DOCSLIB.ORG

Specific Imbalanced Inflammatory Response Human Endothelial Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Specific Imbalanced Inflammatory Response Human Endothelial Cells Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 is online at: average * The Journal of Immunology , 19 of which you can access for free at: 2011; 186:164-173; Prepublished online 24 from submission to initial decision 4 weeks from acceptance to publication November 2010; doi: 10.4049/jimmunol.0904170 http://www.jimmunol.org/content/186/1/164 H5N1 Virus Activates Signaling Pathways in Human Endothelial Cells Resulting in a Specific Imbalanced Inflammatory Response Dorothee Viemann, Mirco Schmolke, Aloys Lueken, Yvonne Boergeling, Judith Friesenhagen, Helmut Wittkowski, Stephan Ludwig and Johannes Roth J Immunol cites 48 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2010/11/24/jimmunol.090417 0.DC1 This article http://www.jimmunol.org/content/186/1/164.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology H5N1 Virus Activates Signaling Pathways in Human Endothelial Cells Resulting in a Specific Imbalanced Inflammatory Response Dorothee Viemann,*,†,‡ Mirco Schmolke,x Aloys Lueken,*,‡ Yvonne Boergeling,x Judith Friesenhagen,* Helmut Wittkowski,*,† Stephan Ludwig,‡,x and Johannes Roth*,‡ H5N1 influenza virus infections in humans cause a characteristic systemic inflammatory response syndrome; however, the molec- ular mechanisms are largely unknown. Endothelial cells (ECs) play a pivotal role in hyperdynamic septic diseases. To unravel specific signaling networks activated by H5N1 we used a genome-wide comparative systems biology approach analyzing gene ex- pression in human ECs infected with three different human and avian influenza strains of high and low pathogenicity. Blocking of specific signaling pathways revealed that H5N1 induces an exceptionally NF-kB–dependent gene response in human endothelia. Downloaded from Additionally, the IFN-driven antiviral program in ECs is shown to be dependent on IFN regulatory factor 3 but significantly impaired upon H5N1 infection compared with low pathogenic influenza virus. As additional modulators of this H5N1-specific imbalanced gene response pattern, we identified HMGA1 as a novel transcription factor specifically responsible for the over- whelming proinflammatory but not antiviral response, whereas NFATC4 was found to regulate transcription of specifically H5N1- induced genes. We describe for the first time, to our knowledge, defined signaling patterns specifically activated by H5N1, which, in contrast to low pathogenic influenza viruses, are responsible for an imbalance of an overwhelming proinflammatory and http://www.jimmunol.org/ impaired antiviral gene program. The Journal of Immunology, 2011, 186: 164–173. nfluenza A viruses still pose a major threat due to their cell (EC) tropism (9–13). Recently, a-2,3-linked sialic acid re- pandemic potential. There is a huge natural virus reservoir in ceptors preferentially bound by avian influenza virus were shown to I birds, which provides a pool of viral genes that contribute to be present on human ECs, suggesting a crucial involvement of ECs the generation of novel pandemic virus strains. The highly path- in the characteristics of systemic H5N1 diseases (14). Isolated ogenic avian H5N1 virus is the first example of an avian virus re- suppression or knockdown of the cytokine response did not pro- ported to have infected and killed several hundreds of humans (1). tect against lethal outcomes (13, 15, 16). In human bronchial epi- by guest on September 25, 2021 Human-adapted influenza A viruses cause primarily infections of thelial cells, high pathogenic H5N1 variants replicate stronger than the upper respiratory tract with limited virus replication. Highly low pathogenic variants or the human H3N2 virus but elicit a much pathogenic avian influenza viruses (HPAIVs) rather cause systemic weaker and delayed IFN response (17). The overall pattern of infections with hemorrhagic sepsis in poultry. In humans, clinical proinflammatory and antiviral signaling pathways activated by manifestations of H5N1 infections are a systemic inflammatory H5N1 in specific tissues might be the