Supplementary Table 3: Description of the 81 Genes Used As the Copy Number Signature
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
Open Dogan Phdthesis Final.Pdf
The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
The Origin and Evolution of Human Ampliconic Gene Families and Ampliconic Structure
Downloaded from genome.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Letter The origin and evolution of human ampliconic gene families and ampliconic structure Bejon Kumar Bhowmick, Yoko Satta, and Naoyuki Takahata1 Department of Biosystems Science, The Graduate University for Advance Studies (Sokendai), Kanagawa 240-0193, Japan Out of the nine male-specific gene families in the human Y chromosome amplicons, we investigate the origin and evolution of seven families for which gametologous and orthologous sequences are available. Proto-X/Y gene pairs in the original mammalian sex chromosomes played major roles in origins and gave rise to five gene families: XKRY, VCY, HSFY, RBMY, and TSPY. The divergence times between gametologous X- and Y-linked copies in these families are well correlated with the former X-chromosomal locations. The CDY and DAZ families originated exceptionally by retroposition and transposition of autosomal copies, respectively, but CDY possesses an X-linked copy of enigmatic origin. We also investigate the evolutionary relatedness among Y-linked copies of a gene family in light of their ampliconic locations (palindromes, inverted repeats, and the TSPY array). Although any pair of copies located at the same arm positions within a palindrome is identical or nearly so by frequent gene conversion, copies located at different arm positions are distinctively different. Since these and other distinct copies in various gene families were amplified almost simultaneously in the stem lineage of Catarrhini, we take these simultaneous amplifications as evidence for the elaborate formation of Y ampliconic structure. Curiously, some copies in a gene family located at different palindromes exhibit high sequence similarity, and in most cases, such similarity greatly extends to repeat units that harbor these copies. -
1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN. -
Regulation of Oxidized Base Damage Repair by Chromatin Assembly Factor 1 Subunit a Chunying Yang1,*,†, Shiladitya Sengupta1,2,*,†, Pavana M
Published online 27 October 2016 Nucleic Acids Research, 2017, Vol. 45, No. 2 739–748 doi: 10.1093/nar/gkw1024 Regulation of oxidized base damage repair by chromatin assembly factor 1 subunit A Chunying Yang1,*,†, Shiladitya Sengupta1,2,*,†, Pavana M. Hegde1,JoyMitra1, Shuai Jiang3, Brooke Holey3, Altaf H. Sarker3, Miaw-Sheue Tsai3, Muralidhar L. Hegde1,2,4 and Sankar Mitra1,2,* 1Department of Radiation Oncology, Houston Methodist Research Institute, Houston, TX 77030, USA, 2Weill Cornell Medical College, Cornell University, New York, NY 10065, USA, 3Biological Systems and Engineering Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA and 4Houston Methodist Neurological Institute, Houston, TX 77030, USA Received March 23, 2016; Revised October 13, 2016; Editorial Decision October 17, 2016; Accepted October 19, 2016 ABSTRACT INTRODUCTION Reactive oxygen species (ROS), generated both en- ROS, continuously generated in mammalian cells both en- dogenously and in response to exogenous stress, in- dogenously and by environmental genotoxicants, induce duce point mutations by mis-replication of oxidized various genomic lesions, including oxidized bases, abasic bases and other lesions in the genome. Repair of (AP) sites and single-strand breaks (SSBs). If unrepaired or these lesions via base excision repair (BER) pathway mis-repaired, DNA lesions would cause mutations which may lead to cytotoxicity and cell death and also carcino- maintains genomic fidelity. Regulation of the BER genic transformation (1). The base excision repair (BER) pathway for mutagenic oxidized bases, initiated by pathway, responsible for repair of oxidized base lesions NEIL1 and other DNA glycosylases at the chromatin which contribute to drug/radiation sensitivity is highly con- level remains unexplored. -
Liver Glucose Metabolism in Humans
Biosci. Rep. (2016) / 36 / art:e00416 / doi 10.1042/BSR20160385 Liver glucose metabolism in humans Mar´ıa M. Adeva-Andany*1, Noemi Perez-Felpete*,´ Carlos Fernandez-Fern´ andez*,´ Cristobal´ Donapetry-Garc´ıa* and Cristina Pazos-Garc´ıa* *Nephrology Division, Hospital General Juan Cardona, c/ Pardo Bazan´ s/n, 15406 Ferrol, Spain Synopsis Information about normal hepatic glucose metabolism may help to understand pathogenic mechanisms underlying obesity and diabetes mellitus. In addition, liver glucose metabolism is involved in glycosylation reactions and con- nected with fatty acid metabolism. The liver receives dietary carbohydrates directly from the intestine via the portal vein. Glucokinase phosphorylates glucose to glucose 6-phosphate inside the hepatocyte, ensuring that an adequate flow of glucose enters