sign in sign up
<<
Home , Cryptosporidium hominis, Cryptosporidium muris, Cryptosporidium varanii

STUDIES IN :

MAINTENANCE OF STABLE POPULATIONS THROUGH IN VIVO

PROPOGATION AND MOLECULAR DETECTION STRATEGIES

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of

Philosophy in the Graduate School of the Ohio State University

By

Norma E. Ramirez, M.P.H.

! ! ! !

The Ohio State University 2005

Dissertation Committee: Approved by

Dr. Srinand Sreevatsan, Adviser Dr. Y.M. Saif ______Dr. Roger W. Stich Adviser Dr. Lucy A. Ward Graduate Program in Veterinary Preventive Medicine

ABSTRACT

Cryptosporidiosis, an infection caused by several genotypically and phenotypically diverse Cryptosporidium species, is a serious enteric disease of animals and humans worldwide. The current understanding of , transmission, diagnosis, treatment and prevention measures for this disease is discussed.

Contaminated water represents the major source of Cryptosporidium infections for humans. Manure from cattle can be a major source of Cryptosporidium oocysts.

Oocysts transport to surface water can occur through direct fecal contamination, surface transport from land-applied manure or leaching through the soil to groundwater.

Identification of Cryptosporidium species and genotypes facilitates determining the origin of the oocysts and to recognize sources of infection in outbreak situations and the risk factors associated with transmission. Very few studies have applied isolation methods to field samples because of difficulties with detection of oocysts in environmental samples. The objective of this study was to develop an easy method that can be applied to field samples to rapidly detect the presence of Cryptosporidium oocysts and identify their species. A molecular detection system that included an oocyst recovery method combined with spin column DNA extraction, followed by PCR- hybridization for detection and a Real-Time PCR-melting curve analysis for species

ii assignment. Due to its versatility and capability of rapid high-throughput analysis of multiple targets, an oligonucleotide microarray was also designed to identify

Cryptosporidium parasites and discriminate between species. The detection assay was then used to assess Cryptosporidium contamination in swine and poultry samples and to study the transport of Cryptosporidium oocysts through disturbed (tilled) and non- disturbed (no-till) soil during simulated rainfall. The results of the study demonstrated the potential of the assay for the detection of the parasite in environmental samples.

In vitro cultivation systems that permit Cryptosporidium development and propagation are still under development; therefore clonal reference strains are not available. Using micromanipulation, single-cell clones of C. hominis were derived and maintained in a gnotobiotic pig model. Genetic stability of each subsequent generation was monitored through microsatellite fingerprinting and sequence analysis. The results indicated that these single oocyst derivatives led to the expansion and maintenance of genetically and phenotypically homogeneous populations.

iii

Dedicated to

My parents, Danilo and Norma

and

My husband, Juan

iv

ACKNOWLEDGMENTS

I would like to express my appreciation and gratitude to everyone who collaborated in my doctoral training and research providing guidance, support and friendship:

My advisor, Dr. Srinand Sreevatsan

The members of my committee, Dr. Y. M. Saif, Dr. Roger W. Stich and Dr. Lucy A. Ward for her role as my advisor during the first part of my training.

My friends in the laboratory, Chris, Sonia, Matt, Mohamed, Ellen, Megan, Mike, Alifiya, Harish, David, Kaori, Sukhbir, and Zhu.

The members of the Food Animal Health Research Program

Dr. Raymond Clarke and Mrs. Gloria Clarke

My family and friends

My husband

¡Muchas Gracias!

v

VITA

August 3, 1973 …… Born - San Juan, Puerto Rico

1995 ………………. Bachelor of Sciences, Biology. Department of Biology, School of Arts and Sciences, University of Puerto Rico, Mayaguez Campus, Mayaguez, Puerto Rico. Magna Cum Laude.

1995 – 1996 ………. Biologist I, Puerto Rico Department of Agriculture, Agrological Laboratory, Dorado, Puerto Rico.

1997 ………………. Master in Public Health, Epidemiology. Department of Biostatistics and Epidemiology, School of Public Health, University of Puerto Rico, Medical Sciences Campus, San Juan, Puerto Rico.

1997 – 1999 ………. Research Assistant, Department of Biostatistics and Epidemiology, School of Public Health, University of Puerto Rico, Medical Sciences Campus, San Juan, Puerto Rico.

2000 – 2001 ………. Research Assistant, Department of Veterinary Preventive Medicine and Food Animal Health Research Program, Ohio Agricultural Research and Development Center, The Ohio State University, Wooster, Ohio.

2001-present ……… PhD Candidate. Department of Veterinary Preventive Medicine and Food Animal Health Research Program, Ohio Agricultural Research and Development Center, College of Veterinary Medicine, The Ohio State University, Columbus, Ohio.

vi

PUBLICATIONS

Peer Review Journals

1. Pereira SJ, Ramirez NE, Xiao L, Ward LA. Pathogenesis of human and bovine in gnotobiotic pigs. J. Infect. Dis. 2002 Sep 1;186(5):715-8.

2. Ramirez NE, Ward LA, Sreevatsan S. A review of the biology and epidemiology of cryptosporidiosis in humans and animals. Microbes Infect. 2004 Jul;6(8):773-85.

FIELD OF STUDY

Major Field: Veterinary Preventive Medicine Studies in Parasitology and Molecular Epidemiology

vii

TABLE OF CONTENTS

Page

Abstract …………………………………………………………………………... ii

Dedication ………………………………………………………………………... iv

Acknowledgments ……………………………………………………………….. v

Vita ………………………………………………………………………………. vi

List of Tables …………………………………………………………………….. x

List of Figures ………………………………………………………………...... xii

Chapters:

1. Introduction ………………………………………………………………...... 1

Cryptosporidium biology …………………………………………………….. 4 Cryptosporidium and strain variation …………………………….. 5 Cryptosporidium infection and cryptosporidiosis…………………………….. 8 Cryptosporidium diagnosis and molecular detection methods ………………. 19 Treatment …………………………………………………………………….. 22 Prevention and control ……………………………………………………….. 24 Conclusion …………………………………………………………………… 29 References ……………………………………………………………………. 31

2. Development of a sensitive detection system for Cryptosporidium in environmental samples ………………………………………………………... 51

Introduction …………………………………………………………………… 51 Materials and methods………………………………………………………… 53 Results…………………………………………………………………………. 61 Discussion……………………………………………………………………... 63 References …………………………………………………………………...... 68

viii

3. Cryptosporidium detection by oligonucleotide microarray …………………... 83

Introduction …………………………………………………………………… 83 Materials and methods………………………………………………………… 85 Results…………………………………………………………………………. 89 Discussion……………………………………………………………………... 90 References …………………………………………………………………...... 94

4. Effect of soil tillage and rainfall on the transport of Cryptosporidium through soil …………………………………………………………………... 104

Introduction …………………………………………………………………… 104 Materials and methods………………………………………………………… 107 Results…………………………………………………………………………. 111 Discussion……………………………………………………………………... 113 References ……………………………………………………………………. 117

5. Derivation of progeny in the gnotobiotic pig model …………………………………………………………………………. 127

Introduction …………………………………………………………………… 127 Materials and methods………………………………………………………… 129 Results…………………………………………………………………………. 133 Discussion…………………………………………………………………...… 137 References …………………………………………………………………..… 144

Appdendix A: Swine and poultry operations sample description …………….….. 153

Bibliography…………………………………………………………………….... 163

ix

LIST OF TABLES

Page Table 1.1 Valid taxonomic nomenclature of Cryptosporidium species and their 49 host range.

Table 1.2 Cryptosporidium species and genotypes reported in human 50 infections.

Table 2.1 Primers used for the construction of the Internal Positive Control. 71

Table 2.2 Mean absorbance at 450nm of PCR-Hybridization products from 72 Cryptosporidium spiked soil samples.

Table 2.3 Mean absorbance at 450nm of PCR-Hybridization products from 72 Cryptosporidium spiked water samples.

Table 2.4 Melting temperature of the hybridization probes for different 73 Cryptosporidium species in five independent assays.

Table 2.5 Procedures for Cryptosporidium oocysts purification and detection 74 for different types of environmental samples.

Table 2.6 Number of Cryptosporidium-positive samples from swine 74 operations under different waste management technologies.

Table 2.7 Number of Cryptosporidium-positive samples from poultry 74 operations under different waste management technologies.

Table 2.8 Melting temperatures (Tm) of hybridization probes for swine and 75 poultry positive samples.

Table 3.1 Primer sequences for PCR amplification of Cryptosporidium 18s 96 rDNA, hsp70, and β-tubulin genes and universal 16s rRNA primers.

Table 3.2 Sequences of microarray capture probes. 97

x

Table 3.3 18s rDNA nucleotide sequences used for the design of the five 98 Cryptosporidium species specific capture probes.

Table 4.1 Presence of Crytposporidium parvum oocysts in the block sections of tilled (T) and no-tilled (NT) soil after rainfall treatments (T2, T3, 121 T5, T6).

Table 5.1 Summary of Cryptosporidium hominis oocyst passages performed in 148 gnotobiotic pigs.

Table 5.2 Frequency of nucleotide base substitutions among cloned C. hominis 149 β-tubulin and GP60 genes sequences.

Table 5.3 Summary of microsatellite polymorphisms by Cryptosporidium 150 hominis oocyst passages.

xi

LIST OF FIGURES

Page Figure 2.1 NaCl flotation method for oocyst recovery from soil samples, modified from Kuczynska and Shelton, 1999 (s.g., specific 76 gravity, dH2O, distilled water).

Figure 2.2 Sugar flotation method for oocyst recovery from soil samples 77 modified from Kato and Bowman, 2002.

Figure 2.3 Construction of Internal Positive Control (IPC). Primers C1 and 78 C2 amplify both Cryptosporidium DNA and IPC.

Figure 2.4 Gel electrophoresis of PCR products from spiked soil samples 79 after different recovery/purification methods.

Figure 2.5 Gel electrophoresis of PCR products from spiked soil samples 80 after sucrose flotation method.

Figure 2.6 Gel electrophoresis of PCR products from spiked soil samples 81 after sucrose flotation method.

Figure 2.7 Melting peaks of hybridization probes for different 82 Cryptosporidium species.

Figure 3.1 Microarray hybridization of Cryptosporidium hominis. 99

Figure 3.2 Microarray hybridization of Cryptosporidium parvum. 100

Figure 3.3 Microarray hybridization of Cryptosporidium meleagridis. 101

Figure 3.4 Microarray hybridization of Cryptosporidium canis. 102

Figure 3.5 Microarray hybridization of Cryptosporidium felis. 103

Figure 4.1 Rainfall treatments. 122

xii

Figure 4.2 Number of Cryptosporidium parvum oocysts recovered from leachate of tilled and no-till soil blocks under different rainfall 123 treatments (T1-T6).

Figure 4.3 Number of Cryptosporidium parvum oocysts recovered from blocks of tilled and no-tilled soil under different rainfall 124 treatments.

Figure 4.4 Distribution of Cryptosporidium parvum oocysts remaining in 125 no-till and tilled soil.

Figure 4.5 Distribution of Cryptosporidium parvum oocysts remaining in 126 soil blocks exposed to simulated rainfall treatments.

Figure 5.1 Positions of polymorphisms amongst Cryptosporidium hominis 151 β-tubulin gene by generation.

Figure 5.2 Positions of polymorphisms amongst Cryptosporidium hominis 152 GP60 gene by generation.

xiii

CHAPTER 1

INTRODUCTION

A REVIEW OF THE BIOLOGY AND EPIDEMIOLOGY OF

CRYPTOSPORIDIOISIS IN HUMANS AND ANIMALS.

The initial reports of Cryptosporidium infection in mice were published by

Tyzzer in 1907 (1). In 1955, Slavin described the parasite as a potential cause of in turkeys (2). Cryptosporidiosis in calves was subsequently recognized in the

1970s (3). But it was not until Cryptosporidium infections were reported as a cause of death in AIDS patients in the 1980s that the protozoan parasite became accepted as a significant human pathogen warranting scientific research (4). Cryptosporidium sparked great public health interest after the large human waterborne outbreak in Milwaukee in

1993 (5) and rapidly became recognized as one of the most serious and difficult to control waterborne pathogens to date. Subsequent reports have demonstrated its worldwide distribution and zoonotic potential (6, 7). Cryptosporidium infections are associated with mild to severe diarrheal disease which is typically self-limiting in the immunocompetent host but often persistent and debilitating in the immunodeficient 1 host. Thus, Cryptosporidium is a serious pathogen of AIDS patients, becoming an

AIDS-defining illness and calling the attention of the medical practice. On the other hand, because diagnosis of cryptosporidiosis is frequently not considered outside of immunodeficiencies, and because many laboratories do not routinely test stool specimens for Cryptosporidium unless specifically requested, the disease in immunocompetent human host continues to be underreported (8).

A single oocyst is sufficient to produce infection and disease in susceptible hosts

(9, 10). Oocysts are commonly transmitted by the fecal-oral route through direct contact, but indirect contamination of food or water, and aerosol transmission of oocysts has also been reported (11). Cases of human-to-human transmission have been reported between family members, sexual partners, children in day-care centers, and hospital patients and staff (6, 12). Zoonotic transmission has been confirmed by epidemiological studies involving pets, farm animals and by accidental infection of veterinary workers

(13-15). Food handled by a contaminated person and food that had been exposed to contaminated water have been sources for food-borne Cryptosporidium infection (16-

18). Food grown in soil fertilized with manure could also be considered as potential source of infection. Contaminated water represents the major source of infections for humans. Cryptosporidium oocysts may remain viable in water for over 140 days (19) and are very resistant to the most common disinfectants (20) making them difficult to destroy by conventional chlorination treatment. Outbreaks have been associated with contamination of surface waters, well waters, swimming pools, and public water

2 supplies. In the United States (US), the parasite has been identified in 80-97% of all surface waters (rivers, lakes, ponds, etc.) (21). Studies have shown that up to 97% of the surface waters serving water treatment plants and 54% of treated (filtered and chlorinated) waters contain low numbers of Cryptosporidium oocysts (22, 23).

Likewise, recreational waters like swimming pools, ponds and fountains can be contaminated with sewage or feces of infected animals or humans (24-26).

Waterborne outbreaks have been attributed to agricultural sources, particularly cattle due to the high prevalence of infection among calves. However, these implications have rarely been confirmed during outbreak investigations. With the advances in molecular techniques and the development of highly sensitive detection and genotyping methods, better assessment of the sources and causes of Cryptosporidium outbreaks are finally being accomplished. The potential risk of the Cryptosporidium infection in wildlife and companion animals is uncertain but of increasing concern.

There have been reports of infected dogs and cats (27, 28) and Cryptosporidium infection has been found in a wide range of wild animals, (29, 30) representing a potentially significant source of environmental contamination and reservoir of parasite for domestic livestock and humans.

3 Cryptosporidium biology

The life cycle of most Cryptosporidium species is completed within the gastrointestinal tract (primarily small intestine and colon) of the host with developmental stages being associated with the luminal surface of the mucosal epithelial cells. Cryptosporidium oocysts are spherical, measuring only 3-6 µm in diameter. Thick-wall oocysts are excreted from the infected host in fecal material and represent the infective stage of the parasite. Infection of Cryptosporidium in a new host results from the ingestion of these oocysts, which release sporozoites that invade the epithelial cells and undergo asexual and sexual multiplication to produce thin-walled and thick-walled oocysts. Thin-walled oocysts can excyst endogenously, resulting in autoinfection, which helps to explain the mechanism of persistent infections (in AIDS patients) in the absence of successive exposure to thick-walled oocyst (6). Depending on the parasite species, host and the host’s immunocompetency, the prepatent period

(time between infection and active oocyst shedding) ranges from one to three weeks, whereas the patent period (duration of oocyst shedding) can range from several days to months or years, (31) demonstrating the potential persistence of this infection.

There is little doubt that C. parvum is the major species responsible for disease in humans and domestic animals such as cattle, horses, sheep, goats and pigs (32).

Although phenotypic differences were traditionally used to distinguish between strains of C. parvum isolated from several host species, molecular epidemiological studies have

4 demonstrated the existence of at least two unique and separate C. parvum genotypes, human (genotype 1) and bovine (genotype 2) (33). The human genotype has recently been re-classified as a different species and named Cryptosporidium hominis (34) for several important reasons. C. hominis infects mainly humans, while C. parvum infections have been reported in numerous animal species including cattle, sheep, goats, pigs, mice, and humans. Morphologically, the two species are nearly indistinguishable; however, genetic differences have been demonstrated (33, 35, 36). In addition, C. parvum and C. hominis showed distinctly different pathological disease patterns in gnotobiotic pigs, and failed to exchange genetic material during dual infections (9).

Cryptosporidium’s unusual location within the host cell, sequestered between the cell cytoplasm and cell membrane, its ability to autoinfect, its innate antimicrobial resistance, and its general lack of host specificity (especially C. parvum) are unique features that distinguish it from other enteric protozoa.

Cryptosporidium taxonomy and strain variation

The genus Cryptosporidium has been classified in the phylum , class Sporozoasida, subclass Coccidiasina, order Eucooccidiida, suborder Eimeriina, family Cryptospordiidae (31). At least 22 species of Cryptosporidium have been named but only 16 are considered valid by most investigators (Table 1.1). (2, 3, 34, 37-62), C. parvum is the most commonly reported species in numerous species of mammals including humans. Originally, species assignment within the genus Cryptosporidium

5 was based on phenotypic characteristics such as host specificity and oocyst morphology. Recently, genetic characterization using specific and reliable techniques such as polymerase chain reaction-restriction fragment length polymorphisms (PCR-

RFLP) and sequence analyses have been employed to discriminate between

Cryptosporidium isolates and to confirm the validity of the species of this genus.

Analysis of the small subunit of the ribosomal DNA gene (18s rDNA) has indicated the existence of up to 23 different genotypes of C. parvum. The most extensively characterized are ‘human’, ‘bovine’, ‘cattle’, ‘pig’, ‘cat’, ‘mouse’, ‘dog’, ‘monkey’,

‘ferret’ and ‘goose’, ‘muskrat’, and ‘masurpial’ genotypes (35, 63). Further analyses confirmed that the human, bovine, pig, cat and dog genotypes are different species.

Whether the rest of the genotypes are part of a single species is still speculative, but as new species are described, new genotypes are continually found such as masurpial genotype II in kangoroos, genotype II in geese, muskrat genotype II, pig genotype II, deer genotype, fox genotype, mongoose genotype, horse genotype, rabbit genotype, unnamed genotypes in geese and reptiles and more (64). Validating these species and genotypes will require the support of morphologic, biologic (phenotypic) and genetic investigations. Sequence analysis of additional genes such as ribosomal internal transcriber spacer (ITS rDNA) regions, oocyst wall protein (COWP), dihydrofolate reductase-tyhymidylate synthase (dhfr-ts), thrombospondin-related adhesion proteins

(TRAP-C1, TRAP-C2), and 70-kDa heat shock protein (hsp70) have differentiated between Cryptosporidium species (C. parvum, C. hominis, C. meleagridis, C. baileyi, C. muris, C. felis, C. serpentis, C. wrairi, C. andersoni) and C. parvum genotypes (pig,

6 ferret, mouse, monkey). For example, phylogenetic analyses based on the 18s rRNA and hsp70 genes indicate that Cryptosporidium forms two major groups. C. muris, C. serpentis, C. andersoni and C.galli constitute one group and C. parvum, C. hominis, C. meleagridis, C. baileyi, C. felis, and C. canis form the other (35, 55, 63, 65). Allelic variations in these loci also indicate significant intraspecies heterogeneity among C. parvum, leading to the recognition of multiple genotypes. C. felis, C. canis and C. baileyi are divergent from the major clades of C. parvum and thus have been classified as different species. While, C. meleagridis and C. wrairi cluster with C. parvum, they are still considered distinct species based on biological or phenotypic characteristics.

Single gene and multilocus genotyping studies of isolates from different geographic localities (e.g. North and South America, Europe, Australia, and Kenya) and hosts have demonstrated considerable inter-species (C. parvum, C. hominis, C. muris,

C. serpentis and C. wrairi) diversity between human and animal isolates and high levels of intraspecies identity, especially among C. parvum, C. hominis and C. wrairi, across countries (66, 67).

Achieving collective agreement on criteria for species assignment within this genus will help physicians, veterinarians and epidemiologists to determine the impact of each species on human and animal health, their zoonotic potential, transmission mechanisms and preventive measures. The taxonomy remains controversial and the epidemiology of different species is unclear although implementation of the newer

7 molecular tools that have recently become available should help clarify

Cryptosporidium diversity and improve our understanding of the parasite. Recently, analysis of the 18s rRNA has suggested that Cryptosporidium is more closely related to gregarines than to coccidian (68). This finding is supported by the observation that

Cryptosporidium and the gregarines have similar life cycle stages (69). Further studies are required to confirm the classification and validity of Cryptosporidium spp. not only for taxonomic purposes, but also for adequate diagnosis and treatment.

Cryptosporidium infection and cryptosporidiosis

Cryptosporidium primarily infects the micovillous border of the small intestinal epithelium, spreading to the biliary or pancreatic tract causing acute gastrointestinal disease. The parasite resides at the apical surface of the intestinal epithelial cells and is a minimally invasive mucosal pathogen because the sporozoites do not actively penetrate host cell membranes. Despite this fact, strong humoral and cell-mediated responses following primary and secondary infection are elicited by Cryptosporidium infection

(70). The infection induces blunting of the small intestinal villi, hyperplasia of the intestinal crypt cells and infiltration of inflammatory cells into the lamina propria (71).

The resulting diarrhea appears to be malapsorptive caused by villi tip cell damage and

− impaired glucose-stimulated Na and H2O absorption (71). However, late in the

− infection, increased Cl secretion induced by prostaglandin E2 (PGE2) is observed (72).

In addition, the immune system, in response to the production of proinflammatory

8 cytokines such as TNF-α and IL-8, may amplify the secretory response. CD4+ T-helper cells and interferon-γ also play major roles in the immune response to cryptosporidiosis

(70).

Human infections

Contaminated water represents the major source of Cryptosporidium infections for humans. Several waterborne outbreaks of cryptosporidiosis have been reported that implicated contaminated drinking water and recreational water (24, 26). The most severe and largest human waterborne outbreak occurred in Milwaukee in 1993, where more than 400,000 people were infected (5). Cryptosporidiosis in humans typically manifests itself as a self-limiting disease with a median duration of 9-15 days, resulting in total recovery in healthy individuals. The major symptom is watery diarrhea associated with abdominal cramps, anorexia, weight loss, nausea, vomiting, fatigue and low-grade fever (73). Symptoms are similar in children and adults although cryptosporidiosis acquired during infancy may have permanent effects on growth and development (74). However, it is in the immunocompromised host (due to a variety of causes including but not limited to HIV and AIDS, drugs, organ transplantation, cancer chemotherapy, etc.(75)) that the infections are most chronic and debilitating. Patients can have chronic diarrhea that can last for more than two months, shedding oocysts in stool during the entire period, which contributes to severe dehydration, weight loss and malnutrition, extended hospitalizations, and mortality (75). Thus, the severity and duration of illness clearly depends on the host’s immune status. The groups implicated

9 with higher risks of infection include children and staff in day care centers, farmers and animal handlers, and health care workers. Travelers are at risk when they travel from developed to developing countries with high prevalence of the disease.

At least 10 molecularly different types of Cryptosporidium have been found to infect humans (34, 56, 57, 59, 76-83), (Table 1.2). Excluding C. suis and C. muris, infection with these species have been reported not only in HIV-positive individuals but also in immunocompetent children and adults. In the US, more than 75% of human cryptosporidiosis cases are caused by C. hominis (33, 84). However, in the United

Kingdom (UK) bovine C. parvum is responsible for 61.5% of the human cases and

37.8% of human cryptosporidiosis was caused by C. hominis (76). These differences may be due to the obvious separation between urban and rural populations in the US, while in the UK communities are closely related to agricultural sources (85, 86). The human genotype is also notably predominant in Switzerland, Australia, Kenya, Uganda,

Guatemala and Peru, because it is responsible for 85-92% of the human infections (64,

87).

Infection in animals

As reports of human and animal infections increased, interest in

Cryptosporidium was heightened in the veterinary field, not only because animals were seen as a source of infection for humans, but also because the organism could cause economic losses in production animals and was proving to be very difficult to control.

10 Cryptosporidium infections have now been reported in most domestic animals as well as in a large variety of wild and captive animals since its first identification. Most infections have been described in mammals and are attributed to bovine C. parvum (31).

Young animals appear to be more susceptible to infection and disease while infections in adult animals are often asymptomatic or do not occur. Similar to human cryptosporidiosis, the common symptom in animals is yellow watery diarrhea which leads to dehydration, weight loss, fever, and inappetence. Most (immunocompetent) animals recover within 1 to 2 weeks of infection with supportive fluid therapy (31).

Livestock. Cryptosporidium infections in ruminant species are typically symptomatic in the young. Among cattle, calves are susceptible to infection shortly after birth and remain so for several months (88). Infection in dairy calves are most often detected (via fecal oocyst shedding) between 8 and 15 days of age, while infections in beef calves most often occur between 1 and 2 months of age (89, 90).

Infection in lambs and goat kids is more common in animals under one month old (91).

Infection can be spread animal-to-animal by the fecal-oral route, usually when animals are housed together in an overcrowded environment, but contamination of udders and water supplies by feces is another common source for transmission in livestock.

Transmission of the bovine genotype of C. parvum from calves to humans is established (92, 93). It is estimated that 50% or more of all dairy calves will shed detectable numbers of oocysts and that the parasite is present on more than 90% of all

11 US dairy farms (94). This high prevalence of infected calves underscores the risk of drinking unpasteurized milk. Milk can be contaminated through mechanisms of poor udder hygiene, and some recent outbreaks of human cryptosporidiosis have been associated with drinking unpasteurized milk (95, 96). Furthermore, the large number of oocysts excreted during infection help to ensure a high level of environmental contamination. Although not always confirmed, cattle facilities are frequently blamed when Cryptosporidium is found in surface waters. Thus, cattle living in close proximity to rivers should be considered potential causes of waterborne contamination as surface run-off does transport Cryptosporidium oocysts in soils to water sources.

The calving season has been associated with outbreaks of cryptosporidiosis in beef and dairy cattle, (94, 97, 98) but it is not clear if the adult cattle are the source of infection for newborn calves or if transmission occurs in the other direction. Stress on cattle and environmental conditions may increase disease incidence during the calving season. Cryptosporidium oocysts are resistant to many unfavorable environmental conditions and can be well preserved in the cold and wet environment surrounding the calving grounds. The presence of high concentrations of the parasite when cattle are overcrowded is also related to higher rates of infection. Another risk factor identified for increasing probability of calves shedding oocysts is frequent bedding changes as personnel and equipment used for removal of the bedding can become a vehicle for spreading the infection (94). Herds with wells as their principal water sources are associated with lower concentrations of the parasite compared to herds with access to

12 dug-out and run-off water sources (99). Contamination of dug-out water sources (i.e. ponds) due to the direct defecation by an infected animal into the water source, resulting in subsequent infections in other members of the herd, may account for these differences.

Unlike young ruminants, infections in swine and horses are typically asymptomatic, even in young animals, provided animals are not under extreme stress or immunologically compromised (i.e.- severe combined immunodeficiency (SCID) in foals) (100, 101). However, serious naturally occurring problematic cryptosporidial infections in nursing piglets (< 3 weeks of age) have been reported in Europe (102), and experimental infection and disease can be readily induced in piglets inoculated before

14 days of age (103). Experimental challenge in older pigs typically results in infection but not clinical disease (40). Interestingly, horses and swine are not considered an important source of environmental contamination. Cryptosporidiosis in these species is not well-studied, so their potential or actual contribution to environmental contamination is unknown (7). Most of the epidemiological studies on cryptosporidial infection have focused on cattle or humans, ignoring swine and equine populations. In fact, several episodes of swine and equine infections have been reported in a variety of geographical localities globally and have been connected with diarrhea and morbidity.

In Southern California, a prevalence of 5% was reported in feeder pigs and butcher hogs. There was shedding of oocysts by both clinically healthy pigs and those with diarrhea (104). In Canada, Cryptosporidium was identified in hog operations with an

13 overall prevalence of 11% (105). Higher prevalence of Cryptosporidium infection in pigs have been reported in Spain (21.9%) (100) and Trinidad (19.6%) (106) with asymptomatic infection in most of the pigs and higher rates in 1-2 months old pigs.

There is scarce information concerning equine Cryptosporidium infection but best estimates derived from several studies indicate that the infection is common in foals and adult horses, with a prevalence of 6.4% in the UK (107), 9.4% in Poland (108) and 17% in Canada (105). In the US, higher infection rates have been reported: 15-31% in Ohio and Kentucky, (109) and 100% in Louisiana (110). These studies have also revealed that foals develop diarrhea while the infection is usually asymptomatic in adult horses. Due to the use of horses for recreational riding and hippotherapy, further studies are needed to understand the role of Cryptosporidium infected horses as a source for human infections.