clue to the pathogenicity of response syndrome (SIRS) leading to multiorgan failure (2–6). HPAIVs. There are two characteristics of H5N1 infections: an unusual The cardinal problem of treating H5N1 infections with neur- strong cytokine response (7, 8) and a neuro- as well as endothelial aminidase inhibitors is that it has to be initiated very early, oth- erwise virus replication and dissemination has already progressed too far (6). Evaluating the role of endothelial response programs x *Institute of Immunology, ‡Interdisciplinary Center of Clinical Research, and Institute with respect to proinflammatory and antiviral strategies and de- of Molecular Virology, University of Muenster; and †Department of Pediatrics, Uni- versity Hospital of Muenster, Muenster, Germany lineating the responsible signaling cascades will allow the de- velopment of novel therapeutic strategies. Received for publication December 28, 2009. Accepted for publication October 29, 2010. To approach to these objectives, we performed comparative This work was supported by the Bundesministerium fu¨r Bildung, Wissenschaft, For- global gene expression studies of ECs infected with HPAIV of the schung und Technologie Zoonosis Network FluResearchNet (Grant 01KI07130). H7N7 and H5N1 subtype and a low pathogenic human influenza D.V. and J.R. were supported by grants from the Interdisciplinary Center of Clinical virus of the H1N1 subtype to identify H5N1 specific gene response Research University of Muenster. subpatterns. In line with recent findings of our group, we confirm Address correspondence and reprint requests to Dr. Dorothee Viemann, Institute of k Immunology, University of Muenster, Roentgenstr. 21, D-48149 Muenster, Germany. a remarkable NF- B dependency of the H5N1-induced gene ex- E-mail address: [email protected] pression program (18), which we demonstrate to be much weaker The online version of this article contains supplemental material. or not relevant for infections with the other influenza strains. Abbreviations used in this paper: BS, binding site; EC, endothelial cell; FC, fold Concurrently, infections with H5N1 were characterized by a strik- change; FPV, A/FPV/Bratislava/79 (H7N7) fowl plague virus; HPAIV, highly patho- ing attenuation of the IFN-b–dependent antiviral response. Fur- genic avian influenza virus; IKK2kd, kinase-dead IkB kinase 2; IRF, IFN regulatory factor; ISRE, IFN-stimulated response element; MDCK, Madin-Darby canine kidney; thermore, we reveal HMGA1 as a novel transcription factor to be MOI, multiplicity of infection; PCA, principal component analysis; p.i., postinfection; specifically responsible for the overwhelming proinflammatory PR8, A/PR8/34 (H1N1); qRT-PCR, quantitative real-time RT-PCR; siRNA, short in- but not antiviral response in H5N1 infections, whereas NFATC4 terfering RNA; SIRS, systemic inflammatory response syndrome; wt, wild-type. was found to be a transcriptional regulator of specifically H5N1- Copyright Ó 2010 by The American Association of Immunologists, Inc. 0022-1767/10/$16.00 induced genes. We describe for the first time, to our knowledge, www.jimmunol.org/cgi/doi/10.4049/jimmunol.0904170 The Journal of Immunology 165 MDCKII were cultured in MEM (PAA Laboratories, Pasching, Austria) containing 10% v/v FCS and 100 U/ml penicillin/0.1 mg/ml streptomycin (13 penicillin/streptomycin) (Life Technologies, Carlsbad, CA). A/PR8/ 34 (H1N1) (PR8) was cultivated in 11-d-old embryonic chicken as de- scribed previuosly (19). Allantoic liquid containing viral particles was harvested 50 h postinfection (p.i.). HUVECs were obtained from Cambrex (Charles City, IA) and cultured as described elsewhere (20, 21). HUVECs between passages 5 and 7 were infected with a multiplicity of infection (MOI) of 5 of each viral strain. For the plaque assay, MDCK cells grown 100% confluent in six-well dishes were washed with PBS and infected with serial dilutions of culture FIGURE 1. Infectibility of HUVECs with different strains of influenza supernatants in PBS containing 0.2% bovine serum albumin, 1 mM MgCl2, viruses. Lysates of uninfected HUVECs (ctrl) and PR8-, FPV-, and H5N1- 0.9 mM CaCl2, 100 U/ml penicillin, and 0.1 mg/ml streptomycin for 30 infected HUVECs were immunoblotted 3, 5, and 8 h p.i. for viral proteins min at 37˚C. The inoculum was aspirated, and cells were incubated with PB1 (86 kDa), M1 (27 kDa), and NS1 (26 kDa). Immunostaining of ERK1/ 2 ml MEM medium containing 0.2% BSA and antibiotics supplemented with 0.6% agar (Oxoid, Cambridge, U.K.), 0.3% DEAE-dextran (GE 2 served as protein loading control. Healthcare Bio-Sciences AB, Uppsala, Sweden), and 1.5% NaHCO3 at 37˚C, 5% CO2 for 2 to 3 d. Virus plaques were visualized by staining with defined signaling patterns specifically activated by H5N1, which, neutral-red or Coomassie blue (0.1% Coomassie
