibly two kilobases upstream of the transcription start site. This upstream region, however, is an important part of the tobacco anionic 162 peroxidase regulatory machinery. GUS activity was reduced by 56% with the deletion of this region. This region contains several potential regulatory domains based on sequence homology with identified regulatory elements from other promoters (Figure 33) . These potential regulatory elements include three copies of a motif identified as a positive regulatory element in the bean seed storage protein, 5-phaseolin, and sequence elements common to auxin responsive genes (9-11). Negative as well as positive regulatory elements are important in the expression of the peroxidase gene. The region between -638 and -220 bps suppressed expression to baseline levels. Deletion of this region increased expression from 5 to 99% of the activity of the full 3 kb promoter in protoplasts transformed without an internal standard. Deletion of only a portion of this region, from - 638 to -344 bps, restored approximately 30% of the original activity. Three potential regulatory elements occur between -636 and -344 bps— a sequence common to auxin responsive genes, a series of TA repeats and a G box. The sequence common to auxin regulated genes is known to be a site of protein binding in other genes, although its function is unknown (9). TA repeats and AT-rich regions, in general, have been identified as having enhancer-like activity— a quite different effect than was observed for this region (13,14). G-boxes have been attributed a myriad of functions, 163 and have been implicated in environmental responsiveness, as well as quantitative, spatial, and temporal regulation (11,15-18). It is unknown if any, all, or a combination of these elements are responsible for the observed suppression of activity. No sequence homology could be found between known regulatory elements of other genes and the -344 to -220 bp region which has the greatest suppressive effect on expression. A strong positive regulatory element lies between -220 and -136 bps. Three repeats of a TC-rich sequence are contained in this region. Although no regulatory element with a similar sequence could be found in plants, TC-rich domains have been reported as promoter elements in mammalian systems (19,20). The region between -136 and -60 bps had a slightly suppressive effect on the activity of the promoter. This region contained another copy of the TC-rich repeats, as well as a putative as-2 box and a CAAT box. The full 3 kb peroxidase promoter and all deletions were suppressed by auxin. The magnitude of suppression remained relatively constant. Two to three-fold suppression was

observed for all deletion constructs in the presence of 1 0 0 uM IAA. This suggests that auxin responsive element(s) are

located 3 1 of -60 bps. Any auxin responsive elements, therefore, are close to the TATA box or in the untranslated leader. It is unknown at this time whether auxin suppresses expression at the transcriptional or post-transcriptional 164 level. Either would be supported by the data. Post- transcriptional regulation is possible since the promoter fragment used for all constructs contained the entire (71 bps) transcribed, but untranslated leader. The use of a second reporter gene as an internal standard in protoplast transient expression assays has been recommended to reduce variability between experiments. Reporter genes under the control of the same or a different promoter than the gene of interest have been used successfully as internal standards (12,21,22). Introduction of an internal standard in the protoplast transient expression assays described in this chapter caused strange, but reproducible, changes in expression. Protoplasts co­ transformed with the peroxidase promoter/CAT fusion and the peroxidase promoter/GUS fusion exhibited little or no suppression of CAT expression by auxin. GUS expression was enhanced by auxin. Two reporter genes controlled by the same promoter exhibited different regulation. Moreover, the effect of auxin on GUS expression was reversed in co­ transformed protoplasts compared to singly transformed protoplasts. GUS expression was suppressed by auxin when only the peroxidase promoter/GUS fusion was transformed into protoplasts. The anomalous results from transient expression experiments with two plasmids under the control of the same promoter are difficult to explain. The dilution of a trans 165 acting factor might be partially responsible for the observed changes. Experiments with an internal standard contained twice as much plasmid DNA as experiments without an internal standard. The same concentration of peroxidase promoter/GUS DNA was used in experiments with and without an internal standard. For experiments containing an internal standard, the peroxidase promoter/CAT DNA was added at equimolar amounts. Dilution of trans acting factors in transient expression is possible and may explain why auxin affected GUS expression differently in singly transformed or co­ transformed protoplasts. Loake et al. reported loss of inducibility of the chalcone synthase promoter when alfalfa protoplasts were co-transformed with a second plasmid containing a portion of the chalcone synthase promoter (23). They attributed this change in gene regulation to dilution of a trans acting factor. Dilution of a trans acting factor does not explain the difference in response to auxin by the two different reporter genes. Others have also observed different expression levels and regulation with different reporter genes fused to the same promoter (24-26). There is growing evidence that promoters can interact with reporter sequences. It is unknown whether these differences arise from competition for trans acting factors, or from differences in RNA stability or translational efficiency. 166 Despite these anomalous results, it is evident that the tobacco anionic peroxidase promoter is complexly regulated by multiple sequence elements. Further work is required to better define the regulatory elements within the TobANPOD promoter and determine how they function in the plant. Likewise, further work is necessary to understand the nature of auxin suppression of this peroxidase isozyme. It is likely that an understanding of the regulation of the tobacco anionic peroxidase gene will provide valuable clues to the function of this enzyme in plants. 167

LIST OF REFERENCES

Lam, Eric; Chua, Nam-Hai (1989). "ASF-2: A Factor that Binds to the Cauliflower Mosaic Virus 35S Promoter and a Conserved GATA Motif in Cab Promoters." Plant Cell. 1, pp. 1147-1156. Lagrimini, L. Mark; Rothstein, Steven (1987). "Tissue Specificity of Tobacco Peroxidase Isozymes and their Induction by Wounding and Tobacco Mosaic Virus Infection." Plant Phvsiol.. 84, pp. 438-442. Kay, Robert; Chan, Amy; Daly, Mark; McPherson, Joan (1987). "Duplication of CaMV 35S Promoter Sequences Creates a Strong Enhancer for Plant Genes." Science. 236, pp. 1299-1302. Intapruk, Chokchai; Yamamoto, Keiji; Sekine, Masami; Takano, Mitsuo; Shinmyo, Atsuhiko (1994). "Regulatory Sequences Involved in the Peroxidase Gene Expression in Arabidopsis thaliana." Plant Cell Reports. 13, pp. 123- 129. Bustos, M. M.; Guiltinan, M. J.; Jordano, J.; Begum, D. ;

Kalkan, F. A.; Hall, T. C. (1989). "Regulation of 6 - Glucuronidase Expression in Transgenic Tobacco Plants by an A/T-Rich, cis-Acting Sequence Found Upstream of a French Bean B-Phaseolin Gene." Plant Cell. 1, pp. 839- 853. Jourdano, J.; Amloguera, C.; Thomas, T. L. (1989). "A Sunflower Helianthinin Gene Upstream Sequence Ensemble Contains an Enhancer and Sites of Nuclear Protein Interaction." Plant Cell. 1, pp. 855-866. Sambrook, J.; Fritsch, E. F.; Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd ed. Plainview, NY: Cold Spring Harbor Laboratory Press, 1989. Conner, T. W.; Goekjian, V. H.; LaFayette, P. R.; Key, J. L. (1990). "Structure and Expression of Two Auxin- Inducible Genes from Arabidopsis." Plant Mol. Biol.. i5, pp. 623—632. 168 9. Nagao, R. T. ; Goekjian, B. H.; Hong, J. C.; Key, J. L. (1993). "Identification of Protein-Binding DNA Sequences in an Auxin-Regulated Gene of Soybean." Plant Mol. Biol.. 21, pp. 1147-1162. 10. Balias, N.; Wong, L.-M.; Theologis, A. (1993). "Identification of the Auxin-Responsive Element, AuxRE, in the Primary Indoleacetic Acid-Inducible Gene, PS- IAA4/5, of Pea (Pisum sativum)." J. Mol. Biol.. 233, pp. 580-596. 11. Kawagoe, Y.; Campbell, B. R.; Murai, N. (1994). "Synergism between CACGTG (G-Box) and CACCTG cis Elements is Required for Activation of the Bean Seed Storage Protein B-Phaseolin Gene." Plant J. . 5, pp. 885-890. 12. Lepetit, Marc; Ehling, Martine; Gigot, Claude; Hahne, Gunther (1991). "An Internal Standard Improves the Reliability of Transient Expression Studies in Plant Protoplasts." Plant Cell Reports. 10, pp. 401-405. 13. Rieping, M. ; Schoffl, F. (1992). "Synergistic Effect of Upstream Sequences, CCAAT Box Elements, and HSE Sequences for Enhanced Expression of Chimaeric Heat Shock Genes in Transgenic Tobacco." Mol. Gen. Genet.. 231, pp. 226-232. 14. Boulikas, T. ; Kong, C. F. (1993). "Multitude of Inverted Repeats Characterizes a Class of Anchorage Sites of Chromatin Loops to the Nuclear Matrix." J. Cell. Biochem.. 53, pp. 1-12. 15. Donald, R. G. K.; Cashmore, A. R. (1990). "Mutation of Either G Box or I Box Sequences Profoundly Affects Expression from the Arabidopsis rbcS-lA Promoter." EMBO J^., 9, pp. 1717-1726. 16. Schulze-Lefert, P.; Becker-Andre, M.; Schulz, W,. ; Hahlbrock, K. ; Dangl, J. L. (1989). "Functional Architecture of the Light-Responsive Chalcone Synthase Promoter from Parsley." Plant Cell. 1, pp. 707-714. 17. Marcotte, W. R,, Jr.; Russell, S. H.; Quatrano, R. S. (1989). "Abscisic Acid-Responsive Sequence from the Em Gene of Wheat." Plant Cell. 1, pp. 969-976. 169 18. Kawagoe, Y.; Murai, N. (1992). "Four Distinct Nuclear Proteins Recognize in vitro the Proximal Promoter of the Bean Seed Storage Protein B-Phaseolin Gene Conferring Spatial and Temporal Control." Plant J.. 2, pp. 927- 936. 19. Boldyreff, Brigitte; Wehr, Klaus; Hecht, Roland; Issinger, Olaf-Georg (1992). "Identification of Four Genomic Loci Highly Related to Casein-Kinase-2-a cDNA and Characterization of a Casein Kinase-2-a Pseudogene Within the Mouse Genome." Biochem. Bioohvs. Res. Commun.. 186, pp. 723-730. 20. Takimoto, Masato; Tomonaga, Takeshi; Matunis, Michael; Avigan, Mark; Krutzsch, Henry; Dreyfuss, Gideon; Levens, David (1993). "Specific Binding of Heterogeneous Ribonucleoprotein Particle Protein K to the Human c-myc Promoter, in vitro." J. Biol. Chem.. 268, pp. 18249- 18258. 21. Hollon, T. ; Yoshimura, F. K. (1989). "Variation in Enzymatic Transient Gene Expression Assays." Anal. Biochem.. 182, pp. 411-418. 22. Leckie, F. ; Devoto, A.; De Lorenzo, G. (1994). "Normalization of GUS by Luciferase Activity from the Same Cell Extract Reduces Transformation Variability." BioTechnioues. 17, pp.52-57. 23. Loake, G. J. ; Choudhary, A. D. ; Harrison, M. J. ; Mavandad, M. ; Lamb, C. J.; Dixon, R. A. (1991). "Phenylpropanoid Pathway Intermediates Regulate Transient Expression of a Chalcone Synthase Gene Promoter." Plant Cell. 3, pp. 829-840. 24. Graves, B. J.; Eisenberg, S. P.; Coen, D. M.; McKnight, S. L. (1985). "Alternate Utilization of Two Regulatory Domains within the Moloney Murine Sarcoma Virus Long Terminal Repeat." Mol. Cell. Biol.. 5, pp. 1959-1968. 25. Scholer, H. R. ; Gruss, P. (1984). "Specific Interaction between Enhancer-Containing Molecules and Cellular Components." Cell. 36, pp. 403-411. 26. Novak, T. J.; Rothenberg, E. V. (1986). "Differential Transient and Long-Term Expression of DNA Sequences Introduced into T-Lymphocyte Lines." DNA. 5, pp. 439- 451. CHAPTER V HISTOLOGICAL AND DEVELOPMENTAL EXPRESSION OF THE TOBACCO ANIONIC PEROXIDASE GENE

Introduction Not much is known about the location and timing of expression of the tobacco anionic peroxidase gene. It is known that the anionic peroxidase is most highly expressed in stem tissue. Both the protein and mRNA of this isozyme are

present in stem pith tissue in significant amounts (1 ,2 ). Anionic peroxidase activity is also found in stem epidermal tissue (3). It is presumed that this isozyme is located in other tissues of the stem. Since the anionic peroxidase has been implicated in lignification, it is thought to be expressed in vascular tissue as well as other lignified cells (4). Localization of this isozyme to vascular tissue, however, is not based on histological evidence, but on its in vitro reactivity to polymerize cinnamyl alcohols into lignin (5) . The anionic peroxidase is also expressed in leaf and root tissue, although in much smaller quantities than found in the stem (1). The tissues of leaf and root that express the anionic peroxidase are unknown.