Wild animals. A large number of infectious agents, many of them parasites, are carried by wild animals (29). Although Cryptosporidium infection has been demonstrated in a wide range of wild animals, the significance of wildlife as a reservoir for farm animals or humans is uncertain.(30). C. parvum has been isolated from wild mice, (111) deer, (112, 113) feral pigs, (114) wild rabbits, (115) foxes, (30) squirrels,

(116) chipmunks and muskrats (113). C. parvum infections were asymptomatic in all of these instances. Some of these animals, particularly rodents, are found in urban areas, increasing the opportunity for the transmission of wild animal C. parvum infection to

14 humans and domestic animals. In addition, these wild animals share their habitats with farm animals, providing an additional source for environmental contamination and possible infection of livestock. Wild animals may also contribute to the contamination of surface waters. In the UK it has been estimated that up to one-fifth of the oocysts in agricultural drainage come from wildlife (19). The fact that muskrats (aquatic rodents) can be infected with C. parvum may suggest that they may also be a threat to the water supplies. The C. parvum cervine genotype has been found in streams that contribute to human water supplies (117). Therefore, the identification of animals and human cases infected with novel genotypes from wildlife should not be surprising. While some investigators suggest that wild animals are not an important source of infection, others imply the contrary. The lack of information about Cryptosporidium infections in the wild host may be explained by the insufficient studies of wildlife and their diseases performed by researchers and veterinarians.

Although C. muris oocysts are known to be shed by cattle (118) the pathogenicity of C. muris is not fully understood because the infection is asymptomatic in mice (>10 days of age), However, it is well-established that the infection is restricted to the stomach (111). Failure to thrive, reduced milk production and chronic abomasal cryptosporidiosis have been reported in adult cattle infected with C. muris (119). The presence of C. muris oocysts in bovine feces, manure and surface waters indicates the transmission of the infection from wild rodents to farm animals. In addition, cases of human C. muris infection have been reported, suggesting that wild rodents may also be

15 a source of human infection (56, 82). Therefore, the role of wild animals in the transmission of Cryptosporidium to livestock and humans warrants further investigation.

Companion animals. Humans have close interactions with companion animals, sharing their living space and, consequently, sharing microorganisms that may cause disease. In the US, more than 58 million households have a companion animal (120).

Most commonly, people have cats, dogs and birds, but fish, lizards, , ferrets, and other exotic animals are also frequent household pets. The occurrence of

Cryptosporidium in dogs, cats and other pets has been described (50, 60).

Cryptosporidium infection in dogs is generally asymptomatic. Dogs less than six month of age are affected more often than the adults. By comparison, in a recent report of

Cryptosporidium in cats, 50% of infected cats showed diarrheal symptoms (121).

Zoonotic cryptosporidiosis from exposure to pets has not been documented in healthy human adults, but transmission of bovine C. parvum from companion animals

(cats, dogs) to HIV-infected persons has been reported (14). In addition, other

Cryptosporidium species such as C. felis, C. canis and C. meleagridis have also been able to infect healthy children and adults (77, 81), but the route of transmission was not identified. The concern of acquiring cryptosporidiosis from pets is more serious for children, the elderly and immunocompromised individuals; however, one report suggests that pets are not a major risk factor (122). Veterinarians are the best-suited

16 professionals to provide accurate advise to people about the risk of Cryptosporidium infection from their pet(s) and what measures should be taken to minimize the occurrence of cryptosporidiosis in animals, especially, to those owners at high risk (i.e.- immunocompromised) (123).

Other Animals. Infection with Cryptosporidium has also been detected in domestic and wild birds, including chickens, turkeys, ducks, geese, quails, pheasants, and peacocks (124). The ingestion or inhalation of oocysts in contaminated litter, feces, water, dust and any other materials that birds may contact can lead to the infection in birds. Poor hygiene has been associated with increased prevalence of the disease in flocks. At present, three Cryptosporidium species are recognized as valid in birds, C. baileyi, C. meleagridis and C galli. These Cryptosporidium species differ in the site of infection and clinical manifestations. C. meleagridis infects the intestines where it causes mild to severe diarrhea, dehydration, weight loss and weakness. C. baileyi, which is the most prevalent species in poultry, generally infects the respiratory tract resulting in potentially severe respiratory disease manifested by coughing, convulsive sneezing, mucoid discharges and shortness of breath. C. galli infects the proventriculus

(stomach) and not the respiratory tract (55). As with mammalian species, young birds appear more susceptible to infection and disease than adults. In fact, one study reported cryptosporidiosis occurred only in young chickens and not in adult birds (125).

17 Reptiles may also be infected with Cryptosporidium. Since the first confirmed report of the protozoa in snakes in 1977, (126) the infection of C. serpentis in other reptiles, including lizards and tortoises, has been described (127). The manifestations of cryptosporidiosis in snakes and lizards are different than in mammals or birds, generally presenting with symptoms of gastric disease including anorexia, progressive weight loss, postprandial regurgitation, body swelling and lethargy. Reptilian infection also tends to be persistent with oocyst excretion ranging from months to as long as two years

(31). Contrary to mammals and birds, adult reptiles are more frequently affected than the young. The acquisition of infection may be due to the ingestion of infected prey. It is speculated that rats or mice may not serve as a source of infection in reptiles as attempts to transmit C. serpentis to mice have failed (128).

Information about cryptosporidiosis in fish is limited. Reports of infection with

C. nasorum have been described in captive and ornamental fish (129). Wild-caught fish infections have been reported in two species of catfish (130). Parasites have been detected in the stomach, intestinal tract and feces of the fish. Human infection with C. nasorum has not been reported suggesting that fish are not a source of infection for humans. However, C. parvum and C. hominis oocysts have been found in oysters, (131) clams (132) and mussels (133) intended for human consumption. The oocysts are retained in hemocytes, gills and gut contents of the oysters and may remain infective for at least 1 week (134). These studies indicate that mollusks can serve as source of human infection. Even though no link between fish has been determined, probably because

18 species of salt and fresh waters have not been tested for the presence of

Cryptosporidium oocysts, shellfish and fish collected from contaminated waters may be a threat to public health.

Cryptosporidium diagnosis and molecular detection methods

A variety of tests have been developed for the diagnosis of Cryptosporidium.

Most of them involve direct detection by microscopic examination of tissues or fecal material using staining techniques (135). Many specialized staining procedures have been described to facilitate the reliable detection of oocysts. The modified acid-fast stain (AF) is widely used in clinical laboratories because of its low cost and simple methodology; unfortunately, it is associated with a relatively low sensitivity for fecal samples (136). The sensitivity of the AF stain on fecal smears can be increased 10- to

100-fold by examination of prepared slides under UV light with a rhodamine (540-560 nm) filter (137). Several immunolabelling techniques using polyclonal or monoclonal antibodies have also been developed, but these are more expensive than conventional staining while their sensitivity and specificity seems to be similar (138). Rapid immunoassays designed for simple diagnostic testing with minimal training are commercially available (e.g., ImmunoCard STAT! and MERIFLUOR direct fluorescent-antibody (DFA) test, (both from Meridian Bioscience, Inc.), the ProSpecT

Cryptosporidium microplate assay (Alexon-Trend, Inc.), Beckton Dickinson ColorPAC, and BIOSITE Diagnostics Triage Parasite Panel. MERIFLUOR DFA had the highest

19 sensitivity but specificity was equal to or greater than 99% for all the tests (139). Their suitability for use in individual laboratories depends on the balance between the assay cost, the reduced time and the number of specimens processed daily (140, 141).

Although these tests do not replace routine diagnostic methods, their high sensitivity and specificity suggest that they may be useful to confirm Cryptosporidium infections in patients with low parasite numbers and to distinguish between Cryptosporidium and other waterborne parasites like Giardia and Entamoeba.

The immunoflourescence assays (IFA) are routinely used for the detection of

Cryptosporidium in water samples, but these are time-consuming and may not be able to detect species other than C. parvum (142). The US Environmental Protection Agency

(EPA) developed and approved Method 1623 for simultaneous detection of Giardia and

Cryptosporidium. This method requires five major steps: filtration, immunomagnetic separation (IMS), IFA, confirmation through vital dye staining (4,6-diamidino- phenylindole (DAPI)) and differential interference contrast (DIC) microscopy.

However, the most powerful methods are those that include Polymerase Chain Reaction

(PCR) alone or combined with infectivity assays such as cell-culture-PCR to determine oocyst viability (23, 63, 143).

PCR protocols have shown to be very specific and highly sensitive: PCR-RFLP,

PCR single strand conformation polymorphism (PCR-SSCP), reverse-transcriptase-

PCR (RT-PCR), Real-Time PCR, PCR-heteroduplex analysis incorporating DNA

20 sequencing and single or multilocus mini and microsatellite analysis. PCR amplification techniques that targeted genes encoding the oocyst wall protein (COWP), small-subunit rRNA, β-tubulin, thrombospondin-related adhesive protein 1 and 2 (TRAP-C1, TRAP-

C2), internally transcribed spacer 1 (ITS1), polythreonine repeat (Poly-T), dihydrofolate reductase (DHFR), 60 kDa glycoprotein (GP60) and unknown DNA sequences and mRNA of heat shock proteins have been successful used for detecting and differentiating Cryptosporidium parasites (144). PCR techniques in combination with sequence analysis permit genetic characterization to discriminate between

Cryptosporidium species to help determine the most likely source of origin and real risks to human or animal health.

Nucleic acid sequence-based amplification (NASBA) is an isothermal, transcription-based amplification system specifically designed for detection of RNA targets (145). Bauemner et al., 2001 (146) described the use of NASBA for the amplification of the Cryptosporidium hsp70 mRNA with a detection limit of five oocysts. This technique may offer the advantage of identifying viable oocysts because it is based on RNA detection; however, it is more complex than PCR because it requires three enzymes (reverse transcriptase, RNase H, and T7 RNA polymerase). Additionally, the incorporation of enrichment culture or oocysts directly to the NASBA reaction, as possible with PCR, can not be done because the temperature (42°C) is to low to lyse the cells and release the nucleic acids. NASBA research is new compared to PCR and its potential for the routine use for Cryptosporidium oocysts detection needs further

21 development effort. More detection and typing tools are expected to be develop with the reported C. parvum and C. hominis genomes (147, 148)

Treatment

Oral or intravenous rehydration remains the single most important treatment to diminish clinical signs of disease. Trials evaluating different drugs, novel classes of compounds and immune therapy are currently in progress. Recently, the US Food and

Drug Administration (FDA) approved the drug (AliniaTM ) for the treatment of pediatric diarrhea caused by C. parvum and G. lamblia in children ages 1 -

11 years of age (149). The efficacy of nitazoxanide (a synthetic antiprotozoal agent) in children was studied in double-blind placebo-controlled trials which showed reduced duration of diarrhea and oocyst excretion (150-152) but its safety and effectiveness in adults or inmmunodeficient patients have not been established (153, 154).

Although more than 150 antimicrobial agents have been studied and a few have been demonstrated to reduce the magnitude of the symptoms, none eliminate the disease completely and none have received the regulatory approval for the treatment of animal cryptosporidiosis. Nitazoxanide (NTZ) has been tested in animal models, but showed only partial efficacy in the gnotobiotic pig model (with high doses (150-250 mg/kg/day) reducing oocyst shedding but inducing drug-related diarrhea) and no efficacy in the mouse model, bringing in to question the true efficacy of the drug (155, 156).

Aminoglycoside antibiotics, such as paromomycin have proved to decrease the patent

22 period, oocyst shedding and clinical symptoms in mice and calves infected with C. parvum and in birds infected with C. baileyi (155-158). A recent report determined that the dinitroaniline oryzalin reduced oocyst numbers and pathologic manifestations in the gut of mice infected with C. parvum (159). The short-term feeding (2 to 3 days) of relatively high levels (6-15 mg/kg/day) of the ionophore polyether antibiotic, lasalocid, was reported to be an effective treatment for acute cryptosporidiosis in young calves

(160-162) but this treatment was highly toxic when fed (at 8/mg/kg/day) for 2 weeks as a prophylaxis (163). Lower doses of lasalocid have not demonstrated any efficacy against C. parvum infections.

Alternative therapies such as passive immunotherapy using hyperimmune serum and hyperimmune bovine colostrum containing antibodies against C. parvum surface proteins as well as antisporozoite monoclonal antibodies have also been tested, with promising but inconclusive results (164-168). The administration of probiotics (live bacterial cell supplements) have been shown to reduce the duration and number of oocysts shed by experimentally infected mice (169, 170). In addition, in vitro studies have demonstrated that lactic acid bacteria (LAB) supernatants significantly reduced oocyst viability (171). Although bacterial mechanisms involved in protection against cryptosporidiosis are not identified, the studies suggest that probiotic bacteria may have potential for therapeutic use against Cryptosporidium.

23 Although it may not be practical for Cryptosporidium, vaccines always present as an attractive strategy to battle infectious diseases (172, 173). Vaccination of young animals with an immature immune system may not be effective, and widespread vaccination may not be economical as the disease is rarely lethal when good preventive measures are in place. The lack of understanding of the host’s immune response to the infection and the mechanisms utilized by the parasite to invade the gastrointestinal tissues and evade host immunity have been barriers to the development of effective therapy for cryptosporidiosis.

Prevention and control

Preventive measures are by far the most effective method to control this parasite. This was proven by the marked decline in human cases of cryptosporidiosis during the 2001 epidemic of foot and mouth disease (FMD) in the UK (86). Limiting human access to the countryside, containment of animals and restriction of livestock movement for trade or to pastures, and extensive slaughtering of FMD-affected animals were the immediate actions taken that not only ended the FMD epidemic but also resulted in a significant reduction (81.8%) in reported human cryptosporidiosis cases as compared to the previous year 2000 (85). These reports also provide clear evidence that zoonotic transmission is indeed a major route of human Cryptosporidium infection in the UK.

24 Because the major source of human infection is contaminated water supplies, implementation of measures to decrease the spread of the parasitic oocysts in the environment are critical. Thus, identification of the risk factors for infection in livestock will allow for the logical development of oocyst shedding management strategies.

Prevention of cryptosporidiosis transmission is clearly dependent on hygiene measures in any setting. The destruction of oocysts on surfaces of housing facilities is possible by cleaning with 5% ammonia solutions (20), especially if heat can also be applied.

Isolation of ill animals and ensuring that newborns have received adequate colostrum are always good preventive actions to control infectious diseases. Although passively acquired antibodies have not been effective in protecting calves against

Cryptosporidium infections, (174) calves fed with hyperimmune colostrum from immunized dams developed less severe diarrhea and shed fewer oocysts than calves fed

“non-hyperimmune” colostrum (175).

Measures that reduce transmission between animals should be encouraged.

Limiting the number of animals enclosed in the same facilities (i.e. reduced stocking density), keeping young animals separated from adults, minimizing contact between personnel and calves, and maintaining a short calving period may assure reduced opportunities for the parasite to spread within a herd. Reproductive management such as increasing herd fertility, and increasing the bull:cow ratio, limiting the time of cow and bull exposure may help reduce the calving period while maintaining calving rates (97).

25 Because rainfall or snowmelt can transport contaminated fecal material, cattle facilities should be located away from streams and rivers whenever possible and waterways should be fenced-off in pasture lands to prevent direct contamination.

Frequent manure spread on pastures has been associated to the detection of oocysts in streams (94). The use of manure-storage facilities and strategic spreading of manure may prevent direct contact of the manure with surface water. Stream-bank fencing is a useful way to restrict the access of livestock to streams. Its establishment may become mandatory for landowners who pasture livestock along streams, not only because it protects the wildlife, fish and vegetation from the adjacent agricultural activities but also because it reduces stream-bank erosion and improves water quality (176).

Providing cattle with an off-stream water source that eliminates the interaction of the animals with the waterways could be an economic and effective alternative that may offer the same benefits as the fencing of farm animals from streams (177). A prevalence study in Alberta, Canada suggested a possible relationship between contaminated waterways and infected calves due to the tendency to detect C. parvum oocysts in cow- calf herds located within 10 km of water streams (99). As a result, the investigators indicated that the restricted access to streams would reduce the contamination by farm animals. Grass or riparian filter strips (buffer zones) have been documented to protect waterways from nutrients and sediment in runoff from feedlots (178). Vegetative filter strips are areas of dense vegetation (grass, hay or timber) along water’s edge that slow the surface runoff trapping the sediment and reducing the amount of chemicals, nutrients and organic materials that get into the streams. Attempts to control the runoff

26 of fecal bacteria with the filter strips have had variable results. Some researchers demonstrated that coliform bacteria were reduced in soil-water and shallow ground- water by 10-fold using vegetative or riparian strips (179). Another report suggested that even short vegetative strips significantly reduced the transport of fecal coliform and nutrients originating from cattle manure (180). In contrast, other investigators suggest grass filter strips are ineffective at reducing fecal contamination levels to meet the water quality standards (181). The ability of this management system to protect the water from Cryptosporidium remains unclear but a recent study suggests that vegetated buffer strips may remove 99.9% of C. parvum oocyst from overland flow generated during low to moderated precipitation if specific criteria such as slope, soil and length are optimized (182). Land-use regulations, economic incentives and educational efforts may be necessary for the implementation and the success of these innovative strategies.

Water treatment plant processes need to be regulated to provide safe drinking water for human and animal communities. In the US, continual effort is done to establish water quality standards. The US EPA has regulated the national drinking water activities under the Safe Drinking Water Act (SDWA) since 1974. The Surface Water

Treatment Rule (SWTR) requires the use of treatment technology to remove or inactivate 99.9% (3-log) of Cryptosporidium and Giardia. Under this rule, the Interim

Enhanced Surface Water Treatment Rule (IESWTR) was promulgated in 1998 to control Cryptosporidium in drinking water (183). It applies to public water systems using surface or ground waters under the influence of surface waters and establishes a

27 Maximum Contaminant Level Goal (MCLG) of zero for Cryptosporidium. To achieve these removal requirements each of the conventional water treatment processes

(coagulation, flocculation, clarification, filtration and disinfection) have to be optimized. For example, during the clarification process, dissolved air flotation (DAF) has demonstrated to be more effective than sedimentation for removal of oocysts (184).

Because chlorination does not inactivate Cryptosporidium, alternative disinfectants such as ozone and UV irradiation have being evaluated. Low doses of UV (1-9mJ/cm2) can inactivate 2-4 log10 (99-99.9%) of C. parvum oocysts (185) and low doses (2 mg/L) of ozone for short times (1 min) are able to inactivate up to 99% of oocysts (186).

However, ozone disinfection is temperature dependent and initial cyst concentration might influence the inactivation.

Alternative to conventional treatment, pressure-driven membrane processes, microfiltration (MF), ultrafiltration (UF), nanofiltration (NF) and reverse osmosis (RO) have proven complete removal of all protozoan cysts. MF (0.1-10µM pore membranes),

UF (0.002-0.1µM pore membranes) and RO provide >4-7 log removal (187-189). As a result these membrane technologies are playing a major role in drinking water production in the US and Europe (183). In the US, the Centers for Disease Control and

Prevention (CDC) reported that only RO or less than 1 micron filters are effective for the removal of Cryptospordium oocysts and advise the exclusive use of bottled water processed under those treatments (190).

28 Immunosuppressed persons should avoid contact with animals with diarrhea, dogs or cats younger than six month of age and stray animals (191). However, it should not be recommended that individuals give away healthy pets with which they may have emotional attachment. The examination of an animal’s stool by the veterinarian before the person has contact with the animal is critical for those at risk of infection.

Conclusion

Cryptosporidiosis is a common cause of diarrhea in humans and animals worldwide. It can be acquired by ingestion of oocysts excreted in the feces of infected host individuals. Transmission can occur from person-to-person, from animal-to-person, animal-to-animal, by ingestion of contaminated water and food or by contact with contaminated surfaces. It may be misdiagnosed and underreported because it is usually a self-limited disease in immunocompetent individuals similar to other diarrheal diseases. The protozoan is highly resistant to environmental and chemical hazards and its propagation in vitro is difficult, limiting the study of this organism. No effective chemotherapy has been identified for the treatment of the disease in adult humans and animals making cryptosporidiosis a debilitating and persistent disease in immunocompromised humans and animals. However, studies to determine the safety and efficacy of some treatments are reporting promising results.

Although many Cryptosporidium species have been described, the biologic and genetic differences of many of them are not clear. Sensitive and reliable isolation and

29 detection techniques are needed to facilitate the study of the parasite. Being able to differentiate Cryptosporidium genotypes and species of is important for determining the possible sources of infection in outbreaks and the risk factors associated with the transmission. PCR assays allow a rapid diagnosis in outbreak situations and provide information on genotypes. In addition, PCR techniques could be valuable tools for disease surveillance in high-risk populations such as AIDS patients and young animals.

Cryptosporidiosis is a significant disease in livestock, affecting mostly neonates.

The economic losses incurred from Cryptosporidium infections in livestock and the threat to human health are major concerns. Prevention and control measures need to be adopted and regulated in the animal environment. The role of the veterinarian in the diagnosis, treatment and counseling concerning cryptosporidiosis is relevant for the management and prevention of the disease in companion and farm animals as these have been implicated as a major source of transmission to humans. Continued research to increase our knowledge of the parasites’ epidemiology, biology, taxonomy, and molecular diversity is greatly needed, as are improved detection protocols capable of differentiating species and genotypes. Understanding the biological behavior and correctly identifying the offending Cryptosporidium speces will be critical if our intervention and control strategies are to be effective. The recent completion of C. parvum and C. hominis genomes may provide clues into the mechanisms of infection of these organisms and lay scientific foundations to develop in vitro propagation techniques and new effective therapeutic modalities.

30 References

1. Tyzzer EE: A sporozoan found in the peptide glands of the common mouse. Proc Soc Exp Biol Med 1907;5:12-13.

2. Slavin D: Cryptosporidium meleagridis sp. nov. J Pathol Ther 1955;65:262-266.

3. Panciera RJ, Thomassen RW, Garner FM: Cryptosporidiosis in a calf. Vet Pathol 1971;8:479-484.

4. Current WL, Reese NC, Ernst JV, Bailey WS, Heyman MB, Weinstein WM: Human cryptosporidiosis in immunocompetent and immunodeficient persons. Studies of an outbreak and experimental transmission. N Engl J Med 1983;308:1252-1257.

5. MacKenzie WR, Schell WL, Blair KA, Addiss DG, Peterson DE, Hoxie NJ, Kazmierczak JJ, Davis JP: Massive outbreak of waterborne cryptosporidium infection in Milwaukee, Wisconsin: recurrence of illness and risk of secondary transmission. Clin Infect Dis 1995;21:57-62.

6. Current WL, Garcia LS: Cryptosporidiosis. Clin Microbiol Rev 1991;4:325-358.

7. Mosier DA, Oberst RD: Cryptosporidiosis. A global challenge. Ann N Y Acad Sci 2000;916:102-111.

8. CDC: Summary of Notifiable Diseases, United States, 1998. MMWR Morb Mortal Wkly Rep 1999;47:1-92.

9. Pereira SJ, Ramirez NE, Xiao L, Ward LA: Pathogenesis of human and bovine Cryptosporidium parvum in gnotobiotic pigs. J Infect Dis 2002;186:715-718.

10. USFDA: US Food and Drug Administration. Foodborne Pathogenic Microorganisms and Natural Toxins Handbook, Center for Food Safety and Applied Nutrition: College Park, Maryland. 1992.

11. Hojlyng N, Holten-Andersen W, Jepsen S: Cryptosporidiosis: a case of airborne transmission. Lancet 1987;2:271-272.

12. Koch KL, Phillips DJ, Aber RC, Current WL: Cryptosporidiosis in hospital personnel. Evidence for person-to-person transmission. Ann Intern Med 1985;102:593-596.

31 13. Anderson BC, Donndelinger T, Wilkins RM, Smith J: Cryptosporidiosis in a veterinary student. J Am Vet Med Assoc 1982;180:408-409. 14. Meisel JL, Perera DR, Meligro C, Rubin CE: Overwhelming watery diarrhea associated with a cryptosporidium in an immunosuppressed patient. Gastroenterology 1976;70:1156-1160.

15. Reese NC, Current WL, Ernst JV, Bailey WS: Cryptosporidiosis of man and calf: a case report and results of experimental infections in mice and rats. Am J Trop Med Hyg 1982;31:226-229.

16. Quiroz ES, Bern C, MacArthur JR, Xiao L, Fletcher M, Arrowood MJ, Shay DK, Levy ME, Glass RI, Lal A: An outbreak of cryptosporidiosis linked to a foodhandler. J Infect Dis 2000;181:695-700.

17. Millard PS, Gensheimer KF, Addiss DG, Sosin DM, Beckett GA, Houck- Jankoski A, Hudson A: An outbreak of cryptosporidiosis from fresh-pressed apple cider. Jama 1994;272:1592-1596.

18. CDC: Foodborne outbreak of Cryptosporidiosis--Spokane, Washington, 1997. JAMA 1998;280:595-596.

19. Hooda PS, Edwards AC, Anderson HA, Miller A: A review of water quality concerns in livestock farming areas. Science of the Total Environment 2000;250:143-167.

20. Campbell I, Tzipori AS, Hutchison G, Angus KW: Effect of disinfectants on survival of cryptosporidium oocysts. Vet Rec 1982;111:414-415.

21. LeChavallier MW, Norton WD, Lee RG: Occurence of Giardia and Cryptosporidium spp. in surface water supplies. Appl Environ Microbiol 1991;57:2610-2616.

22. LeChavallier MW, Norton WD, Lee RG: Giardia and Cryptosporidium spp. in filtered water supplies. Appl Environ Microbiol 1991;57:2617-2621.

23. LeChevallier MW, Di Giovanni GD, Clancy JL, Bukhari Z, Bukhari S, Rosen JS, Sobrinho J, Frey MM: Comparison of method 1623 and cell culture-PCR for detection of Cryptosporidium spp. in source waters. Appl Environ Microbiol 2003;69:971-979.

24. Kramer MH, Sorhage FE, Goldstein ST, Dalley E, Wahlquist SP, Herwaldt BL: First reported outbreak in the United States of cryptosporidiosis associated with a recreational lake. Clin Infect Dis 1998;26:27-33.

32 25. CDC: Outbreak of cryptosporidiosis associated with a water sprinkler fountain-- Minnesota, 1997. MMWR Morb Mortal Wkly Rep 1998;47:856-860.

26. CDC: Protracted outbreak of cryptosporidiosis associated with swimming pool use-Ohio and Nebraska, 2000. MMWR Morb Mortal Wkly Rep 2001;50:406- 410.

27. el-Ahraf A, Tacal JV, Jr., Sobih M, Amin M, Lawrence W, Wilcke BW: Prevalence of cryptosporidiosis in dogs and human beings in San Bernardino County, California. J Am Vet Med Assoc 1991;198:631-634.

28. Mtambo MM, Nash AS, Blewett DA, Smith HV, Wright S: Cryptosporidium infection in cats: prevalence of infection in domestic and feral cats in the Glasgow area. Vet Rec 1991;129:502-504.

29. Simpson VR: Wild animlas as reservoirs of infectious diseases. Vet J 2002;163:128-146.

30. Sturdee AP, Chalmers RM, Bull SA: Detection of Cryptosporidium oocysts in wild mammals of mainland Britain. Vet Parasitol 1999;80:273-280.

31. O'Donoghue PJ: Cryptosporidium and cryptosporidiosis in man and animals. Int J Parasitol 1995;25:139-195.

32. de Graaf DC, Vanopdenbosch E, Ortega-Mora LM, Abbassi H, Peeters JE: A review of the importance of cryptosporidiosis in farm animals. Int J Parasitol 1999;29:1269-1287.

33. Sulaiman IM, Xiao L, Yang C, Escalante L, Moore A, Beard CB, Arrowood MJ, Lal AA: Differentiating human from animal isolates of Cryptosporidium parvum. Emerg Infect Dis 1998;4:681-685.

34. Morgan-Ryan UM, Fall A, Ward LA, Hijjawi N, Sulaiman I, Fayer R, Thompson RC, Olson M, Lal A, Xiao L: Cryptosporidium hominis n. sp. (Apicomplexa: Cryptosporidiidae) from Homo sapiens. J Eukaryot Microbiol 2002;49:433-440.

35. Xiao L, Morgan UM, Limor J, Escalante A, Arrowood M, Shulaw W, Thompson RC, Fayer R, Lal AA: Genetic diversity within Cryptosporidium parvum and related Cryptosporidium species. Appl Environ Microbiol 1999;65:3386-3391.

33 36. Morgan UM, Sargent KD, Deplazes P, Forbes DA, Spano F, Hertzberg H, Elliot A, Thompson RC: Molecular characterization of Cryptosporidium from various hosts. Parasitology 1998;117 ( Pt 1):31-37.

37. Nime FA, Burek JD, Page DL, Holscher MA, Yardley JH: Acute enterocolitis in a human being infected with the protozoan Cryptosporidium. Gastroenterology 1976;70:592-598.