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids
    Supplementary Materials: Evaluation of cytotoxicity and α-glucosidase inhibitory activity of amide and polyamino-derivatives of lupane triterpenoids Oxana B. Kazakova1*, Gul'nara V. Giniyatullina1, Akhat G. Mustafin1, Denis A. Babkov2, Elena V. Sokolova2, Alexander A. Spasov2* 1Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences, 71, pr. Oktyabrya, 450054 Ufa, Russian Federation 2Scientific Center for Innovative Drugs, Volgograd State Medical University, Novorossiyskaya st. 39, Volgograd 400087, Russian Federation Correspondence Prof. Dr. Oxana B. Kazakova Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences 71 Prospeсt Oktyabrya Ufa, 450054 Russian Federation E-mail: [email protected] Prof. Dr. Alexander A. Spasov Scientific Center for Innovative Drugs of the Volgograd State Medical University 39 Novorossiyskaya st. Volgograd, 400087 Russian Federation E-mail: [email protected] Figure S1. 1H and 13C of compound 2. H NH N H O H O H 2 2 Figure S2. 1H and 13C of compound 4. NH2 O H O H CH3 O O H H3C O H 4 3 Figure S3. Anticancer screening data of compound 2 at single dose assay 4 Figure S4. Anticancer screening data of compound 7 at single dose assay 5 Figure S5. Anticancer screening data of compound 8 at single dose assay 6 Figure S6. Anticancer screening data of compound 9 at single dose assay 7 Figure S7. Anticancer screening data of compound 12 at single dose assay 8 Figure S8. Anticancer screening data of compound 13 at single dose assay 9 Figure S9. Anticancer screening data of compound 14 at single dose assay 10 Figure S10.
    [Show full text]
  • Disruption of the Neuronal PAS3 Gene in a Family Affected with Schizophrenia D Kamnasaran, W J Muir, M a Ferguson-Smith,Dwcox
    325 ORIGINAL ARTICLE J Med Genet: first published as 10.1136/jmg.40.5.325 on 1 May 2003. Downloaded from Disruption of the neuronal PAS3 gene in a family affected with schizophrenia D Kamnasaran, W J Muir, M A Ferguson-Smith,DWCox ............................................................................................................................. J Med Genet 2003;40:325–332 Schizophrenia and its subtypes are part of a complex brain disorder with multiple postulated aetiolo- gies. There is evidence that this common disease is genetically heterogeneous, with many loci involved. See end of article for In this report, we describe a mother and daughter affected with schizophrenia, who are carriers of a authors’ affiliations t(9;14)(q34;q13) chromosome. By mapping on flow sorted aberrant chromosomes isolated from lym- ....................... phoblast cell lines, both subjects were found to have a translocation breakpoint junction between the Correspondence to: markers D14S730 and D14S70, a 683 kb interval on chromosome 14q13. This interval was found to Dr D W Cox, 8-39 Medical contain the neuronal PAS3 gene (NPAS3), by annotating the genomic sequence for ESTs and perform- Sciences Building, ing RACE and cDNA library screenings. The NPAS3 gene was characterised with respect to the University of Alberta, genomic structure, human expression profile, and protein cellular localisation to gain insight into gene Edmonton, Alberta T6G function. The translocation breakpoint junction lies within the third intron of NPAS3, resulting in the dis- 2H7, Canada; [email protected] ruption of the coding potential. The fact that the bHLH and PAS domains are disrupted from the remain- ing parts of the encoded protein suggests that the DNA binding and dimerisation functions of this Revised version received protein are destroyed.