170 171 Very little is known about the developmental expression of the anionic peroxidase. There is some evidence that tobacco anionic peroxidase activity increases with plant development. Thorpe et al. observed increasing activity of anionic peroxidases from the shoot apex to the base of the stem in tobacco epidermal explants (3). Birecka and Miller

observed a similar increase in activity with tissue age (6 ). Cell wall peroxidase activity in tobacco pith was ten times greater in old internodes compared to young, elongating internodes. Knowledge of the expression of the tobacco anionic peroxidase gene may provide clues to its function. The time and location of its expression in relation to development and physiology of the plant may confirm suspected functions or suggest other roles for this enzyme. Comparison of tobacco anionic expression with lignin formation may help to clarify its role in lignification. Likewise, knowledge of its expression may aid in understanding the relationship of this gene to plant growth. The spatial and temporal expression of the tobacco anionic peroxidase gene were determined by examining the expression of a reporter gene, B-glucuronidase (GUS), placed under the control of the 5' regulatory region of the TobAnPOD gene and stably incorporated in the genome of tobacco plants. Two species of tobacco were transformed with the peroxidase promoter/GUS gene chimera— Nicotiana sylvestris and N. 172

tabacum cv. Xanthi. Both Nicotiana species were used since the anionic peroxidase gene is natively found in both species. The original cDNA and genomic clones of the tobacco

anionic peroxidase were isolated from N. tabacum (2,7). N.

tabacum, however, is an allotetraploid arising from the

interspecific hybridization of N. sylvestris and N.

tomentosiformis over a million years ago (8 ). Although

isolated from N. tabacum, the genomic anionic peroxidase clone originated from N. sylvestris, one of the progenitors of N. tabacum. Transformation of two different species also allowed examination of anionic peroxidase expression in two plants with very different growth habits. N. tabacum is a day neutral plant exhibiting continuous growth until time of

flowering. N. sylvestris is a long day plant that grows as an essentially stemless rosette of leaves until time of flowering when it bolts, producing a 1-1.5 m stem in a few weeks.

Materials and Methods Plasmid construct. A 4.9 kb fragment containing the full peroxidase promoter and the GUS coding region was obtained by digestion of pKK060992 (Figure 15a) with SstI and

Sail. This fragment was inserted with T4 DNA ligase into the

Agrobacterium tumefaciens plasmid, pBI101.2, which had been digested with SstI and Sail (9) . This plasmid, pKK060193 173

(Figure 41), was incorporated into E. coli strain JM109 by a PEG-mediated transformation procedure (10) . Incorporation of the insert was confirmed by restriction enzyme fragment analysis. Stable transformation of tobacco plants. pKK060193 was

stably incorporated into the genomes of N. sylvestris and N.

tabacum cv. Xanthi by Agrobacterium tumefaciens-mediated transformation (11) . pKK060193 was transformed into the E.

coli mating strain S17-1 (12). pKK060193 was transferred to

Agrobacterium tumefaciens strain A136 by conjugation (13).

A136 contains the disarmed Ti helper plasmid pCib542. A 3

day culture of A136 in AB minimal media and an overnight

culture of S17-1 with the pKK060193 plasmid in LB were

individually resuspended in equivalent volumes of N broth ( 8 g nutrient broth/L) and 100 ul of each were spotted on the

center of the same N plate ( 8 g nutrient broth, 15 g agar/L) . Cells were incubated overnight at 28°. Transformed A136 cells were selected by subculturing twice on AB minimal plates with 50 mg/L kanamycin sulfate at 28°.

Young leaves from aseptically grown N. tabacum and N.

sylvestris plants were cut in half and incubated for 3-5 minutes in an overnight culture of pKK060193 in A136. Leaf halves were blotted on sterile filter paper and placed on MS plates for two days at 28° in the dark (14) . Leaf halves were transferred to MS plates with 1 mg/L benzyladenine, 100 mg/L kanamycin sulfate and 500 mg/L carbenicillin under HinD3 jSphl pPstI liSall IjClal jlHinD3 ll|EcoR5 StuI Xbal SstI ill EcoRI HinD3 Smal EcoRI

Figure 41: pKK060193 containing the tobacco anionic peroxidase promoter from -3146 to +71 bps fused to the GUS coding region and NOS terminator in the Agrobacterium tumefaciens plasmid, pBI101.2, containing the NPTII gene for kanamycin resistance. 175 fluorescent lights. Shoots that developed on explants were excised and cultured on MS plates with 100 mg/L kanamycin sulfate and 500 mg/L carbenicillin until roots developed. Six kanamycin-resistant, GUS-active transformants of each species were grown to maturity in the greenhouse on soilless media with a 14 hour day period. Seeds from self-fertilized transgenic plants were germinated on MS plates containing 100 mg/L kanamycin sulfate. Fx kanamycin resistant plants were grown to maturity. Seeds from self-fertilized Fx plants were germinated on MS plates with 100 mg/L kanamycin sulfate to determine zygosity of the Fx parent. Two lines of each Nicotians species with the greatest GUS activity were selected and used for all histological analyses. Histology. Stem and root sections were made with a Lancer series 1000 vibratome. Sections were 150 to 210 uM thick. Leaf, petiole, flower and fruit sections were made by hand. GUS activity was localized using 5-bromo-4-chloro-3-

indolyl-6 -D-glucuronide (X-Gluc) as substrate. Sections were incubated overnight at 37° in a solution of 1 mM X-Gluc, 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide, 10 mM EDTA, 1% DMSO, 0.1% Triton-X 100, and 0.1 M sodium phosphate, pH 7.5 (15). Ascorbate (50 mM) and 2% polyvinyl pyrollidone (MW 360,000) were added to the X-Gluc solution when staining floral or fruit sections to prevent browning (16,17). A saturated aqueous solution of phloroglucinol in 20% HCi was used for lignin staining (18). Lignification was 176 also determined by autofluorescence (19).

Results Nicotians sylvestris and N. tabacum cv. Xanthi were stably transformed with a ,gene chimera composed of the tobacco anionic peroxidase promoter from -3146 to +71 bps fused to the GUS coding region and NOS terminator (Figure 41). Homozygous, F: progeny from two independent transformants of each species were examined in detail for tissue and development specific expression of the GUS chimera. GUS expression was examined in stem, leaf, petiole, root, flower and fruit. No qualitative differences were observed among individual transformants for each species. Differences between the two Nicotians species, however, were observed. TobAnPOD promoter activity and lignification in N. sylvestris and N. tabacum cv. Xanthi stem tissue. N. sylvestris essentially has no stem until flower initiation. It was not possible, therefore, to look at GUS expression in the stem until late in the plant's life cycle when it began to bolt. GUS expression was examined in plants that were in the process of bolting as well as plants that had reached maturity. All N. sylvestris plants exhibited qualitatively similar expression pattern of GUS at all stages of development. 177 The activity of the TobAnPOD promoter in N. sylvestris stems increased quantitatively as well as qualitatively with increased distance from the apex (Figure 42a-i). GUS activity increased basipetally in terms of total amount of GUS activity as well as the number of tissues expressing activity. No GUS activity was evident by X-gluc staining at the very apex of the stem. A few centimeters below the stem apex, GUS activity was evident in both glandular and non- glandular trichomes. Activity was also observed in the epidermis slightly below the region where trichome staining was first observed. Strong GUS activity in trichomes and epidermis was observed in all subsequent sections down the length of the stem. Approximately 5-10% of the distance of the stem down from the apex, expression also was observed in the parenchyma cells immediately adjacent to the primary xylem elements. These primary xylem elements were lignified as evidenced by their ability to autofluoresce upon exposure to UV light. No other cells were lignified at this distance from the apex. About 25% of the distance down the stem, GUS activity had increased substantially. GUS was strongly expressed in trichomes, epidermis and the cells adjacent to primary xylem elements (Figure 42b-d). Lignification of the primary xylem had noticeably increased. GUS activity was also evident in the cell layer below the epidermis, where it was strongly expressed, as well as in pith tissue. GUS expression in pith Figure 42: GUS activity and autofluorescence of stem (a-j) and root (k-p) cross-sections from N. sylvestris (a-i,k-n) and N. tabacum cv. Xanthi (j, o-p) plants transformed with the -3146 peroxidase promoter/GUS fusion. Location of sections are given as a percentage of stem height from the stem apex. a. GUS staining of parenchyma adjacent to primary xylem at 40% of the distance from apex. b. GUS staining of parenchyma adjacent to primary xylem at 25% distance from apex. c. Autofluorescence of b showing lignification of primary xylem. d. GUS staining of trichomes, epidermis and subepidermal cells at 25% the distance from the apex. e. GUS staining in starch sheath, pericycle and vascular rays at 80% of the distance from apex, f. Autofluorescence of e showing lignification of pericyclic fibers and secondary xylem. g. GUS staining of trichomes, epidermis, cortex, starch sheath and pericycle at the base of the stem. h. GUS staining of starch sheath, pericycle and phloem rays at the base of the stem. i. GUS staining of pith tissue and parenchyma adjacent to primary xylem at the base of the stem, j . GUS staining evident only in trichomes at the base of N. tabacum cv. Xanthi stem. k-1. GUS activity surrounding the base of lateral roots in young roots of N. sylvestris. m-n. GUS activity in the cortex and vascular rays of a N. sylvestris root located near the crown, o. GUS activity in the cortex and vascular rays of a medium sized (3-4 mm diameter) N. tabacum cv. Xanthi root. p. GUS activity in the cortex and vascular rays of a large (7-8 mm diameter) N. tabacum cv. Xanthi root near the crown of the plant. GUS activity is greater in the region surrounding a lateral root.