38. Kennedy GA, Kreitner GL, Strafuss AC: Cryptosporidiosis in three pigs. J Am Vet Med Assoc 1977;170:348-350. 39. Barker IK, Carbonell PL: Cryptosporidium agni sp.n. from lambs, and cryptosporidium bovis sp.n. from a calf, with observations on the oocyst. Z Parasitenkd 1974;44:289-298.

40. Tzipori S, Smith M, Makin T, Halpin C: Enterocolitis in piglets caused by Cryptosporidium sp. purified from calf faeces. Vet Parasitol 1982;11:121-126.

41. Snyder SP, England JJ, McChesney AE: Cryptosporidiosis in immunodeficient Arabian foals. Vet Pathol 1978;15:12-17.

42. Tyzzer EE: An extracellular coccidium, (gen. et sp. nov.), of the gastric glands of the common mouse. J Med Res 1910;18.

43. Tyzzer EE: Cryptosporidium parvum (sp. nov.), a coccidium found in the small intestine of the common mouse. Archiv für Protistenkunde 1912;26:394-412.

44. Hoover DM, Hoerr FJ, Carlton WW, Hisman EJ, Ferguson HW: Enteric cryptosporidiosis in a naso tang, Naso lituratus Bloch and Snider. J Fish Dis 1981;4:425-428.

45. Current WL, Upton SJ, Haynes TB: The life cycle of Cryptosporidium baileyi n. sp. (Apicomplexa, Cryptosporidiidae) infecting chickens. J Protozool 1986;33:289-296.

46. Levine ND: Some corrections of coccidian (Apicomplexa: Protozoa) nomenclature. J Parasitol 1980;66:830-834.

47. Vetterling JM, Jervis HR, Merrill TG, Sprinz H: Cryptosporidium wrairi sp. n. from the guinea pig Cavia porcellus, with an emendation of the genus. J Protozool 1971;18:243-247.

48. Iseki M: Cryptosporidium felis sp.n. (Protozoa: ) from the domestic cat. Japanese J Parasitol 1979;28:285-307.

34 49. Wilson RB, Holscher MA, Lyle SJ: Cryptosporidiosis in a pup. J Am Vet Med Assoc 1983;183:1005-1006, 1965.

50. Fayer R, Trout JM, Xiao L, Morgan UM, Lai AA, Dubey JP: Cryptosporidium canis n. sp. from domestic dogs. J Parasitol 2001;87:1415-1422.

51. Lindsay DS, Upton SJ, Owens DS, Morgan UM, Mead JR, Blagburn BL: Cryptosporidium andersoni n. sp. (Apicomplexa: Cryptosporiidae) from cattle, Bos taurus. J Eukaryot Microbiol 2000;47:91-95.

52. Koudela B, Modry D: New species of Cryptosporidium (Apicomplexa, Cryptosporidiidae) from lizards. Folia Parasitol 1998;45:93-100. 53. Pavlasek I, Lavickova M, Horak P, Kral J, Kral B: n. sp. (Apicomplexa: Cryptosporidiidae) in Emerald monitor (Varanus prasinus Schlegel, 1893) in captivity at Prague zoo. Gazella 1995;22:99-108.

54. Pavlasek I: Findings of Cryptosporidia in the stomach of chickens and of exotic and wild birds. Veterinarstvi 2001;51:103-108.

55. Ryan UM, Xiao L, Read C, Sulaiman IM, Monis P, Lal AA, Fayer R, Pavlasek I: A redescription of Cryptosporidium galli Pavlasek, 1999 (Apicomplexa: Cryptosporidiidae) from birds. J Parasitol 2003;89:809-813.

56. Katsumata T, Hosea D, Ranuh IG, Uga S, Yanagi T, Kohno S: Short report: possible Cryptosporidium muris infection in humans. Am J Trop Med Hyg 2000;62:70-72.

57. Pieniazek NJ, Bornay-Llinares FJ, Slemenda SB, da Silva AJ, Moura IN, Arrowood MJ, Ditrich O, Addiss DG: New cryptosporidium genotypes in HIV- infected persons. Emerg Infect Dis 1999;5:444-449.

58. Xiao L, Ryan UM, Graczyk TK, Limor J, Li L, Kombert M, Junge R, Sulaiman IM, Zhou L, Arrowood MJ, Koudela B, Modry D, Lal AA: Genetic diversity of Cryptosporidium spp. in captive reptiles. Appl Environ Microbiol 2004;70:891- 899.

59. Morgan U, Weber R, Xiao L, Sulaiman I, Thompson RC, Ndiritu W, Lal A, Moore A, Deplazes P: Molecular characterization of Cryptosporidium isolates obtained from human immunodeficiency virus-infected individuals living in Switzerland, Kenya, and the United States. J Clin Microbiol 2000;38:1180- 1183.

35 60. Morgan UM, Xiao L, Monis P, Fall A, Irwin PJ, Fayer R, Denholm KM, Limor J, Lal A, Thompson RC: Cryptosporidium spp. in domestic dogs: the "dog" genotype. Appl Environ Microbiol 2000;66:2220-2223.

61. Ryan UM, Monis P, Enemark HL, Sulaiman I, Samarasinghe B, Read C, Buddle R, Robertson I, Zhou L, Thompson RC, Xiao L: Cryptosporidium suis n. sp. (Apicomplexa: Cryptosporidiidae) in pigs (Sus scrofa). J Parasitol 2004;90:769- 773.

62. Alvarez-Pellitero P, Sitja-Bobadilla A: Cryptosporidium molnari n. sp. (Apicomplexa: Cryptosporidiidae) infecting two marine fish species, Sparus aurata L. and Dicentrarchus labrax L. Int J Parasitol 2002;32:1007-1021.

63. Xiao L, Escalante L, Yang C, Sulaiman I, Escalante AA, Montali RJ, Fayer R, Lal AA: Phylogenetic analysis of Cryptosporidium parasites based on the small- subunit rRNA gene locus. Appl Environ Microbiol 1999;65:1578-1583. 64. Xiao L, Ryan UM: Cryptosporidiosis: an update in molecular epidemiology. Curr Opin Infect Dis 2004;17:483-490.

65. Sulaiman IM, Morgan UM, Thompson RC, Lal AA, Xiao L: Phylogenetic relationships of Cryptosporidium parasites based on the 70-kilodalton heat shock protein (HSP70) gene. Appl Environ Microbiol 2000;66:2385-2391.

66. Spano F, Putignani L, Crisanti A, Sallicandro P, Morgan UM, Le Blancq SM, Tchack L, Tzipori S, Widmer G: Multilocus genotypic analysis of Cryptosporidium parvum isolates from different hosts and geographical origins. J Clin Microbiol 1998;36:3255-3259.

67. Mallon ME, MacLeod A, Wastling JM, Smith H, Tait A: Multilocus genotyping of Cryptosporidium parvum Type 2: population genetics and sub-structuring. Infect Genet Evol 2003;3:207-218.

68. Carreno RA, Martin DS, Barta JR: Cryptosporidium is more closely related to the gregarines than to as shown by phylogenetic analysis of apicomplexan parasites inferred using small-subunit ribosomal RNA gene sequences. Parasitol Res 1999;85:899-904.

69. Hijjawi NS, Meloni BP, Ryan UM, Olson ME, Thompson RC: Successful in vitro cultivation of Cryptosporidium andersoni: evidence for the existence of novel extracellular stages in the life cycle and implications for the classification of Cryptosporidium. Int J Parasitol 2002;32:1719-1726.

70. Deng M, Rutherford MS, Abrahamsen MS: Host intestinal epithelial response to Cryptosporidium parvum. Adv Drug Deliv Rev 2004;56:869-884.

36

71. Clark DP, Sears CL: The pathogenesis of cryptosporidiosis. Parasitol Today 1996;12:221-225.

72. Argenzio RA, Lecce J, Powell DW: Prostanoids inhibit intestinal NaCl absorption in experimental porcine cryptosporidiosis. Gastroenterology 1993;104:440-447.

73. Marshall AT, LaMont JT: Cryptosporidiosis and public health. Hosp Pract (Off Ed) 1997;32:11, 15-16, 23.

74. Molbak K, Andersen M, Aaby P, Hojlyng N, Jakobsen M, Sodemann M, da Silva AP: Cryptosporidium infection in infancy as a cause of malnutrition: a community study from Guinea-Bissau, west Africa. Am J Clin Nutr 1997;65:149-152.

75. Farthing MJ: Clinical aspects of human cryptosporidiosis. Contrib Microbiol 2000;6:50-74. 76. McLauchlin J, Amar C, Pedraza-Diaz S, Nichols GL: Molecular epidemiological analysis of Cryptosporidium spp. in the United Kingdom: results of genotyping Cryptosporidium spp. in 1,705 fecal samples from humans and 105 fecal samples from livestock animals. J Clin Microbiol 2000;38:3984- 3990.

77. Xiao L, Bern C, Limor J, Sulaiman I, Roberts J, Checkley W, Cabrera L, Gilman RH, Lal AA: Identification of 5 types of Cryptosporidium parasites in children in Lima, Peru. J Infect Dis 2001;183:492-497.

78. Xiao L, Bern C, Arrowood M, Sulaiman I, Zhou L, Kawai V, Vivar A, Lal AA, Gilman RH: Identification of the cryptosporidium pig genotype in a human patient. J Infect Dis 2002;185:1846-1848.

79. Ong CS, Eisler DL, Alikhani A, Fung VW, Tomblin J, Bowie WR, Isaac-Renton JL: Novel cryptosporidium genotypes in sporadic cryptosporidiosis cases: first report of human infections with a cervine genotype. Emerg Infect Dis 2002;8:263-268.

80. Pedraza-Diaz S, Amar CF, McLauchlin J, Nichols GL, Cotton KM, Godwin P, Iversen AM, Milne L, Mulla JR, Nye K, Panigrahl H, Venn SR, Wiggins R, Williams M, Youngs ER: Cryptosporidium meleagridis from humans: molecular analysis and description of affected patients. J Infect 2001;42:243-250.

81. Pedraza-Diaz S, Amar C, Iversen AM, Stanley PJ, McLauchlin J: Unusual cryptosporidium species recovered from human faeces: first description of

37 Cryptosporidium felis and Cryptosporidium 'dog type' from patients in England. J Med Microbiol 2001;50:293-296.

82. Gatei W, Greensill J, Ashford RW, Cuevas LE, Parry CM, Cunliffe NA, Beeching NJ, Hart CA: Molecular analysis of the 18S rRNA gene of Cryptosporidium parasites from patients with or without human immunodeficiency virus infections living in Kenya, Malawi, Brazil, the United Kingdom, and Vietnam. J Clin Microbiol 2003;41:1458-1462.

83. Palmer CJ, Xiao L, Terashima A, Guerra H, Gotuzzo E, Saldias G, Bonilla JA, Zhou L, Lindquist A, Upton SJ: Cryptosporidium muris, a rodent pathogen, recovered from a human in Peru. Emerg Infect Dis 2003;9:1174-1176.

84. Peng MM, Xiao L, Freeman AR, Arrowood MJ, Escalante AA, Weltman AC, Ong CS, Mac Kenzie WR, Lal AA, Beard CB: Genetic polymorphism among Cryptosporidium parvum isolates: evidence of two distinct human transmission cycles. Emerg Infect Dis 1997;3:567-573.

85. Hunter PR, Chalmers RM, Syed Q, Hughes LS, Woodhouse S, Swift L: Foot and Mouth Disease and Cryptosporidiosis: Possible Interaction between Two Emerging Infectious Diseases. Emerg Infect Dis 2003;9:109-112. 86. Smerdon WJ, Nichols T, Chalmers RM, Heine H, Reacher MH: Foot and mouth disease in livestock and reduced cryptosporidiosis in humans, England and wales. Emerg Infect Dis 2003;9:22-28.

87. Xiao L, Morgan UM, Fayer R, Thompson RC, Lal AA: Cryptosporidium systematics and implications for public health. Parasitol Today 2000;16:287- 292.

88. Xiao L, Herd RP: Infection pattern of Cryptosporidium and Giardia in calves. Vet Parasitol 1994;55:257-262.

89. Garber LP, Salman MD, Hurd HS, Keefe T, Schlater JL: Potential risk factors for Cryptosporidium infection in dairy calves. J Am Vet Med Assoc 1994;205:86-91.

90. Atwill ER, Johnson E, Klingborg DJ, Veserat GM, Markegard G, Jensen WA, Pratt DW, Delmas RE, George HA, Forero LC, Philips RL, Barry SJ, McDougald NK, Gildersleeve RR, Frost WE: Age, geographic, and temporal distribution of fecal shedding of Cryptosporidium parvum oocysts in cow-calf herds. Am J Vet Res 1999;60:420-425.

38 91. Ortega-Mora LM, Wright SE: Age-related resistance in ovine cryptosporidiosis: patterns of infection and humoral immune response. Infect Immun 1994;62:5003-5009.

92. Miron D, Kenes J, Dagan R: Calves as a source of an outbreak of cryptosporidiosis among young children in an agricultural closed community. Pediatr Infect Dis J 1991;10:438-441.

93. Lengerich EJ, Addiss DG, Marx JJ, Ungar BL, Juranek DD: Increased exposure to cryptosporidia among dairy farmers in Wisconsin. J Infect Dis 1993;167:1252-1255.

94. Sischo WM, Atwill ER, Lanyon LE, George J: Cryptosporidia on dairy farms and the role these farms may have in contaminating surface water supplies in the northeastern United States. Prev Vet Med 2000;43:253-267.

95. Harper CM, Cowell NA, Adams BC, Langley AJ, Wohlsen TD: Outbreak of Cryptosporidium linked to drinking unpasteurised milk. Commun Dis Intell 2002;26:449-450.

96. Gelletlie R, Stuart J, Soltanpoor N, Armstrong R, Nichols G: Cryptosporidiosis associated with school milk. Lancet 1997;350:1005-1006.

97. Hoar BR, Atwill ER, Elmi C, Farver TB: An examination of risk factors associated with beef cattle shedding pathogens of potential zoonotic concern. Epidemiol Infect 2001;127:147-155. 98. Atwill ER, Johnson EM, Pereira MG: Association of herd composition, stocking rate, and duration of calving season with fecal shedding of Cryptosporidium parvum oocysts in beef herds. J Am Vet Med Assoc 1999;215:1833-1838.

99. Heitman TL, Frederick LM, Viste JR, Guselle NJ, Morgan UM, Thompson RC, Olson ME: Prevalence of Giardia and Cryptosporidium and characterization of Cryptosporidium spp. isolated from wildlife, human, and agricultural sources in the North Saskatchewan River Basin in Alberta, Canada. Can J Microbiol 2002;48:530-541.

100. Quilez J, Sanchez-Acedo C, Clavel A, del Cacho E, Lopez-Bernad F: Prevalence of Cryptosporidium infections in pigs in Aragon (northeastern Spain). Vet Parasitol 1996;67:83-88.

101. Xiao L, Herd RP: Review of equine Cryptosporidium infection. Equine Vet J 1994;26:9-13.

39 102. Rotkiewicz T, Rotkiewicz Z, Depta A, Kander M: Effect of Lactobacillus acidophilus and Bifidobacterium sp. on the course of Cryptosporidium parvum invasion in New-Born Piglets. Bull. Vet. Inst. Pulawy 2001;45:187-195.

103. Tzipori S, McCartney E, Lawson GH, Rowland AC, Campbell I: Experimental infection of piglets with cryptosporidium. Res Vet Sci 1981;31:358-368.

104. Tacal JV, Jr., Sobieh M, el-Ahraf A: Cryptosporidium in market pigs in southern California, USA. Vet Rec 1987;120:615-616.

105. Olson ME, Thorlakson CL, Deselliers L, Morck DW, McAllister TA: Giardia and Cryptosporidium in Canadian farm animals. Vet Parasitol 1997;68:375-381.

106. Kaminjolo JS, Adesiyun AA, Loregnard R, Kitson-Piggott W: Prevalence of Cryptosporidium oocysts in livestock in Trinidad and Tobago. Vet Parasitol 1993;45:209-213.

107. Sturdee AP, Bodley-Tickell AT, Archer A, Chalmers RM: Long-term study of Cryptosporidium prevalence on a lowland farm in the United Kingdom. Vet Parasitol 2003;116:97-113.

108. Majewska AC, Werner A, Sulima P, Luty T: Survey on equine cryptosporidiosis in Poland and the possibility of zoonotic transmission. Ann Agric Environ Med 1999;6:161-165.

109. Xiao L, Herd RP: Epidemiology of equine Cryptosporidium and Giardia infections. Equine Vet J 1994;26:14-17.

110. Coleman SU, Klei TR, French DD, Chapman MR, Corstvet RE: Prevalence of Cryptosporidium sp in equids in Louisiana. Am J Vet Res 1989;50:575-577.

111. Chalmers RM, Sturdee AP, Bull SA, Miller A, Wright SE: The prevalence of Cryptosporidium parvum and C. muris in Mus domesticus, Apodemus sylvaticus and Clethrionomys glareolus in an agricultural system. Parasitol Res 1997;83:478-482.

112. Rickard LG, Siefker C, Boyle CR, Gentz EJ: The prevalence of Cryptosporidium and Giardia spp. in fecal samples from free-ranging white- tailed deer (Odocoileus virginianus) in the southeastern United States. J Vet Diagn Invest 1999;11:65-72.

113. Perz JF, Le Blancq SM: Cryptosporidium parvum infection involving novel genotypes in wildlife from lower New York State. Appl Environ Microbiol 2001;67:1154-1162.

40

114. Atwill ER, Sweitzer RA, Pereira MG, Gardner IA, Van Vuren D, Boyce WM: Prevalence of and associated risk factors for shedding Cryptosporidium parvum oocysts and Giardia cysts within feral pig populations in California. Appl Environ Microbiol 1997;63:3946-3949.

115. Ryan MJ, Sundberg JP, Sauerschell RJ, Todd KS, Jr.: Cryptosporidium in a wild cottontail rabbit (Sylvilagus floridanus). J Wildl Dis 1986;22:267.

116. Sundberg JP, Hill D, Ryan MJ: Cryptosporidiosis in a gray squirrel. J Am Vet Med Assoc 1982;181:1420-1422.

117. Xiao L, Alderisio K, Limor J, Royer M, Lal AA: Identification of species and sources of Cryptosporidium oocysts in storm waters with a small-subunit rRNA- based diagnostic and genotyping tool. Appl Environ Microbiol 2000;66:5492- 5498.

118. Anderson BC: Prevalence of Cryptosporidium muris-like oocysts among cattle populations of the United States: preliminary report. J Protozool 1991;38:14S- 15S.

119. Anderson BC: Cryptosporidiosis in bovine and human health. J Dairy Sci 1998;81:3036-3041.

120. Enriquez C, Nwachuku N, Gerba CP: Direct exposure to animal enteric pathogens. Rev Environ Health 2001;16:117-131.

121. Hill SL, Cheney JM, Taton-Allen GF, Reif JS, Bruns C, Lappin MR: Prevalence of enteric zoonotic organisms in cats. J Am Vet Med Assoc 2000;216:687-692.

122. Glaser CA, Safrin S, Reingold A, Newman TB: Association between Cryptosporidium infection and animal exposure in HIV-infected individuals. J Acquir Immune Defic Syndr Hum Retrovirol 1998;17:79-82.

123. Irwin PJ: Companion animal parasitology: a clinical perspective. Int J Parasitol 2002;32:581-593.

124. Sreter T, Varga I: Cryptosporidiosis in birds--a review. Vet Parasitol 2000;87:261-279.

125. Lindsay DS, Blagburn BL, Sundermann CA, Giambrone JJ: Effect of broiler chicken age on susceptibility to experimentally induced Cryptosporidium baileyi infection. Am J Vet Res 1988;49:1412-1414.

41 126. Brownstein DG, Strandberg JD, Montali RJ, Bush M, Fortner J: Cryptosporidium in snakes with hypertrophic gastritis. Vet Pathol 1977;14:606- 617.

127. Upton SJ, McAllister CT, Freed PS, Barnard SM: Cryptosporidium spp. in wild and captive reptiles. J Wildl Dis 1989;25:20-30.

128. Fayer R, Graczyk TK, Cranfield MR: Multiple heterogenous isolates of Cryptosporidium serpentis from captive snakes are not transmissible to neonatal BALB/c mice (Mus musculus). J Parasitol 1995;81:482-484.

129. Landsberg JH, Paperna I: Ultrastructural-study of the coccidian Cryptosporidium sp from stomachs of juvenile cichlid fish. Dis Aquat Organ 1986;2:13-20.

130. Muench TR, White MR: Cryptosporidiosis in a tropical freshwater catfish (Plecostomus spp.). J Vet Diagn Invest 1997;9:87-90.

131. Fayer R, Lewis EJ, Trout JM, Graczyk TK, Jenkins MC, Higgins J, Xiao L, Lal AA: Cryptosporidium parvum in oysters from commercial harvesting sites in the Chesapeake Bay. Emerg Infect Dis 1999;5:706-710.

132. Graczyk TK, Fayer R, Cranfield MR, Conn DB: Recovery of waterborne Cryptosporidium parvum oocysts by freshwater benthic clams (Corbicula fluminea). Appl Environ Microbiol 1998;64:427-430.

133. Graczyk TK, Fayer R, Lewis EJ, Trout JM, Farley CA: Cryptosporidium oocysts in Bent mussels (Ischadium recurvum) in the Chesapeake Bay. Parasitol Res 1999;85:518-521.

134. Fayer R, Farley AA, Earl EJ, Trout JM, Graczyk TK: Potential role of the Eastern oyster, Crassostrea virginica, in the epidemiology of Cryptosporidium parvum. Applied Environ Microbiol 1997;63:2086-2088.

135. Garcia LS, Bruckner DA, Brewer TC, Shimizu RY: Techniques for the recovery and identification of Cryptosporidium oocysts from stool specimens. J Clin Microbiol 1983;18:185-190.

136. Weber R, Bryan RT, Bishop HS, Wahlquist SP, Sullivan JJ, Juranek DD: Threshold of detection of Cryptosporidium oocysts in human stool specimens: evidence for low sensitivity of current diagnostic methods. J Clin Microbiol 1991;29:1323-1327.

42 137. Nielsen CK, Ward LA: Enhanced detection of Cryptosporidium parvum in the acid-fast stain. J Vet Diagn Invest 1999;11:567-569.

138. Garcia LS, Shimizu RY: Evaluation of nine immunoassay kits (enzyme immunoassay and direct fluorescence) for detection of Giardia lamblia and Cryptosporidium parvum in human fecal specimens. J Clin Microbiol 1997;35:1526-1529.

139. Johnston SP, Ballard MM, Beach MJ, Causer L, Wilkins PP: Evaluation of three commercial assays for detection of Giardia and Cryptosporidium organisms in fecal specimens. J Clin Microbiol 2003;41:623-626.

140. Chan R, Chen J, York MK, Setijono N, Kaplan RL, Graham F, Tanowitz HB: Evaluation of a combination rapid immunoassay for detection of Giardia and Cryptosporidium antigens. J Clin Microbiol 2000;38:393-394.

141. Sharp SE, Suarez CA, Duran Y, Poppiti RJ: Evaluation of the Triage Micro Parasite Panel for detection of Giardia lamblia, Entamoeba histolytica/Entamoeba dispar, and Cryptosporidium parvum in patient stool specimens. J Clin Microbiol 2001;39:332-334.

142. Graczyk TK, Cranfield MR, Fayer R: Evaluation of commercial enzyme immunoassay (EIA) and immunofluorescent antibody (FA) test kits for detection of Cryptosporidium oocysts of species other than Cryptosporidium parvum. Am J Trop Med Hyg 1996;54:274-279.

143. Quintero-Betancourt W, Peele ER, Rose JB: Cryptosporidium parvum and : a review of laboratory methods for detection of these waterborne parasites. J Microbiol Methods 2002;49:209-224.

144. Sulaiman IM, Xiao L, Lal AA: Evaluation of Cryptosporidium parvum genotyping techniques. Appl Environ Microbiol 1999;65:4431-4435.

145. Cook N: The use of NASBA for the detection of microbial pathogens in food and environmental samples. J Microbiol Methods 2003;53:165-174.

146. Baeumner AJ, Humiston MC, Montagna RA, Durst RA: Detection of viable oocysts of Cryptosporidium parvum following nucleic acid sequence based amplification. Anal Chem 2001;73:1176-1180.

147. Abrahamsen MS, Templeton TJ, Enomoto S, Abrahante JE, Zhu G, Lancto CA, Deng M, Liu C, Widmer G, Tzipori S, Buck GA, Xu P, Bankier AT, Dear PH, Konfortov BA, Spriggs HF, Iyer L, Anantharaman V, Aravind L, Kapur V:

43 Complete genome sequence of the apicomplexan, Cryptosporidium parvum. Science 2004;304:441-445.

148. Xu P, Widmer G, Wang Y, Ozaki LS, Alves JM, Serrano MG, Puiu D, Manque P, Akiyoshi D, Mackey AJ, Pearson WR, Dear PH, Bankier AT, Peterson DL, Abrahamsen MS, Kapur V, Tzipori S, Buck GA: The genome of Cryptosporidium hominis. Nature 2004;431:1107-1112.

149. USFDA: US Food and Drug Administration Web site. FDA Talk Paper. FDA approves new treatment for parasitic infections in pediatric patients. Available at: http://www.fda.gov/bbs/topics/ANSWERS/2002/ANS01178.html. 2002.

150. Rossignol JF, Hidalgo H, Feregrino M, Higuera F, Gomez WH, Romero JL, Padierna J, Geyne A, Ayers MS: A double-'blind' placebo-controlled study of nitazoxanide in the treatment of cryptosporidial diarrhoea in AIDS patients in Mexico. Trans R Soc Trop Med Hyg 1998;92:663-666.

151. Rossignol JF, Ayoub A, Ayers MS: Treatment of diarrhea caused by Cryptosporidium parvum: a prospective randomized, double-blind, placebo- controlled study of Nitazoxanide. J Infect Dis 2001;184:103-106.

152. Amadi B, Mwiya M, Musuku J, Watuka A, Sianongo S, Ayoub A, Kelly P: Effect of nitazoxanide on morbidity and mortality in Zambian children with cryptosporidiosis: a randomised controlled trial. Lancet 2002;360:1375-1380.

153. Gilles HM, Hoffman PS: Treatment of intestinal parasitic infections: a review of nitazoxanide. Trends Parasitol 2002;18:95-97.

154. Bicart-See A, Massip P, Linas MD, Datry A: Successful treatment with nitazoxanide of Enterocytozoon bieneusi microsporidiosis in a patient with AIDS. Antimicrob Agents Chemother 2000;44:167-168.

155. Blagburn BL, Drain KL, Land TM, Kinard RG, Moore PH, Lindsay DS, Patrick DA, Boykin DW, Tidwell RR: Comparative efficacy evaluation of dicationic carbazole compounds, nitazoxanide, and paromomycin against Cryptosporidium parvum infections in a neonatal mouse model. Antimicrob Agents Chemother 1998;42:2877-2882.

156. Theodos CM, Griffiths JK, D'Onfro J, Fairfield A, Tzipori S: Efficacy of nitazoxanide against Cryptosporidium parvum in cell culture and in animal models. Antimicrob Agents Chemother 1998;42:1959-1965.

157. Fayer R, Ellis W: Paromomycin is effective as prophylaxis for cryptosporidiosis in dairy calves. J Parasitol 1993;79:771-774.

44

158. Sreter T, Szell Z, Varga I: Anticryptosporidial prophylactic efficacy of enrofloxacin and paromomycin in chickens. J Parasitol 2002;88:209-211.

159. Armson A, Menon K, O'Hara A, MacDonald LM, Read CM, Sargent K, Thompson RC, Reynoldson JA: Efficacy of oryzalin and associated histological changes in Cryptosporidium-infected neonatal rats. Parasitology 2002;125:113- 117.

160. Gobel E: Diagnosis and treatment of acute cryptosporidiosis in the calf. Tierarztl Umschau 1987;42:863-864.

161. Gobel E: Possibilities of therapy of cryptosporidiosis in calves in problematic farms. Zbl Bakt-Int J Med M 1987;265:490.

162. Gobel E, Loscher T: Possibilities of treating cryptosporidiosis in man and animals. Trop Med Parasitol 1987;38:253-254.

163. Moon HW, Woode GN, Ahrens FA: Attempted chemoprophylaxis of cryptosporidosis in calves. Veterinary Record 1982;110:181.

164. Riggs MW, Schaefer DA, Kapil SJ, Barley-Maloney L, Perryman LE: Efficacy of monoclonal antibodies against defined antigens for passive immunotherapy of chronic gastrointestinal cryptosporidiosis. Antimicrob Agents Chemother 2002;46:275-282.

165. Hunt E, Fu Q, Armstrong MU, Rennix DK, Webster DW, Galanko JA, Chen W, Weaver EM, Argenzio RA, Rhoads JM: Oral bovine serum concentrate improves cryptosporidial enteritis in calves. Pediatr Res 2002;51:370-376.

166. Arrowood MJ, Mead JR, Mahrt JL, Sterling CR: Effects of immune colostrum and orally administered antisporozoite monoclonal antibodies on the outcome of Cryptosporidium parvum infections in neonatal mice. Infect Immun 1989;57:2283-2288.