    [Show full text]
  • Transcription Factor P73 Regulates Th1 Differentiation
    ARTICLE https://doi.org/10.1038/s41467-020-15172-5 OPEN Transcription factor p73 regulates Th1 differentiation Min Ren1, Majid Kazemian 1,4, Ming Zheng2, JianPing He3, Peng Li1, Jangsuk Oh1, Wei Liao1, Jessica Li1, ✉ Jonathan Rajaseelan1, Brian L. Kelsall 3, Gary Peltz 2 & Warren J. Leonard1 Inter-individual differences in T helper (Th) cell responses affect susceptibility to infectious, allergic and autoimmune diseases. To identify factors contributing to these response differ- 1234567890():,; ences, here we analyze in vitro differentiated Th1 cells from 16 inbred mouse strains. Haplotype-based computational genetic analysis indicates that the p53 family protein, p73, affects Th1 differentiation. In cells differentiated under Th1 conditions in vitro, p73 negatively regulates IFNγ production. p73 binds within, or upstream of, and modulates the expression of Th1 differentiation-related genes such as Ifng and Il12rb2. Furthermore, in mouse experimental autoimmune encephalitis, p73-deficient mice have increased IFNγ production and less dis- ease severity, whereas in an adoptive transfer model of inflammatory bowel disease, transfer of p73-deficient naïve CD4+ T cells increases Th1 responses and augments disease severity. Our results thus identify p73 as a negative regulator of the Th1 immune response, suggesting that p73 dysregulation may contribute to susceptibility to autoimmune disease. 1 Laboratory of Molecular Immunology and the Immunology Center, National Heart, Lung, and Blood Institute, Bethesda, MD 20892-1674, USA. 2 Department of Anesthesia, Stanford University School of Medicine, Stanford, CA 94305, USA. 3 Laboratory of Molecular Immunology, National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892, USA. 4Present address: Department of Biochemistry and Computer Science, Purdue University, West ✉ Lafayette, IN 37906, USA.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Regulation of Expression and Activity of the Bhlh-PAS Transcription
    Regulation of Expression and Activity of the bHLH-PAS Transcription Factor NPAS4 David Christopher Bersten B.Sc. (Biomedical Science), Honours (Biochemistry) A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy Discipline of Biochemistry School of Molecular and Biomedical Science University of Adelaide, Australia June 2014 1 Contents Abstract ................................................................................................................................................... 3 PhD Thesis Declaration ........................................................................................................................... 5 Acknowledgements ................................................................................................................................. 6 Publications ............................................................................................................................................. 8 Conference oral presentations ........................................................................................................... 9 Additional publications ....................................................................................................................... 9 Chapter 1: .............................................................................................................................................. 10 Introduction .....................................................................................................................................
    [Show full text]
  • (Ubl-Ptms): Small Peptides with Huge Impact in Liver Fibrosis
    cells Review Ubiquitin-Like Post-Translational Modifications (Ubl-PTMs): Small Peptides with Huge Impact in Liver Fibrosis 1 1, 1, Sofia Lachiondo-Ortega , Maria Mercado-Gómez y, Marina Serrano-Maciá y , Fernando Lopitz-Otsoa 2, Tanya B Salas-Villalobos 3, Marta Varela-Rey 1, Teresa C. Delgado 1,* and María Luz Martínez-Chantar 1 1 Liver Disease Lab, CIC bioGUNE, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), 48160 Derio, Spain; [email protected] (S.L.-O.); [email protected] (M.M.-G.); [email protected] (M.S.-M.); [email protected] (M.V.-R.); [email protected] (M.L.M.-C.) 2 Liver Metabolism Lab, CIC bioGUNE, 48160 Derio, Spain; fl[email protected] 3 Department of Biochemistry and Molecular Medicine, School of Medicine, Autonomous University of Nuevo León, Monterrey, Nuevo León 66450, Mexico; [email protected] * Correspondence: [email protected]; Tel.: +34-944-061318; Fax: +34-944-061301 These authors contributed equally to this work. y Received: 6 November 2019; Accepted: 1 December 2019; Published: 4 December 2019 Abstract: Liver fibrosis is characterized by the excessive deposition of extracellular matrix proteins including collagen that occurs in most types of chronic liver disease. Even though our knowledge of the cellular and molecular mechanisms of liver fibrosis has deeply improved in the last years, therapeutic approaches for liver fibrosis remain limited. Profiling and characterization of the post-translational modifications (PTMs) of proteins, and more specifically NEDDylation and SUMOylation ubiquitin-like (Ubls) modifications, can provide a better understanding of the liver fibrosis pathology as well as novel and more effective therapeutic approaches.