178 179

Figure 42 180 was light and was not evident in all cells. Cells exhibiting GUS activity were scattered throughout the pith. Approximately 40% down the length of the stem, GUS activity was observed in more tissues. Intense staining was observed in the outermost 1-2 cell layers of the cortex. Moderate activity was observed in the starch sheath, the innermost cell layer of the cortex. Most, but not all, cells of the starch sheath, expressed GUS activity. Very light activity was observed in the rays of the secondary xylem. Activity was greatest about 4-5 cell layers inside of the vascular cambium. No lignification of the secondary xylem was evident. Scattered, light GUS activity was also observed in the region around phloem elements. About half way down the length of the stem, the intensity of GUS staining had increased in all the GUS- containing tissues described above. Particularly noticeable were increases in activity in the starch sheath, pith, rays of the secondary xylem and cells of the phloem region. The cells of the phloem region that contained GUS activity were clearly rays that initiated from the same cambial cells as the xylem rays and extended into the pericycle. Additional GUS activity was observed in scattered cells of the cortex. Very strong activity was observed in the outermost 2-3 cell layers of the cortex, just below the epidermis. Lignification of the secondary xylem was observed for the first time at this height of the stem. Lignification was 181 evident in the newer xylem elements about 2-3 cell layers inside the vascular cambium. GUS expression continued to increase with increased distance from the shoot apex. 75 to 80% percent down the distance of the stem, the pattern of GUS expression was essentially the same as observed at the mid-height of the stem, although the intensity of GUS activity had increased. GUS activity was intense in the trichomes, epidermis and the 2-3 cell layers below the epidermis. More cells of the cortex were exhibiting GUS activity and the intensity of GUS staining in these cells was greater than was observed in sections higher on the stem. All cells of the starch sheath contained GUS activity and the amount of GUS activity per cell had also increased (Figure 42e-f). Lignified fibers were evident in the pericycle. Lignified fibers were not found in previously described sections higher on the stem. The parenchyma cells surrounding these fibers exhibited light GUS activity. The secondary xylem was highly lignified. Lignification extended from a few cell layers inside the vascular cambium through the primary xylem. As before, light GUS activity was observed in the vascular rays. GUS activity in the rays was greatest just inside of the vascular cambium at approximately the same centripetal level as where xylem elements first exhibited lignification. GUS activity in the phloem, primary xylem and pith were essentially unchanged from stem sections taken at mid-height. 182 The greatest GUS activity was observed at the base of the stem (Figure 42g-i). Very intense GUS staining was observed in the trichomes, epidermis, the outermost 2-3 cell layers of the cortex, the starch sheath and 1-3 cell layers inside the starch sheath. Moderate activity was observed throughout the cortex and the pith, although not every cell exhibited activity. Activity in the pith was somewhat greater than that observed in the cortex. In the pericycle, rays of the phloem stained for GUS activity. GUS activity extended centrifugally from the phloem rays into the outermost cell layers of the pericycle. Activity continued to be observed in the cells surrounding pericyclic fibers. Interxylary rays exhibited low levels of GUS activity. The cells surrounding primary xylem elements exhibited moderate GUS activity— a decline in activity from sections higher on the stem. This was the only region that exhibited a decline in activity at this stage of development. The pattern of GUS expression in N. tabacum cv. Xanthi was similar to that of N. sylvestris stems, although the amount of activity was substantially less. The TobAnPOD promoter exhibited surprisingly little activity in N. tabacum cv. Xanthi stem tissue (Figure 42j). Xylem lignification, however, was greater and occurred much earlier, developmentally, in this species than in N. sylvestris. GUS expression was examined in plants at different stages of development. Similar levels and pattern of GUS expression and lignification were observed in all cases. GUS activity was not detected in any tissues at the very apex of plants. One centimeter below the shoot apex, light to moderate GUS activity was evident in trichomes and epidermis. GUS activity was greatest in larger trichomes. Smaller trichomes exhibited only light GUS activity. GUS was expressed in both glandular and non-glandular trichomes, although activity was greatest in the head of glandular trichomes. In the epidermis, less than half of the cells exhibited activity. The innermost primary xylem elements were lignified at this stage of development. No GUS activity was detected near the primary xylem elements. About 25% of the distance from the apex to the crown of the plant, GUS activity did not increase substantially. Trichome and epidermal staining was similar to that observed at 1 cm from the apex, although GUS activity had increased slightly in the head of glandular trichomes. A few faint traces of GUS activity could be detected in the parenchyma cells adjacent to the oldest primary xylem elements. All primary xylem elements were lignified and the beginning of secondary xylem lignification was evident just internal to the vascular cambium. Approximately 40% down the length of the stem, GUS activity had increased in the head of glandular trichomes and in the epidermis. Although the head of trichomes stained 184 the stalk of glandular trichomes or in non-glandular trichomes. Epidermal GUS activity increased in intensity. The number of epidermal cells expressing activity increased slightly. GUS activity in the cells adjacent to primary xylem elements was the same as observed above. All primary and secondary xylem was lignified. Three-quarters of the distance down the stem, there was a slight increase in GUS activity. Epidermal cells that stained for GUS activity did so intensely. There appeared to be no increase, however, in the number of epidermal cells expressing GUS activity. GUS activity in the cells surrounding primary xylem elements had increased slightly and extremely light, barely detectable, activity was observed in the rays of the xylem over their entire length. Trichome activity was unchanged. At the base of the plant, activity in trichomes appeared to be reduced. Moderate activity was observed in the head of glandular trichomes. GUS activity in all other tissues was essentially the same or slightly reduced from sections taken at three-quarters height. GUS activity was never detected in the cortex, pericycle or pith tissue at any stem height, at any developmental stage in N. tabacum cv. Xanthi. TobAnPOD promoter activity in N. sylvestris and N. tabacum cv. Xanthi leaf and petiole tissue. The pattern of GUS activity in the leaves and petioles of both Nicotiana species reflected the activity observed in their respective 185 stem tissues. The amount of GUS activity in leaf and petioles, however, was considerably less than in stem tissue. For both Nicotiana species, the amount of GUS activity was dependent on the position of the leaf on the plant. Leaves positioned at the base of the stem had greater GUS activity than those at the top of the stem. Greater activity was also observed in mature, fully expanded leaves compared to immature leaves. GUS activity was observed in the trichomes and epidermis for both N. sylvestris and N. tabacum. In general activity was greater in leaves of N. sylvestris than N. tabacum. Significantly more activity was observed in the lower epidermis than the upper epidermis for both species. A majority of epidermal cells on the lower epidermis exhibited GUS activity. Stomata were free of GUS activity. Fewer cells of the upper leaf epidermis expressed GUS, and GUS- expressing cells were almost always adjacent to a stoma. Some GUS staining of vascular tissue was observed in the mid­ rib of N. sylvestris. The parenchyma cells surrounding the oldest primary xylem elements exhibited GUS activity. TobAnPOD promoter activity in petioles was similar to its activity in stems. The number of tissues expressing GUS activity and the intensity of that expression was correlated with development. Mature petioles of N. sylvestris exhibited strong GUS activity in trichomes, epidermis and the 1-2 layers of ground tissue beneath the epidermis. A starch 186 sheath completely enclosing the vascular tissue was evident. All cells of the starch sheath showed moderate GUS expression. Interxylary rays had light to moderate GUS expression. GUS expression was observed in the rays of the phloem in some sections. The cells adjacent to primary xylem elements consistently had strong GUS activity. Moderate GUS activity was also observed in scattered cells of the ground tissue in petioles of old leaves. Petioles of transformed N. tabacum cv. Xanthi had much less activity than petioles of N. sylvestris. GUS activity was found primarily in the trichomes and epidermis. Although moderate activity was observed in the cells that expressed GUS, the majority of trichomes and epidermal cells showed no GUS staining. Occasionally, faint staining in the cells surrounding primary xylem elements was observed. It was more common, however, to detect no GUS activity in the vascular tissue. TobAnPOD promoter activity in N. sylvestris and N. tabacum cv. Xanthi root tissue. TobAnPOD promoter activity was essentially the same, quantitatively and qualitatively, in N. sylvestris and N. tabacum cv. Xanthi roots (Figure 42k- p) . In general, GUS expression increased with the size of the root and its distance from the root tip. No activity was observed at the root tip or in very young roots. It was not until roots were sufficiently mature to form lateral roots that any GUS activity was detected. GUS activity was 187 detected in the cortex of the primary root surrounding the region where a lateral root was emerging or had emerged (Figure 42k-l). Moderate to strong staining was observed in 1-2 cell layers encircling the lateral root. With greater distance from the root tip, GUS activity was evident in the cortex and was not associated solely with lateral roots. Staining in the cortex was not continuous. Roots in the primary state of growth exhibited regions of strong cortical staining interrupted by regions with no GUS activity. Roots exhibiting secondary growth, that is, roots with distinct vascular and cork cambiums, had GUS activity in the cortex as well as in vascular rays (Figure 42m-p). Not all cells of the cortex exhibited GUS activity. In general, activity in the cortex was greater in the outermost cell layers in terms of the percentage of cells exhibiting activity and the intensity of staining. The percentage of cells with GUS activity increased with the diameter of the root and proximity to the crown of the plant. In the largest roots, just below the crown of the plant, nearly all cortical cells contained GUS activity. GUS activity was observed in the rays of xylem and phloem. Light GUS activity was seen in the interxylary rays in all stages of secondary growth that were observed. Activity was greatest in the cell layers just below the vascular cambium. GUS activity was detected only in the outermost cells of the xylem rays in the early stages of 188 secondary growth. With increasing root size, GUS activity was observed throughout the entire length of the ray extending from the vascular cambium to the primary xylem. Moderate GUS activity was observed in the cells surrounding primary xylem elements in N. sylvestris. No GUS activity around the primary xylem elements was observed in N. tabacum cv. Xanthi, although primary and secondary xylem were lignified in older roots of both species. The rays of the phloem exhibited GUS staining only in the older, larger roots of both Nicotiana species. GUS activity was observed extending from the vascular cambium through the entire region of the phloem. In general, GUS activity was greater in all GUS-expressing tissues— cortex and vascular rays— surrounding lateral roots (Figure 42p). Overall, the tobacco anionic peroxidase promoter was not highly expressed in roots. Tobacco has a fibrous root system. The majority of the root mass, therefore, is comprised of roots in which the TobAnPOD promoter has little activity. Larger roots, which exhibited considerable GUS activity, comprise only a small portion of the total root system. TobAnPOD promoter activity in N. sylvestris and N. tabacum cv. Xanthi reproductive tissue. GUS expression regulated by the TobAnPOD promoter was similar in N. sylvestris and N. tabacum cv. Xanthi flowers and fruits. In general, activity of the TobAnPOD promoter increased with 189 flower development from bud to anthesis. GUS activity increased substantially after anthesis in the amount of activity and the tissues expressing it. Further changes in GUS expression were evident with development of the fruit. Activity in unopened flower buds and pre-anthesis flowers was observed predominantly in the sepals and petals (Figure 43a). In young buds, GUS activity occurred in the trichomes and epidermis of sepals and the trichomes of petals. GUS expression in the sepal was greatest at the base of the flower. Little to no activity was observed in the distal regions of the sepal in very young buds. Both sepals and petals were covered with GUS-expressing glandular trichomes. Greater GUS activity was observed in the head of the trichome than in the stalk. GUS expression increased as flowers developed to maturity. Activity in the sepal increased substantially. Trichomes and epidermis of the sepal exhibited increased GUS activity extending the entire length of the sepal. GUS activity was also observed in the ground tissue of sepals. The outer cell layers of ground tissue just beneath the epidermis stained intensely for GUS activity. Moderate GUS activity was observed in the internal ground tissue. Vascular traces leading into the floral receptacle and the sepal in N. tabacum cv Xanthi exhibited light GUS activity. N. sylvestris exhibited light to moderate GUS activity throughout the receptacle with greater activity surrounding Figure 43: GUS activity in flower and fruit of N. sylvestris and N. tabacum cv. Xanthi plants transformed with the -3146 peroxidase promoter/GUS fusion. a-b. GUS activity of a N. tabacum flower before anthesis (a) and after fertilization (b) . c-d. GUS staining in the stigma of N. sylvestris at anthesis (c) and after fertilization (d) . e. GUS staining in the style of N. tabacum after fertilization. f-g. GUS staining in N. tabacum filament. Staining underlies breaks in the cuticle (g). h. GUS staining where the pollen sacs connect and the top of the filament in N. sylvestris stamen at anthesis. i-j. GUS staining in the developing seed capsule and embryos (j) of N. sylvestris. k. GUS staining in a seed capsule of N. tabacum.

190 191

h.'j $

Figure 43 192 the vascular traces. GUS activity in the petal did not noticeably change with development to anthesis in either Nicotiana species. GUS activity was observed in the pollen of both species, although only a minority of the pollen grains stained. The intensity of staining differed among different pollen grains. A gradient of staining intensity from none to moderate intensity was observed and may be correlated with pollen grain maturity. GUS expression in pollen, however, may not be due to TobAnPOD promoter activity. Ectopic expression of GUS in pollen has been reported. Uknes et al. observed GUS activity in pollen that was unrelated to promoter activity and increased with the maturation of the pollen (20). They suggest that the GUS coding region is responsible for GUS expression in pollen. Despite the similar GUS expression patterns in N. sylvestris and N. tabacum at anthesis as described above, two differences were noted. The papillae of the stigma of N. sylvestris exhibited very light GUS expression (Figure 43c) . No such GUS activity was observed in N. tabacum. Unique expression was also observed in the filament of the stamen of N. tabacum cv. Xanthi. Multiple bands of intense GUS activity were observed completely encircling the filament slightly below the junction of the filament and anther (Figure 43f-g). Lighter GUS activity was sometimes observed between and surrounding these bands. Close inspection 193 revealed a circumscissile break in the cuticle that coincided with the rings of GUS staining. The cause or significance of these breaks in the cuticle and the underlying activity of the TobAnPOD promoter is unknown. It is possible that the cuticular breaks occurred from mechanical stress on the filament during flower development. Anthers of N. tabacum cv. Xanthi were folded over in the bud such that the upper portion of the filament was bent into a hook-like shape. Anthers of N. sylvestris were not bent over in this manner during flower development. No cuticular breaks and the associated GUS activity were observed in stamens of N. sylvestris at any stage of development. A large change in GUS expression occurred after flower anthesis (Figure 43b) . Not only did the level of GUS expression increase substantially, but tissues that previously did not express GUS now expressed it in significant amounts. Sepals exhibited intense staining in trichomes, epidermis and ground tissue in a similar pattern to anthesis-stage sepals. Petals of both species showed GUS expression in new tissues. Petals of N. tabacum exhibited GUS activity in the trichomes and epidermis. Petals of N. sylvestris exhibited GUS activity in the trichomes and ground tissue, but not in the epidermis. Minor differences in GUS expression were also observed in the stamens of the two tobacco species. Light GUS activity was observed at the base of stamen filaments of both 194 species. In N. tabacum this activity was limited to trichomes. Filaments of N. sylvestris were devoid of trichomes and GUS activity at the base of filaments was observed in the filament proper. Bands of GUS activity near the top of filaments were still evident in N. tabacum cv. Xanthi and did not noticeably change after anthesis. Anthers of N. tabacum cv. Xanthi were nearly free of any GUS activity. GUS activity was observed only at the very tip of the anther in some stamens. Stamens of N. sylvestris exhibited slight GUS activity in the upper portion of filaments and in the few cell layers where the two pollen sacs of the anther join (Figure 43h). This activity was not observed in N. tabacum. The largest increase in GUS activity after anthesis occurred in the gynoecium. In N. sylvestris, regions of intense GUS activity were observed on the stigma (Figure 43d) . All tissues of the style except the epidermis and central transmitting tissue exhibited moderate GUS activity. In N. tabacum cv. Xanthi, no activity was detected in the stigma. All tissues of the style except the transmitting tissue exhibited moderate GUS activity (Figure 43e). Unlike N. sylvestris, the epidermis of the style stained with equal intensity as the underlying ground tissue. Moderate GUS activity was observed throughout the pericarp, that is, the ovary wall which was to develop into the capsule (Figure 43i). In N. tabacum, the greatest activity occurred in the 195 inner pericarp which contained a layer of darkly staining cells located 5-6 cell layers from the innermost ovary wall. Strong GUS activity was observed in the central ovary tissue at the vascular traces in both species. Light GUS activity was observed in the developing embryos and appeared to be developmentally regulated (Figure 43j). GUS was not expressed in very young embryos. Further changes in GUS expression occurred with the development of the seed capsule (Figure 43k) . Most GUS activity was associated with the pericarp. GUS activity was greatest in the outermost 3-4 cell layers of exocarp and endocarp.as well as at the major vascular traces. Within the capsule, light GUS activity was observed in the outermost vascular tissue of the placenta in regions where it connected with developing seeds. No GUS expression was observed in the developing seeds which had clearly formed seed coats.