the cell to be metabolized. Glucose 6-phosphate may proceed to several metabolic path- ways. During the post-prandial period, most glucose 6-phosphate is used to synthesize glycogen via the formation of glucose 1-phosphate and UDP–glucose. Minor amounts of UDP–glucose are used to form UDP–glucuronate and UDP– galactose, which are donors of monosaccharide units used in glycosylation. A second pathway of glucose 6-phosphate metabolism is the formation of fructose 6-phosphate, which may either start the hexosamine pathway to produce UDP-N-acetylglucosamine or follow the glycolytic pathway to generate pyruvate and then acetyl-CoA. Acetyl-CoA may enter the tricarboxylic acid (TCA) cycle to be oxidized or may be exported to the cytosol to synthesize fatty acids, when excess glucose is present within the hepatocyte. Finally, glucose 6-phosphate may produce NADPH and ribose 5-phosphate through the pentose phosphate pathway. -
Essential Genes and Their Role in Autism Spectrum Disorder
University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2017 Essential Genes And Their Role In Autism Spectrum Disorder Xiao Ji University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Bioinformatics Commons, and the Genetics Commons Recommended Citation Ji, Xiao, "Essential Genes And Their Role In Autism Spectrum Disorder" (2017). Publicly Accessible Penn Dissertations. 2369. https://repository.upenn.edu/edissertations/2369 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2369 For more information, please contact [email protected]. Essential Genes And Their Role In Autism Spectrum Disorder Abstract Essential genes (EGs) play central roles in fundamental cellular processes and are required for the survival of an organism. EGs are enriched for human disease genes and are under strong purifying selection. This intolerance to deleterious mutations, commonly observed haploinsufficiency and the importance of EGs in pre- and postnatal development suggests a possible cumulative effect of deleterious variants in EGs on complex neurodevelopmental disorders. Autism spectrum disorder (ASD) is a heterogeneous, highly heritable neurodevelopmental syndrome characterized by impaired social interaction, communication and repetitive behavior. More and more genetic evidence points to a polygenic model of ASD and it is estimated that hundreds of genes contribute to ASD. The central question addressed in this dissertation is whether genes with a strong effect on survival and fitness (i.e. EGs) play a specific oler in ASD risk. I compiled a comprehensive catalog of 3,915 mammalian EGs by combining human orthologs of lethal genes in knockout mice and genes responsible for cell-based essentiality. -
Differential Requirements for Tousled-Like Kinases 1 and 2 in Mammalian Development
Cell Death and Differentiation (2017) 24, 1872–1885 & 2017 Macmillan Publishers Limited, part of Springer Nature. All rights reserved 1350-9047/17 www.nature.com/cdd Differential requirements for Tousled-like kinases 1 and 2 in mammalian development Sandra Segura-Bayona1,8, Philip A Knobel1,8, Helena González-Burón1,8, Sameh A Youssef2,3, Aida Peña-Blanco1, Étienne Coyaud4,5, Teresa López-Rovira1, Katrin Rein1, Lluís Palenzuela1, Julien Colombelli1, Stephen Forrow1, Brian Raught4,5, Anja Groth6, Alain de Bruin2,7 and Travis H Stracker*,1 The regulation of chromatin structure is critical for a wide range of essential cellular processes. The Tousled-like kinases, TLK1 and TLK2, regulate ASF1, a histone H3/H4 chaperone, and likely other substrates, and their activity has been implicated in transcription, DNA replication, DNA repair, RNA interference, cell cycle progression, viral latency, chromosome segregation and mitosis. However, little is known about the functions of TLK activity in vivo or the relative functions of the highly similar TLK1 and TLK2 in any cell type. To begin to address this, we have generated Tlk1- and Tlk2-deficient mice. We found that while TLK1 was dispensable for murine viability, TLK2 loss led to late embryonic lethality because of placental failure. TLK2 was required for normal trophoblast differentiation and the phosphorylation of ASF1 was reduced in placentas lacking TLK2. Conditional bypass of the placental phenotype allowed the generation of apparently healthy Tlk2-deficient mice, while only the depletion of both TLK1 and TLK2 led to extensive genomic instability, indicating that both activities contribute to genome maintenance. Our data identifies a specific role for TLK2 in placental function during mammalian development and suggests that TLK1 and TLK2 have largely redundant roles in genome maintenance. -
Investigating the Molecular Mechanisms of Splicing-Perturbing Small Molecules with Massively Parallel Sequencing in a Myotonic Dystrophy 1 Model