    [Show full text]
  • Genome-Wide Screen for Genes Involved in Edna Release During
    Genome-wide screen for genes involved in eDNA PNAS PLUS release during biofilm formation by Staphylococcus aureus Alicia S. DeFrancescoa,1, Nadezda Masloboevaa,1, Adnan K. Syeda, Aaron DeLougherya,b, Niels Bradshawa, Gene-Wei Lib, Michael S. Gilmorec,d, Suzanne Walkerd, and Richard Losicka,2 aDepartment of Molecular and Cellular Biology, Harvard University, Cambridge, MA 02138; bDepartment of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142; cDepartment of Ophthalmology, Harvard Medical School, Massachusetts Eye and Ear Infirmary, Boston, MA 02114; and dDepartment of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115 Edited by Ralph R. Isberg, Howard Hughes Medical Institute, Tufts University School of Medicine, Boston, MA, and approved June 13, 2017 (received for review March 20, 2017) Staphylococcus aureus is a leading cause of both nosocomial and We have shown that the major components of the biofilm community-acquired infection. Biofilm formation at the site of infec- matrix of HG003 are proteins and eDNA, which associate with tion reduces antimicrobial susceptibility and can lead to chronic infec- the biofilm in a manner that depends on a drop in pH during tion. During biofilm formation, a subset of cells liberate cytoplasmic growth in the presence of glucose (5, 6). Many of these proteins proteins and DNA, which are repurposed to form the extracellular are cytoplasmic in origin and are thus moonlighting in their matrix that binds the remaining cells together in large clusters. Using second role as components of the biofilm matrix (5). These a strain that forms robust biofilms in vitro during growth under glu- moonlighting proteins do not depend on eDNA to remain as- cose supplementation, we carried out a genome-wide screen for genes sociated with cells.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Ion Channels 3 1
    r r r Cell Signalling Biology Michael J. Berridge Module 3 Ion Channels 3 1 Module 3 Ion Channels Synopsis Ion channels have two main signalling functions: either they can generate second messengers or they can function as effectors by responding to such messengers. Their role in signal generation is mainly centred on the Ca2 + signalling pathway, which has a large number of Ca2+ entry channels and internal Ca2+ release channels, both of which contribute to the generation of Ca2 + signals. Ion channels are also important effectors in that they mediate the action of different intracellular signalling pathways. There are a large number of K+ channels and many of these function in different + aspects of cell signalling. The voltage-dependent K (KV) channels regulate membrane potential and + excitability. The inward rectifier K (Kir) channel family has a number of important groups of channels + + such as the G protein-gated inward rectifier K (GIRK) channels and the ATP-sensitive K (KATP) + + channels. The two-pore domain K (K2P) channels are responsible for the large background K current. Some of the actions of Ca2 + are carried out by Ca2+-sensitive K+ channels and Ca2+-sensitive Cl − channels. The latter are members of a large group of chloride channels and transporters with multiple functions. There is a large family of ATP-binding cassette (ABC) transporters some of which have a signalling role in that they extrude signalling components from the cell. One of the ABC transporters is the cystic − − fibrosis transmembrane conductance regulator (CFTR) that conducts anions (Cl and HCO3 )and contributes to the osmotic gradient for the parallel flow of water in various transporting epithelia.