167. Doyle PS, Crabb J, Petersen C: Anti-Cryptosporidium parvum antibodies inhibit infectivity in vitro and in vivo. Infect Immun 1993;61:4079-4084.

168. Okhuysen PC, Chappell CL, Crabb J, Valdez LM, Douglass ET, DuPont HL: Prophylactic effect of bovine anti-Cryptosporidium hyperimmune colostrum immunoglobulin in healthy volunteers challenged with Cryptosporidium parvum. Clin Infect Dis 1998;26:1324-1329.

45 169. Alak JI, Wolf BW, Mdurvwa EG, Pimentel-Smith GE, Adeyemo O: Effect of Lactobacillus reuteri on intestinal resistance to Cryptosporidium parvum infection in a murine model of acquired immunodeficiency syndrome. J Infect Dis 1997;175:218-221.

170. Alak JI, Wolf BW, Mdurvwa EG, Pimentel-Smith GE, Kolavala S, Abdelrahman H, Suppiramaniam V: Supplementation with Lactobacillus reuteri or L. acidophilus reduced intestinal shedding of cryptosporidium parvum oocysts in immunodeficient C57BL/6 mice. Cell Mol Biol (Noisy-le-grand) 1999;45:855-863.

171. Foster JC, Glass MD, Courtney PD, Ward LA: Effect of Lactobacillus and Bifidobacterium on Cryptosporidium parvum oocyst viability. Food Microbiol 2003;20:351-357.

172. de Graaf DC, Spano F, Petry F, Sagodira S, Bonnin A: Speculation on whether a vaccine against cryptosporidiosis is a reality or fantasy. Int J Parasitol 1999;29:1289-1306.

173. Jenkins MC: Advances and prospects for subunit vaccines against protozoa of veterinary importance. Vet Parasitol 2001;101:291-310.

174. Harp JA, Woodmansee DB, Moon HW: Effects of colostral antibody on susceptibility of calves to Cryptosporidium parvum infection. Am J Vet Res 1989;50:2117-2119.

175. Fayer R, Andrews C, Ungar BL, Blagburn B: Efficacy of hyperimmune bovine colostrum for prophylaxis of cryptosporidiosis in neonatal calves. J Parasitol 1989;75:393-397.

176. Hafner CL, Brittingham MC: Evaluation of a Stream-Bank Fencing Program in Pennsylvania. Wildlife Society Bulletin 1993;21:307-315.

177. Sheffield RE, Mostaghimi S, Vaughan DH, Collins ER, Allen VG: Off-stream water sources for grazing cattle as a stream bank stabilization and water quality BMP. Transactions of the Asae 1997;40:595-604.

178. Tate KW, Nader GA, Lewis DJ, Atwill ER, Connor JM: Evaluation of buffers to improve the quality of runoff from irrigated pastures. J soil Water Conserv 2000;55:473-478.

179. Entry JA, Hubbard RK, Thies JE, Fuhrmann JJ: The influence of vegetation in riparian filterstrips on coliform bacteria: I. Movement and survival in water. J Envron Qual 2000;29:1206-1214.

46

180. Lim TT, Edwards DR, Workman SR, Larson BT, Dunn L: Vegetatited filter strip removal of cattle manure constituents in runoff. Trans Asae 1998;41:1375- 1381.

181. Coyne MS, Gilfillen RA, Villalba A, Zhang Z, Rhodes RW, Dunn L, Blevins RL: Fecal bacteria trapping by grass filter strips during simulated rain. J Soil Water Conserv 1998;53:140-145.

182. Atwill ER, Hou L, Karle BM, Harter T, Tate KW, Dahlgren RA: Transport of Cryptosporidium parvum oocysts through vegetated buffer strips and estimated filtration efficiency. Appl Environ Microbiol 2002;68:5517-5527.

183. Betancourt WQ, Rose JB: Drinking water treatment processes for removal of Cryptosporidium and Giardia. Vet Parasitol 2004;126:219-234.

184. Edzwald JK, Tobiason JE, Parento LM, Kelley MB, Kaminski GS, Dunn HJ, Galant PB: Giardia and Cryptosporidium removals by clarifiaction and filtration under challenge conditions. J Am Water Works Ass 2000;92:70-84.

185. Craik SA, Weldon D, Finch GR, Bolton JR, Belosevic M: Inactivation of Cryptosporidium parvum oocysts using medium- and low-pressure ultraviolet radiation. Water Res 2001;35:1387-1398.

186. Corona-Vaszuez B, Samuelson A, Rennecker JL, Marinas BJ: Inactivation of Cryptosporidium parvum oocysts with ozone and free chlorine. Water Res 2002;36:4053-4063.

187. Jacangelo JG, Adham SS, Laine JM: Mechanism of Cryptosporidium, Giardia, and MS2 virus removal by MF and UF. J Am Water Works Ass 1995;87:107- 121.

188. Horman A, Rimhanen-Finne R, Maunula L, von Bonsdorff CH, Rapala J, Lahti K, Hanninen ML: Evaluation of the purification capacity of nine portable, small- scale water purification devices. Water Sci Technol 2004;50:179-183.

189. Gerba CP, Naranjo JE, Hansan MN: Evaluation of a combined portable reverse osmosis and iodine resin drinking water treatment system for control of enteric waterborne pathogens. J Envron Sci Health A-Envir 1997;32:2337-2354.

190. CDC: Cryptosporidium and water: A public health handbook. Atlanta, GA, Center for Diseses Control and prevention, 1997.

47 191. Juranek DD: Cryptosporidiosis: sources of infection and guidelines for prevention. Clin Infect Dis 1995;21 Suppl 1:S57-61.

48

Species Host Range Author Ref.

C. parvuma Mus musculus (mouse) Tyzzer, 1912 43 Bos taurus (cattle) Panciera et al., 1971 3 Homo sapiens (humans) Nime et al., 1976 37 Sus scrofa (pig) Kennedy et al., 1977 38 Ovis aries (sheep) Barker et al., 1974 39 Capra hircus (goat) Tzipori et al.,1982 40 Equus caballus (horse) Snyder et al., 1978 41 C. hominis Homo sapiens (humans) Morgan-Ryan et al., 2002 34 C. muris Mus musculus (mouse) Tyzzer, 1910 42 Homo sapiens (humans) Katsumata et al., 2000 56 C. meleagridis Meleagridis gallopavo (turkey) Slavin, 1955 2 Homo sapiens (humans) Morgan et al., 2000 59 C. baileyi Gallus gallus (chicken) Current et al., 1986 45 C. galli Spermestidae, Fringillidae (birds) Pavlasek, 2001 54 G. gallus, Tetrao urogallus, Pinicola Ryan et al., 2003 55 enucleator (birds) C. suis Sus scrofa (pig) Ryan et al., 2004 61 C. nasorum Naso lituratus (fish) Hoover et al.,1981 44 C. molnari Sparus aurata and Dicentarchus labrax Alvarez-Pellitero et al., 2002 62 (fish) C. serpentis Elaphe guttata (corn ) Levine, 1980 46 E.subocularis (rat snake) Different species of lizards Xiao et al., 2004 58 Sanzinia madagascarensus (Madagascar boa) C. varanii Esmeral Pavlasek et al., 1995 53 C. wairi Cavia porcellus (guinea pig) Vetterling et al.,1971 47 C. felis Felis catis (cat) Iseki, 1979 48 Homo sapiens (humans) Pieniazek et al., 1999 57 C. canis Canis familiaris (dog) Wilson, 1983; 49 Morgan et al., 2000 60 Fayer et al, 2001 50 Homo sapiens (humans) Morgan et al., 2000 59 C. andersoni Bos taurus (cattle) Lindsay, 2000 51 C. saurophilum Eumeces Schneideri (lizard) Koduela et al., 1998 52 Different species of snakes Xiao et al., 2004 58 Different species of lizards Xiao et al., 2004 58 aMost commonly reported hosts.

Table 1.1 Valid taxonomic nomenclature of Cryptosporidium species and their host range

49

Species Author Reference

C. hominis McLauchlin et al., 2000 76 Xiao et al., 2001 77 Morgan-Ryan et al., 2002 34

C. parvum bovine genotype Xiao et al., 2001 77 cervine genotype Ong et al., 2002 79 monkey genotype Mallon et al., 2003 67

C. suis Xiao et al., 2002 78

C. meleagridis Morgan et al., 2000 59 Xiao et al., 2001 77 Pedraza-Diaz et al., 2001 80

C. felis Pieniazek et al., 1999 57 Pedraza-Diaz et al., 2001 81 Morgan et al., 2000 59

C. canis Pieniazek et al., 1999 57 Xiao et al., 2001 77 Pedraza-Diaz et al., 2001 81

C. muris Katsumata et al., 2000 56 Gatei et al, 2003 82 Palmer et al., 2003 83

Table 1.2 Cryptosporidium species and genotypes reported in human infections.

50

CHAPTER 2

DEVELOPMENT OF A SENSITIVE DETECTION SYSTEM FOR

CRYPTOSPORIDIUM SPECIES IN ENVIRONMENTAL SAMPLES

Introduction

Cryptosporidium oocyst, which contains four nfective sporozoites, is highly resistant to chemical and environmental hazards, and can remain viable in the environment for months (1). Human and animal feces containing viable oocysts can reach environmental sources, particularly water and soil, and spread to food via irrigation or direct contact. Thus, the environment is increasingly recognized as an important transmission route of Cryptosporidium infection. Sensitive methods to detect and enumerate oocysts in environmental samples are necessary to develop control measures for the transmission of the disease through the identification of contaminated sources and for applications such as environmental screening, monitoring public water supplies and tracing of asymptomatic carriers.

51 Routine detection of Cryptosporidium oocysts in feces is generally carried out using either direct microscopic visualization of oocysts by staining techniques (e.g., acid-fast) and fluorescent antibodies or enzyme immunoassays. The most widely applied diagnostic technique for the detection of oocysts in water is the immunofluorescence assay (IFA). All these methods are labor-intensive; require large number of oocysts for positive detection and are not suitable for high-throughput processing of samples. The few methods for the detection and enumeration of oocysts from soil samples that have been proposed rely on gradient/floatation techniques for oocyst isolation and microscopic visualization for enumeration (2, 3).

Molecular methods based on detection of Cryptosporidium DNA by amplification techniques such as PCR have been applied to environmental settings and have demonstrated relatively high sensitivity and specificity (4, 5). However, the sensitivity is affected by the presence of numerous organic and inorganic substances, especially in feces and soil, which inhibit the nucleic-acid based methods (6, 7).

Identified inhibitors include bile salts and complex polysaccharides in feces (8, 9) and humic substances in soil (10). Approaches that attempt to eliminate these inhibitors consist of oocyst recovery/purification methods prior to DNA extraction and/or direct removal of inhibitors during DNA extraction (e.g., spin columns (11, 12)). Density gradient purification (13), flow cytometry (4) and immunomagnetic separation (14) have been used to improve sensitivity by isolating clean oocysts suitable for subsequent

DNA extraction. These oocyst isolation and nucleic acid extraction methods are

52 frequently combined with conventional and molecular methods to achieve optimal detection limits. However, many of these assays include multiple steps that are time- consuming, expensive and a limited number of samples can be processed at one time.

To identify false negative results due to PCR inhibition, investigators have designed internal amplification controls that co-amplify with the target during the PCR reaction

(15, 16). In the presence of inhibition neither the internal control nor the target will amplify. A true negative can be identified if the internal control was amplified but not the target. It has been suggested that an internal control is absolutely necessary if samples are not subjected to DNA extraction before PCR amplification (15).

In the present study a sensitive rapid high-throughput assay for the detection and differentiation of Cryptosporidium species was developed. The assay included an oocyst recovery method combined with spin column DNA extraction, followed by a

PCR-hybridization protocol and Real-Time PCR-melting curve analysis for species identification. Additionally, an internal positive control (IPC) was designed to determine the presence of inhibitors.

Materials and Methods

Cryptosporidium oocysts. Cryptosporidium parvum oocysts OH strain, which has been maintained in our laboratory by passages in neonatal calves, were used to spike water, feces and soil samples. Oocysts were purified from calf feces by sodium

53 chloride and cesium chloride density gradient centrifugation (17) and enumerated with and hemacytometer. Purified oocysts (107oocysts/ml) were stored at 4ºC until used.

Oocyst suspensions used to spike water, feces or soil were 10-fold serially diluted immediately prior to use to obtain final concentrations of 106, 105, 104, 103, 102, 10 and

1 oocyst/g of soil or feces. Additionally, C. hominis, C. meleagridis, C. felis and C. canis oocysts used for Real-Time PCR were provided by Dr. Lihua Xiao (CDC,

Atlanta, GA). The identity of these isolates has been established by sequence analysis of the small-subunit rRNA and 70 kDa heat shock protein (hsp70) genes (18, 19).

Oocyst recovery/purification procedures used for soil. Five grams of soil were inoculated with oocysts suspensions of different concentrations. Spiked soil was subjected to two different protocols: the sodium chloride (NaCl) flotation method with

Tris-Tween 80 dispersion solution modified from Kuczynska and Shelton, 1999 (2),

Figure 2.1, or the sucrose flotation method modified from Kato and Bowman, 2002

(20), Figure 2.2. Each protocol was performed in triplicate.

Oocyst recovery procedures used for feces and water. Five grams of feces were spiked with 100-106 oocysts in suspension. Forty ml of water was added to the feces in 50 ml tubes, oocyst suspensions were added to the mix and vortex for 1 min.

Feces were centrifuged at 1800 x g and supernatant was discarded. 0.2g of spiked feces were directly used for DNA extraction. For water samples, 15 ml of distilled water was spiked with oocyst suspensions. Spiked water samples were centrifuged at 1800 x g for

54 20 min at 4ºC, the supernatant was discarded and the pellet was resuspended in 200µl of distilled water and transferred to a 1.5 ml centrifuge tube for subsequent DNA extraction. The procedures were performed in triplicate.

DNA extraction methods for soil, feces and water. Immediately after three freeze-thaw cycles (in liquid nitrogen), all samples were subjected to a DNA extraction protocol using the QIAmp DNA Stool Kit (QIAGEN, Inc., Valencia, CA) according to the manufacturer’s instructions. The UltraCleanTM Mega Soil DNA Kit (Mo Bio

Laboratories, Inc., Carlsbad, CA) was also used to directly extract DNA from five grams of Cryptosporidium spiked soil.

PCR-hybridization protocol for Cryptosporidium detection. A 442-bp

Cryptosporidium DNA fragment was amplified with the primers published by Laxer et al., 1991 (21): C1 (sense), 5’-CCGAGTTTGATCCAAAAAGTTACGAA-3’ and C2

(antisense), 5’-TAGCTCCTCATATGCCTTATTGAGTA-3’. The PCR reaction had a final volume of 30µl and contained 1X PCR Buffer, 2.5mM MgCl2, 200µM (each) dNTPs, 0.7µg bovine serum albumin, 0.5µM of each primer, 1 U HotStart Taq DNA

Polymerase (QIAGEN, Inc., Valencia, CA) and 3µl of DNA. The PCR program included 15min of initial denaturation at 95°C, followed by 35 cycles of denaturation at

94°C for 30s, annealing at 56°C for 30s, extension at 72°C for 1min, and final extension at 72°C for 7min. Both C1 and C2 primers were biotinylated to produce a labeled PCR product which was subjected to a solid-phase hybridization in 96-well microtiter plates

55 as described (22). The Cryptosporidium specific hybridization probe (5’-

TAACTTCACGTGTGTTTGCCAATGCATATGAA -3’) was resuspended in freshly prepared 1M ammonium acetate solution (pH 7.5) with a final concentration of 1 ng/µl.

Microtiter plates were coated with 100µl of the probe solution (coating solution), wrapped in parafilm and incubated overnight at 37ºC. After overnight incubation plates were washed 3 times with phosphate-buffered saline (PBS)-Tween 20 (0.05%) and then blocked with 200µl/well PBS-1% bovine serum albumin for 2 hr at 37°C. Plates were washed 3 times with PBS-Tween 20, air dried, and stored in airtight bags with desiccant at 4°C until used. Previously amplified biotinylated PCR products were denaturated with equal volume of denaturation solution (0.4N NaOH, 80mM disodium EDTA,

0.005% thymol blue). Then 100µl/well of neutrlization-hybridization buffer (1M

NaSCN, 80 mM NaH2PO4, 10mM NaH2PO4, pH 4.5) was added to precoated microtiter plates and 25µl aliquots of the denaturated amplicons were loaded into the wells. Plates were incubated for 1 hr at 37ºC and washed 6 times with PBS-Tween 20. Then

100µl/well of a 1:2,500 dilution of neutravidin-peroxidase (Pierce, Rockford, IL) were added and incubated for 15 min at 37ºC. Plates were washed 6 times with PBS-Tween

20 and 100µl/well of the substrate (tetramethylbenzidine) were added. After a 10 min incubation in the dark at room temperature the reaction was stopped with 100µ/well of a mild acid (5% HCl), and plates were read at 450nm with the automated ELISA reader

(Emax precision microplate reader, Molecular Devices, Sunnyvale, CA). Positive and negative controls were included in each plate. Samples were considered positive if the optical density was equal or higher than 0.2.

56

Internal positive control. An internal positive control (IPC) was prepared to distinguish between PCR failure, true negative results or false-negative results due to inhibitors that were not removed during the purification and DNA extraction steps. The strategy for the IPC construction was accomplished through several successive PCR reactions and is illustrated in Figure 2.3. First, PCR amplification was performed using primers 18S-LambdaF and Lambda-18SR which complement to each other at the 3’end and 5’ end, respectively (primers used for the IPC construction are described in Table

2.1). The initial 50µl PCR reaction contained 1X PCR Buffer, 2.5mM MgCl2, 200µM

(each) dNTPs, 1µM each primer, and 1.25 U HotStart Taq DNA Polymerase (QIAGEN,

Inc., Valencia, CA). After a 15min of initial denaturation at 95°C, 10 cycles of denaturation at 94°C for 30s, annealing at 50°C for 30s, and extension at 72°C for 1min, were followed by a final extension at 72°C for 7min. (Figure 2.3A). After 10 amplification cycles, primers 18SF and 18SR were added to the PCR tube. The 3’-end of 18SF and 18SR bind to the two ends of Lambda. Twenty-five additional cycles were performed to obtain a double stranded PCR product (Lambda-18s) (Figure2.3B). Next,

Lambda-18S was used as the template for a second PCR with primers C1-18S and 18S-

C2 which bind at their 3’ends to the ends of Lambda-18s to complete the IPC. PCR conditions were similar to the initial PCR reaction except that 35 cycles were performed without interruptions and 10µl of DNA template was added to the reaction (Figure

2.3C). Finally, the 135-bp IPC included Lambda primers and Cryptosporidium 18s rDNA primers flanked by primers C1 and C2. C1 and C2 amplify both the IPC and

57 Cryptosporidium DNA. An IPC hybridization probe was also designed to detect the IPC during the hybridization assay. The IPC hybridization probe binds to the 18s fragments in the IPC (see Table 2.1 and Figure 2.3D).

For further cloning, the IPC was purified with a QIAquick PCR purification Kit

(QIAGEN, Valencia, CA) following the manufacturer’s instructions. The IPC was ligated to a pcr2.1 vector (Invitrogen, Carlsbad, CA) and transformed into E. coli

TOP10 cells. Plasmids were purified using QIAprep Spin Miniprep Kit (QIAGEN,

Valencia, CA). Just before the DNA extraction step, 100 copies of IPC were added to each sample. It was detected and differentiated from the Cryptosporidium product by size (135-bp) during gel electrophoresis and by the IPC specific hybridization probe during the hybridization protocol. A positive result from the IPC indicated absence of inhibition and confirmed a negative result as a true negative.

Real-Time PCR. Bovine fecal samples were spiked with C. hominis, C. parvum, C. meleagridis, C. canis and C. felis oocysts. DNA extraction was performed as described above. To differentiate Cryptosporidium species a 272-bp fragment of the small-subunit rDNA (18s rDNA) was amplified using biotinylated Cryptosporidium- specific sense (18SF) 5’-GGAAGGGTTGTATTTATTAGATAAAG-3’ and antisense

(18SR-272) 5’-ATTGTTATTTCTTGTCACTACCTCCCT-3’ primers. Real-Time PCR was performed in 20µl capillary tubes using the LightCycler instrument (Roche

Molecular Biomedicals, Indianapolis, IN). The QuantiTeC Probe PCR Kit (QIAGEN,

58 Inc., Valencia, CA) was used for the reaction mixture. The PCR mixture contained 1X of the QuantiTec Probe master mix, 4mM MgCl2, 0.5µM each primer, 0.2µM of hybridization probes (anchor probe, 5’-

CCGTCTAAAGCTGATAGGTCAGAAACTTGAATG-fluorescein-3’; mutation probe, 5’-LCred705-GTCACATTAATTGTGATCCGTAAAG-3’) (23), 0.5µg of bovine serum albumin and 1µl of DNA template in a total volume of 20µl. The capillary tubes were capped, centrifuged at 700 x g for 5s, and placed in the LightCycler carousel. The LightCycler was programmed as follows: an initial denaturation at 95°C for 15min followed by 55 cycles of amplification with denaturation at 95°C for 0s, annealing at 48°C for 30s, and extension at 72°C for 30s. Following the amplification the PCR products were identified by a melting curve analysis.

Melting curve analysis. After the completion of the last PCR cycle, a quick denaturation at 95°C (0s holding time) was performed, followed by a 30s annealing step at 40°C with a slow ramp (0.1°C/s) up to 80°C with continuous detection throughout the ramp. In addition, the Real-Time PCR products were harvested from the capillary tubes, electrophoresed, and visualized by ethidium bromide stained 1.5% agarose gels to confirm the size of the amplified product. The Real-Time PCR with melting curve analysis was performed five times to establish a specific melting temperature for each species.

59 The anchor probe for use in the Real-Time PCR is based on the sequence that is conserved among all Cryptosporidium species. The mutation probe is based on a sequence of C. hominis and it is designed to hybridize to all intestinal Cryptosporidium parasites with varying degrees of mismatches (23). The amount and the position of the mismatches determine the melting temperature of the DNA-mutation probe complex.

The melting temperature is inversely proportional to the number of mismatches with the mutation probe. Therefore, species and genotype differentiation was based on differences in melting temperatures of the PCR-probe complexes.

Data analysis. Three replicates of the PCR-hybridization assay were performed for each type of spiked sample (soil, feces or water) The absorbance (A450) obtained from each replicate was recorded and mean absorbance was calculated for each type of sample to determine the limit of oocyst detected in soil, water and feces. Similarly, mean melting temperatures of the five replicates of the Real-Time PCR were calculated to establish a melting temperature for each Cryptosporidium species.

Sequencing analysis. After the PCR amplification and the Real-Time PCR method, sequencing analysis was performed with the 18s rDNA sense and antisense primers using the Big Dye Terminator Cycle Sequence Kit (Perkin Elmer) and analyzed on an ABI 377 automated sequencer to confirm that amplification of the

Cryptosporidium 18s rDNA gene was accomplished and to determine the specificity of the Real-Time PCR differentiation method.

60

Field samples. To validate the usefulness of the high-throughput detection methods, analysis of fecal, water, compost and manure samples from poultry and swine operations were performed. To detect the presence of Cryptosporidium parasites, the selected purification and DNA extraction protocol followed by the PCR-hybridization method were performed and only those determined to be Cryptosporidium-positive were subjected to the LightCycler Real-Time PCR method for species differentiation.

One hundred and seventy swine operation samples and 198 poultry operation samples were analyzed. Samples from swine operations included feces, manure, and products from waste management processes (Apendix A). Poultry samples included feces, manure, drag swabs and waste management process products (Apendix A).

Results

Soil purification and DNA extraction methods. After the purification-DNA extraction protocol, PCR was performed to determine the sensitivity of the purification methods. The direct purification/DNA extraction method with the UltraCleanTM Mega

Soil DNA Kit was able to detect above 1 x 106 oocysts (Figure 2.4). The detection limit of the NaCl flotation method was always 1 x 105 oocysts (Figure 2.4). However, the sucrose flotation method provided the greatest sensitivity detecting at least 10 oocysts.

Addition of the internal control to the soil samples confirmed the absence of inhibitors in the samples after the oocyst recovery and DNA extraction protocol (Figure 2.5).

61

PCR-hybridization protocol. Means absorbance (A450) values of the three replicates were calculated for Cryptosporidium spiked soil, water and fecal samples. As low as 10 oocysts were detected in the spiked soil and fecal samples (Table 2.2), but less than 10 oocysts were detected from spiked water samples (Table 2.3). The hybridization assay following PCR amplification was 10-fold more sensitive than gel electrophoresis. IPC PCR-hybridization gave positive results for all the samples indicating no PCR inhibition (Figure 2.6). Serial dilutions of the IPC were tested with the PCR-hybridization protocol and down to 10 copies of the IPC were detected.

Real-Time PCR. All Cryptosporidium species DNA samples used in this study were detected with the Real-Time PCR and were differentiated by the melting curve analysis (Figure 2.7). Each species had a different melting temperature (Tm) facilitating its identification. Melting temperatures calculated for C. parvum, C.hominis, C. meleagridis, C. canis and C. felis were 55.6°C, 64.2°C, 59.8°C, 54.0°C and 50.1°C, respectively (Table 2.4). Consistent Tm were obtained for each species with inter-assay variation smaller than 0.3°C (Table 2.4). Sequence analysis of the PCR products confirmed targeted species.

Field samples. A detection assay was adapted for each different sample type analyzed (Table 2.5). A total of 368 samples were analyzed from poultry and swine operations (Tables 2.6 and 2.7). Twenty-three samples were positive for

62 Cryptosporidium by the PCR-hybridization assay. Cryptosporidium was detected only in hog manure samples that came from the Hog High Rise House (Table 2.6).

Cryptosporidium was detected in both feces and manure samples in all poultry operations studied (Table 2.7). Most of the poultry positive samples came from the

Chicken Layer House (29.6%).

Analysis of the Tm demonstrated that the species present in the poultry samples corresponded to C. baileyi and C. meleagridis. On the other hand, Tm for swine samples corresponded to C. felis a species only reported in human and cat infections.

Sequence analysis of the swine samples confirmed the isolates as C. parvum.

Discussion

A PCR-hybridization method preceded by sucrose flotation and DNA extraction was developed for the detection of Cryptosporidium DNA and applied to field samples.

The results of this study demonstrate the potential of the assay for rapid detection of

Cryptosporidium parasites in environmental samples with a high-throughput approach.

Results indicated that sucrose flotation method provided high analytical sensitivity for isolation of Cryptosporidium oocysts from soil samples and combined with the DNA extraction step, prior to PCR, efficiently eliminated inhibitory substances. Sensitivity of the sucrose flotation method for oocyst extraction has been

63 reported as 93% with a specificity of 100% when 1.5 x 103 C. parvum oocysts were inoculated into soil samples (24). Mawdsley et al. (1996) (3) reported extraction efficiencies of up to 61.6% for 1g of soil samples. In contrast, low sensitivity was observed when samples were processed using the NaCl flotation method (1 x 105 oocysts/g). These results disagree with the detection limit (<40 oocysts/g) reported by

Kuczynska and Shelton (2) and Walker et al. (25). Differences may be due to the use of different amounts of soil sample and oocysts enumeration methods. Kuczynska and

Shelton spiked 25g of soil with 104 oocysts, recovery was estimated by fluorescence microscopy and they did not perform PCR. Walker et al. performed their experiments with one gram of soil and their PCR amplification success rate was greater than 70% only when soil samples were spiked with 100 oocysts/g or more. Oocyst recovery might be higher with smaller sample sizes due to increased oocyst/soil ratio and less debris and inhibitors. Low detection observed with the NaCl method, in this study, might also be associated with the high number of manipulation steps that could result in reduced oocysts recovery. The UltraCleanTM Mega Soil DNA Kit had the lowest sensitivity.

The use of this commercial kit for Cryptosporidium DNA extraction is limited to samples containing high numbers of oocysts (11) and it might be more useful for samples heavily contaminated with microbial populations (26, 27).

The PCR-hybridization after the purification and extraction steps was highly sensitive (10 oocysts/g), particularly for water samples (1 oocyst/15ml) and 10-fold more sensitive than PCR-gel electrophoresis. Real-Time PCR also had a high sensitivity

64 and specificity. The use of two sets of specific primers (primers for the amplification and the hybridization probes for the real-time detection and melting curve analysis) increases the specificity of the detection (23). Another advantage is that species differentiation or genotyping can be accomplished without additional methods such as sequencing or restriction digestion. In this study, Tm differences between species were at least 1°C, allowing easy identification. The Tm of each species was approximately

4ºC lower than the Tm reported by Limor et al. (23) possibly due to the differences of the amplicon size and PCR conditions. In this study the primers amplified a 272-bp fragment which resulted in a lower Tm and greater sensitivity. However, Tms of the two studies correlated in that C. hominis had the highest Tm followed by C. meleagridis, C. parvum, C. canis and C. felis with the lowest Tm.