Discussion The tissue and developmental specific expression of the tobacco anionic peroxidase promoter was determined using tobacco plants stably transformed with approximately 3 kb of the peroxidase promoter fused to the GUS coding region and NOS terminator. GUS activity was used as an indicator of promoter activity to localize TobAnPOD expression spatially and temporally. TobAnPOD promoter activity was determined in two species of tobacco, Nicotiana sylvestris and N. tabacum 196 cv. Xanthi. All organs of both species were examined for GUS activity at different stages of development. The two species exhibited very similar patterns of expression both spatially and temporally, although some differences were noted. From detailed study of the expression of the tobacco anionic peroxidase gene, general trends emerged. The location and time of expression also provided clues to possible functions for the anionic peroxidase in tobacco plants. TobAnPOD promoter activity was not specific for a particular tissue type or organ. Rather, the TobAnPOD promoter directed expression in all organs, in practically all tissue systems at some stage of their development. Expression, of course, was not observed in every cell of these organs and tissue systems. GUS activity was observed in the epidermis, ground tissues and vascular tissues of the aerial portions of the plant. GUS activity was observed in all tissues of the root except the epidermis. Although all organs of the plant exhibited GUS activity, not all tissue systems of every organ expressed GUS. TobAnPOD promoter activity was highly regulated developmentally and spatially. This was observed in all organs of the plant. Expression was differentially regulated not only among the organs and tissues of a plant, but even among the individual cells of a tissue. Expression levels and patterns were clearly related to the development of the plant. Little activity was observed in young plants or young 197 tissue. GUS activity was greatest in mature plants and mature tissues. At any stage of development, TobAnPOD promoter activity increased with distance from the apex. This was observed quantitatively by the intensity of GUS staining as well as qualitatively in the number of tissues expressing GUS activity. This was most evident in the stem and root, but occurred in all organs, even flowers, which exhibited greater activity at their base. It is unknown if this gradient of expression is related to tissue age, developmental state, or concentration of a plant growth regulator. It is possible that some of the increase in GUS activity was correlated with age of the tissue and could be attributed to the accumulation of a stable protein steadily expressed throughout the life of the tissue. Enzyme accumulation, however, c^n not account for all increases in activity. Activity increases were often dramatic and occurred in tissues that previously exhibited no GUS activity. Maturation, and not just tissue age, may also be a factor in regulation of GUS expression. The observed pattern of expression could also be explained by hormonal regulation of the TobAnPOD promoter. TobAnPOD promoter activity was generally observed to be inversely correlated with auxin levels in the plant. Little or no GUS activity was observed in young stem or leaf tissue where auxin levels are greatest. Likewise, no GUS activity was detected in root tips where auxin levels are high. 198 Greatest GUS activity in the shoots and roots occurred near the crown of the plant where auxin levels are lowest. GUS activity in leaves and petioles also correlated inversely with auxin concentration. GUS activity was noticeably greater in older leaves and leaf petioles at the base of plants than young leaves and petioles located at the top. This same inverse correlation with auxin concentration was observed at the tissue level. Greatest GUS activity in the shoot was nearly always found in the epidermis. Auxin levels are lower in the epidermis than in the underlying tissue (21). This relationship between the TobAnPOD promoter activity and auxin levels, however, was not universal throughout the plant. GUS expression in floral tissues were not inversely related to auxin levels. Auxin levels increase in the style and ovary after fertilization, yet GUS activity increased in these organs after fertilization (22,23). The location and time of expression of the tobacco anionic peroxidase suggests possible roles for this enzyme in plants. Its presence in the trichomes and epidermis of the aerial portions of plants, at nearly all stages of development, suggest that this enzyme may have a role in defense. Trichomes are thought to hinder insect feeding and glandular trichomes are thought to be involved in the chemical defense of the plant (24). The epidermis is also specialized to guard against pathogen attack, and together with the trichomes are the plants first line of defense. 199 Peroxidase in these cells may defend plants against pathogens passively and actively. Peroxidase may passively protect a plant by strengthening the outermost cell walls of epidermis and trichomes, making the epidermis more impenetrable to invading pathogens and the trichomes more rigid and bothersome to insects. Peroxidases may also actively defend a plant by the cross-linkage of pathogen cell walls during penetration, creation of toxic compounds or oxidation of compounds important for the pathogen's metabolism (25). A role for the tobacco anionic peroxidase in cell wall lignification and strengthening is also supported by the pattern of expression observed. The role of the anionic peroxidase in lignification, however, appears to be a limited one. A correlation between TobAnPOD promoter activity and lignification of primary xylem and pericyclic fibers was observed in N. sylvestris. The TobAnPOD promoter was strongly active in the parenchyma adjacent to primary xylem elements and moderately active in the cells surrounding pericyclic fibers at the time that lignification was observed. Lignification, if catalyzed by this enzyme, occurred external to the lignified cell by peroxidase secreted into the apoplast by adjacent cells . Such a pattern of expression would permit lignification of dead and evacuated cells. No GUS activity was observed in any cells that were lignified or destined to be lignified. 200 Not all lignification could be correlated with adjacent TobAnPOD activity. In secondary xylem of N. sylvestris, GUS activity was observed at the same time and location as lignification, but the activity was extremely weak. As before, GUS activity was not observed in the lignified cells but in the adjacent parenchyma. It is unlikely that TobAnPOD promoter activity surrounding secondary xylem elements was sufficient to account for the extent of lignification observed in secondary xylem. In N. tabacum cv. Xanthi, no correlation was observed between TobAnPOD promoter activity and lignification. Both primary and secondary xylem of stems were lignified in all but the earliest stages of development, yet no associated GUS activity was observed. GUS activity was negligible in all lignified tissues at all developmental stages. The lack of TobAnPOD promoter activity in the stem tissue of N. tabacum, however, was not a true reflection of tobacco anionic peroxidase expression. TobAnPOD mRNA and protein have been detected in appreciable amounts in stem pith tissue of N. tabacum (1,2). The absence of TobAnPOD promoter activity in N. tabacum may be related to its genetics. N. tabacum is an allotetraploid formed by the interspecific hybridization of N. sylvestris and N. tomentosiformis over a million years ago (8). The TobAnPOD promoter, although isolated from N. tabacum, originated in the N. sylvestris progenitor of N. tabacum. It is 201 conceivable that the anionic peroxidase gene originating from N. sylvestris is not active in N. tabacum stem tissue. The anionic peroxidase mRNA and protein found in stem is likely to be formed exclusively by the anionic peroxidase gene derived from the N. tomentosiformis genome. The tobacco anionic peroxidase gene is, therefore, differentially regulated in the two N. tabacum progenitors. Dominance of the N. tomentosiformis genome in N. tabacum stems is evidenced by the growth habit of N. tabacum. Both N. tabacum and N. tomentosiformis have the same pattern of continuous stem growth throughout development. N. sylvestris, in contrast, exhibits minimal stem growth until the initiation of flowering when the stem bolts. Even if the role of the tobacco anionic peroxidase in lignification is uncertain, it is likely that this isozyme is involved in cell wall strengthening. The TobAnPOD promoter was active in and around tissues or cells with unique cell wall mechanical properties. The peroxidase promoter was highly active in the epidermis, the developing seed capsule, and the cells surrounding stomata and primary xylem. The cell walls of these structures are specialized to permit their unique functions in the plant and are generally thicker and stronger than the cell walls of most other cells (26). Epidermal cell walls are approximately ten-fold thicker than most other cells in the plant and withstand tension from the internal tissues (27,28). Stomata also have regions of their 202 cell walls that are thickened and are thought to be load- bearing (26). Likewise, the seed capsule and primary xylem are comprised of cells with thickened walls and are specialized to withstand mechanical stress (2 6). TobAnPOD promoter activity was clearly greater in other regions under mechanical stress, such as the cortical cells surrounding lateral roots, and the upper portion of the stamen filament in N. tabacum cv. Xanthi. A role for the tobacco anionic peroxidase in growth regulation can also be inferred from the observed time and location of its expression. The tobacco anionic peroxidase may limit growth by reducing cell wall plasticity through the cross-linking of cell wall components. Many studies have shown a correlation between cell wall peroxidase activity and the cessation of growth (29-31). TobAnPOD expression was inversely correlated with growth and development in the aerial portions of the plant. No expression was observed at the apical meristem where cell expansion was greatest. GUS activity became evident in epidermal tissue a few centimeters below the apex and increased with distance from the stem apex. Greatest GUS activity was observed in mature, fully developed regions of the stem, pedicels and leaves. The location of TobAnPOD expression in the epidermis further supports a role for this enzyme in growth cessation. The outer cell wall of the epidermis is thought to control growth of organs (28,32). The expansion of an organ is limited by 203 the growth and extensibility of the epidermis. The tobacco anionic peroxidase may have other unknown functions in plants. The proposed functions of plant defense, cell wall strengthening and control of growth do not adequately explain the activity observed in all tissues. The purpose of the tobacco anionic peroxidase in the root cortex, the starch sheath and pith of stem, and post-anthesis styles is unknown. Yet, its expression in these tissues is likely to be important. Tobacco plants allocate significant resources to produce this enzyme in these tissues. Clearly, the function of the tobacco anionic peroxidase is as complex as its temporal and spatial pattern of expression. 204