    [Show full text]
  • Cav1.2 and Cav1.3 Voltage-Gated L-Type Ca2+ Channels in Rat White Fat Adipocytes
    244 2 Journal of O A Fedorenko et al. Ca channels in white 244:2 369–381 Endocrinology adipocytes RESEARCH CaV1.2 and CaV1.3 voltage-gated L-type Ca2+ channels in rat white fat adipocytes Olena A Fedorenko1, Pawitra Pulbutr2, Elin Banke3, Nneoma E Akaniro-Ejim1, Donna C Bentley4, Charlotta S Olofsson3, Sue Chan1 and Paul A Smith1 1School of Life Sciences, University of Nottingham, Nottingham, UK 2Faculty of Pharmacy, Mahasarakham University, Mahasarakham, Thailand 3Department of Physiology/Metabolic Physiology, Institute of Neuroscience and Physiology, The Sahlgrenska Academy at University of Gothenburg, Göteborg, Sweden 4School of Sport, Exercise and Health Sciences, Loughborough University, Loughborough, UK Correspondence should be addressed to P A Smith: [email protected] Abstract L-type channel antagonists are of therapeutic benefit in the treatment of Key Words 2+ hyperlipidaemia and insulin resistance. Our aim was to identify L-type voltage-gated Ca f adipocyte 2+ channels in white fat adipocytes, and determine if they affect intracellular Ca , lipolysis f calcium channel and lipogenesis. We used a multidisciplinary approach of molecular biology, confocal f lipolysis 2+ microscopy, Ca imaging and metabolic assays to explore this problem using adipocytes f obesity isolated from adult rat epididymal fat pads. CaV1.2, CaV1.3 and CaV1.1 alpha1, beta and alpha2delta subunits were detected at the gene expression level. The CaV1.2 and CaV1.3 alpha1 subunits were identified in the plasma membrane at the protein level. Confocal microscopy with fluorescent antibodies labelled CaV1.2 in the plasma membrane. 2+ 2+ 2+ Ca imaging revealed that the intracellular Ca concentration, [Ca ]i was reversibly decreased by removal of extracellular Ca2+, an effect mimicked by verapamil, nifedipine and Co2+, all blockers of L-type channels, whereas the Ca2+ channel agonist BAY-K8644 2+ increased [Ca ]i.
    [Show full text]
  • The Methamphetamine-Induced RNA Targetome of Hnrnp H in Hnrnph1 Mutants Showing Reduced Dopamine Release and Behavior
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.06.451358; this version posted July 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The methamphetamine-induced RNA targetome of hnRNP H in Hnrnph1 mutants showing reduced dopamine release and behavior Qiu T. Ruan1,2,3, Michael A. Rieger4, William B. Lynch2,5, Jiayi W. Cox6, Jacob A. Beierle1,2,3, Emily J. Yao2, Amarpreet Kandola2, Melanie M. Chen2, Julia C. Kelliher2, Richard K. Babbs2, Peter E. A. Ash7, Benjamin Wolozin7, Karen K. Szumlinski8, W. Evan Johnson9, Joseph D. Dougherty4, and Camron D. Bryant1,2,3* 1. Biomolecular Pharmacology Training Program, Department of Pharmacology and Experimental Therapeutics, Boston University School of Medicine 2. Laboratory of Addiction Genetics, Department of Pharmacology and Experimental Therapeutics and Psychiatry, Boston University School of Medicine 3. Transformative Training Program in Addiction Science, Boston University School of Medicine 4. Department of Genetics, Department of Psychiatry, Washington University School of Medicine 5. Graduate Program for Neuroscience, Boston University 6. Programs in Biomedical Sciences, Boston University School of Medicine 7. Department of Pharmacology and Experimental Therapeutics and Neurology, Boston University School of Medicine 8. Department of Psychological and Brain Sciences, University of California, Santa Barbara 9. Department of Medicine, Computational Biomedicine, Boston University School of Medicine *Corresponding Author Camron D. Bryant, Ph.D. Department of Pharmacology and Experimental Therapeutics and Department of Psychiatry 72 E.
    [Show full text]