The Tm predicted for C. parvum bovine genotype was 55.6ºC and the Tm obtained for the swine samples that came from the High Rise House range from 49.6-

50.1ºC. The swine samples might be contaminated with a pig genotype of C. parvum, which appears to have a Tm similar to C. felis. This could not be confirmed because the

C. parvum pig genotype isolate was not available for analysis and there are no previous reports on the Tm of the pig genotypes. It is also important to note that the Tm obtained for most of the poultry samples was similar to C. canis Tm (54.0ºC). Limor et al. reported that C. canis and C. baileyi had a Tm difference of less than 0.5ºC. Thus, poultry samples with Tm that range from 53ºC -54ºC were classified as C. baileyi.

65 The assay developed in the present study is intended to detect the presence of

Cryptosporidium oocysts in environmental samples, but not to differentiate viable from non-viable oocysts. Methods that estimate viable oocysts include in vitro excystation, vital staining (dye exclusion, FISH), reverse transcriptase (RT)-PCR and infectivity (in vitro or in vivo). Each of these methods has limitations including in vivo infectivity which requires animal testing and is the most costly and time-consuming. Excystation and vital staining overestimate oocyst viability and do not correlate well with animal infectivity (28, 29). Excystation combined with RT-PCR may detect messenger-RNA from viable oocysts but its correlation with infectivity has not been demonstrated (28).

Cell culture-PCR has being shown to be highly correlated to mouse infectivity but it has a high detection limit (102 oocysts) (29). The use of PCR combined with other techniques may provide powerful tools for viability testing. In this study, sucrose flotation was used for oocyst purification prior to PCR. Flotation methods require intact oocysts for isolation which can be identified by microscopic visualization. This might suggest that oocysts purified and identified by flotation techniques are viable because oocysts only an intact oocyst has the potential to be infective (24). Thus, it is possible to speculate that the current assay will be able to detect infectious oocysts because subsequent PCR amplify only DNA from viable oocysts.

The present study has shown that the hybridization detection system is feasible for routine detection of Cryptosporidium parasites; it can be adapted to different types of samples with minimal modifications and does not require expensive equipment. The

66 complete assay is easy and quick to perform with the capability of obtaining results from a large amount of samples in a few hours. The reagents and supplies to process each sample by the sucrose flotation, DNA extraction and PCR-hybridization assay costs approximately $4.00. When Real-Time PCR is included, the cost increases by approximately $2.25 per sample if a commercial kit is used in conjuction with specialized equipment (e.g., LightCycler Instrument). The Real-Time PCR cost per sample can be reduced to less than $1.00 if regular PCR reagents are used. In conclusion, the molecular detection system developed in the present study is sensitive, relatively inexpensive, amenable to automation, and can be applied to field samples for routine testing.

67 References

1. Fayer, R. 2004. Cryptosporidium: a water-borne zoonotic parasite. Vet Parasitol 126:37-56.

2. Kuczynska, E., and Shelton, D.R. 1999. Method for detection and enumeration of Cryptosporidium parvum oocysts in feces, manures, and soils. Appl Environ Microbiol 65:2820-2826.

3. Mawdsley, J.L., Brooks, A.E., and Merry, R.J. 1996. Movement of the protozoan pathogen Cryptosporidium parvum through three contrasting soil types. Biology and Fertility of Soils 21:30-36.

4. Johnson, D.W., Pieniazek, N.J., Griffin, D.W., Misener, L., and Rose, J.B. 1995. Development of a PCR protocol for sensitive detection of Cryptosporidium oocysts in water samples. Appl Environ Microbiol 61:3849-3855.

5. Caccio, S.M. 2003. Molecular techniques to detect and identify protozoan parasites in the environment. Acta Microbiol Pol 52 Suppl:23-34.

6. Wilson, I.G. 1997. Inhibition and facilitation of nucleic acid amplification. Appl Environ Microbiol 63:3741-3751.

7. Radstrom, P., Knutsson, R., Wolffs, P., Lovenklev, M., and Lofstrom, C. 2004. Pre-PCR processing: strategies to generate PCR-compatible samples. Mol Biotechnol 26:133-146.

8. Lantz, P.G., Matsson, M., Wadstrom, T., and Radstrom, P. 1997. Removal of PCR inhibitors from human faecal samples through the use of an aqueous two- phase system for sample preparation prior to PCR. J Microbiol Methods 28:159- 167.

9. Monteiro, L., Bonnemaison, D., Vekris, A., Petry, K.G., Bonnet, J., Vidal, R., Cabrita, J., and Megraud, F. 1997. Complex polysaccharides as PCR inhibitors in feces: Helicobacter pylori model. J Clin Microbiol 35:995-998.

10. Tsai, Y.L., and Olson, B.H. 1992. Rapid method for separation of bacterial DNA from humic substances in sediments for polymerase chain reaction. Appl Environ Microbiol 58:2292-2295.

68 11. Higgins, J.A., Fayer, R., Trout, J.M., Xiao, L., Lal, A.A., Kerby, S., and Jenkins, M.C. 2001. Real-time PCR for the detection of Cryptosporidium parvum. J Microbiol Methods 47:323-337. 12. Ward, L.A., and Wang, Y. 2001. Rapid methods to isolate Cryptosporidium DNA from frozen feces for PCR. Diagn Microbiol Infect Dis 41:37-42.

13. Chesnot, T., and Schwartzbrod, J. 2004. Quantitative and qualitative comparison of density-based purification methods for detection of Cryptosporidium oocysts in turbid environmental matrices. J Microbiol Methods 58:375-386.

14. Yakub, G.P., and Stadterman-Knauer, K.L. 2004. Immunomagnetic separation of pathogenic organisms from environmental matrices. Methods Mol Biol 268:189-197.

15. Betsou, F., Beaumont, K., Sueur, J.M., and Orfila, J. 2003. Construction and evaluation of internal control DNA for PCR amplification of Chlamydia trachomatis DNA from urine samples. J Clin Microbiol 41:1274-1276.

16. Hartman, L.J., Coyne, S.R., and Norwood, D.A. 2005. Development of a novel internal positive control for Taqman((R)) based assays. Mol Cell Probes 19:51- 59.

17. Current, W.L. 1990. Techniques and Laboratory maintenance of Cryptosporidium. In Cryptsoporidiosis of man and animals. R. Fayer, editor. Boca Raton, FL: CRC Press. 41-44.

18. Xiao, L., Escalante, L., Yang, C., Sulaiman, I., Escalante, A.A., Montali, R.J., Fayer, R., and Lal, A.A. 1999. Phylogenetic analysis of Cryptosporidium parasites based on the small-subunit rRNA gene locus. Appl Environ Microbiol 65:1578-1583.

19. Sulaiman, I.M., Morgan, U.M., Thompson, R.C., Lal, A.A., and Xiao, L. 2000. Phylogenetic relationships of Cryptosporidium parasites based on the 70- kilodalton heat shock protein (HSP70) gene. Appl Environ Microbiol 66:2385- 2391.

20. Kato, S., and Bowman, D.D. 2002. Using flow cytometry to determine the viability of Cryptosporidium parvum oocysts extracted from spiked environmental samples in chambers. Parasitol Res 88:326-331.

21. Laxer, M.A., Timblin, B.K., and Patel, R.J. 1991. DNA sequences for the specific detection of Cryptosporidium parvum by the polymerase chain reaction. Am J Trop Med Hyg 45:688-694.

69 22. Sreevatsan, S., Bookout, J.B., Ringpis, F., Perumaalla, V.S., Ficht, T.A., Adams, L.G., Hagius, S.D., Elzer, P.H., Bricker, B.J., Kumar, G.K., et al. 2000. A multiplex approach to molecular detection of Brucella abortus and/or Mycobacterium bovis infection in cattle. J Clin Microbiol 38:2602-2610.

23. Limor, J.R., Lal, A.A., and Xiao, L. 2002. Detection and differentiation of Cryptosporidium parasites that are pathogenic for humans by real-time PCR. J Clin Microbiol 40:2335-2338.

24. Barwick, R.S., Mohammed, H.O., White, M.E., and Bryant, R.B. 2000. Detectin of Cryptosporidium parvum and Cryptosporidium muris in soil samples. Biol Fertil Soils 31:385-390.

25. Walker, M.J., Montemagno, C., Bryant, J.C., and Ghiorse, W.C. 1998. Method detection limits of PCR and immunofluorescence assay for Cryptosporidium parvum in soil. Appl Environ Microbiol 64:2281-2283.

26. Priha, O., Hallamaa, K., Saarela, M., and Raaska, L. 2004. Detection of Bacillus cereus group bacteria from cardboard and paper with real-time PCR. J Ind Microbiol Biotechnol 31:161-169.

27. Mumy, K.L., and Findlay, R.H. 2004. Convenient determination of DNA extraction efficiency using an external DNA recovery standard and quantitative- competitive PCR. J Microbiol Methods 57:259-268.

28. Joachim, A., Eckert, E., Petry, F., Bialek, R., and Daugschies, A. 2003. Comparison of viability assays for Cryptosporidium parvum oocysts after disinfection. Vet Parasitol 111:47-57.

29. Jenkins, M., Trout, J.M., Higgins, J., Dorsch, M., Veal, D., and Fayer, R. 2003. Comparison of tests for viable and infectious Cryptosporidium parvum oocysts. Parasitol Res 89:1-5.

70

Primer name Primer sequence (5’-3’)a

18S-LambdaF TTTATTAGATAAAGGAATATGTCCGTAAGCCATGTCTCGCACCGCAACAACA Lambda-18SR TTGTTGTCGCCACGCTCTGTACCGAATGCCTGTATAAGACCTCCAACAAGGA

18SF GGAAGGGTTGTATTTATTAGATAAAG 18SR AAGGAGTAAGGAACAACCTCCA

C1-18S CCGAGTTTGATCCAAAAAGTTACGAAGGAAGGGTTGTATTT 18S-C2 TAGCTCCTCATATGCCTTATTGAGTAAAGGAGTAAGGAACA

C1 CCGAGTTTGATCCAAAAAGTTACGAA C2 TAGCTCCTCATATGCCTTATTGAGTA

IPC probe GGAAGGGTTGTATTTATTAGATAAAG a Color code corresponds to Figure 2.3

Table 2.1 Primers used for the construction of the Internal Positive Control.

71

Oocyst Concentration 106 105 104 103 102 10 1 0 PC NC a b Dilution A450

1:5 3.078 3.041 3.245 3.518 3.041 2.688 0.069 0.062 3.342 0.067 1:25 2.794 2.711 2.519 2.204 1.463 1.057 0.062 0.064 2.601 0.068 1:125 1.508 1.378 1.159 0.998 0.693 0.602 0.068 0.070 1.396 0.065 1:625 0.595 0.423 0.357 0.311 0.233 0.172 0.064 0.065 0.432 0.066 1:3125 0.171 0.120 0.108 0.100 0.089 0.078 0.062 0.063 0.137 0.072 1:15625 0.121 0.076 0.095 0.072 0.068 0.059 0.068 0.065 0.065 0.064 1:78125 0.080 0.073 0.069 0.065 0.065 0.063 0.062 0.063 0.062 0.064 IPC 3.196 3.127 3.224 3.202 2.953 3.099 3.497 3.406 3.164 0.062 a Serial 5-fold dilutions of the PCR product b Values are means of three independent assays.

Table 2.2 Mean absorbance at 450nm of PCR-Hybridization products from Cryptosporidium spiked soil samples. Samples were considered positive at absorbance ≥ 0.2. Positive readings are bolded. PC, Cryptosporidium positive control; NC; negative control; IPC, internal positive control.

Oocyst Concentration 106 105 104 103 102 10 1 0 PC NC a b Dilution A450

1:5 3.459 3.209 3.182 3.209 3.015 1.109 1.071 0.082 3.371 0.091 1:25 2.266 2.418 2.775 2.765 2.295 0.325 0.345 0.08 2.785 0.084 1:125 0.849 0.854 1.31 1.309 0.971 0.132 0.133 0.073 1.19 0.083 1:625 0.253 0.232 0.427 0.395 0.324 0.083 0.081 0.072 0.445 0.088 1:3125 0.108 0.099 0.139 0.132 0.112 0.078 0.076 0.077 0.154 0.087 1:15625 0.094 0.087 0.099 0.09 0.085 0.077 0.075 0.079 0.103 0.089 1:78125 0.078 0.070 0.075 0.076 0.072 0.069 0.071 0.065 0.081 0.088 IPC 3.496 3.616 3.253 3.139 3.445 3.248 3.169 3.223 3.320 0.087 a Serial 5-fold dilutions of the PCR product b Values are means of three independent assays.

Table 2.3 Mean absorbance at 450nm of PCR-Hybridization products from Cryptosporidium spiked water samples. Samples were considered positive at absorbance ≥ 0.2. Positive readings are bolded. PC, Cryptosporidium positive control; NC; negative control; IPC, internal positive control. 72

Melting Temperature (ºC) Species 1 2 3 4 5 Mean (ºC) STDV

C. hominis 64.2 63.9 64.2 64.6 63.9 64.2 0.309 C. parvum 55.7 55.7 55.6 55.6 55.5 55.6 0.094 C. meleagridis 59.6 59.7 60.0 59.6 59.9 59.8 0.167 C. canis 53.9 53.9 53.8 54.2 54.3 54.0 0.199 C. felis 50.0 50.1 50.1 50.0 50.5 50.1 0.206

Table 2.4 Melting temperature of the hybridization probes for different Cryptosporidium species in five independent assays. STDV, standard deviation.

73

Sample Procedure

Feces Direct DNA extraction from the feces followed by PCR-hybridization Manure, soil, bedding litter Sucrose flotation, DNA extraction, PCR-hybridization Liquids Centrifugation, DNA extraction, PCR-hybridization Drag Swab Soak in water, vortex, centrifugation, DNA extraction, PCR- hybridization

Table 2.5 Procedures for Cryptosporidium oocysts purification and detection for different types of environmental samples.

Technology Total No. of Positive Percentage Samples Samples (%)

High Rise House 94 3 3.2 Ambient Anaerobic Digester and Greenhouse 30 0 0 Constructed Wetland 8 0 0 Conventional Swine Operation 6 0 0 Ekokan Up-flow biofiltration 10 0 0 Super Soils 16 0 0 ORBIT High Solids Anaerobic Digester 6 0

Total 170 3 1.8

Table 2.6 Number of Cryptosporidium positive samples from swine operations under different waste management technologies.

Technology Total No. of Positive Percentage Samples Samples (%)

Broiler House 44 2 4.5 Turkey House 100 2 2.0 Layer House 54 16 29.6

Total 198 20 10.1

Table 2.7 Number of Cryptosporidium positive samples from poultry operations under different waste management technologies. 74

Sample Code Melting Temperature (ºC) Suspected Species Sample Source

H1 49.6 C. parvum High Rise Hog Bldg H2 50.1 C. parvum High Rise Hog Bldg H11 49.9 C. parvum High Rise Hog Bldg P14 54.1 C. baileyi Broiler Farm - Poultry P60 53.8 C. baileyi Broiler Farm - Poultry P98 60.1 C. meleagridis Turkey Farm - Poultry P100 59.9 C. meleagridis Turkey Farm - Poultry P165 53.9 C. baileyi Chicken Layer House P182 53.9 C. baileyi Chicken Layer House P183 53.3 C. baileyi Chicken Layer House P184 53.5 C. baileyi Chicken Layer House P185 53.8 C. baileyi Chicken Layer House P186 53.7 C. baileyi Chicken Layer House P187 53.0 C. baileyi Chicken Layer House P188 54.0 C. baileyi Chicken Layer House P190 53.7 C. baileyi Chicken Layer House P191 54.0 C. baileyi Chicken Layer House P192 53.5 C. baileyi Chicken Layer House P193 53.5 C. baileyi Chicken Layer House P194 53.4 C. baileyi Chicken Layer House P195 53.5 C. baileyi Chicken Layer House P196 53.6 C. baileyi Chicken Layer House P198 53.5 C. baileyi Chicken Layer House

Table 2.8 Melting temperatures (Tm) of hybridization probes for swine and poultry positive samples

75

Disperse 5g of soil in 50 ml dispersion solution (50 mM Tris and 0.5% Tween 80) for 15 min with magnetic stirrer ↓ Filter solution through a stainless steel mesh sieve (pore size 40 µM), collect into 200 ml conical centrifuge tubes (Nalgene

↓ Add 50 ml extraction solution, centrifuge for 10 min at 500 x g

↓ Decant supernatant and transfer sediments to 50 ml tubes, add dispersion solution to 45 ml final volume and centrifuge at 500 x g, 10 min

↓ Resuspend sediment in 45 ml of NaCl (s.g. = 1.2), vortex and centrifuge (500 x g, 10 min)

↓ Transfer 5 ml of supernatant to 50 ml tube, add 45 ml dH2O, vortex and centrifuge (500 x g, 10 min)

↓ Transfer lower 25 ml of supernatant to 50 ml tube, add 25 ml dH2O, vortex and centrifuge (500 x g, 10 min)

↓ Transfer lower 5 ml of supernatant to 15 ml tube, add 10 ml dH2O, vortex and centrifuge (500 x g, 10 min)

↓ Transfer lowest 1 ml of supernatant to 1.5 ml eppendorf tube, centrifuge at 1500 x g for 3 min

↓ Resuspend pellet in 200 µl of dH2O ↓ DNA extraction, PCR

Figure 2.1 NaCl flotation method for oocysts recovery from soil samples, modified from Kuczynska and Shelton, 1999 (s.g., specific gravity, dH2O, distilled water).

76

Weigh 5 g of soil in 50 ml tubes.

↓ Add 20 ml of dispersion solution (0.5% 7X detergent (ICN Biomedical, Inc.) in PBS).

↓ Add small amout of zirconia/silica beads (0.5 mm) to the tube and vortex for 1 min.

↓ Underlaid the soil mix with 20 ml cold (4ºC) sugar solution (500 g Dextrose and 6.5 g Phenol crystals in 320 ml water, s.g = 1.2).

↓ Centrifuge at 1800 x g for 20 min at 4ºC.

↓ Remove the interface (10 ml) and transfer it to a second 50 ml tube.

↓ Add 35 ml of dH2O, vortex and centrifuge (1800 x g for 20 min at 4ºC).

↓ Remove supernatant and resuspend pellet in 200 µl dH2O

↓ DNA extraction and PCR

Figure 2.2 Sugar flotation method for oocysts recovery from soil samples modified from Kato and Bowman, 2002.

77

A 1st PCR 10 cycles + 18s-LambdaF Lambda-18sR

Lambda

B 25 cycles + 18sF 18sR

18s 18s Lambda-18s

C 2nd PCR + C1-18s 18s-C2

D Internal Positive Control C1

C2

IPC probe

Figure 2.3 Construction of Internal Positive Control (IPC). Primers C1 and C2 amplify both Cryptosporidium DNA and IPC. The IPC hybridization probe binds to the 18s fragment of the IPC.

78

M 1 2 3 4 5 6 7 8 9

A

~ 442 bp

M 1 2 3 4 5 6 7 8 9

B

~ 442 bp

Figure 2.4 Gel electrophoresis of PCR products from spiked soil samples after different recovery/purification methods. A: UltraClean Mega Soil DNA Kit, B: NaCl flotation method. M, marker 100 bp ladder; lanes 1-7, soil samples spiked with 106, 105, 104, 103, 102, 10, and 1 oocysts/g, respectively; lane 8, Cryptosporidium positive control, lane 9, negative control.

79

M 1 2 3 4 5 6 7 8 9 10

~ 442bp

Figure 2.5 Gel electrophoresis of PCR products from spiked soil samples after sucrose flotation method. M, marker 100 bp ladder; lanes 1-8, soil samples spiked with 106, 105, 104, 103, 102, 10, 1 and zero oocysts/g, respectively; lane 9, positive control, lane 10, negative control.

80

M 1 2 3 4 5 6 7 8 9

~ 442bp

~ 135 bp

Figure 2.6 Gel electrophoresis of PCR products from spiked soil samples after sucrose flotation method. M, marker 100 bp ladder; lanes 1-6, soil samples spiked with 100 copies of IPC and 106, 105, 104, 103, 102, 10, oocysts/g, respectively; lane 7, Cryptosporidium positive control; lane 8, 1000 copies of IPC; lane 9, negative control.

81

species.

Cryptosporidium

C. hominis C.

C. meleagridis

C. parvum

C. canis

C. felis C.

2.7Figure hybridization of different Peaks probes for Melting

82

CHAPTER 3

CRYPTOSPORIDIUM DETECTION BY OLIGONUCLEOTIDE MICROARRAY

Introduction

The Cryptosporidium parasite is a ubiquitous pathogen that infects humans and animals. Generally, humans are more frequently infected through contaminated water via an anthroponotic cycle (C. hominis infections) or a zoonotic cycle (C. parvum infections). From 1991 to 2000 Cryptosporidium was responsible for 37.7% of recreational water and 8.5% of drinking water outbreaks of gastroenteritis in United

States (US) (1). In 2000, 3,016 cases of cryptosporidiosis were reported to the Centers of Disease Control and Prevention (CDC), with higher incidence in children 1-9 years old and adults aged 30-39 years. However, due to underreported cryptosporidiosis cases, the CDC estimates that the true burden of this disease could have been 60,320 to

302,600 cases for that year (1). In the United Kingdom (UK) 2, 992 cases were reported in 2002 (www.hpa.org.uk/infections/topics_az/crypto/data_ew.htm) and 817-

1480 annual cases were reported in Germany during 2001-2003 (2). Measures to

83 improve surveillance include encouragement of laboratories to test for Cryptosporidium when examining stools and the conduction of epidemiological studies to understand geographic variability, incidence and risk factors associated with this disease.

Developing rapid methods for the detection and characterization of Cryptosporidium in the environment are critical to accomplish these tasks.

Biological research and diagnostics have been revolutionized with the development of microarray-based technology due to its versatility and capability of rapid high-throughput simultaneous analysis of a large number of targets. Microarray applications may include DNA and RNA sequence analysis (3, 4), detection of mutations at the genome level (5, 6), monitoring gene expression level of multiple genes (7, 8), genotyping (9) and detection of pathogens (10, 11). The latter application is being increasingly developed as sensitive and specific tools are needed for detection of food, air and waterborne pathogens during public health surveillance and biodefense

(11, 12). DNA microarrays might also satisfy the requirements for an effective molecular tool to identify and genotype Cryptosporidium in clinical and environmental samples. Therefore, the purpose of this study was to develop an oligonucleotide microarray to detect Cryptosporidium parasites with the potential to discriminate between species.

84 Materials and Methods

Cryptosporidium isolates. Cryptosporidium parvum oocysts OH strain has been maintained in our laboratory by passages in neonatal calves. C. hominis, C. meleagridis,

C. canis, C. felis oocysts were provided by Dr. Lihua Xiao (CDC, Atlanta, GA). The identity of these isolates has been established by sequence analysis of the small-subunit rRNA and 70 kDa heat shock protein (hsp70) genes (13, 14). Oocyst suspensions were subjected to three freeze-thaw cycles before DNA extraction with the QIAmp DNA

Stool Mini Kit (QIAGEN, Inc., Valencia, CA) according to the manufacturer’s instructions.

PCR primers. The 18s rDNA and hsp70 genes were chosen for

Cryptosporidium detection and species identification based on sequence availability in

GenBank database. Available target sequences were aligned using the Clustal method in

MEGALIGN (DNASTAR, Inc., Madison, WI) to identify intra-species polymorphisms.

PCR primers that amplify different fragments of these genes were designed using the primer design software Primer3 (http://frodo.wi. mit.edu/cgibin/primer3/primer3_ www.cgi). Forward primers were Cy3 labeled to detect hybridization between the forward sequence and the capture oligos (probes) in the array. Primers for the amplification of Cryptosporidium β-tubulin gene and universal 16s rRNA primers were also included as positive controls. Primers are listed in Table 3.1.

85 PCR amplification. Asymmetric PCR was performed for each species in 100µl reaction volumes with 1X PCR buffer, 2.5mM Mg2+, 200µM dNTPs, 500ng BSA, 2.5 U

HotStart Taq Polymerase (QIAGEN, Inc., Valencia, CA), 0.25µM Cy3-forward primer,

0.05µM reverse primer and 10µl of DNA. The PCR program included initial denaturation 95ºC for 15min, 35 cycles of amplification at 94ºC for 35s, 50ºC for 45s and 72ºC for 60s and final extension at 72ºC for 7min. Amplicons were visualized by gel electrophoresis. PCR products were purified with the QIAquick PCR purification

Kit (QIAGEN, Valencia, CA) according to the manufacturer’s instructions with few modifications: to elute DNA, 30µl of sterile water (instead of QIAGEN EB buffer) was added to the column for two minutes and centrifuged to collect the eluate. This step was repeated twice, collecting the eluate in the same tube. DNA was desiccated under vacuum.

Design of capture oligonucleotides (probes). Probes to capture

Cryptosporidium DNA were designed using the PROBESEL and Pickprb programs which select one unique oligo for each target sequence using thermodynamic alignment algorithm and calculates the melting temperatures (Tm) for each selected oligo (15). All

C. hominis, C. parvum, C. meleagridis, C. canis, and C. felis sequences for 18s rRNA, hsp70, β-tubulin genes and E. coli 16s rRNA available in GenBank were used for the

PROBESEL analysis. The probes were designed in the antisense direction to hybridize with the forward Cy3 labeled DNA. The array contained 18 detection probes and 4 control probes in triplicate. For the 18s rRNA gene one probe for each species was

86 found to be unique. For the hsp70 gene three probes for C. parvum, one for C. hominis, three for C. meleagridis, two for C. canis and one for C. felis were selected. Three probes were selected to capture β-tubulin gene sequences, one each for C. parvum, C. hominis and C. meleagridis. No β-tubulin sequences were found in GenBank for C. canis and C. felis. The control probes included a positive hybridization control (sense- antisense) which served as a quality control (16), and a positive PCR-hybridization control (16s rRNA). A negative hybridization control that was a nonspecific capture probe, and the fixation controls, which are Cy3 labeled probes spotted at different concentrations (10ng, 5ng, 2.5ng, 1.25ng and 0.625ng) were also used. The fixation controls served as a detection efficiency control (17). The nucleotide sequences of capture probes are shown in Table 3.2.

Microarray fabrication. Probes were resuspended in dH2O at a concentration of 100µM. Probe solution (4µl/well) was transferred into a 384-well microplate and 4µl of 2X Micro Spotting Solution Plus (TeleChem International, Inc., Sunnyvale, CA) was added to each well and mixed thoroughly by pipetting up and down 10 times. Oligos were printed onto glass ArrayItTM Super Amine Substrates with Stealth Micro Spotting

Pins fitted in the TeleChem’s ArrayItTM SpotBot® personal microarray robot

(TeleChem International, Inc., Sunnyvale, CA). Spot size was 100µm with 300µm spacing between spots. Printed substrates were baked for 90 minutes at 80°C in a drying oven without vacuum and stored at room temperature until used.

87 Microarray hybridization. Printed substrates were incubated for at least one hour at room temperature with 30ml of 1X BlockIt solution (TeleChem International,

Inc., Sunnyvale, CA). After blocking, substrates were washed twice in 1X SSC buffer and once in 0.01X SSC buffer. Pre-hybridized substrates were dried by centrifugation for 10s in a microarray high speed mini centrifuge. The purified and desiccated DNA was resuspended in 4µl of dH2O and 4µl of denaturation solution (0.4N NaOH, 80mM disodium EDTA, 0.005% thymol blue) in a 1.5ml microcentrifuge tube. Then, 32µl of neutralization-hybridization buffer (1M NaSCN, 80mM NaH2PO4.dH20, 10mM

NaH2PO4, 0.125% Tween-20) containing 0.05µM of positive control (sense strand)

(5Cy3-TTGTGGTGGTGGTGTGGT) (16) was added to the tube. Denatured DNA was hybridized to the microarray under glass coverslip for 16-18 hours at 42ºC. Hybridized substrates were washed twice with 1X SSC buffer, once with 0.01X SSC buffer and dried by centrifugation. Microarrays were imaged at 5.0µM resolution for 0.5sec using

ArrayWoRx microarray scanner (Applied Precision, Issaquah, Washington). Two slides per species were printed and hybridized.

Data analysis. Spot intensity data was exported to Microsoft Office EXCEL

2003. The intensity value for a given probe was the calculated mean of the three replicates of each capture probe. Signals greater than the intensity value of the negative control probe were considered positive.

88 Results

All Cryptosporidium isolates were amplified by PCR primers of each gene and detected by electrophoresis. The oligonucleotide microarray developed in this study was able to detect all Cryptosporidium isolates. Several, but not all, capture probes were specific for the targeted species (Figures 3.1-3.5).

Of the five capture probes that targeted the 18s rDNA (18s-hominis, 18s- parvum, 18s-meleagridis, 18s-canis, 18s-felis), 18s-parvum and 18s-felis were specific for C. parvum and C. felis, respectively. Probe 18s-canis hybridized correctly with C. canis DNA, but this probe also showed positive hybridization signal for C. hominis, C. parvum, C. meleagridis, and C. felis DNA. Probes 18s-hominis and 18s-meleagridis did not hybridized with any species.