INVESTIGATING THE MOLECULAR MECHANISMS OF SPLICING-PERTURBING SMALL MOLECULES WITH MASSIVELY PARALLEL SEQUENCING IN A MYOTONIC DYSTROPHY 1 MODEL by MATTHEW TANNER A THESIS Presented to the Department of Chemistry and Biochemistry and the Robert D. Clark Honors College in partial fulfillment of the requirements for the degree of Bachelor of Science June, 2014 An Abstract of the Thesis of Matthew Tanner for the degree of Bachelor of Science in the Department of Chemistry and Biochemistry to be taken June, 2014 Title: Investigating the Molecular Mechanisms of Splicing-Perturbing Small Molecules with Massively Parallel Sequencing in a Myotonic Dystrophy 1 Model Approved: 4 fhh 73cJ-i J. Andrew Berglund Myotonic dystrophy is the most common form of adult-onset muscular dystrophy and appears in two forms: myotonic dystrophy 1 (OM 1) and 2 (DM2). Both diseases arc characterized by progressive muscle degeneration, myotonia. iridescent cataracts, and in severe cases neurodcgcncration and cardiac dysfunction. Both fonns of myotonic dystrophy arc caused by an expansion of repeat DNA in distinct loci in the genome. In DM 1, a CTG repeat is expanded from less than 50 repeats in nonnal individuals to up to several thousand repeats in DM 1 patients. The molecular basis of this disease relics on the transcription of these repeats from DNA into RNA. Small molecules that can specifically target the repeats at the DNA level and inhibit their transcription - and thus alleviate the disease symptoms - represent a prime target for the development of therapeutics. This study investigates the capacity of two small molecules, pentamidine and actinomycin D, to reverse the molecular symptoms of DM I through transcriptional inhibition and provides insight into their DNA target specificity and potential mechanisms of action. -
Mir-17-92 Fine-Tunes MYC Expression and Function to Ensure
ARTICLE Received 31 Mar 2015 | Accepted 22 Sep 2015 | Published 10 Nov 2015 DOI: 10.1038/ncomms9725 OPEN miR-17-92 fine-tunes MYC expression and function to ensure optimal B cell lymphoma growth Marija Mihailovich1, Michael Bremang1, Valeria Spadotto1, Daniele Musiani1, Elena Vitale1, Gabriele Varano2,w, Federico Zambelli3, Francesco M. Mancuso1,w, David A. Cairns1,w, Giulio Pavesi3, Stefano Casola2 & Tiziana Bonaldi1 The synergism between c-MYC and miR-17-19b, a truncated version of the miR-17-92 cluster, is well-documented during tumor initiation. However, little is known about miR-17-19b function in established cancers. Here we investigate the role of miR-17-19b in c-MYC-driven lymphomas by integrating SILAC-based quantitative proteomics, transcriptomics and 30 untranslated region (UTR) analysis upon miR-17-19b overexpression. We identify over one hundred miR-17-19b targets, of which 40% are co-regulated by c-MYC. Downregulation of a new miR-17/20 target, checkpoint kinase 2 (Chek2), increases the recruitment of HuR to c- MYC transcripts, resulting in the inhibition of c-MYC translation and thus interfering with in vivo tumor growth. Hence, in established lymphomas, miR-17-19b fine-tunes c-MYC activity through a tight control of its function and expression, ultimately ensuring cancer cell homeostasis. Our data highlight the plasticity of miRNA function, reflecting changes in the mRNA landscape and 30 UTR shortening at different stages of tumorigenesis. 1 Department of Experimental Oncology, European Institute of Oncology, Via Adamello 16, Milan 20139, Italy. 2 Units of Genetics of B cells and lymphomas, IFOM, FIRC Institute of Molecular Oncology Foundation, Milan 20139, Italy. -
Gene Section Review
Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Review MIRN21 (microRNA 21) Sadan Duygu Selcuklu, Mustafa Cengiz Yakicier, Ayse Elif Erson Biology Department, Room: 141, Middle East Technical University, Ankara 06531, Turkey Published in Atlas Database: March 2007 Online updated version: http://AtlasGeneticsOncology.org/Genes/MIRN21ID44019ch17q23.html DOI: 10.4267/2042/38450 This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence. © 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology sequences of MIRN21 showed enrichment for Pol II Identity but not Pol III. Hugo: MIRN21 MIRN21 gene was shown to harbor a 5' promoter Other names: hsa-mir-21; miR-21 element. 1008 bp DNA fragment for MIRN21 gene Location: 17q23.1 was cloned (-959 to +49 relative to T1 transcription Location base pair: MIRN21 is located on chr17: site, see Figure 1; A). Analysis of the sequence showed 55273409-55273480 (+). a candidate 'CCAAT' box transcription control element Local order: Based on Mapviewer, genes flanking located approximately about 200 nt upstream of the T1 MIRN21 oriented from centromere to telomere on site. T1 transcription site was found to be located in a 17q23 are: sequence similar to 'TATA' box - TMEM49, transmembrane protein 49, 17q23.1. (ATAAACCAAGGCTCTTACCATAGCTG). To test - MIRN21, microRNA 21, 17q23.1. the activity of the element, about 1kb DNA fragment - TUBD1, tubulin, delta 1, 17q23.1. was inserted into the 5' end of firefly luciferase - LOC729565, similar to NADH dehydrogenase indicator gene and transfected into 293T cells. The (ubiquinone) 1 beta subcomplex, 8, 19 kDa, 17q23.1.