LIST OF REFERENCES 1. Lagrimini, L. Mark; Rothstein, Steven (1987). "Tissue Specificity of Tobacco Peroxidase Isozymes and Their Induction by Wounding and Tobacco Mosaic Virus Infection." Plant Phvsiol.. 84, pp. 438-442. 2. Lagrimini, L. Mark; Burkhart, William; Moyer, Mary; Rothstein, Steven (1987). "Molecular Cloning of Complementary DNA Encoding the Lignin-Forming Peroxidase from Tobacco: Molecular Analysis and Tissue-Specific Expression." Proc. Natl. Acad. Sci.. 84, pp. 7542-7546. 3. Thorpe, T. A.; Tran Thanh Van, M.; Gaspar, T. (1978). "Isoperoxidases in Epidermal Layers of Tobacco and Changes during Organ Formation in vitro." Phvsiol. Plant.. 44, pp. 388-394. 4. Grisebach, H. (1981). "Lignins." In The Biochemistry of Plants, pp. 451-478. Edited by E. E. Conn. New York: Academic Press, Inc., 1981. 5. Mader, M. ; Nessel, A.; Bopp, M. (1977). "Uber die Physiologische Bedeutung det Peroxidase-Isoenzym-Gruppen des Tabaks anhand eineger Biochemischer Eigenschaften. II. pH-Optima, Michaelis-Konstanten, Maximale Oxidationsraten." Z. Pflanzenohvsiol. Bd. . 82, pp. 247- 260. 6. Birecka, H.; Miller, A. (1974). "Cell Wall and Protoplast Isoperoxidases in Relation to Injury, Indoleacetic Acid, and Ethylene Effects." Plant Phvsiol.. 53, pp. 569-574. 7. Diaz-De-Leon, F.; Klotz, K. L.; Lagrimini, L. M. (1993). "Nucleotide Sequence of the Tobacco (Nicotiana tabacum) Anionic Peroxidase Gene." Plant Phvsiol.. 101, pp. 1117-1118. 8. Okamuro, J. K.; Goldberg, R. (1985). "Tobacco Single- Copy DNA is Highly Homologous to Sequences Present in the Genomes of its Diploid Progenitors." Mol. Gen. Genet.. 198, pp. 290-298. 205 9. Jefferson, R. A.; Kavanagh, T. A.; Bevan, M. W. (1987). "GUS Fusions: B-Glucuronidase as a Sensitive and Versatile Gene Fusion Marker in Higher Plants." EMBO J. . 6, pp. 3901-3907. 10. Promeaa Protocols and Application Guide. 2nd ed. . p.95. Madison, WI: Promega Corp., 1991. 11. Rothstein, S. J.; Lahners, K. N. ; Lotstein, R. J. ; Carozzi, N. B.; Jayne, S. M. ; Rice, D. A. (1987). "Promoter Cassettes, Antibiotic-Resistant Genes, and Vectors for Plant Transformation." Gene. 53, pp. 153- 161. 12. Chung, C. T. ; Niemela, S. L. ? Miller, R. H. (1989). "One-Step Preparation of Competent Escherichia coli: Transformation and Storage of Bacterial Cells in the Same Solution." Proc. Natl. Acad. Sci. USA. 86, pp. 2172-2175. 13. Simon, R. ; Priefer, U. ; Puhler, A. "Vector Plasmids for in vivo and in vitro Manipulation of Gram-Negative Bacteria." In Genetics of the Bacteria-Plant Interaction, pp. 98-106. Edited by A. Puhler. Berlin: Springer-Verlag, 1983. 14. Murashige, T. ; Skoog, S. (1962). "A Revised Medium for Rapid Growth and Bioassays with Tobacco Tissue Cultures." Phvsiol. Plant.. 15, pp. 473-497. 15. Stomp, A-M. "Histochemical Localization of B- Glucuronidase." In GUS Protocols: Using the GUS Gene as a Reporter of Gene Expression, pp. 103-113. Edited by Sean R. Gallagher. San Diego: Academic Press, Inc., 1992. 16. Craig, Stuart. "The GUS Reporter Gene— Application to Light and Transmission Electron Microscopy." In GUS Protocols: Using the GUS Gene as a Reporter of Gene Expression, pp. 115-124. Edited by Sean R. Gallagher. San Diego: Academic Press, Inc., 1992. 17. Martin, T.; Wohner, R-V; Hummel, S.; Willmitzer, L.; Frommer, W. B. "The GUS Reporter System as a Tool to Study Plant Gene Expression." In GUS Protocols: Using the GUS Gene as a Reporter of Gene Expression, pp. 23- 43. Edited by Sean R. Gallagher. San Diego: Academic Press, Inc., 1992. 206 18. Jensen, William A. Botanical Histochemistry; Principles and Practice. San Francisco: W. H. Freeman & Co., 1962, p. 205. 19. Harris, P. J. ; Hartley, R. D. (1976). "Detection of Bound Ferulic Acid in Cell Walls of the Gramineae by Ultraviolet Fluorescence Microscopy." Nature, 259, pp. 508-510. 20. Uknes, S.; Dincher, S.; Friedrich, L. ; Negrotto, D.; Williams, S.; Thompson-Taylor, H.; Potter, S.; Ward, E.; Ryals, J. (1993). "Regulation of Pathogenesis-Related Protein-la Gene Expression in Tobacco." Plant Cell. 5, pp. 159-169. 21. McKay, J. J. ; Ross, J. J. ; Lawrence, N. L. ; Cramp, R. E.; Beveridge, C. A.; Reid, J. B. (1994). "Control of Internode Length in Pi sum sativum: Further Evidence for the Involvement of Indole-3-Acetic Acid." Plant Phvsiol.. 106, pp. 1521-1526. 22. Muir, R. M. (1942). "Growth hormones as related to the setting and development of fruit in Nicotians tabacum." Am. J . Bot.. 29, pp. 716-720. 23. Muir, R. M. (1947). "The Relationship of Growth Hormones and Fruit Development." Proc. Natl. Acad. Sci.. USA. 33, pp. 303. 24. Levin, D. A. (1973). "The Role of Trichomes in Plant Defense." Quart. Rev. Biol.. 48, 3-15. 25. Moerschbacher, B. M. "Plant Peroxidases: Involvement in Response to Pathogens." In Plant Peroxidases 1980- 1990: Topics and Detailed Literature on Molecular. Biochemical, and Physiological Aspects, pp. 91-99. Edited by C. Penel, Th. Gaspar, H. Greppin. Geneva: University of Geneva, 1992. 26. Esau, Katherine Anatomy of Seed Plants. 2nd ed. New York: John Wiley & Sons, 1977. 27. Fry, Stephen C. The Growing Plant Cell Wall: Chemical and Metabolic Analysis. Essex, UK: Longman Scientific and Technical, 1988. 28. Bret-Harte, M. Syndonia (1993). "Total Epidermal Cell Walls of Pea Stems Respond Differently to Auxin than does the Outer Epidermal Wall Alone." Planta. 190, pp. 379-386. 207 29. MacAdam, J. W.; Nelson, C. J.; Sharp, R. E. (1992). "Peroxidase Activity in the Leaf Elongation Zone of Tall Fescue. I. Spatial Distribution of Ionically Bound Peroxidase Activity in Genotypes Differing in Length of the Elongation Zone." Plant Phvsiol.. 99, pp. 872-878. 30. Goldberg, R.; Inberty, A.; Chu-Ba, J. (1986). "Development of Isoperoxidases along the Growth Gradient in the Mung Bean Hypocotyl." Phytochemistry. 25, pp. 1271-1274. 31. Gardiner, M. G. ; Cleland, R. (1974). "Peroxidase Changes during the Cessation of Elongation in Pisum sativum Stems." Phytochemistry. 13, pp. 1095-1098. 32. Bret-Harte, M. S.; Talbott, L. D. (1993). "Changes in Composition of the Outer Epidermal Cell Wall of Pea Stems during Auxin-Induced Growth." PIanta. 190, pp. 369-378. CHAPTER VI DISCUSSION

A study into the regulation and expression of the tobacco anionic peroxidase was undertaken to provide clues to its function in plants. Several roles have previously been proposed for the tobacco anionic peroxidase. Based on its location in the cell wall and its in vitro reactivity, it has been suggested that this peroxidase isozyme is involved in the cross-linking of cell wall components, lignification and/or auxin catabolism. None of these functions, however, have been unequivocally established. The limited understanding of this enzyme arises from the difficulty of studying any peroxidase isozyme. Peroxidases lack the substrate specificity that is the hallmark of most enzyme-catalyzed reactions. Peroxidases are capable of reacting with numerous plant compounds in vitro. It is unknown which of these compounds are actually substrates for peroxidase in vivo. Peroxidase studies are further confounded by the number of peroxidase isozymes found in plants. Peroxidases occur in plants as multiple isozymes. Different isozymes have different expression patterns, regulation and reactivities, and they are thought to have

208 209 different functions in the plant. Yet, peroxidase isozymes are similar enough that separation of their individual activities is difficult by biochemical or physiological means. A molecular biology approach was taken to study the expression and regulation of the tobacco anionic peroxidase. Transforming plants or cells with a gene in which the peroxidase coding region had been replaced by the coding region of a reporter gene (GUS) made it possible to separate the expression of the tobacco anionic peroxidase from other tobacco peroxidase isozymes. Stable transformation of this gene chimera into tobacco plants and analysis of these plants for reporter gene activity allowed determination of the time and location of TobAnPOD gene expression. Regulation of the TobAnPOD gene was probed by examining transient expression of the TobAnPOD promoter/GUS chimera in tobacco protoplasts in the presence of potential chemical and environmental regulators of expression. Potential regulatory regions and elements in the TobAnPOD were also identified. Sequencing the 5' regulatory region of the TobAnPOD gene revealed possible regulatory elements based on homology to known regulatory elements of other genes. Positive and negative regulatory regions were also identified by promoter deletion analysis of the TobAnPOD promoter/GUS fusion transformed into tobacco protoplasts. 210 These experiments reveal that the tobacco anionic peroxidase gene is highly and complexly regulated. Sequencing of the TobAnPOD promoter revealed a myriad of potential regulatory elements based on sequence homology. The presence of multiple regulatory elements within the TobAnPOD promoter was confirmed by promoter deletion analysis. Each of six 5' promoter deletions caused a change in reporter gene expression, suggesting that one or more elements were removed with each deletion. Gene regulation involved both positive and negative regulatory regions. The complex expression pattern observed in plants stably transformed with the TobAnPOD/GUS gene fusion was further evidence of the complex regulation of this gene. GUS expression from the TobAnPOD promoter was highly regulated temporally and spatially within tobacco plants. Chemical and environmental factors also modify tobacco anionic peroxidase gene expression. Auxin was effective in suppressing activity from the TobAnPOD promoter. Auxin suppression of the TobAnPOD promoter was observed in transiently transformed tobacco protoplasts and stably transformed root cultures. In protoplasts, auxin suppression was reversed by p-chlorophenoxyisobutyric acid (PCIB), a competitive inhibitor of auxin. PCIB alone enhanced expression. Tobacco plants stably transformed with a TobAnPOD promoter/GUS chimera also showed an inverse relationship between auxin concentration and TobAnPOD 211 promoter-driven expression. Little or no GUS activity was observed in regions of high auxin concentration such as young tissues, shoot apices and root tips. Old, mature tissues, where auxin concentrations were lowest, had the highest level of GUS activity. The tobacco anionic peroxidase promoter contains several regions homologous to an auxin responsive element or protein binding sites identified in other auxin regulated genes. The importance of these sequences in the TobAnPOD promoter is unknown. Deletion of any or all of these potential elements did not alter or prevent auxin suppression in tobacco protoplasts. It is likely that some unidentified element(s) located close to the TATA box or in the untranslated leader are responsible for auxin suppression of the TobAnPOD gene. Auxin suppression may occur transcriptionally or post- transcriptionally since all promoter deletions contained the untranslated leader of the TobAnPOD gene. Other factors also affected TobAnPOD gene expression in tobacco protoplasts. Salicylic acid, jasmonic acid and a fungal cell wall elicitor suppressed expression from the TobAnPOD promoter. Gibberellic acid, abscisic acid, benzyladenine, ethylene and a 2 hour 41° heat shock did not significantly affect TobAnPOD gene expression. The results of this study into the regulation and expression of the tobacco anionic peroxidase gene suggests possible functions for this peroxidase isozyme in plants. It 212 is likely that this peroxidase isozyme is involved in cell wall strengthening. Its location in the cell wall and its ability to cross-link cell wall materials in vitro has long suggested a role for the anionic peroxidase in cell wall strengthening. GUS expression patterns observed in stably transformed plants support this proposed function. The TobAnPOD promoter was active in and around tissues or cells with thickened, load-bearing cell walls. The TobAnPOD promoter was generally active in cells under mechanical stress including the epidermis, developing seed capsules, and cells surrounding stomata and primary xylem. The tobacco anionic peroxidase may have a limited role in cell wall lignification. It has long been thought that the tobacco anionic peroxidase is responsible for lignification based on its location in the cell wall, its high in vitro reactivity for polymerization of monolignols, and its high level of expression in stem tissue. A correlation between TobAnPOD promoter activity and lignification of primary xylem and pericyclic fibers was observed in N. sylvestris. TobAnPOD promoter activity was observed in the cells adjacent to lignified cells at the time lignification was beginning. TobAnPOD activity was never detected in lignified cells or cells destined to be lignified. Lignification, if catalyzed by this peroxidase isozyme, occurs external to the lignified cell by peroxidase secreted into the apoplasm by surrounding cells. 213 Not all lignification was correlated with the activity of the TobAnPOD promoter. Little expression of this gene was observed in or around secondary xylem, although secondary xylem was highly lignified. It is likely that other enzymes are involved in lignification— possibly other peroxidase isozymes or laccase. The tobacco anionic peroxidase may have a role in defense of the plant against pathogens or insects. The strong expression from the TobAnPOD promoter in trichomes and epidermis at all stages of development suggest a defense- related role for this peroxidase isozyme. The tobacco anionic peroxidase is likely to be part of a plant's first line of defense. The tobacco anionic peroxidase is continuously expressed in the tissues first encountered by an invading insect or pathogen. The anionic peroxidase, however, is not part of a plant's inducible defense response. The tobacco anionic peroxidase is not wound inducible. Salicylic acid and jasmonic acid— compounds associated with triggering plant defense responses to pathogens— suppress expression from the TobAnPOD promoter. The tobacco anionic peroxidase may also be involved in regulation of growth. Auxin suppression of peroxidase expression may provide a mechanism to regulate cell wall extensibility by controlling the extent of cross-linking of cell wall components. In regions of active growth, such as the shoot tip, no expression was observed from the TobAnPOD 214 promoter. The lack of expression of the tobacco anionic peroxidase— perhaps due to suppression by high concentrations of auxin— may aid in maintaining cell wall plasticity throughout the growing regions by preventing or limiting cell wall cross-linkages. TobAnPOD promoter-driven expression increased basipetally, coincidental with decreases in growth and auxin concentrations. The tobacco anionic peroxidase may also function in controlling growth by controlling auxin levels. The tobacco anionic peroxidase is capable of catabolizing auxin in vitro. It is unknown whether it catalyzes this reaction in vivo. TobAnPOD expression increases basipetally and, if involved in auxin catabolism, may cause decreasing auxin levels basipetally. LIST OF REFERENCES