Ten probes were designed to target the hsp70 gene (Table 3.2). Probe Hsp70- hominis had positive hybridization signal only for C. hominis. This probe did not show hybridization signal for the other four species. Of the three hsp70 probes designed to detect C. parvum, only hsp70-parvum-2 showed positive hybridization signal, but it hybridized with both C. parvum and C. hominis DNA. No hybridization signal was detected for probes hsp70-parvum-1 and hsp70-parvum-3 with any of the five species in this study. No positive signal was detected for any of the three C. meleagridis hsp70 probes with any of these species. Both probes hsp70-canis-1 and hsp70-canis-2 had

89 positive hybridization. Hsp70-canis-2 hybridized only with C. canis. Hsp70-canis-1 showed positive hybridization signal with all the species. The probe designed to identify

C. felis (hsp70-felis) hybridized only with C. felis DNA.

Probes designed to capture β-tubulin amplicons included Btub-hominis, Btub- parvum and Btub-meleagridis, which were designed to identify C. hominis, C. parvum and C. meleagridis, respectively. The three probes showed hybridization signal. Probe

Btub-hominis hybridized with C. hominis and C. parvum. Probe Btub-parvum specifically detected C. parvum. Btub-melaegridis hybridized with C. hominis and C. parvum, but not with C. meleagridis. The positive and negatives controls were correctly detected in all hybridization microarrays.

Discussion

Microarray systems may be useful for the rapid detection of pathogens due to their miniaturized design and multiplex capabilities. However, the specificity of this analysis depends on the availability of accurate genomic sequences in public databases.

This study intended to identify the five species reported in human infections using a low-density oligonucleotide microarray. The microarray detected Cryptosporidium isolates but did not allow the correct identification of the species except for C. canis.

Several reasons may help explain these results. First, complete genome sequences are only available for C. hominis and C. parvum. The number of sequences for the other

90 species is limited and their accuracy is uncertain. Second, the hsp70 and 18s rDNA were the genes with the greater number of sequences published in the database that included all five species. Finding unique probes to identify each species was difficult due to the high similarity between the targets used in this study. Phylogenetic analyses have recognized that C. parvum, C. hominis and C. meleagridis cluster together while

C. canis and C. felis are divergent of the major clades of C. parvum (13, 18). This was also evident in the sequence alignments and the small number of unique capture probes selected by PROBESEL software. Third, most of the probes differed by only one nucleotide (Table 3.3). More polymorphic genes, such as the GP60 gene, did not have enough species sequence information to be included in the analysis. The inclusion of additional genes may help in the discrimination between the most commonly reported species, C. parvum and C. hominis. Straub et al. (16) attempted to differentiate

Cryptosporidium species with an hsp70 single-nucleotide polymorphism microarray.

Only C. parvum and C. hominis isolates were detected and differentiated correctly on their array. They suggested that the discrimination failure was due to erroneous sequence information in GenBank and that the hsp70 gene is highly conserved among all Cryptosporidium spp. These same factors may have contributed to the ambiguous results of our microarray hybridization.

C. canis was the only species that hybridized correctly with all C. canis probes and without cross-hybridization with other species probes (Figure 3.4). Probe hsp70- hominis was specific for C. hominis. Similarly, probes 18s-parvum and Btub-parvum

91 were specific for C. parvum. Probe hsp70-canis-2 was specific for C. canis. Both C. felis probes (18s-felis and hsp70-felis) were specific for this species. Potentially, these specific probes can differentiate C. hominis, C. parvum, C. canis and C. felis. The remaining probes were not specific and showed cross-hybridization between species.

Cross-hybridization might be decreased with optimization of hybridization conditions.

DNA denaturation mode, hybridization temperature, incubation time, and several hybridization solutions with different salt composition were tested to obtain optimal signal with minimal background. Most favorable conditions were finally applied in the analysis.

C. hominis and C. parvum isolates cross-hybridized with each other and with C. meleagridis and C. canis probes. Excluding hybridization with C. canis probes, these results may not be unexpected due to the close similarities of these species and the few nucleotide mismatches between probes. The cross-hybridization of all the species with the C. canis 18s probe can be explained by a difference of one nucleotide at the 3’end

(Table 3.3).

In this study, discrimination of C. hominis, C. parvum, C. felis and C.canis was achieved with several of the selected probes. C. mealeagridis probes did not differentiate this species from the other four. Only two microarray-based technologies have been reported for Cryptosporidium detection (16, 19). Both arrays detected and differentiated only C. parvum and C. hominis isolates. Cross-hybridization problems

92 might be reduced when availability of Cryptosporidium sequences increase in public databases and genome sequences of other Cryptosporidium species are resolved.

Improvement of the detection might be achieved by analyzing other genes in addition to the ones included in this array, or by selecting longer probes with multiple polymorphisms. Additionally, a specific sequence fragment of each species can be identified by a perfectly matching probe set and additional probes with single- nucleotide mismatches which could result in a more robust analysis. Nevertheless, this work is an important step toward a molecular detection tool for Cryptosporidium species detection and genotyping in epidemiological investigations.

93 References

1. Hlavsa, M.C., Watson, J.C., and Beach, M.J. 2005. Cryptosporidiosis surveillance--United States 1999-2002. MMWR Surveill Summ 54:1-8.

2. Joachim, A. 2004. Human cryptosporidiosis: an update with special emphasis on the situation in Europe. J Vet Med B Infect Dis Vet Public Health 51:251-259.

3. Chechetkin, V.R., Turygin, A.Y., Proudnikov, D.Y., Prokopenko, D.V., Kirillov, E.V., and Mirzabekov, A.D. 2000. Sequencing by hybridization with the generic 6-mer oligonucleotide microarray: an advanced scheme for data processing. J Biomol Struct Dyn 18:83-101.

4. Ahrendt, S.A., Halachmi, S., Chow, J.T., Wu, L., Halachmi, N., Yang, S.C., Wehage, S., Jen, J., and Sidransky, D. 1999. Rapid p53 sequence analysis in primary lung cancer using an oligonucleotide probe array. Proc Natl Acad Sci U S A 96:7382-7387.

5. Kaller, M., Ahmadian, A., and Lundeberg, J. 2004. Microarray-based AMASE as a novel approach for mutation detection. Mutat Res 554:77-88.

6. Bruder, C.E., Hirvela, C., Tapia-Paez, I., Fransson, I., Segraves, R., Hamilton, G., Zhang, X.X., Evans, D.G., Wallace, A.J., Baser, M.E., et al. 2001. High resolution deletion analysis of constitutional DNA from neurofibromatosis type 2 (NF2) patients using microarray-CGH. Hum Mol Genet 10:271-282.

7. Ross, M.E., Mahfouz, R., Onciu, M., Liu, H.C., Zhou, X., Song, G., Shurtleff, S.A., Pounds, S., Cheng, C., Ma, J., et al. 2004. Gene expression profiling of pediatric acute myelogenous leukemia. Blood 104:3679-3687.

8. Harrington, C.A., Rosenow, C., and Retief, J. 2000. Monitoring gene expression using DNA microarrays. Curr Opin Microbiol 3:285-291.

9. Grimm, V., Ezaki, S., Susa, M., Knabbe, C., Schmid, R.D., and Bachmann, T.T. 2004. Use of DNA microarrays for rapid genotyping of TEM beta-lactamases that confer resistance. J Clin Microbiol 42:3766-3774.

10. Long, W.H., Xiao, H.S., Gu, X.M., Zhang, Q.H., Yang, H.J., Zhao, G.P., and Liu, J.H. 2004. A universal microarray for detection of SARS coronavirus. J Virol Methods 121:57-63.

94 11. Wilson, W.J., Strout, C.L., DeSantis, T.Z., Stilwell, J.L., Carrano, A.V., and Andersen, G.L. 2002. Sequence-specific identification of 18 pathogenic microorganisms using microarray technology. Mol Cell Probes 16:119-127.

12. Weinberg, S. 2004. Emergent FDA biodefense issues for microarray technology: process analytical technology. Expert Rev Mol Diagn 4:779-781.

13. Xiao, L., Escalante, L., Yang, C., Sulaiman, I., Escalante, A.A., Montali, R.J., Fayer, R., and Lal, A.A. 1999. Phylogenetic analysis of Cryptosporidium parasites based on the small-subunit rRNA gene locus. Appl Environ Microbiol 65:1578-1583.

14. Sulaiman, I.M., Morgan, U.M., Thompson, R.C., Lal, A.A., and Xiao, L. 2000. Phylogenetic relationships of Cryptosporidium parasites based on the 70- kilodalton heat shock protein (HSP70) gene. Appl Environ Microbiol 66:2385- 2391.

15. Kaderali, L., and Schliep, A. 2002. Selecting signature oligonucleotides to identify organisms using DNA arrays. Bioinformatics 18:1340-1349.

16. Straub, T.M., Daly, D.S., Wunshel, S., Rochelle, P.A., DeLeon, R., and Chandler, D.P. 2002. Genotyping Cryptosporidium parvum with an hsp70 single-nucleotide polymorphism microarray. Appl Environ Microbiol 68:1817-1826.

17. Hamels, S., Gala, J.L., Dufour, S., Vannuffel, P., Zammatteo, N., and Remacle, J. 2001. Consensus PCR and microarray for diagnosis of the genus Staphylococcus, species, and methicillin resistance. Biotechniques 31:1364-1366, 1368, 1370- 1362.

18. Xiao, L., Morgan, U.M., Limor, J., Escalante, A., Arrowood, M., Shulaw, W., Thompson, R.C., Fayer, R., and Lal, A.A. 1999. Genetic diversity within Cryptosporidium parvum and related Cryptosporidium species. Appl Environ Microbiol 65:3386-3391.

19. Wang, Z., Vora, G.J., and Stenger, D.A. 2004. Detection and genotyping of Entamoeba histolytica, Entamoeba dispar, Giardia lamblia, and Cryptosporidium parvum by oligonucleotide microarray. J Clin Microbiol 42:3262-3271.

95

Primer name Sequence (5’-3’) Product size Tm (ºC)

18SF-87 5Cy3-TGCGAATGGCTCATTATAACA 52.2 246 18SR-332 AGGCCAATACCCTACCGTCT 57.8 18SF-1426 5Cy3-TGATGCCCTTAGATGTCCTG 54.1 175 18SR-1600 AAGCTGATGACTTGCGCTTA 54.7 18SF-1663 5Cy3-CGGTGAATTATTCGGACCAT 52.5 111 18SR-1773 TGCAGGTTCACCTACGGAAA 56.4

HSPF-142 5Cy3-TTGGTGATGCAGCAAAGAA 52.7 388 HSPR-529 GCTGCAGTTGGCTCGTTAAT 56.0 HSPF-1150 5Cy3-CCTCTGCCGTACAGGATCTC 56.9 440 HSPR-1589 CTGCTCATCCTCACCCTTGT 56.9

BTUBF 5Cy3-GATTGGTGCTAAATTCTGGG 51.3 442 BTUBR GTCTGCAAAATACGATCTGG 52.2

16SF-11 5Cy3-GTTTGATCMTGGCTCAG 50.0 897 16SR-907 CCGTCAATTCMTTTRAGTTT 52.1

Table 3.1 Primer sequences for PCR amplification of Cryptosporidium 18s rDNA, hsp70, and β-tubulin genes and universal 16S rRNA primers.

96

Probe name Sequence (3’-5’) Tm (ºC)

18s-hominis TTCTTGGTCATATTAACCAC 47.3 18s-parvum TGCCTAGTGTAATTTACACT 49.3 18s-meleagridis TTATTAGGACAAAGCTTCCT 48.8 18s-canis GAATCTCCTTCCTCTTCAGC 51.6 18s-felis GTACGCCTTTCTGGGATGAA 54.8

hsp70-hominis AACCTTTCAAGGTAGAACTA 49.3 hsp70-parvum-1 TCCTTGTGGTAGGTTCTTGG 54.8 hsp70-parvum-2 GGAAGTGATGAATACGACTA 49.1 hsp70-parvum-3 GACAACTATTTTCATGACCA 47.2 hsp70-meleagridis-1 AACTATTCTCGTGACCATTC 49.3 hsp70-meleagridis-2 CTAAAGCTATTGTCTGAACA 47.6 hsp70-meleagridis-3 TCCGTTGTTTCCTACGACCA 57.5 hsp70-canis-1 AGGTCGGTTCTTCTGGGTCC 59.3 hsp70-canis-2 GACGACAACCTACAACGGGG 59.3 hsp70-felis TTCCAGCAGTCTCCGGGCTTCCT 64.1

Btub-hominis AGCCCATACCCATGAAACGA 55.8 Btub-parvum ACTACTTGTGCCCTAGCTGG 52.7 Btub-meleagridis CCCAAAGGTTTAGTGAGTGA 57.0

Positive control AACACCACCACCACACCA 57.1 16srRNA GGCCACCGCTTCCGCCGGGG 71.5 Negative control ATATGTCCGTAAGCCATGTCTCGC 67.0 Fixation control CGCCACGCTCTGTACCGAAT-Cy3 60.0

Table 3.2 Sequences of microarray capture probes.

97

Probe name Species Sequence (5’-3’)

18s-hominis C. hominis AAGAACCAGTATAATT----GGTG C. parvum AAGAACCAATATAATT----GGTG C. meleagridis AAGAACCAATATAATT----GGTG C. canis AAGAACCAATATTTTT----GGTG C. felis AAGAACCAATATTTTTTTTTGGTG

18s-parvum C. parvum ACGGATCACATT---AAAT---GTGA C. hominis ACGGATCACAAT---TAAT---GTGA C. meleagridis ACGGATCACAAT---TTAT---GTGA C. canis ACGGATCACATT---TTAT---GTGA C. felis ACGGATCACAATAATTTATTTTGTGA

18s-meleagridis C. meleagridis A-ATAA-TCCTGTTTCGAAGGA C. hominis ATATAT-TCCTGTTTCGAAGGA C. parvum ATATAT-TCCTGTTTCGAAGGA C. canis -TTTTT-TCCTGTTTCGAAGGA C. felis ATATTTATCCTGTTTCGAAGGA

18s-canis C. canis CTTAGAGGAAGGAGAAGTCG C. hominis TTTAGAGGAAGGAGAAGTCG C. parvum TTTAGAGGAAGGAGAAGTCG C. meleagridis TTTAGAGGAAGGAGAAGTCG C. felis TTTAGAGGAAGGAGAAGTCG

18s-felis C. felis CATGCGGAAAGACCCTACTT C. hominis CATGCGAAAAAACTCGACTT C. parvum CATGCGAAAAAACTCGACTT C. meleagridis CATGCGAAAAAACCTGACTT C. canis CATGCGAAAAAACCTGACTT

Table 3.3 18s rDNA nucleotide sequences used for the design of the five Cryptosporidium species specific capture probes. GenBank accession numbers are AF093491 (C. hominis), AF093493 (C. parvum), AF112574 (C. meleagridis), AF112576 (C. canis), AF112575 (C. felis). Bolded nucleotides indicate distinctive polymorphisms between the probe and the other species.

98 . The table indicate the probes and C. felisC. canis C. meleagridis C. parvum C. hominis C. Cryptosporidium hominis Cryptosporidium 5ng5ng5ng sen-anti sen-anti hsp70 sen-anti hsp70 hsp70-1 hsp70 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70 hsp70 hsp70 10ng10ng10ng Buffer Buffer Buffer 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 2.5ng2.5ng2.5ng 16s 16s 16s Buffer Buffer hsp70-2 Buffer hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 Buffer Buffer Buffer 1.25ng1.25ng Negative1.25ng Negative Buffer Negative Buffer Buffer Buffer Buffer Buffer hsp70-3 hsp70-3 hsp70-3 hsp70-3 hsp70-3 hsp70-3 Buffer Buffer Buffer 0.625ng0.625ng0.625ng Buffer Buffer Buffer Buffer Buffer Buffer Buffer Buffer Buffer B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin Fix ControlFix Controls their positions in the array. Figure 3.1Figure Microarray hybridization of

99 . The table indicate the probes and C. felisC. canis C. meleagridis C. parvum C. hominis C. Cryptosporidium parvum Cryptosporidium 5ng5ng5ng sen-anti sen-anti hsp70 sen-anti hsp70 hsp70-1 hsp70 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70 hsp70 hsp70 10ng10ng10ng Buffer Buffer Buffer 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 2.5ng2.5ng2.5ng 16s 16s 16s Buffer Buffer hsp70-2 Buffer hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 Buffer Buffer Buffer 1.25ng1.25ng Negative1.25ng Negative Buffer Negative Buffer Buffer Buffer Buffer Buffer hsp70-3 hsp70-3 hsp70-3 hsp70-3 hsp70-3 hsp70-3 Buffer Buffer Buffer 0.625ng0.625ng Buffer0.625ng Buffer Buffer Buffer Buffer Buffer Buffer Buffer Buffer B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin Fix ControlFix Controls their positions in the array. positions in the array. their Figure 3.2Figure hybridization of Microarray

100 . The table indicate the probes C. felisC. canis C. meleagridis C. parvum C. hominis C. Cryptosporidium meleagridis 5ng5ng5ng sen-anti sen-anti hsp70 sen-anti hsp70 hsp70-1 hsp70 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70 hsp70 hsp70 10ng10ng10ng Buffer Buffer Buffer 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 2.5ng2.5ng2.5ng 16s 16s 16s Buffer Buffer hsp70-2 Buffer hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 Buffer Buffer Buffer 1.25ng1.25ng Negative1.25ng Negative Buffer Negative Buffer Buffer Buffer Buffer Buffer hsp70-3 hsp70-3 hsp70-3 hsp70-3 hsp70-3 hsp70-3 Buffer Buffer Buffer 0.625ng0.625ng0.625ng Buffer Buffer Buffer Buffer Buffer Buffer Buffer Buffer Buffer B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin Fix Control Controls and their positions in the array. the in array. their positions and Figure 3.3 hybridization Microarray of

101 . The table indicate the probes C. felisC. canis C. meleagridis C. parvum C. hominis C. Cryptosporidium canisCryptosporidium 5ng5ng5ng sen-anti sen-anti hsp70 sen-anti hsp70 hsp70-1 hsp70 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70 hsp70 hsp70 10ng10ng10ng Buffer Buffer Buffer 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 2.5ng2.5ng2.5ng 16s 16s 16s Buffer Buffer hsp70-2 Buffer hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 Buffer Buffer Buffer 1.25ng1.25ng Negative1.25ng Negative Buffer Negative Buffer Buffer Buffer Buffer Buffer hsp70-3 hsp70-3 hsp70-3 hsp70-3 hsp70-3 hsp70-3 Buffer Buffer Buffer 0.625ng0.625ng Buffer0.625ng Buffer Buffer Buffer Buffer Buffer Buffer Buffer Buffer B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin Fix Control Controls and theirand positions in the array. Figure 3.4Figure hybridization Microarray of

102

. The table indicate the probes

C. felisC. canis C. meleagridis C. parvum C. hominis C.

Cryptosporidium felis

5ng5ng5ng sen-anti sen-anti hsp70 sen-anti hsp70 hsp70-1 hsp70 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70-1 hsp70 hsp70 hsp70 10ng10ng10ng Buffer Buffer Buffer 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 18s 2.5ng2.5ng2.5ng 16s 16s 16s Buffer Buffer hsp70-2 Buffer hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 hsp70-2 Buffer hsp70-2 Buffer Buffer 1.25ng1.25ng Negative1.25ng Negative Buffer Negative Buffer Buffer Buffer Buffer Buffer hsp70-3 hsp70-3 hsp70-3 hsp70-3 hsp70-3 Buffer hsp70-3 Buffer Buffer 0.625ng0.625ng Buffer0.625ng Buffer Buffer Buffer Buffer Buffer Buffer Buffer Buffer B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin B-tubulin Fix Control Controls

and their positions in the array.

3.5Figure Microarray hybridization of

103

CHAPTER 4

EFFECT OF SOIL TILLAGE AND RAINFALL ON THE TRANSPORT OF

CRYPTOSPORIDIUM OOCYSTS THROUGH SOIL

Introduction

Cryptosporidiosis is a debilitating gastrointestinal disease in humans and animals characterized by severe diarrhea. It is a serious opportunistic infection in immunocompromised individuals. Cryptosporidium oocysts can be transmitted by direct human-animal contact or through contaminated food and water (1, 2). Numerous outbreaks of cryptosporidiosis have been documented worldwide, demonstrating that

Cryptosporidium is a significant waterborne pathogen, particularly in industrialized countries (1, 3). The main public health concerns are that Cryptosporidium oocysts are resistant to disinfectants commonly used in water treatments and may survive for months in water environments (4, 5). Furthermore, a low number of oocysts are sufficient to establish infection and cause disease in susceptible hosts. The infective

104 dose has been estimated as low as 10 oocysts (6, 7), but may be as low as one oocyst for the immunocompromised hosts (8, 9).

Many studies have demonstrated high concentrations of Cryptosporidium in untreated and treated waters sources (10, 11) and have implicated agricultural practices as an important source of contamination. Environmental contamination (water, soil and food crops) has been casually linked to manure runoff and manure spreading on farmland due to the high prevalence of the parasite in cattle (12-14). It has been suggested that rainfall events and snowmelt may increase Cryptosporidium loads in water sources due to surface runoff. Rainfall intensity especially determines the rapid and effective transport of oocysts (15, 16). In the United States, 68% of waterborne outbreaks reported from 1948 through 1994 were strongly associated with precipitation events (16). In Germany, Kiestemann et al. (17) compared microbial loads occurring during rainfall events and non-rain conditions. They showed that Cryptosporidium oocysts were frequently detected in drinking water tributaries and that parasite load increased during heavy rainfall events.

Most of the research designed to evaluate environmental contamination by

Cryptosporidium spp. has focused on direct contamination of water sources. Although

Cryptosporidium’s potential to contaminate and survive in the environment is well established, few studies have considered the role of soil as a reservoir of

Cryptosporidium oocysts. Similar to water environments, oocysts can remain infective

105 for months in the soil (18, 19). Large amounts of waste organics are disposed or applied to land (20), including sewage sludge and animal manure which are potentially contaminated by Cryptosporidium oocysts that can survive conventional sewage sludge treatments (21). The extent of soil contamination due to the presence of the parasite is not widely documented but could be highly prevalent in the surroundings of cattle facilities (22). Fruits and vegetables that are in contact with soil may become contaminated with Cryptosporidium oocysts if untreated manure or wastewater has been used as fertilizer or for irrigation (23).

Rainfall has a significant effect on the movement of pathogens through the soil and could result in contaminated water (24). The movement of Cryptosporidium oocysts through different types of soil following rainfall has been demonstrated under several experimental and natural conditions (12, 22, 25, 26). Water can spread and carry pathogens into and through the soil, reaching surface water sources and possibly ground water. Indeed, Cryptosporidium oocysts can migrate to a depth of 90 cm in soil and probably deeper in fractured soils (23). No-till soil often transports water faster and in larger amounts than tilled soil due to increased macropore continuity, suggesting that pathogen transport and dispersion can be increased by no-till management practices

(27). Earthworms can create burrows up to 2.5 m deep and these macropores have been shown to rapidly transmit up to 10% of natural rainfall through the soil profile and earthworm populations and burrow numbers frequently increase with no-till (28, 29).

Nevertheless no-till also provides numerous benefits to soil and crops, including greatly

106 reducing soil erosion and improving soil productivity by increasing soil organic matter content, plant-available water, and plant root growth. Moreover, no-till is considered one of the most cost effective crop production systems because it lowers labor and machinery costs (8, 30). Its use is increasing annually in the United States and no-till was used on 25.3 million hectares in 2004.

Therefore, the objective was to assess the effect of soil tillage and rainfall on the transport of Cryptosporidium oocysts through no-till and tilled soil under simulated rainfall following the application of liquid dairy manure. The results will aid in the design of better no-till and manure management strategies that maintain the many benefits of no-till while reducing pathogen loads to surface and subsurface waters.

Materials and Methods

Soil blocks. Twelve 30 by 30 by 30 cm blocks of intact loamy soil were collected from the surface of a no-till field and encased in polyurethane foam as described previously (31). To simulate tillage the surface10 cm of soil from six of the blocks was removed, mixed and then replaced on the top of blocks. The other six blocks were left as they were collected out of the field.

Inoculum preparation and manure application. Cryptosporidium parvum oocysts (OH strain), maintained in our laboratory by passages in neonatal calves, were

107 used to spike liquid dairy manure. Oocysts were separated from the calf feces by sodium chloride and cesium chloride density gradient centrifugation (32) and enumerated with an hemacytometer. One liter of liquid manure (3% solids) was spiked with approximately 4 x 108 oocysts and was slowly poured over the surface of each of soil block. The amount of liquid manure applied was equivalent to 11.1 mm of water and is within the range normally recommended for field applications. If any liquid manure immediately passed through the blocks following application the amount was recorded and a sample retained for analysis. Blocks were then kept undisturbed for 2, 4,

24 and 48 hours before being subjected to the rainfall treatments (Figure 4.1).

Rainfall treatments and leachate collection. Rain was applied to the blocks using a rainfall simulator described by Shipitalo et al. (31). The blocks were placed beneath an array of 105, 60 ml plastic syringes filled with tap water and manipulated by motor driven plates that control the application rates while creating a random drop pattern. The blocks were supported by a 64-cell grid lysimeter (cell size 3.75 by 3.75 cm). Transparent plastic tubing connected to each cell led to a collection rack consisting of sixty-four 50 ml tubes. These tubes were individually changed each time 35 mL of leachate was collected for an individual cell and the time recorded. Simulated rainfall was applied as either a low intensity, light rain (i.e., 5 mm in 30 min- total 450 mL) or as a high intensity, heavy rain (i.e., 30 mm in 30 min- total 2700 ml. Six different rainfall treatments (T1-T6) were designed to simulate typical rainfall patterns observed in the state of Ohio. Each treatment was applied to one no-till and one tilled block.

108 Leachate was collected during and approximately 30 min after application of the rain had ceased. The total amount of collected leachate was recorded for each cell.

The blocks were weighed before and after each rain to determine soil water content. After the last rainfall, four of the no-till blocks and four of the tilled blocks were sliced into eight, 3.75- cm-thick horizontal sections. Each soil section was carefully collected from top to bottom to avoid cross-contamination, placed in a plastic bag and mixed well prior to being subsampled for determination of oocyst content.

Cryptosporidium detection in water samples. Immediately after collection, 15 ml of the leachate samples were centrifuged at 1000 x g for 20 minutes at 4ºC. The pellet was resuspended in 500µl of sterile distilled water and stored at 4ºC until further processing. 200µl were used for DNA extraction with the QIAmp DNA stool Mini Kit

(QIAGEN, Inc., Valencia, CA). Cryptosporidium DNA was amplified by PCR with the primers published by Laxer et al. (33). PCR reaction of 20µl final volume contained 1X

PCR Buffer, 2.5mM MgCl2, 200µM (each) dNTPs, 0.7µg bovine serum albumin, 0.5

µM (each) sense and antisense primers, 1 U HotStart Taq DNA Polymerase (QIAGEN,

Inc., Valencia, CA) and 2µl of DNA. Both sense and antisense primers were biotinylated to produce a labeled PCR product which was subjected to a solid-phase hybridization in 96-well microtiter plates described elsewhere (34). Briefly, each well of the microtiter plates was coated with a Cryptosporidium specific oligonucleotide (5’-

TAACTTCACGTGTGTTTGCCAATGCATATGAA -3’) designed to capture both

109 strands of the labeled PCR product. Denaturated PCR products were loaded into the pre-coated wells containing neutralization-hybridization buffer (1M NaSCN, pH 4.5) and incubated at 37ºC. After a series of washing and incubation steps Cryptosporidium detection was achieved using the enzyme neutravidin-peroxidase and its substrate tetramethylbenzidine (TMB). The optical density (OD) of each well was determined at

450 nm with an automated ELISA Reader (Emax precision microplate reader,

Molecular Devices, Sunnyvale, CA). Positive and negative controls were included in each plate. The negative OD cutoff (less than 0.2 OD) was resolved previously.

Cryptosporidium detection in soil samples. Oocysts were separated from soil by a modified sucrose flotation protocol described by Kato et al. (35). In brief, five grams of soil from each of the eight sliced sections of blocks 2, 3, 5, and 6 were weighted and added to 50 ml tubes. Small amount of zirconia/silica beads (0.5 mm) and

20 ml of 0.5% 7X detergent in PBS were added to the sample and vortex for 1 min. The mix was underlain with 20 ml of cold (4 ºC) sugar solution (specific gravity = 1.2) and centrifuged at 1000 X g for 30min at 4ºC. The interface was removed, transferred to a second 50 ml tube and distilled water was added to a final volume of 45 ml. The sample was vortex and centrifuged. Supernatant was removed and pellet was resuspended in

500 µl of sterile distilled water. DNA extraction, PCR and hybridization were performed as described above.