Ainley, W. M.; Walker, J. C.; Nagao, R.? Key, J. L. (1988). "Sequence and Characterization of Two Auxin-Regulated Genes from Soybean." J. Biol. Chem.. 263, pp. 10658- 10666. Ayers, A. R. ; Ebel, J.; Valent, B.; Albersheim, P. (1976). "Host-Pathogen Interactions X. Fractionation and Biological Activity of an Elicitor Isolated from the Mycelial Walls of Phytophthora megasperma var. sojae." Plant Physiol.. 57, pp. 760-765. Balias, N.; Wong, L.-M.; Theologis, A. (1993). "Identification of the Auxin-Responsive Element, AuxRE, in the Primary Indoleacetic Acid-Inducible Gene, PS- IAA4/5, of Pea (Pisum sativum)." J. Mol. Biol.. 233, pp. 580-596. Barcelo, A. R. ? Pedreno, M. A.; Munoz, R. ? Sabater, F. (1988). "Lupin Peroxidases. II. Binding of Acidic Peroxidases to Cell Walls." Physiol. Plant. 71, pp. 238-244. Barcelo, A. R.; Munoz, R. "Peroxidases: Their Role in the Control of Plant Cell Growth." In Plant Peroxidases 1980-1990: Topics and Detailed Literature on Molecular. Biochemical, and Physiological Aspects, pp. 71-89. Edited by C. Penel, Th. Gaspar, H. Greppin. Geneva: University of Geneva, 1992. Benfey, P. N.; Chua, N.-H. (1990). "The Cauliflower Mosaic Virus 35S Promoter: Combinatorial Regulation of Transcription in Plants." Science. 250, pp. 959-966. Bernues, J. ; Beltran, R. ; Casasnovas, J. M.; Azorin, F. (1989). "Structural Polymorphism of Homopurine- Homopyrimidine Sequences: the Secondary DNA Structure

Adopted by a d(GA.CT) 22 Sequence in the Presence of Zinc

Ions." EMBO J .. 8 , pp. 2087-2094.

215 216 Birecka, H.; Miller, A. (1974). "Cell Wall and Protoplast Isoperoxidases in Relation to Injury, Indoleacetic Acid, and Ethylene Effects . 11 Plant Physiol. . 53, pp. 569-574. Boldyreff, B.; Wehr, K.; Hecht, R.; Issinger, O.-G. (1992). "Identification of Four Genomic Loci Highly Related To Casein-Kinase-2-a cDNA and Characterization of a Casein Kinase-2-a Pseudogene Within the Mouse Genome." Biochem. Biophvs. Res. Commun.. 186, pp. 723-730. Boulikas, T. (1993). "Nature of DNA Sequences at the Attachment Regions of Genes to the Nuclear Matrix." J. Cell. Biochem.. 52, pp. 14-22. Boulikas, T.; Kong, C. F. (1993). "Multitude of Inverted Repeats Characterizes a Class of Anchorage Sites of Chromatin Loops to the Nuclear Matrix." J. Cell. Biochem.. 53, pp. 1-12. Boyer, N. ; DeJaegher, G. "Direct or Indirect Role of Peroxidases in Ethylene Biosynthesis?" In Molecular and Physiological Aspects of Plant Peroxidases, pp. 47-60. Edited by H. Greppin, C. Penel, Th. Gaspar. Geneva: University of Switzerland, 1986. Bret-Harte, M. S.; Talbott, L. D. (1993). "Changes in Composition of the Outer Epidermal Cell Wall of Pea Stems during Auxin-Induced Growth." Planta, 190, pp. 369-378. Bret-Harte, M. S. (1993). "Total Epidermal Cell Walls of Pea Stems Respond Differently to Auxin than does the Outer Epidermal Wall Alone." Planta. 190, pp. 379-386. Burstrom, H. (1950). "Studies on Growth and Metabolism of Roots IV. Positive and Negative Auxin Effects on Cell Elongation." Physiol. Plant.. 3, pp. 277-292. Bustos, M. M. ; Guiltinan, M. J. ; Jordano, J. ; Begum, D. ; Kalkan, F. A.; Hall, T. C. (1989). "Regulation of B- Glucuronidase Expression in Transgenic Tobacco Plants by an A/T-Rich, cis-Acting Sequence Found Upstream of a French Bean B-Phaseolin Gene." Plant Cell. 1, pp. 839- 853. Campa, A. "Biological Roles of Plant Peroxidases: Known and Potential Function." In Peroxidases in Chemistry and Biology, vol. 2, pp. 25-50. Edited by Johannes Everse, Kathleen E. Everse and Matthew B. Grisham. Boca Raton: CRC Press, 1991. 217 Castresana, C. ; Staneloni, R. ; Malik, V. ; Cashmore, A. (1987). "Molecular Characterization of Two Clusters of Genes Encoding the Type I CAB Polypeptides of PSII in Nicotiana plumbaginifolia." Plant Mol. Biol.. 10, pp. 117-126. Chabbert B. ; Liu, T. Y. ; Lagrimini, L. M. "Lignin Content and Composition in Transgenic Tobacco Plants with Altered Peroxidase Activity." In Proceedings of the Fifth International Conference of Biotechnology in the Pulp and Paper Industry. Kyoto, Japan, 1992. Chung, C. T.; Niemela, S. L.; Miller, R. H. (1989). "One- Step Preparation of Competent Escherichia coli: Transformation and Storage of Bacterial Cell in the Same

Solution." Proc. Natl. Acad. Sci. USA. 8 6 , pp. 2172- 2175. Conner, T. W.; Goekjian, V. H.; LaFayette, P. R.; Key, J. L. (1990). "Structure and Expression of Two Auxin- Inducible Genes from Arahidopsis." Plant Mol. Biol.. 15, pp. 623—632. Craig, S. "The GUS Reporter Gene— Application to Light and Transmission Electron Microscopy." In GUS Protocols: Using the GUS Gene as a Reporter of Gene Expression, pp. 115-124. Edited by Sean R. Gallagher. San Diego: Academic Press, Inc., 1992. Czarnecka, E.; Nagao, R. T. ; Key, J. L. ; Gurley, W. B. (1988). "Characterization of Gmhsp26-A, a Stress Gene Encoding a Divergent Heat Shock Protein of Soybean: Heavy-Metal-Induced Inhibition of Intron Processing."

Mol. Cell. Biol.. 8 , pp. 1113-1122. Datta, N. ; LaFayette, P. R. ; Kroner, P. A. ; Nagao, R. T. ; Key, J. L. (1993). "Isolation and Characterization of Three Families of Auxin Down-Regulated cDNA Clones." Plant Mol. Biol.. 21, pp. 859-869. Devlin, R. M. ; Witham, F. H. Plant Physiology. 4th ed. Boston: Willard Grant Press, 1983. Diaz de Leon, F. G. "Characterization of the Tobacco Anionic Peroxidase Gene: Sequence and Expression Analysis." M.S. dissertation. Ohio State University, 1993. Diaz-De-Leon, F. ; Klotz, K. L. ; Lagrimini, L. M. (1993). "Nucleotide Sequence of the Tobacco (Nicotiana tabacum) Anionic Peroxidase Gene." Plant Phvsiol.. 101, pp. 1117-1118. 218 Donald, R. G. K. ; Cashmore, A. R. (1990). "Mutation of Either G Box or I Box Sequences Profoundly Affects Expression from the Arabidopsis rbcS-lA Promoter." EMBO L., 9, Pp. 1717-1726. Dowd, P. F.; Lagrimini, L. M. unpublished results. Dunford, H. B. "Horseradish Peroxidase: Structure and Kinetic Properties." In Peroxidases in Chemistry and Biology, vol. 2, pp. 1-24. Edited by Johannes Everse, Kathleen E. Everse and Matthew B. Grisham. Boca Raton: CRC Press, 1991. Dunsmuir, P. ; Bond, D. ; Lee, K. ? Gidoni, D. ; Townsend, J. "Stability of Introduced Genes and Stability in Expression." In Plant Molecular Biology Manual, pp. Cl: 5-7. Edited by Stanton B. Gelvin, Robbert A. Schilperoort, and Desh Pal S. Verma. Dordrecht, Belgium: Kluwer Academic Publishers, 1988. Esau, K. Anatomy of Seed Plants. 2nd ed. New York: John Wiley & Sons, 1977. Farmer, E. E.; Johnson, R. R.; Ryan, C. A. (1992). "Regulation of Expression of Proteinase Inhibitor Genes by Methyl Jasmonate and Jasmonic Acid." Plant Physiol. . 98, pp. 995-1002. Fiedler, U.; Filistein, R.; Wobus, U.? Baumlein, H. (1993). "A Complex Ensemble of cis-Regulatory Elements Controls the Expression of a Vicia faba Non-Storage Seed Protein Gene." Plant Mol. Biol.. 22, pp. 669-679. Fry, S. C. (1980). "Gibberellin-Controlled Pectinic Acid and Protein Secretion in Growing Cells." Phytochemistry. 19, pp. 735-740.

Fry, S. C. (1984) . "Incorporation of [1 4 C]Cinnamate into Hydrolase-Resistant Components of the Primary Cell Wall." Phytochemistry. 23, pp. 59-64. Fry, S. C. (1987). "Formation of Isodityrosine by Peroxidase Isozymes." J. Exp. Bot.. 38, pp. 853-862. Fry, S. C. The Growing Plant Cell Wall: Chemical and Metabolic Analysis. Essex, UK: Longman Scientific and Technical, 1988. Gardiner, M. G. ; Cleland, R. (1974). "Peroxidase Changes during the Cessation of Elongation in Pi sum sativum Stems." Phytochemistry. 13, pp. 1095-1098. 219 Gaspar, T.; Penel, C.; Castillo, F. J.; Greppin, H. (1985). "A Two-Step Control of Basic and Acidic Peroxidases and its Significance for Growth and Development." Plant Phvsiol.. 64, pp. 418-423. Gaspar, T.; Penel, C.? Hagege, D. ; Greppin, H. "Peroxidases in Plant Growth, Differentiation, and Development Processes." In Biochemical. Molecular. and Physiological Aspects of Plant Peroxidases, pp. 249-280. Edited by J. Lobarzewski, H. Greppin, C. Penel, Th. Gaspar. Lubin, Poland: University M. Curie-Sklodowska, 1991. Gidoni, D.; Brosia, P.; Bond-Nutter, D.; Bedbrook, J. ; Dunsmuir, P. (1989). "Novel Cis-Acting Elements in Petunia Cab Gene Promoters." Mol. Gen. Genet.. 215, pp. 337-344. Goldberg, R.; Inberty, A.; Chu-Ba, J. (1986). "Development of Isoperoxidases along the Growth Gradient in the Mung Bean Hypocotyl." Phytochemistry. 25, pp. 1271-1274. Graham, M. Y. ; Graham, T. L. (1991). "Rapid Accumulation of Anionic Peroxidases and Phenolic Polymers in Soybean Cotyledon Tissues following Treatment with Phytophthora megasperma f. sp. Glycinea Wall Glucan." Plant Phvsiol.. 97, pp. 1445-1455. Graves, B. J. ; Eisenberg, S. P.; Coen, D. M. ; McKnight, S. L. (1985). "Alternate Utilization of Two Regulatory Domains within the Moloney Murine Sarcoma Virus Long Terminal Repeat." Mol. Cell. Biol.. 5, pp. 1959-1968. Grignon, C.; Sentenac, H. (1991). "pH and Ionic Conditions in the Apoplast." Annu. Rev. Plant Phvsiol.. 42, pp. 103-128. Grisebach, H. (1981). "Lignins." In The Biochemistry of Plants. pp. 451-478. Edited by E. E. Conn. New York: Academic Press, Inc., 1981. Hagen, G. ; Martin, G.; Li, Y. ? Guilfoyle, T. J. (1991). "Auxin-Induced Expression of the Soybean GH3 Promoter in Transgenic Tobacco Plants." Plant Mol. Biol.. 17, pp. 567-579. Harris, P. J. ; Hartley, R. D. (1976). "Detection of Bound Feruiic Acid in Cell Walls of the Gramineae by Ultraviolet Fluorescence Microscopy." Nature. 259, pp. 508-510. 220 Hibi, N. ; Higashiguchi, S.; Hashimoto, T. ; Yamada, Y. (1994). "Gene Expression in Tobacco Low-Nicotine Mutants." Plant Cell. 6, pp. 723-735.