110 Cryptosporidium oocysts quantification. The remaining 300 µl from the leachate and soil samples that resulted positive by Cryptosporidium-specific PCR- hybridization was subjected to immunomagnetic separation (IMS) using Dynabeads anti-Cryptosporidium Kit (Dynal Biotech ASA, Oslo, Norway) according to manufacturer instructions. Oocysts were enumerated using a hemacytometer.

Statistical analysis. Analysis of variance was performed using GLM procedure in SAS statistical software (SAS Institute Inc., Cary, NC). Independent variables included tillage and rainfall treatment (T1-T6), dependent variable was oocyst number.

Data was log10 transformed for the analysis. All rainfall treatments were combined to assess differences among tillage treatments Similarly, data for tilled and no-till blocks was combined to assess differences among rainfall treatments. P-value of 0.05 or lower was considered statistically significant.

Results

Tillage effect on oocyst transport. In each no-till block about 300 ml (30%) of the liquid manure leached through the block even before rain application. No pre-rain leaching was observed in the tilled blocks after the manure was applied. From a total of

810 leachate samples collected from the 12 blocks, 66.7% were collected from no-till soil blocks. An average of 17 cells collected leachate from the tilled blocks and an average of 24 cells from the tilled blocks. A significantly (P < 0.005) higher number of

111 samples tested positive for Cryptosporidium from no-till soil blocks (332 samples) compared with the samples collected from tilled soil blocks (127 samples). The number of oocysts recovered in leachate from no-till soil blocks was significantly higher than the number of oocysts recovered from tilled soil blocks (P=0.02) (Figure 4.2). Rainfall treatments did not significantly affect (P=0.96) the oocysts numbers detected in the leachate. The number of oocysts transported through no-till soil blocks ranged from 7.3 x 103 (T1) to 6.8 x 104 (T5), while the number of oocysts transported through tilled soil blocks ranged from 800 (T5) to 1.5 x 104 (T6).

Oocysts recovered from the soil block sections indicated that the tilled soil generally retained higher number of oocysts compared to the no-till soil, except when subjected to T2 (Figure 4.3). Only with treatments T5 and T6 applied to tilled blocks were oocysts detected in the top section of the soil blocks (Table 4.1). There was no clear pattern of distribution of oocysts in the soil blocks for the two tillage treatments as both exhibited a great amount of variation among depths. The factors that cause movement of the oocysts in the liquid manure into the soil matrix are not well understood and will require further investigation.

Rainfall effect on oocyst transport. Leachate collected from no-till soil blocks subjected to T4 andT5 (Figure 4.1) resulted in the highest number of oocysts recovered in the leachate (Figure 4.2). These treatments corresponded to the shortest time (2-4 hrs) between the manure application and rainfall. The highest number of oocysts in soil were

112 recovered from tilled soil blocks subjected to T5, which had two heavy rainfalls applied, and T2 and T3 that had 48 hours between manure application and rainfall. The lowest number of oocyst were recovered from the tilled soil block exposed to T 2.

The number of oocysts recovered from the soil sections was higher for T6, followed by T5, T2, and T3 (Figure 4.4). The lowest number of oocysts was recovered from no-till soil block exposed to T3 and were detected only from the bottom sections

(7 and 8) of the block (Table 4.1) where water tended to hang before falling into the collection vessels, thus allowing more contact time with the soil.

The distribution of oocysts in soil blocks did not show a common pattern

(Figure 4.5). For T3, the highest concentrations of oocysts were found in the bottom layers. Treatment 5 showed a different pattern with lower number of oocysts in the top and bottom layers and higher numbers in the middle layers. Soil blocks exposed to T2 and T6 generally showed oocysts numbers decreasing as depth increased.

Discussion

Vertical transport of Cryptosporidium oocysts was demonstrated with or without tillage as a function of rainfall treatment. Oocysts were detected in the leachate from all soil blocks, but significant higher number of oocysts was recovered from no-till soil blocks. The large size of Cryptosporidium oocysts, filtration, sedimentation and

113 adsorption to soil particles may influence its movement through soil (36). In addition, soil properties such as type of soil, size and number of micropores, organic matter and charge may have considerable effects. Major differences between the intact and disturbed soil are the lack of natural soil structure and absence of macropores

(wormholes) in the latter. Macropores were clearly visible in the soil blocks and, because they were not disrupted by tillage, can lead to high numbers of oocysts being transported through no-till soil, even before application of rain. Macropores, cracks and root channels in the soil allow rapid flow of water, promoting pathogens and chemical pollutants transport. Thus, the oocysts may have bypassed the adsorptive and filtering effects of the soil. Although it was not observed in all treatments, the oocysts retained in the top sections of tilled blocks demonstrated the filtration and absorption capabilities of disturbed soil.

When a rainfall event occurred only a few hours (2-4h) after the manure application, more oocysts were transported through the no-till soil. Allowing a longer time period to pass (i.e., 48 h) prior to the rainfall reduced the pathogen transport through no-till soil. It has been reported that storing animal wastes in piles before spreading may reduce the number of infective oocysts in the soil environment (37). Our results indicate that spreading the manure during dry seasons could be an effective management practice for reducing the oocysts movement. Therefore, the combination of these practices (storing animal wastes and spreading it during dry periods) may significantly reduce number of infective oocysts to reach susceptible hosts and may help

114 farmers to beneficially spread manure to fields without abandoning the use of no-till soil for crop production.

Filtration and adsorption may account for the retention of C. parvum oocysts in the soil mainly because of their relatively larger size (4-5µm) compared to other biological contaminants. In no-till soil, concentrations of oocysts in the soil represented a smallest proportion compared to the percolate. But the higher retention observed in the plow-till soil does not eliminate the fact that oocysts can be further transported with additional rain episodes. Rainfall intensity and duration can also affect oocysts retention in soil. No-till soil exposed to rainfall treatment 3, which included two episodes of heavy rain, resulted in the lowest number of oocysts recovered in the soil and most of this recovery occurred at the bottom of the block. Retention of oocysts at the top layer has been reported by other investigators (36, 38) and it was thought to be due to a filtering effect by the surface soil. However, the results observed in no-till soil blocks suggested that even though the depth of oocyst movement needed to reach drains may be greater than examined in this study (30 cm), some methods to reduce the risk of ground water contamination when liquid manure is applied to no-till soil is needed.

Hoorman and Shipitalo (39) recently reported results from a survey they conducted that investigated 98 incidents, over a 4-year period (2000 to 2003), where agricultural wastes in drainage waters contaminated streams in Ohio. Violations occurred most frequently with liquid swine or dairy wastes with all methods of

115 application irrigation, surface spreading, and subsurface injection. In most instances multiple factors contributed to each incident. The factor most commonly cited (41 cases) was application to saturated soils or heavy rainfall after application. Avoiding these conditions when applying liquid manure to soil should reduce the number and severity of incidents. Some method of disrupting the macropores in a no-till soil seems to be required for minimizing transport of manure to tile drain as only 17% of the incidents occurred on soils that were tilled or where wastes were incorporated. Thus the challenge is to develop liquid manure application technologies that can be used on no- till fields to minimize water contamination while maintaining the many benefits that are associated with no-till. Some possible solutions are 1) to avoid application directly over tile lines as transport in no-till soil is primarily in the vertical direction and 2) make sure application is conducted when soils are not saturated and with at least 48 hours between time of application and rainfall. Practices that reduce the load of infective oocysts and environmental contamination should also be examined including manure composting and storing of the animal wastes before spreading.

116 References

1. Slifko, T.R., Smith, H.V., and Rose, J.B. 2000. Emerging parasite zoonoses associated with water and food. Int J Parasitol 30:1379-1393.

2. Duffy, G., and Moriarty, E.M. 2003. Cryptosporidium and its potential as a food-borne pathogen. Anim Health Res Rev 4:95-107.

3. Solo-Gabrielle, H., and Neumeister, S. 1996. US outbreaks of cryptosporidiosis. J Am Water Works Assoc 88:76-86.

4. Robertson, L.J., Campbell, A.T., and Smith, H.V. 1992. Survival of Cryptosporidium parvum oocysts under various environmental pressures. Appl Environ Microbiol 58:3494-3500.

5. Tamburrini, A., and Pozio, E. 1999. Long-term survival of Cryptosporidium parvum oocysts in seawater and in experimentally infected mussels (Mytilus galloprovincialis). Int J Parasitol 29:711-715.

6. DuPont, H.L., Chappell, C.L., Sterling, C.R., Okhuysen, P.C., Rose, J.B., and Jakubowski, W. 1995. The infectivity of Cryptosporidium parvum in healthy volunteers. N Engl J Med 332:855-859.

7. USFDA. US Food and Drug Administration. 1992. Foodborne Pathogenic Microorganisms and Natural Toxins Handbook. Center for Food Safety and Applied Nutrition: College Park, Maryland.

8. Medema, G.J., and Schijven, J.F. 2001. Modelling the sewage discharge and dispersion of Cryptosporidium and Giardia in surface water. Water Res 35:4307- 4316.

9. Pereira, S.J., Ramirez, N.E., Xiao, L., and Ward, L.A. 2002. Pathogenesis of human and bovine Cryptosporidium parvum in gnotobiotic pigs. J Infect Dis 186:715-718.

10. Roach, P.D., Olson, M.E., Whitley, G., and Wallis, P.M. 1993. Waterborne Giardia cysts and Cryptosporidium oocysts in the Yukon, Canada. Appl Environ Microbiol 59:67-73.

11. LeChevallier, M.W., and Norton, W.D. 1995. Giadia and Cryptosporidium in raw and finished water. J Am Water Works Assoc 87:54-68.

117 12. Tate, K.W., Atwill, E.R., George, M.R., McDougald, N.K., and Larsen, R.E. 2000. Cryptosporidium parvum transport from cattle fecal deposits on California rangelands. J Range Management 53:295-299. 13. Tyrrel, S.F., and Quinton, J.N. 2003. Overland flow transport of pathogens from agricultural land receiving faecal wastes. J Appl Microbiol 94 Suppl:87S-93S.

14. Graczyk, T.K., Evans, B.M., Shiff, C.J., Karreman, H.J., and Patz, J.A. 2000. Environmental and geographical factors contributing to watershed contamination with Cryptosporidium parvum oocysts. Environ Res 82:263-271.

15. Atherholt, T.B., LeChevallier, M.W., Norton, W.D., and Rosen, J.S. 1998. Effect of rainfall on Giardia and Cryptosporidium. J Am Water Works Assoc 90:66-80.

16. Curriero, F.C., Patz, J.A., Rose, J.B., and Lele, S. 2001. The association between extreme precipitation and waterborne disease outbreaks in the United States, 1948-1994. Am J Public Health 91:1194-1199.

17. Kistemann, T., Classen, T., Koch, C., Dangendorf, F., Fischeder, R., Gebel, J., Vacata, V., and Exner, M. 2002. Microbial load of drinking water reservoir tributaries during extreme rainfall and runoff. Appl Environ Microbiol 68:2188- 2197.

18. Jenkins, M., Bowman, D., Forgaty, E., and Ghiorse, W. 2002. Cryptosporidium parvum oocysts inactivation in three soil types at various temperatures and water potentials. Soil Biol Biochem 34:1101-1109.

19. Kato, S., Jenkins, M., Fogarty, E., and Bowman, D. 2004. Cryptosporidium parvum oocyst inactivation in field soil and its relation to soil characteristics: analyses using the geographic information systems. Sci Total Environ 321:47- 58.

20. EPA. 2002. Land application of biosolids. (Office of Inspector General, Status Report 2002-S-biosolids) http://www.epa.gov/oig/reports/2002/BIOSOLIDS_FINAL_REPORT.pdf.

21. Whitmore, T.N., and Robertson, L.J. 1995. The effect of sewage sludge treatment processes on oocysts of Cryptosporidium parvum. J Appl Bacteriol 78:34-38.

22. Barwick, R.S., Mohammed, H.O., White, M.E., and Bryant, R.B. 2003. Prevalence of Giardia spp. and Cryptosporidium spp. on dairy farms in southeastern New York state. Prev Vet Med 59:1-11.

118 23. Armon, R., Gold, D., Brodsky, M., and Oron, G. 2002. Surface and subsurface irrigation with effluents of different qualities and presence of Cryptosporidium oocysts in soil and on crops. Water Sci Technol 46:115-122.

24. Auckenthaler, A., Raso, G., and Huggenberger, P. 2002. Particle transport in a karst aquifer: natural and artificial tracer experiments with bacteria, bacteriophages and microspheres. Water Sci Technol 46:131-138. 25. Davies, C.M., Ferguson, C.M., Kaucner, C., Krogh, M., Altavilla, N., Deere, D.A., and Ashbolt, N.J. 2004. Dispersion and transport of Cryptosporidium Oocysts from fecal pats under simulated rainfall events. Appl Environ Microbiol 70:1151-1159.

26. Barwick, R.S., Mohammed, H.O., White, M.E., and Bryant, R.B. 2003. Factors associated with the likelihood of Giardia spp. and Cryptosporidium spp. in soil from dairy farms. J Dairy Sci 86:784-791.

27. Gagliardi, J.V., and Karns, J.S. 2000. Leaching of Escherichia coli O157:H7 in diverse soils under various agricultural management practices. Appl Environ Microbiol 66:877-883.

28. Shipitalo, M.J. 2002. Earthworm and structure. In Encyclopedia of Soil Science. R. Lal, editor. 1255-1258.

29. Shipitalo, M.J., Dick, W.A., and Edwards, W.M. 2000. Conservation tillage and macropore factors that affect water movement and the fate of chemicals. Soil & Tillage Research 53:167-183.

30. CTIC. 2004. Conservation Technology Information Center. Conservation tillage and tillage types in United States, 1990-2004. 2004 National Crop Management Survey. http://www.ctic.purdue.edu/CTIC/CRM.html.

31. Shipitalo, M.J., Edwards, W.M., Dick, W.A., and Owens, L.B. 1990. Initial storm effects on macropore transport of surface applied chemicals in no-till soil. Soil Sci Soc Am J 54:1530-1536.

32. Current, W.L. 1990. Techniques and laboratory maintenance of Cryptosporidium. In Cryptosporidiosis of man and animals. J.P. Dubey, C.A. Spencer, and R. Fayer, editors. Boca Raton, FL: CRC Press. 41-44.

33. Laxer, M.A., Timblin, B.K., and Patel, R.J. 1991. DNA sequences for the specific detection of Cryptosporidium parvum by the polymerase chain reaction. Am J Trop Med Hyg 45:688-694.

119 34. Sreevatsan, S., Bookout, J.B., Ringpis, F., Perumaalla, V.S., Ficht, T.A., Adams, L.G., Hagius, S.D., Elzer, P.H., Bricker, B.J., Kumar, G.K., et al. 2000. A multiplex approach to molecular detection of Brucella abortus and/or Mycobacterium bovis infection in cattle. J Clin Microbiol 38:2602-2610.

35. Kato, S., and Bowman, D.D. 2002. Using flow cytometry to determine the viability of Cryptosporidium parvum oocysts extracted from spiked environmental samples in chambers. Parasitol Res 88:326-331. 36. Mawdsley, J.L., Brooks, A.E., and Merry, R.J. 1996. Movement of the protozoan pathogen Cryptosporidium parvum through three contrasting soil types. Biol Fertil Soil 21:30-36.

37. Jenkins, M.B., Walker, M.J., Bowman, D.D., Anthony, L.C., and Ghiorse, W.C. 1999. Use of a sentinel system for field measurements of Cryptosporidium parvum oocyst inactivation in soil and animal waste. Appl Environ Microbiol 65:1998-2005.

38. Darnault, C.J., Garnier, P., Kim, Y.J., Oveson, K.L., Steenhuis, T.S., Parlange, J.Y., Jenkins, M., Ghiorse, W.C., and Baveye, P. 2003. Preferential transport of Cryptosporidium parvum oocysts in variably saturated subsurface environments. Water Environ Res 75:113-120.

39. Hoorman, J.J., and Shipitalo, M.J. 2005. Factors contributing to the movement of liquid animal wastes surfaces drains. J Soil Water Conserv (in press).

120

Soil Treatmenta Block T-T2 NT-T2 T-T3 NT-T3 T-T5 NT-T5 T-T6 NT-T6 Section

1-Top - - - - + - + - 2 - + - - - + + - 3 + + - - - + + + 4 - - - - + + - + 5 - + - - + + + + 6 - - - - + - + - 7 + - + + - - - + 8-Bottom - - + - - + - - a Soil sections that tested positive for Cryptosporidium parvum by PCR are indicated with a plus sign (+) and section that tested negative are indicated with a dash sign (-).

Table 4.1 Presence of Crytposporidium parvum oocysts in the block sections of tilled (T) and no-tilled (NT) soil after rainfall treatments (T2, T3, T5, T6).

121

↓ ↓ ↓ ↓ ↓ ↓ ↓

↓ ↓ ↓ ↓

↓ ↓ ↓ ↓ ↓ min., (2700 ml total water). Tilled and no-tilled te of 5 mm/30 min. (450 ml total water) and the

↓ ↓ ↓ ↓ ↓ ↓ ↓ Rainfall Treatments

↓ ↓ ↓ ↓ heavy rain was applied at a rate of 30 mm/30 soil block. The light rain was applied at ra a blocks under treatments 2, 3, 5 and 6 were cut into 3.75 cm layers after the last rain event.

Slice soil block Slice soil block block soil leachate Slice block Collect leachate soil Collect Slice

↓ ↓ ↓ ↓ ↓ T1 T2 T3 T4 T5 T6 Wait 24 h 24 Wait hrs 48 Wait hrs 48 Wait hrs 2 Wait hrs 4 Wait hrs 4 Wait Wait 24 h 24 Wait leachate Collect leachate Collect 2 hrs Wait leachate Collect leachate Collect Apply manureApply Apply manure Apply manure manure Apply Apply manure Apply manure Figure 4.1Figure Each treatments. Rainfall was to oneapplied rainfall treatment no-till soil block tilled one and Apply light rain rain light Apply rain heavy Apply rain heavy Apply rain light Apply rain heavy Apply rain heavy Apply Collect leachate leachate Collect rain heavy Apply leachate Collect rain heavy Apply Apply heavy rain rain heavy Apply block soil Slice hrs 72 Wait rain Heavy block soil Slice hrs 72 Wait

122 No Tillage oocysts recoveredoocysts from leachate of tilled and no-till Tillage Rainfall Treatment Rainfall Cryptosporidium parvum soil blocks under different rainfall treatments (T1-T6). T1 T2 T3 T4 T5 T6 All

8 6 4 2 0

18 16 14 12 10 Figure 4.2 of Number

) 10 (x Oocysts of Number 4

123 No Tillage oocysts recoveredoocysts from soil block sections of Tillage Rainfall Treatment Rainfall Cryptosporidium parvum tilled treatments. different rainfall no-till soil under tilled and T2 T3 T5 T6

Figure 4.3 of Number

8 7 6 5 4 3 2 1 0

)/g dry soil dry )/g (x10 Oocysts 4

124 No Tillage oocysts in no-tillremaining oocysts tilledand soil. Soil Depth (cm) Depth Soil Tillage Cryptosporidium parvum 0 3 6 9 12 15 18 21 24 27 30

Figure 4.4Figure of Distribution 5 4 3 2 1 0

) /g dry soil dry /g ) 10 (x Oocysts 4

125

T6

T5

T3 oocysts in soil blocksremaining oocysts to simulatedexposed

(cm) Depth Soil T2

Cryptosporidium parvum

treatments. rainfall 0 3 6 9 12 15 18 21 24 27 30

5 4 3 2 1 0 ) /g dry soil dry /g ) 10 (x Oocyst 4

Figure 4.5Figure of Distribution

126

CHAPTER 5

DERIVATION OF CRYPTOSPORIDIUM HOMINIS PROGENY

IN THE GNOTOBIOTIC PIG MODEL

Introduction

Cryptosporidium is a member of the family Cryptosporidiidae, suborder

Emeriorina, phylum Apicomplexa. The genus Cryptosporidium contains at least 16 valid named species (1) and has been found worldwide in over 170 different vertebrate hosts, including mammals, birds and reptiles (2). Cryptosporidium causes a self-limiting diarrhea in immune-competent hosts but persistent diarrhea or even death can occur in the immune-compromised hosts. Cryptosporidium oocysts can survive in harsh environments and withstand wide variations in temperature, moisture, light intensity and disinfectants.

Several in vitro cell culture systems (e. g., human fetal lung cells (3), human intestinal cell lines (4), and chicken embryos (5) have been shown to permit parasite

127 development, but such systems produce limited numbers of oocysts and only last for a short period. These systems cannot be used for propagation of large numbers of oocysts, i.e. for experimental studies, because autoinfection does not seem to occur in cultured cells, and the number of released oocysts doest not exceeds the initial infective dose.

Recently, a cell-free C. parvum culture was developed. Evidence supported the contention that the parasite completed its life cycle in this system and was associated with a high oocyst yield (6). However, the method took several months and subsequent infection of animals was necessary to obtain large number of oocysts. In addition, in vivo conditions that may regulate oocyst production and development might be missing in the cell-free system. Thus, single cell clones, which have been the standard for other protozoa (7), are not available for Cryptosporidium as in vitro cultivation systems capable of expanding individual organisms from single cells are labor intensive, time consuming and do not reproduce the in vivo environment. Absence of clonal

Cryptosporidium reference strains has greatly limited research into the identification of virulence determinants of these species, and has made difficult the comparisons of pathogenesis studies between laboratories. It has been recently shown that gnotobiotic pigs are highly susceptible to Cryptosporidium infection and are useful for propagation of C. parvum, C. hominis and C. meleagridis isolates (8, 9). In this report we describe the derivation and evaluation of genetic stability of single cell derived progeny of C. hominis by infecting neonatal gnotobiotic pigs with a single oocyst selected using micromanipulation techniques.

128

Materials and Methods

Cryptosporidium hominis oocysts. C. hominis isolate H2265 used for the inoculation of gnotobiotic pigs has been described elsewhere (10). Oocysts were purified from human feces by immunomagnetic separation (IMS) (Dynabeads Anti-

Cryptosporidium; Dynal A.S, Oslo, Norway) according to manufacturer’s recommendations, enumerated and stored at 4°C for less than a month. When one or five oocysts were needed, 5µl of IMS-purified suspension containing approximately

1,000 oocysts/ml was examined on drop-slides by DIC microscopy (40X objective).

Droplets containing a single oocyst (or five when needed) were covered with 50µl of

1% low-melting point agarose solution (Life Technologies, Grand Island, USA) as previously described (8). The solidified agarose containing the oocysts was fed to one- day old pigs within one hour of embedding.

Neonatal gnotobiotic pigs and clinical scoring. Neonatal pigs were derived by hysterectomy and maintained in germ-free isolation as described (11, 12). Ten pigs were inoculated orally with C. hominis oocysts within 32 hours of birth. After inoculation, pigs were examined daily for clinical disease. Rectal swabs were collected to assess the presence of diarrhea and oocyst shedding. Fecal smears were acid-fast stained and examined by UV light microscopy (AF-UV) (13). Feces were scored as follows: 0 = normal, 1 = pasty, 2 = opaque liquid, 3 = watery. A score ≥ 2 was considered as diarrhea. Oocyst shedding was scored as follows: 0 = no oocysts were

129 detected, 1 = 1-10 oocysts/100µm2, 2 = 11-30 oocysts/100µm2 and 3 = >30 oocysts/100µm2. Dehydration was classified as mild (visible vertebrae), moderate

(prominent vertebrae and eyes retracted in orbit <1mm) and severe (prominent protruding vertebral and pelvic bones and eyes retracted in orbit <1mm).

Experimental infection model. Approximately one hundred thousand to one million (105-106) oocysts were inoculated into a gnotobiotic pig. This passage was called Parental 1 since it represented the first passage from outbreak-derived oocysts.

This pig was euthanized at the onset of oocyst shedding and its intestinal contents were collected for oocyst isolation by the previously described IMS method. Five oocysts were embedded in agarose (8), and inoculated into a second gnotobiotic pig (Parental 2) and its intestinal contents were harvested at the onset of oocyst shedding. A single oocyst from the intestinal contents of this gnotobiotic pig was microscopically separated and embedded in agarose prior for experimental inoculation. This single oocyst was used to inoculate a third neonatal gnotobiotic pig whose intestinal content was subsequently harvested at the onset of oocyst shedding as determined by AF-UV. Thus, the feces of this pig contained the progeny of a single oocyst designated as the “Clone”.

Two subsequent passages of 5-10 oocysts of the cloned isolates were performed in gnotobiotic pigs and called Progeny 1 and Progeny 2. Serial passages of oocysts were performed in duplicate experiments (Table 5.1).

130 DNA extraction, PCR amplification and cloning of the β-tubulin and GP60 genes. Two hundred microliters of intestinal contents containing the oocysts were used for DNA extraction using the QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, CA) according to the manufacture’s instructions. DNA concentration was determined by spectrophotometry [OD260 x (50 ng/µl)] (GeneQuant pro RNA/DNA Calcualtor,

Amersham Biosciences, Piscataway, NJ). To monitor the genetic stability of the

“Clone” and to evaluate the intra-generation heterogeneity, DNA was extracted from two separate fecal aliquots from each gnotobiotic pig representing each of the five generations. Cryptosporidium DNA was amplified by PCR techniques based on the 60 kDa glycoprotein (GP60) and the β-tubulin genes. PCR amplifications for β-tubulin were carried out as described previously (14). For the amplification of the GP60 gene the forward primer 5’-TCCGCTGTATTCTCAGCCCCAGCCGTTCC-3’ and reverse primer 5’- GATGTAACTTCACCAGAGATATATCT -3’were designed. The PCR was performed in a 50µl reaction mixture and consisted of 5µl DNA extract, 0.5µM of each primer, 1X PCR buffer, 2.5mM MgCl2, 200µM each dATP, dCTP, dGTP and dTTP,

700ng bovine serum albumin (BSA), and 1.25 U AmpliTaq Gold DNA polymerase

(Applied Biosystems, Foster City, CA). The thermal cycling conditions included an initial denaturation cycle at 94°C for 10 minutes followed by 35 amplification cycles of denaturation at 94°C for 60 sec., annealing at 57°C for 60 sec., and extension at 72°C for 60 sec. A final extension step at 72°C for 7 minutes was included. PCR product was purified with the QIAquick PCR purification Kit (QIAGEN, Valencia, CA) according to the manufacturer’s instructions for further cloning and sequence analyses. Amplicons

131 were cloned using the pcr2.1 vector (Invitrogen, Carlsbad, CA) and transformed into

Escherichia coli TOP10 cells following the protocol recommended by the manufacturer. The Plasmid DNA was harvested using the QIAprep Spin Miniprep Kit

(QIAGEN, Valencia, CA) and sequenced in both directions with the M13 universal primers using the Big Dye Terminator Cycle Sequencing Chemistry and analyzed on an automated ABI Prism 3700 DNA Analyzer (Applied Biosystems, Inc., Foster City,

CA). A total of 200 individual clones (40 clones for each pig passage) of each gene were isolated, sequenced and analyzed.

PCR amplification of microsatellites. Microsatellites 5B12, 1F07, 7E1C,

2G04, 6B03, and 5D11 were amplified by PCR as described by Feng et al., 2000 (15) with few modifications. In brief, the PCR reaction volume was 50µl containing 5µl of

DNA extract, 1X PCR buffer, 2.5mM MgCl2, 700ng BSA, 200µM deoxynucleoside triphosphates, 0.2µM of 5’end 6-FAM labeled forward primer, 1µM reverse primer, 1.0

U of HotStar Taq DNA polymerase (QIAGEN, Valencia, CA). The products were separated on the 3730 DNA analyzer (Applied Biosystems, Foster City, CA) and allele sizes were determined using GeneMapper 3.5 (Applied Biosystems, Foster City, CA).

Data analysis. The differences in the prepatent period, fecal score and oocyst shedding score between passages were compared by the Kruskal-Wallis test using the statistical software MINITAB (MINITAB, Inc., State College, PA). Multiple sequence alignments were performed using the Clustal method in MEGALIGN (DNASTAR,

132 Inc., Madison, WI). A consensus sequence was generated using the 40 sequences for each generation. BLAST database search was used to confirm sequence identities. The nucleotide position numbering was based on the start codon (ATG) in the published open reading frame sequence for β-tubulin (GenBank accession no. Y12615) and GP60 genes (GenBank accession no. AF155624).

Frequency of polymorphisms was calculated for each target gene by generation.

The character of the nucleotide substitutions and their distribution across each gene were used to identify recombination or development of new mutations within each generation.

Nucleotide sequence accession numbers. The nucleotide sequence data reported in this chapter is available in the GenBank database under accession numbers

AY645115 to AY645192.

Results

Experimental infection, clinical assessment, and oocyst shedding. Oocyst shedding and diarrhea began at 8 days post-inoculation (DPI) in low dose experiments

(Table 5.1). Mild to no dehydration or weight loss was observed in all gnotobiotic pigs.

The prepatent period (P = 0.22), fecal score (P = 0.89) and oocyst shedding score (P =

0.38) did not differ significantly between generations.