Hollon, T.; Yoshimura, F. K. (1989). "Variation in Enzymatic Transient Gene Expression Assays." Anal. Biochem.. 182, pp. 411-418. Instruction Manual for the Applied Biosvstems Model 370A/373A DNA Sequencing System. Cycle sequencing protocol. Intapruk, C.; Yamamoto, K.; Sekine, M.; Takano, M.; Shinmyo, A. (1994). "Regulatory Sequences Involved in the Peroxidase Gene Expression in Arabidopsis thaliana." Plant Cell Reports. 13, pp. 123-129. Izawa, T.; Foster, R. ; Chua, N.-H. (1993). "Plant bZip Protein DNA Binding Specificity." J. Mol. Biol.. 230, pp. 1131-1144. Jefferson, R. A. (1987) . "Assaying Chimeric Genes in Plants: The GUS Fusion System." Plant Mol. Bio. Reporter. 5, pp. 387-405. Jefferson, R. A.; Kavanagh, T. A.; Bevan, M. W. (1987). "GUS Fusions: B-Glucuronidase as a Sensitive and Versatile

Gene Fusion Marker in Higher Plants." EMBO J.. 6 , pp. 3901-3907. Jensen, W. A. Botanical Histochemistry: Principles and Practice. San Francisco: W. H. Freeman & Co., 1962, p. 205. Johnson, P. F.; McKnight, S. L. (1989). "Eukaryotic Transcriptional Regulatory Proteins." Annu. Rev. Biochem.. 58, pp. 799-839. Jones, R. L. "Gibberellic Acid and Auxin Influence the Secretion of Peroxidase." In Molecular and Physiologi­ cal Aspects of Plant Peroxidases, pp. 295-308. Edited by H. Greppin, C. Penel, Th. Gaspar. Geneva: Universi­ ty of Geneva, 1986. Joshi, C. P. (1987). "An Inspection of the Domain Between Putative TATA Box and Translation Start Site in 79 Plant Genes." Nucl. Acids Res.. 15, pp. 6643-6653. Joshi, C. P. (1987). "Putative Polyadenylation Signals in Nuclear Genes of Higher Plants: A Compilation and Analysis." Nucl. Acids Res.. 15, pp. 9627-9640. 221 Jourdan, P. S.; Earle, E. D. (1989). "Genotypic Variability in the Frequency of Plant Regeneration from Leaf Protoplasts of Four Brassica spp. and of Raphanus sativus." J. Amer. Soc. Hort. Sci.. 114, pp. 343-349. Jourdano, J. ; Amloguera, C. ; Thomas, T. L. (1989). "A Sunflower Helianthinin Gene Upstream Sequence Ensemble Contains an Enhancer and Sites of Nuclear Protein Interaction." Plant Cell. 1, pp. 855-866. Kawagoe, Y.; Murai, N. (1992). "Four Distinct Nuclear Proteins Recognize in vitro the Proximal Promoter of the Bean Seed Storage Protein B-Phaseolin Gene Conferring Spatial and Temporal Control." Plant J . . 2, pp. 927- 936. Kawagoe, Y.; Campbell, B. R.; Murai, N. (1994). "Synergism between CACGTG (G-Box) and CACCTG cis Elements is Required for Activation of the Bean Seed Storage Protein B-Phaseolin Gene." Plant J.. 5, pp. 885-890. Kawaoka, A.; Kawamoto, T.; Sekine, M.; Yoshida, K? Takano, M. ; Shinmyo, A. (1994). "A Cis-Acting Element and a Trans-Acting Factor Involved in the Wound-Induced Expression of a Horseradish Peroxidase Gene." Plant J. .

6 , pp. 87-97. Kay, R.; Chan, A.; Daly, M. ; McPherson, J. (1987). "Duplication of CaMV 35S Promoter Sequences Creates a Strong Enhancer for Plant Genes." Science. 236, pp. 1299-1302. Kernan, A.; Thornburg, R. W. (1989). "Auxin Levels Regulate the Expression of a Wound-Inducible Proteinase Inhibitor II— Chloramphenicol Acetyl Transferase Gene Fusion in vitro and in vivo." Plant Phvsiol.. 91, pp. 73-78. Kim, S. R. ; Choi, J. L. ; Costa, M. A.; An, G. (1992). "Identification of G-Box Sequence as an Essential Element for Methyl Jasmonate Response of Potato Proteinase Inhibitor II Promoter." Plant Phvsiol.. 99, pp. 627—631. Knee, M. (1991). "Role of Ethylene in Chlorophyll Degradation in Radish Cotyledons." J. of Plant Growth Regulation. 10, pp. 157-162. Kolluri, R.; Torrey, T. A.; Kinniburgh, A. J. (1992). "A CT Promoter Element Binding Protein: Definition of a Double-Strand and a Novel Single-Strand DNA Binding Motif." Nucl. Acids Res.. 20, pp. 111-116. 222 Korber, H.; Strizhov, N. ; Staiger, D.; Feldwisch, J.; Olsson, 0. ; Sanberg, G. ; Palme, K. ; Schell, J. ; Konez, C. (1991). "T-DNA Gene 5 of Agrobacterium Modulates Auxin Response by Autoregulated Synthesis of a Growth Hormone Antagonist in Plants." EMBO J.. 10, pp. 3983-3991. Kraft, R. ; Tardiff, J. ; Krauter, K. S.; Leinwand, L. A. (1988). "Using Mini-Prep Plasmid DNA for Sequencing Double Stranded Templates with Sequenase."

Biotechnioues. 6 , pp. 544-549. Kunkel, T. A. "Oligonucleotide-Directed Mutagenesis Without Phenotypic Selection." In Current Protocols in

Molecular Biology, pp 8 .1.1-8.1.6. Edited by F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moor, J. G. Seidman, J. A. Smith and K. Stouhl. New York: John Wiley & Sons, 1987. Lagrimini, L. M.; Burkhart, W. ; Moyer, M. ; Rothstein, S. (1987). "Molecular Cloning of Complementary DNA Encoding the Lignin-Forming Peroxidase from Tobacco: Molecular Analysis and Tissue-Specific Expression." Proc. Natl. Acad. Sci.. 84, pp. 7542-7546. Lagrimini, L. M. ; Rothstein, S. (1987). "Tissue Specificity of Tobacco Peroxidase Isozymes and Their Induction By Wounding and Tobacco Mosaic Virus Infection." Plant Phvsiol.. 84, pp. 438-442. Lagrimini, L. M. ; Bradford, S.; Rothstein, S. (1990). "Peroxidase-Induced Wilting in Transgenic Tobacco Plants." Plant Cell. 2, pp. 7-18. Lagrimini, L. M. "Altered Phenotypes in Plants Transformed with Chimeric Tobacco Peroxidase Genes." In Biochemical. Molecular, and Physiological Aspects of Plant Peroxidases, pp. 59-67. Edited by J. Lobarzewski, H. Greppin, C. Penel, Th. Gaspar. Lubin, Poland: University M. Curie-Sklodowska, 1991. Lagrimini, L. M. (1991). "Wound-Induced Deposition of Polyphenols in Transgenic Plants Overexpressing Peroxi­ dase." Plant Phvsiol.. 96, pp. 577-583. Lagrimini, L. M. "Plant Peroxidases: Under- and Over- Expression in Transgenic Plants and Physiological Consequences." In Plant Peroxidases 1980-1990: Topics and Detailed Literature on Molecular. Biochemical, and Physiological Aspects, pp. 59-69. Edited by C. Penel, Th. Gaspar, H. Greppin. Geneva: University of Geneva, 1992. 223 Lagrimini, L. M. unpublished results. Lam, E.; Chua, N.-H. (1989). "ASF-2: A Factor that Binds to the Cauliflower Mosaic Virus 35S Promoter and a Conserved GATA Motif in Cab Promoters." Plant Cell. l, pp. 1147-1156. Laux, T.; Seurinck, J.; Goldberg, R. B. (1991). "A Soybean Embryo cDNA Encodes a DNA Binding Protein with Histone and HMG-Protein-Like Domains." Nucl. Acids Res.. 19, 4768. Leckie, F.; Devoto, A.; De Lorenzo, G. (1994). "Normalization of GUS by Luciferase Activity from the Same Cell Extract Reduces Transformation Variability." BioTechnioues. 17, pp.52-57. Lepetit, M.; Ehling, M.; Gigot, C.; Hahne, G. (1991). "An Internal Standard Improves the Reliability of Transient Expression Studies in Plant Protoplasts." Plant Cell Reports. 10, pp. 401-405. Lessard, P. A.; Allen, R. D. ; Fujiwara, T. ; Beachy, R. N. (1993). "Upstream Regulatory Sequences from Two B- Conglycinin Genes." Plant Mol. Biol.. 22, pp. 873-885. Levin, D. A. (1973) . "The Role of Trichomes in Plant Defense." Quart. Rev. Biol.. 48, 3-15. Loake, G. J. ; Choudhary, A. D.; Harrison, M. J. ; Mavandad, M. ; Lamb, C. J. ; Dixon, R. A. (1991). "Phenylpropanoid Pathway Intermediates Regulate Transient Expression of a Chalcone Synthase Gene Promoter." Plant Cell. 3, pp. 829-840. MacAdam, J. W.; Nelson, C. J.; Sharp, R. E. (1992). "Peroxidase Activity in the Leaf Elongation Zone of Tall Fescue. I. Spatial Distribution of Ionically Bound Peroxidase Activity in Genotypes Differing in Length of the Elongation Zone."Plant Phvsiol.. 99, pp. 872-878. MacAdam, J. W.? Sharp,R. E.; Nelson, C. J. (1992). "Peroxidase Activity in the Leaf Elongation Zone of Tall Fescue. II. Spatial Distribution of Apoplastic Peroxidase Activity in Genotypes Differing in Length of the Elongation Zone." Plant Phvsiol.. 99, pp. 879-885. 224 Mader, M.; Nessel, A.; Bopp, M. (1977). "Uber die Physiologische Bedeutung det Peroxidase-Isoenzym-Gruppen des Tabaks anhand eineger Biochemischer Eigenschaften. II. pH-Optima, Michael is-Konstanten, Maxixnale Oxidationsraten." Z. Pflanzenphvsiol. Bd. . 82, pp. 247- 260. Mader, M.; Fussl, R. (1982). "Role of Peroxidase in Lignification of Tobacco Cells. II. Regulation by Phenolic Compounds." Plant Phvsiol.. 70, pp. 1132-1134. Mader, M. "Compartmentation of Peroxidase Isoenzymes in Plant Cells." In Plant Peroxidases 1980-1990: Topics and Detailed Literature on Molecular. Biochemical, and Physiological Aspects, pp. 37-46. Edited by C. Penel, Th. Gaspar, H. Greppin. Geneva: University of Geneva, 1992. Malamy, J. ? Klessig, D. F. (1992) . "Salicylic Acid and Plant Disease Resistance." Plant Journal. 2, pp. 643-654. Marcotte, W. R., Jr.; Russell, S. H. ; Quatrano, R. S. (1989). "Abscisic Acid-Responsive Sequence from the Em Gene of Wheat." Plant Cell. 1, pp. 969-976. Markwalder, H.-U.; Neukom, H. (1976). "Diferulic Acid as a Possible Crosslink in Hemicelluloses from Wheat Germ." Phytochemistry. 15, pp. 836-837. Martin, T. ? Wohner, R-V; Hummel, S.; Willmitzer, L. ; Frommer, W. B. "The GUS Reporter System as a Tool to Study Plant Gene Expression." In GUS Protocols: Using the GUS Gene as a Reporter of Gene Expression, pp. 23-43. Edited by Sean R. Gallagher. San Diego: Academic Press, Inc., 1992. Marty, I.; Brugidou, C.; Chartier, Y.; Meyer, Y. (1993). "Growth-Related Gene Expression in Nicotiana tabacum Mesophyll Protoplasts." Plant Journal. 4, pp. 265-278. McClure, B. A.; Hagen, G. ; Brown, C. S.; Gee, M. A.; Guilfoyle, T. J. (1989). "Transcription, Organization and Sequence of an Auxin-Regulated Gene Cluster in Soybean."- Plant Cell. 1, pp. 229-239. McDougall, G. J. (1992). "Changes in Cell Wall-Associated Peroxidases During the Lignification of Flax Fibres." Phytochemistry. 31, pp. 3385-3389. 225 McDougall, G. J. "Plant Peroxidases and Cell Differen­ tiation." In Plant Peroxidases 1980-1990: Topics and Detailed Literature on Molecular. Biochemical, and Physiological Aspects, pp. 101-115. Edited by C. Penel, Th. Gaspar, H. Greppin. Geneva: University of Geneva, 1992. McKay, J. J.; Ross, J. J. ; Lawrence, N. L. ; Cramp, R. E. ; Beveridge, C. A. ; Reid, J. B. (1994) . "Control of Internode Length in Pisum sativum: Further Evidence for the Involvement of Indole-3-Acetic Acid." Plant Phvsiol.. 106, pp. 1521-1526. McRae, D. H. ; Bonner, J. (1953). "Chemical Structure and Antiauxin Activity." Phvsiol. Plant.. 6 , pp. 485-510. Messner, B.; Boll, M. (1993). "Elicitor-Mediated Induction of Enzymes of Lignin Biosynthesis and Formation of Lignin-Like Material in a Cell Suspension Culture of Spruce (Picea abies) .11 Plant. Cell. Tiss. Ora. Cult.. 34, pp. 261-269. Moerschbacher, B. M. "Plant Peroxidases: Involvement in Response to Pathogens." In Plant Peroxidases 1980-1990: Topics and Detailed Literature on Molecular. Biochemical, and Physiological Aspects, pp. 91-99. Edited by C. Penel, Th. Gaspar, H. Greppin. Geneva: University of Geneva, 1992. Mohan, R. ; Vijayan, P.? Kolattukudy, P. E. (1993). "Developmental and Tissue-Specific Expression of a Tomato Anionic Peroxidase (tapl) Gene by a Minimal Promoter, with Wound and Pathogen Induction by an Additional 5' Flanking Region." Plant Molecular Biology. 22, pp. 475-490. Muchhal, U. S.? Schwartzbach, S. D. (1992). "Characterization of a Euglena Gene Encoding a Polyprotein Precursor to the Light-Harvesting Chlorophyll a/b-Binding Protein of Photosystem II." Plant Mol. Biol.. 18, pp. 287-300. Muir, R. M. (1942). "Growth hormones as related to the setting and development of fruit in Nicotiana tabacum." Am. J . Bot.. 29, pp. 716-720. Muir, R. M. (1947) . "The Relationship of Growth Hormones and Fruit Development." Proc. Natl. Acad. Sci.. USA. 33, pp. 3 03. 226 Murashige, T. ; Skoog, S. (1962). "A Revised Medium for Rapid Growth and Bioassays with Tobacco Tissue Cultures." Phvsiol. Plant.. 15, pp. 473-497. Nagao, R. T. ; Goekjian, V. H. ; Hong, J. C. ? Key, J. L. (1993) . "Identification of Protein-Binding DNA Sequences in an Auxin-Regulated Gene of Soybean." Plant Mol. Biol.. 21, pp. 1147-1162. Novak, T. J. ; Rothenberg, E. V. (1986). "Differential Transient and Long-Term Expression of DNA Sequences Introduced into T-Lymphocyte Lines." DNA. 5, pp. 439- 451. Ockerse, R.; Siegel, B. Z.; Galston, A. W. (1966). "Hormone- Induced Repression of a Peroxidase Isozyme in Plant Tissue." Science. 18, pp. 452-453. Oeller, P. W.; Keller, J. A.; Parks, J. E.; Silbert, J. E.; Theologis, A. (1993). "Structural Characterization of the Early Indoleacetic Acid-Inducible Genes, PS-IAA4/5 and PS-IAA6, of Pea (Pisum sativum L.)." J. Mol. Biol. . 233, pp. 789-798. Okamuro, J. K.; Goldberg, R. (1985). "Tobacco Single-Copy DNA is Highly Homologous to Sequences Present in the Genomes of its Diploid Progenitors." Mol. Gen. Genet.. 198, pp. 290-298. pBluescript instruction manual. Stratagene, La Jolla, California. Peach, C.; Velten, J. (1992). "Application of the Chloram phenicol Acetyltransferase (CAT) Diffusion Assay to Transgenic Plant Tissues." BioTechnioues. 12, pp. 181- 186. Promeaa Protocols and Application Guide. 2nd ed. Madison, WI: Promega Corp., 1991. Reddy, A. S. N.; Poovaiah, B. W. (1987). "Accumulation of a Glycine Rich Protein in Auxin-Deprived Strawberry Fruits." Biochem. Biophvs. Res. Commun.. 147, pp. 885- 891. Rieping, M. ; Schoffl, F. (1992). "Synergistic Effect of Upstream Sequences, CCAAT Box Elements, and HSE Sequences for Enhanced Expression of Chimaeric Heat Shock Genes in Transgenic Tobacco." Mol. Gen. Genet.. 231, pp. 226-232. 227

Robb, J. ; Lee, S.-VI.; Mohan, R. ; Kolattukudy, P. E. (1991). "Chemical Characterization of Stress-Induced Vascular Coating in Tomato." Plant Phvsiol.. 97, pp. 528-536. Rothstein, S. J.; Lahners, K. N.; Lotstein, R. J.; Carozzi, N. B. ; Jayne, S. M. ; Rice, D. A. (1987) . "Promoter Cassettes, Antibiotic-Resistant Genes, and Vectors for Plant Transformation." Gene. 53, pp. 153-161. Rothstein, S. J.; Lagrimini, L. M. "Silencing Gene Expression in Plants." In Oxford Surveys of Plant Molecular and Cellular Biology, pp. 221-246. Edited by B. J. Miflin. Oxford: Oxford University Press, 1989. Salisbury, F. B. ; Ross C. W. Plant Physiology. 4th ed. Belmont, CA: Wadsworth Publishing Co., 1992. Sambrook, J. ; Fritsch, E. F. ; Maniatis, T. Molecular Cloning; A Laboratory Manual. 2nd ed. Plainview, NY: Cold Spring Harbor Laboratory Press, 1989. Sanger, F. ; Nicklen, S.; Coulson, A. R. (1977). "DNA Sequencing with Chain-Terminating Inhibitors." Proc. Natl. Acad. Sci. USA. 74, pp. 5463-5467. Saunders, B. C.; Holmes-Siedle, A. G.; Stark, B. P. Peroxidases: The Properties and Uses of a Versatile Enzyme and of Some Related Catalysts. Washington: Butterworth & Co., 1964. Scholer, H. R.; Gruss, P. (1984). "Specific Interaction between Enhancer-Containing Molecules and Cellular Components." Cell. 36, pp. 403-411. Schulze-Lefert, P.; Becker-Andre, M. ? Schulz, W. ; Hahlbrock, K.; Dangl, J. L. (1989). "Functional Architecture of the Light-Responsive Chalcone Synthase Promoter from Parsley." Plant Cell. 1, pp. 707-714. Sequenase Version 2.0 kit instructions, United .States Biochemical Corp. 1990. Shaw, C. H., ed. Plant Molecular Biology: A Practical Approach. pp. 301-303. Oxford: IRL Press, 1988. Shepard, A. R.; Eberhardt, N. L. (1992). "Thiols Interfere with Chloramphenicol Acetyltransferase Assays." BioTechnigues. 13, pp. 702-704. 228 Sherf, B. A.; Bajar, A. M. ; Kolattukudy, P. E. (1993). "Abolition of an Inducible Highly Anionic Peroxidase Activity in Transgenic Tomato." Plant Phvsiol.. 101, pp. 201-208. Shillito, R. D. ; Saul, M. W. "Protoplast Isolation and Transformation." In Plant Molecular Biology:___ A Practical Approach, pp. 161-186. Edited by C. H. Shaw. Oxford: IRL Press, 1988. Simon, R.; Priefer, U.; Puhler, A. "Vector Plasmids for in vivo and in vitro Manipulation of Gram-Negative Bacteria." In Genetics of the Bacteria-Plant Interaction, pp. 98-106. Edited by A. Puhler. Berlin: Springer-Verlag, 1983. Slightom, J. L.; Durand-Tardif, M.; Jouanin, L.; Tepfer, D. (1986). "Nucleotide Sequence Analysis of TL-DNA of Agrobacterium rhizogenes Agropine Type Plasmid." J . Mol. Biol.. 261, pp.108-121. Stomp, A-M. "Histochemical Localization of B-Glucuronidase." In GUS Protocols: Using the GUS Gene as a Reporter of Gene Expression, pp. 103-113. Edited by Sean R. Gallagher. San Diego: Academic Press, Inc., 1992. Strivastava, 0. P.; Van Huystee, R. B. (1977). "An Inter- Relationship among Peroxidase, IAA Oxidase, and Polyphenoloxidase from Peanut Cells." Can. J. Bot.. 55, pp. 2630—2635. Svalheim, 0. ; Robertsen B. (1990). "Induction of Peroxidases in Cucumber Hypocotyls by Wounding and Fungal Infection." Phvsiolocria Plantarum. 78, pp. 261-267. Taiz, L. (1984). "Plant Cell Expansion: Regulation of Cell Wall Mechanical Properties." Ann. Rev. Plant Phvsiol.. 35, pp. 585-657. Takahashi, Y. ; Niwa, Y. ; Machida, Y. ; Nagata, T. (1990). "Location of the Cis-Acting Auxin-Responsive Region in the Promoter of the Par Gene from Tobacco Mesophyll Protoplasts." Proc. Natl. Acad. Sci.. USA. 87, pp. 8013-8016. Takimoto, M.; Tomonaga, T.; Matunis, M. ; Avigan, M.; Krutzsch, H. ? Dreyfuss, G. ; Levens, D. (1993). "Specific Binding of Heterogeneous Ribonucleoprotein Particle Protein K to the Human c-myc Promoter, in Vitro." J. Biol. Chem.. 268, pp. 18249-18258. 229

Technical Bulletin #138. "Fluorometric 6 -Glucuronidase Assay Using the TKO 100 Fluorometer." Hoefer Scientific Instruments. San Francisco, CA. Theologis, A. (1986). "Rapid Gene Regulation By Auxin." Ann. Rev. Plant Phvsiol.. 37, pp. 407-438. Thorpe, T. A.; Tran Thanh Van, M.; Gaspar, T. (1978). "Isoperoxidases in Epidermal Layers of Tobacco and Changes during Organ Formation in vitro." Phvsiol. Plant.. 44, pp. 388-394. Torres, J. T. ; Block, A.; Hahlbrock, K. ; Somssich, I. E. (1993). "Influence of Bacterial Strain Genotype on Transient Expression of Plasmid DNA in Plant Protoplasts." Plant Journal. 4, pp. 587-592. Uknes, S.; Dincher, S.; Friedrich, L.; Negrotto, D.; Williams, S.; Thompson-Taylor, H. ; Potter, S.; Ward, E. ; Ryals, J. (1993). "Regulation of Pathogenesis-Related Protein-la Gene Expression in Tobacco." Plant Cell. 5, pp. 159-169. Vance, C. P.; Kirk, T. K.; Sherwood, R. T. (1980). "Lignification as a Mechanism of Disease Resistance." Annu. Rev. Phvtopathol.. 18, pp. 259-288. Van Huystee, R. B. (1987) . "Some Molecular Aspects of Plant Peroxidase Biosynthetic Studies." Annu. Rev. Plant Phvsiol.. 38, pp. 205-217. Waffenschmidt, S.; Woessner, J. P.; Beer, K.; Goodenough, U. W. (1993). "Isodityrosine Cross-Linking Mediates Insolubilization of Cell Walls in Chlamydomonas. " Plant Cell. 5, pp. 809-820. Ward, E. R.; Uknes, S. J.; Williams, S. C.; Dincher, S. S.; Wiederhold, D. L. ; Alexander, D. C. ; Ahl-Goy, P. ; Metraux, J.-P.; Ryals, J. A. (1991). "Coordinate Gene Activity in Response to Agents that Induce Systemic Acquired Resistance." Plant Cell. 3, pp. 1085-1094. Waugh, R. ; Brown, J. W. S. "Plant Gene Structure and Expression." In Plant Genetic Engineering, pp. 1-38. Edited by Don Grierson. Glasgow: Blackie & Sons, Ltd., 1991. Wiese, S. "Phenotypic Characterization of Tobacco Transformed to Constitutively Underproduce Anionic Peroxidase." M.S. dissertation. Ohio State University, 1993. 230 Williams, M. E.; Foster, R.? Chua, N.-H. (1992). "Sequences Flanking the Hexameric G-Box Core CACGTG Affect the Specificity of Protein Binding." Plant Cell. 4, pp. 485-496. Williams, S. C.; Cantwell, C. A.; Johnson, P. F. (1991). "A Family of C/EBP-Related Proteins Capable of Forming Covalently Linked Leucine Zipper Dimers In Vitro." Genes & Develop.. 5, pp. 1553-1567. Zarembinski, T. ; Theologis, A. (1993). "Anaerobiosis and Plant Growth Hormones Induce Two Genes Encoding 1- Aminocyclopropane-l-Carboxylate Synthase in Rice (Oryza sativa L.)." Mol. Biol. Cell. 4 , pp. 363-373. Zhou, C.; Abaigar, L.; Jong, A. Y. (1990). "A Protocol for Using T7 DNA Polymerase in Oligonucleotide Site-Directed

Mutagenesis." Biotechnioues. 8 , p. 503.