133

β-tubilin gene sequence analysis. A total of 36 nucleotide substitutions in 35 distinct positions were identified within the 355 bp β-tubulin fragment over the 5 generations (Figure 5.1). When weighted by the total numbers of nucleotides analyzed within each region, 11.7% were variable within the exon 2, 15.7% were substituted within the intron region, and 26% varied within the exon 1.

Seventy eight percent (157 out of 200) of the sequences shared identity between generations. BLAST database search identified seven β-tubulin partial sequences with

100% identity to our consensus sequence (GenBank accesion no. Y17790, AF115399,

CPU65381, AF481961.1, AF323578.1, AF323579.1, AF323580.1).

Parental 1 oocyst clones had 92.5% identical sequences with only 7.5% polymorphic sequences. After the first passage (Parental 2) the polymorphisms increased to 40%. After the isolation and passage of the single oocyst from the Parental

2 population the total number of polymorphic loci decreased. The sequences were identical in 67.5% (27 out of 40) of the cloned population. Among those with polymorphisms, 69.2% (9 out of 13) had single base substitution. Progeny 1 and

Progeny 2 had 87.5% (35 out of 40) and 85.0% (34 out of 40) identical sequences

(Table 5.2).

134 Of the 25 polymorphic sites occurring in the coding regions, eight (32%) resulted in synonymous substitutions and 17 (68%) led to amino acid changes. Of the

36 variable nucleotides, nine (25%) were identified in subsequent generations. High proportion of non-synonymous substitutions was observed in the β-tubulin gene similar to the reports of Rochelle et al.(2000) who suggested that those amino acid changes within the coding regions, if genuine, were conservative and would not affect the protein function.

GP60 gene sequence analysis. Sixty-three percent (126 out of 200) of the sequences were identical across all five generations. Over the five generations a total of

75 variable nucleotides occurred in 61 base positions of the 378 bp PCR product (Figure

5.2). The GP60 gene appeared to be more polymorphic with 24.5% of the cloned sequences carrying one base substitution, 8% two substitutions and 4.5% with 3 or 4 nucleotide mismatches. The clone population had 50% variable sequences (20 out of

40), the first and second progeny carried 35% (14 out of 40) and 20% (8 out of 40) variable sequences, respectively (Table 5.2).

Twenty-three (37.7%) of variable nucleotides led to synonymous substitutions and 38 (62.3%) resulted in non-synonymous changes. 17.3% of the variable nucleotides were passed on to subsequent cloned populations (Figure 5.2).

135 Nucleotide BLAST analysis of GP60 consensus sequence identified four published GP60 gene sequences that produced significant alignments to C. hominis gene with 99%-100% identity (GenBank accession no. AY167594, AF164504,

AF164502, AY262029).

Alignment of each consensus amino acid sequence against those derived from C. hominis and C. parvum isolates confirmed the polymorphic and conserved residues of the GP60 protein as previously reported (16).

Microsatellite analysis. A total of six loci were examined. All loci were consistent with genetic stability as they either maintained the alleles in all generations or converged to identical genotypes after the cloned generation. Locus 6B03 and 5D11 were homozygous in all generations. Locus 2G04 was heterozygous in all generations, while locus 5B12 showed heterogeneous population in the parental passage but homogenous in subsequent generations. The selection of the single oocyst resulted in the favored selection of the homozygous oocysts from parental isolates containing both heterozygous and homozygous. Similar results were observed with marker 7E1C. Locus

1F07 became homozygous at Progeny 2 from previous heterozygous generations.

Progeny 1 and Progeny 2 were the result of infections with 5-10 oocysts which might became a mixed population. Summary of the results are presented in Table 5.3.

136 Discussion

Cryptosporidium causes a difficult to treat and often life-threatening illness in the immune compromised host. Progress in our understanding of several biomedically relevant traits, such as host specialization, virulence, modes of transmission, and pathobiology of Cryptosporidium infections has been hindered by the lack of good in vitro or in vivo propagation systems for this organism. While several in vitro models have been used, they are inadequate to maintain clones and produce oocysts for pathogenesis related studies.

Gnotobiotic pigs have been established as a model for Cryptosporidium research for several years. However, prepatent period and inoculation doses used have varied considerably between different Cryptosporidium species. In the present study, we demonstrated the successful propagation of Cryptosporidium hominis in gnotobiotic pigs using low inoculating doses (1, 5 or 10 oocysts) with uniform onset of shedding at

6 to 8 days post-exposure. The prepatent period for one oocyst (6-8 days) was longer than that observed for relatively larger infecting oocyst doses (105-107) in gnotobiotic pigs or conventional pigs (3-5 days) (17, 18). Conventionally-reared pigs infected with

5×106 C. hominis oocysts began to shed on 3 days post-inoculation (DPI), compared with 4 or 5 DPI in pigs infected with 2×105 to 2×106 oocysts (19). In gnotobiotic pigs infected with 106 parental oocysts of unknown genotype, shedding was first detected on

4 DPI compared with 13 DPI in gnotobiotic pigs given 5×105 oocysts (17). A similar

137 dose effect on the prepatent period of C. parvum has also been demonstrated in neonatal murine cryptosporidiosis (20).

The successful infection of gnotobiotic pigs with a single oocyst purified by immunomagnetic separation and agar embedding lends promise for the use of this model for characterization studies of unique or rare Cryptosporidium isolates of which limited numbers of oocysts are available to study. The absence of the gut microflora in gnotobiotic pigs may explain why the model is so uniquely susceptible to single oocyst infection (21). The IMS procedure readily purifies low numbers of oocysts, which could then be propagated into gnotobiotic pigs to produce large numbers for further studies. Procedures used to prepare Cryptosporidium oocysts for inoculation can have profound affects on viability (and hence infectivity) (22, 23). The IMS method provided an efficient and facile approach to purify oocysts for the gnotobiotic pig inoculation studies in the present investigation.

Genotypic and phenotypic studies of Cryptosporidium have shown heterogeneity or polymorphisms within isolates of Cryptosporidium (10, 15, 24). PCR-

RFLP and real-time PCR has been used to identify genetic heterogeneity in such isolates (25, 26). One approach to confirm heterogeneity in a specific isolate is to study the genotypic and phenotypic profiles of single-oocyst derived clones. Our studies show that the progeny of the single-oocyst is phenotypically homogenous in that the

138 infectivity, prepatent period and severity of clinical signs were consistent in all subsequent low dose experiments.

Sequence analysis of β-tubulin and GP60 genes was undertaken to evaluate genetic stability amongst the original field isolated and subsequently cloned generations. These analyses were designed to identify all possible polymorphisms in the population by duplicate DNA extractions and analyses of the two target nucleotide sequences. The current analysis identified heterogeneity in both loci in the initial parental generations with a trend toward stabilization after single oocyst passage.

Polymers of the β-tubulin gene form microtubules that are the major components of the intracellular structures of eukaryotic cells (mitotic spindle, cytoskeleton and axonemes). It is a single copy gene and thus has been used to study genotypic heterogeneity between isolates (27). A relatively high degree of heterogeneity in the intron and the exon 2 regions has been described (28, 29). Several of these polymorphisms have been used to differentiate C. hominis and C. parvum (28, 30). This study showed low genetic heterogeneity within the intron region in each generation

(1.2-6.0%) compared with previous reports (13% (29) and 18% (14)).

The GP60 gene is single copy, lacks introns and has extensive intragenotype heterogeneity (16). This gene is the precursor of glycoprotein products localized to the surface of sporozoites and merozoites (stages in the life cycle of the parasite). Nucleic

139 acid sequence analysis of GP60 from different C. parvum isolates has shown more polymorphisms than any other Cryptosporidium loci examined to date (31). This study also demonstrated that the GP60 gene is highly polymorphic in the parental generations compared to the β-tubulin gene. The GP60 gene consensus sequence was homologous to the SFGH3, SFH4 isolates, which belonged to C. hominis allelic group Ia, reported by Strong et al. (2000) (16) and the HJ3 isolate reported by Wu et al. (2003) (24) as genotype Ia1. In addition, each of the variable sequences was compared with the

GenBank sequences (16). None of the variable sequences displayed C. parvum genotype II alleles reconfirming our isolates as C. hominis.

If the polymorphisms observed in the two targets analyzed were real, those unique to any single generation were possibly the result of either new mutation due to selective pressure or gene segments reassortment through recombination events that occur during replication and meiotic division. Intragenic recombination analysis demonstrated that recombination events are not the explanation to the polymorphisms observed in the study (data not shown). Alternatively, the polymorphisms observed in the sequences resulted during PCR amplification (due to Taq polymerase errors), cloning procedures and sequencing. The fidelity of the AmpliTaq Gold polymerase, used in this study, was one nucleotide change per 105 bases (Applied Biosystems, Foster

City, CA). Sequencing was performed in both directions with forward and reverse primers and was repeated for all polymorphic sequences to verify the variable nucleotides to get at least 3X coverage and reduce sequencing errors. Since

140 polymorphisms related to Taq polymerase incorporation errors are random, it is unlikely that at least the substitutions observed in subsequent progeny populations were related to these errors. Without excluding the possibility, the effect of the polymerase alone could not generate such a significant number of nonrecurring substitutions. Because the relative abundance of polymorphisms was in the parental generations, the sequence polymorphisms might reflect the degree of heretogeneity within this species (29) or may have occurred due to recombination during subsequent multiple passages.

Inasmuch as the nucleotide sequence data from β-tubulin and GP60 segments indicated that the polymorphic rates stabilized after the single oocyst passage, we further investigated it using microsatellite analysis. The analysis included both highly polymorphic and stable loci for comparisons. As expected, there was an indication of heterogeneity in the initial parental generations. Microsatellites corroborated with the genotype of the single-cell passage. These findings in conjunction with the fact that the total sequence variations in β-tubulin and GP60 segments decreased after passage of a single oocyst indicated that a homogeneous population was selected and maintained in the subsequent low dose passages. Taken together, the results of genetic analysis were highly suggestive that the C. hominis oocysts were successfully cloned.

Single oocyst progeny that we derived in this study are arguably not “single-cell clones” as there are four sporozoites within an oocyst. Therefore there are four copies of the β-tubulin and GP60 genes per oocyst even though these genes exist as a single copy

141 in the Cryptosporidium genome. However, the four sporozoites are derived from the same zygote which undergoes asexual division to produce the oocysts containing the sporulated sporozoites (2, 32) . Thus, in theory all are of the same genetic make-up

(such as quadruplets). This idea has not been confirmed experimentally as molecular studies of individual developmental stages have not been possible. The population structure of Cryptosporidium has been analyzed (33-35) and it appears to be different for C. parvum and C. hominis. In contrast to C. parvum parasites, C. hominis have shown evidence of clonality based on several criteria that have been used as the basis for the clonal population structure in related parasite, Toxoplasma (36, 37). The widespread occurrence of identical genotypes is an important criterion supporting this concept of a clonal population structure in Cryptosporidium (38). Parity between two sets of independent genetic markers suggests that recombination might be biologically restricted. Strong linkage disequilibrium among genes and the absence of recombinant genotypes has been demonstrated in C. hominis parasites (39-41) providing evidence of a clonal population structure as these concepts are considered indicators of clonality of parasitic protozoa.

Adequate preservation methods are not available for long-term storage of viable

Cryptosporidium oocysts (42). Preservation of viable Cryptosporidium requires continual passage in animals (43), and animal passages use large numbers of oocysts for inoculation (106 to 108). In this study, one to ten oocysts were sufficient to establish infection and subsequent disease, indicating that only a few viable oocysts are needed

142 for propagation of large numbers of oocysts in the gnotobiotic pig model allowing for longer “short-term” storage of oocysts in the refrigerator and fewer animal passages per year. The gnotobiotic pig model described in this study could be applied to investigate host Cryptosporidium interactions, recombination events, biology of mixed infections and evaluation of novel therapeutic modalities.

In summary, we developed a simple procedure to obtain single oocyst derived progeny of C. hominis. Using this technique, we established several generations of genetically and phenotypically similar populations. Further studies are needed to expand the numbers of clones sequenced for each gene from single-sporozoite derived populations in order to elucidate the reasons behind the genotypic diversity observed in these populations. Studies with different species of Crytposporidium are under way and should lay the foundation for future pathobiological studies to understand the mechanisms of disease caused by this pathogen.

143 References

1. Xiao, L., Fayer, R., Ryan, U., and Upton, S.J. 2004. Cryptosporidium taxonomy: recent advances and implications for public health. Clin Microbiol Rev 17:72- 97.

2. O'Donoghue, P.J. 1995. Cryptosporidium and cryptosporidiosis in man and animals. Int J Parasitol 25:139-195.

3. Current, W.L., and Haynes, T.B. 1984. Complete development of Cryptosporidium in cell culture. Science 224:603-605.

4. Gargala, G., Delaunay, A., Favennec, L., Brasseur, P., and Ballet, J.J. 1997. In vitro interactions of human blood and intestinal intraepithelial lymphocytes with Cryptosporidium parvum and C. parvum permissive enterocytic cell lines. J Eukaryot Microbiol 44:71S-72S.

5. Current, W.L., and Long, P.L. 1983. Development of human and calf Cryptosporidium in chicken embryos. J Infect Dis 148:1108-1113.

6. Hijjawi, N.S., Meloni, B.P., Ng'anzo, M., Ryan, U.M., Olson, M.E., Cox, P.T., Monis, P.T., and Thompson, R.C. 2004. Complete development of Cryptosporidium parvum in host cell-free culture. Int J Parasitol 34:769-777.

7. Cornelissen, A.W., and Overdulve, J.P. 1985. Sex determination and sex differentiation in coccidia: gametogony and oocyst production after monoclonal infection of cats with free-living and intermediate host stages of Isospora (Toxoplasma) gondii. Parasitology 90 ( Pt 1):35-44.

8. Pereira, S.J., Ramirez, N.E., Xiao, L., and Ward, L.A. 2002. Pathogenesis of human and bovine Cryptosporidium parvum in gnotobiotic pigs. J Infect Dis 186:715-718.

9. Akiyoshi, D.E., Dilo, J., Pearson, C., Chapman, S., Tumwine, J., and Tzipori, S. 2003. Characterization of Cryptosporidium meleagridis of human origin passaged through different host species. Infect Immun 71:1828-1832.

10. Xiao, L., Morgan, U.M., Limor, J., Escalante, A., Arrowood, M., Shulaw, W., Thompson, R.C., Fayer, R., and Lal, A.A. 1999. Genetic diversity within Cryptosporidium parvum and related Cryptosporidium species. Appl Environ Microbiol 65:3386-3391.

144 11. Meyer, R.C., Bohl, E.H., and Kohler, E.M. 1964. Procurement and Maintenance of Germ-Free Seine for Microbiological Investigations. Appl Microbiol 12:295- 300.

12. Saif, L.J., and Ward, L.A. 1999. Pathogenesis and Animal Models. In Rotaviruses: Methods and Protocols. J. Gray, and U. Desselberger, editors. Totowa, NJ: Humana Press, Inc. 101-117.

13. Nielsen, C.K., and Ward, L.A. 1999. Enhanced detection of Cryptosporidium parvum in the acid-fast stain. J Vet Diagn Invest 11:567-569.

14. Widmer, G., Tchack, L., Chappell, C.L., and Tzipori, S. 1998. Sequence polymorphism in the beta-tubulin gene reveals heterogeneous and variable population structures in Cryptosporidium parvum. Appl Environ Microbiol 64:4477-4481.

15. Feng, X., Rich, S.M., Akiyoshi, D., Tumwine, J.K., Kekitiinwa, A., Nabukeera, N., Tzipori, S., and Widmer, G. 2000. Extensive polymorphism in Cryptosporidium parvum identified by multilocus microsatellite analysis. Appl Environ Microbiol 66:3344-3349.

16. Strong, W.B., Gut, J., and Nelson, R.G. 2000. Cloning and sequence analysis of a highly polymorphic Cryptosporidium parvum gene encoding a 60-kilodalton glycoprotein and characterization of its 15- and 45-kilodalton zoite surface antigen products. Infect Immun 68:4117-4134.

17. Vitovec, J., and Koudela, B. 1992. Pathogenesis of intestinal cryptosporidiosis in conventional and gnotobiotic piglets. Vet Parasitol 43:25-36.

18. Widmer, G., Akiyoshi, D., Buckholt, M.A., Feng, X., Rich, S.M., Deary, K.M., Bowman, C.A., Xu, P., Wang, Y., Wang, X., et al. 2000. Animal propagation and genomic survey of a genotype 1 isolate of Cryptosporidium parvum. Mol Biochem Parasitol 108:187-197.

19. Ebeid, M., Mathis, A., Pospischil, A., and Deplazes, P. 2003. Infectivity of Cryptosporidium parvum genotype I in conventionally reared piglets and lambs. Parasitol Res 90:232-235.

20. Vitovec, J., and Koudela, B. 1988. Location and pathogenicity of Cryptosporidium parvum in experimentally infected mice. Zentralbl Veterinarmed B 35:515-524.

145 21. Harp, J.A., Wannemuehler, M.W., Woodmansee, D.B., and Moon, H.W. 1988. Susceptibility of germfree or antibiotic-treated adult mice to Cryptosporidium parvum. Infect Immun 56:2006-2010.

22. Heine, J., and Boch, J. 1981. [Cryptosporidium infections in the calf: diagnosis, occurrence and experimental transmission]. Berl Munch Tierarztl Wochenschr 94:289-292.

23. Vesey, G., Slade, J.S., Byrne, M., Shepherd, K., Dennis, P.J., and Fricker, C.R. 1993. Routine monitoring of Cryptosporidium oocysts in water using flow cytometry. J Appl Bacteriol 75:87-90.

24. Wu, Z., Nagano, I., Boonmars, T., Nakada, T., and Takahashi, Y. 2003. Intraspecies polymorphism of Cryptosporidium parvum revealed by PCR- restriction fragment length polymorphism (RFLP) and RFLP-single-strand conformational polymorphism analyses. Appl Environ Microbiol 69:4720-4726.

25. Tanriverdi, S., Arslan, M.O., Akiyoshi, D.E., Tzipori, S., and Widmer, G. 2003. Identification of genotypically mixed Cryptosporidium parvum populations in humans and calves. Mol Biochem Parasitol 130:13-22.

26. Carraway, M., Tzipori, S., and Widmer, G. 1997. A new restriction fragment length polymorphism from Cryptosporidium parvum identifies genetically heterogeneous parasite populations and genotypic changes following transmission from bovine to human hosts. Infect Immun 65:3958-3960.

27. Caccio, S., La Rosa, G., and Pozio, E. 1997. The beta-tubulin gene of Cryptosporidium parvum. Mol Biochem Parasitol 89:307-311.

28. Caccio, S., Homan, W., van Dijk, K., and Pozio, E. 1999. Genetic polymorphism at the beta-tubulin locus among human and animal isolates of Cryptosporidium parvum. FEMS Microbiol Lett 170:173-179.

29. Rochelle, P.A., De Leon, R., and E.R., A. 2000. Intra-isolate heterogeneity and reproducibility of PCR-based genotyping of Cryptosporidium parvum using the β−tubulin gene. Quant Microbiol 2:87-101.

30. Sulaiman, I.M., Lal, A.A., Arrowood, M.J., and Xiao, L. 1999. Biallelic polymorphism in the intron region of beta-tubulin gene of Cryptosporidium parasites. J Parasitol 85:154-157.

31. Sulaiman, I.M., Lal, A.A., and Xiao, L. 2001. A population genetic study of the Cryptosporidium parvum human genotype parasites. J Eukaryot Microbiol Suppl:24S-27S.

146 32. Tzipori, S., and Widmer, G. 2000. The biology of Cryptosporidium. Contrib Microbiol 6:1-32.

33. Mallon, M.E., MacLeod, A., Wastling, J.M., Smith, H., and Tait, A. 2003. Multilocus genotyping of Cryptosporidium parvum Type 2: population genetics and sub-structuring. Infect Genet Evol 3:207-218.

34. Mallon, M., MacLeod, A., Wastling, J., Smith, H., Reilly, B., and Tait, A. 2003. Population structures and the role of genetic exchange in the zoonotic pathogen Cryptosporidium parvum. J Mol Evol 56:407-417.

35. Widmer, G. 2004. Population genetics of Cryptosporidium parvum. Trends Parasitol 20:3-6; discussion 6.

36. Tibayrenc, M., and Ayala, F.J. 1991. Towards a population genetic of microorganisms: the clonal theory of parasitic protozoa. Parasitol Today 7:228- 232.

37. Tibayrenc, M., and Ayala, F.J. 2002. The clonal theory of parasitic protozoa: 12 years on. Trends Parasitol 18:405-410.

38. Morgan, U.M., Constantine, C.C., Forbes, D.A., and Thompson, R.C. 1997. Differentiation between human and animal isolates of Cryptosporidium parvum using rDNA sequencing and direct PCR analysis. J Parasitol 83:825-830.

39. Awad-el-Kariem, F.M. 1996. Significant parity of different phenotypic and genotypic markers between human and animal strains of Cryptosporidium parvum. J Eukaryot Microbiol 43:70S.

40. Awad-El-Kariem, F.M., Robinson, H.A., Petry, F., McDonald, V., Evans, D., and Casemore, D. 1998. Differentiation between human and animal isolates of Cryptosporidium parvum using molecular and biological markers. Parasitol Res 84:297-301.

41. Spano, F., Putignani, L., Crisanti, A., Sallicandro, P., Morgan, U.M., Le Blancq, S.M., Tchack, L., Tzipori, S., and Widmer, G. 1998. Multilocus genotypic analysis of Cryptosporidium parvum isolates from different hosts and geographical origins. J Clin Microbiol 36:3255-3259.

42. Fayer, R., Nerad, T., Rall, W., Lindsay, D.S., and Blagburn, B.L. 1991. Studies on cryopreservation of Cryptosporidium parvum. J Parasitol 77:357-361.

43. Sherwood, D., Angus, K.W., Snodgrass, D.R., and Tzipori, S. 1982. Experimental cryptosporidiosis in laboratory mice. Infect Immun 38:471-475.

147

Prepatent Serial Pig Dose a Fecal Oocyst Dehydratio period c Passages Number (oocysts) Score b shedding n d (days)

Parental 1 00g9-7 106 6 2 1 Mild 00g11-6 105 7 3 1 None

Parental 2 00g10-11 5 8 2 1 None 00g12-6 5 8 2 2 None

Clone 00g11-2 1 8 2 1 None 00g12-4 1 8 2 3 Mild

Progeny 1 00g12-9 5 8 2 3 None 01g1-9 5 8 2 1 Mild

Progeny 2 01g1-10 10 8 2 1 None 01g2-13 10 7 3 2 Mild a Prepatent Period: the time period from the day of inoculation to the day of onset of oocyst shedding. b Fecal score at day of onset: 0=normal, 1= pasty, 2=opaque liquid, and 3=watery. Diarrhea was considered to be present at scores ≥2. c Oocyst shedding: 0=no oocysts detected, 1=1-10 oocysts/100µm, 2=11-30 oocysts/100µm and 3=more than 30 oocysts/100µm. d Dehydration: mild=visible vertebrate, moderate=prominent vertebrate and eyes retracted in orbit <1mm, severe= prominent protruding vertebral and pelvic bones and eyes retracted in orbit <1mm.

Table 5.1 Summary of Cryptosporidium hominis oocysts passages performed in gnotobiotic pigs.

148 β-tubulin gene sequences a GP60 gene sequences b Serial passages Number of Number of clones c Number of Number of clones c substitutions substitutions

Parental 1 0 37 (92.5%) 0 24 (60.0%) n=40 1 2 (5.0%) 1 11 (27.5%) 2 1 (2.5%) 2 4 (10.0%) 3 1 (2.5%)

Parental 2 0 23 (57%.5) 0 24 (60.0%) n=40 1 13 (32.5%) 1 10 (25.0%) 2 4 (10.0%) 2 4 (10.0%) 3 1 (2.5%) 4 1 (2.5%)

Clone 0 27 (67.5%) 0 20 (50.0%) n=40 1 9 (22.5%) 1 11 (27.55) 2 3 (7.5%) 2 7 (17.5%) 3 1 (2.5%) 3 1 (2.5%) 4 1 (2.5%)

Progeny 1 0 35 (87.5%) 0 24 (60.0%) n=40 1 5 (12.5%) 1 12 (30.0%) 2 2(5.0%) 3 1(2.5%) 4 1(2.5%)

Progeny 2 0 34 (85.0%) 0 31 (77.5%) n=40 1 5 (12.5%) 1 7 (17.5%) 2 0 (0.0%) 2 0 3 1 (2.5%) 3 1 (2.5%) 4 1 (2.5%)

Total 0 156 (78.0%) 0 123 (61.5%) n=200 1 34 (17.0%) 1 51 (25.5%) 2 8 (4.0%) 2 17 (8.5%) 3 2 (1.0%) 3 5 (2.5%) 4 4 (2.0%) a Readable sequence length was 355 bps b Readable sequence length was 378 bps c The percentage of polymorphic sequences was express as the number of sequences with variable nucleotides divided by the total number of sequences per generation multiplied by 100.

Table 5.2 Frequency of nucleotide base substitutions among cloned C. hominis β- tubulin and GP60 genes sequences.

149

Microsatellite locus 5B12 1F07 7E1C 2G04 6B03 5D11 Passage Allelea

Parental 1 1-2 1-2 1-2 1-2 1 1 Parental 2 1 1-2 2 1-2 1 1 Clone 1 1-2 1-2 1-2 1 1 Progeny 1 1 1-2 1-2 1-2 1 1 Progeny 2 1 1 1-2 1-2 1 1 a 1 = allele 1; 2 = allele 2; 1-2 = heterozygote; 1 or 2 = homozygote for that allele

Table 5.3 Summary of microsatellite polymorphisms by Cryptosporidium hominis oocysts passages.

150

403

gene by b-tubulin

2 Exon

) indicate polymorphisms recurring in . The analyzed 355 bases had sequence ↑

at the 403 base position (T). Polymorphism

Cryptosporidium hominis

180

Intron

96

subsequent generations. generation. Base positions were based on based initiation positionsgeneration. the Base were (ATG) codon to theaccording no. Y12615) accession sequence (GenBank published starting at the 47 base position (T) and ending positions are represented by a vertical line. Arrows (

1 Exon

5.1Figure substitutions in the nucleotide Positions of 47 1 Parental 2 Parental Clone 1 Progeny 2 Progeny

151

443

( indicate

↑

GP60 gene by generation. by GP60 gene

(ATG) according to the published sequence

Exon

hominis Cryptosporidium

155624). Analyzed sequence had 378 bases starting at at 66 base had Analyzed starting the 378 bases 155624). sequence

polymorphisms recurring in subsequent generations. position (C). Polymorphism positions are represented by vertical lines. Arrows ( Base positions was basedBase on the initiation codon no. AF accession (GenBank

66

lone

1 arental 2 arental 1 rogeny 2 rogeny Figure 5.2Figure amongst Positions of polymorphisms P P C P P

152

APPENDIX A

SWINE AND POULTRY OPERATIONS SAMPLE DESCRIPTION

153 Sample Sample Sample Date Date Code Identification Description Taken Received Amount Procedure Results Technology

H1 Hog Manure,Sample #1 High Rise House 6/17/2002 6/18/2002 60g DNA Ext, PCR, Hyb Positive HRH

H2 Hog Manure, Sample#2 High Rise House-two samples combined 6/17/2002 6/18/2002 74g DNA Ext, PCR, Hyb Positive HRH

H3 Hog Manure, Sample #3 High Rise House-sample mostly liquid 6/17/2002 6/18/2002 168g DNA Ext, PCR, Hyb Negative HRH

H4 Hog Manure, NW1 High Rise House-sample mostly liquid 7/2/2002 7/9/2002 none DNA Ext, PCR, Hyb n/a HRH

H5 Hog Manure, NW2 High Rise House-sample mostly liquid 7/2/2002 7/9/2002 112g DNA Ext, PCR, Hyb Negative HRH

H6 Hog Manure, NW4 High Rise House-sample mostly liquid 7/2/2002 7/9/2002 150g DNA Ext, PCR, Hyb Negative HRH

H7 Hog Manure, SW2 High Rise House-sample mostly liquid 7/2/2002 7/9/2002 61g DNA Ext, PCR, Hyb Negative HRH

H8 Hog Manure, NW4 Surface manure 7/15/2002 7/15/2002 25g DNA Ext, PCR, Hyb Negative HRH

H9 Hog Manure, SW7 Surface manure 7/15/2002 7/15/2002 25g DNA Ext, PCR, Hyb Negative HRH

H10 Hog Manure, SC1 Surface manure 7/15/2002 7/15/2002 25g DNA Ext, PCR, Hyb Negative HRH

H11 Hog Manure, NC1 Surface manure 7/15/2002 7/15/2002 25g DNA Ext, PCR, Hyb Positive HRH

H12 Hog Manure, NC1 Surface Manure 8/6/2002 8/7/2002 25g DNA Ext, PCR, Hyb Negative HRH

H13 Hog Manure, SC2-3 Surface Manure 8/6/2002 8/7/2002 25g DNA Ext, PCR, Hyb Negative HRH

H14 Hog Manure, NC4 Surface Manure 8/6/2002 8/7/2002 25g DNA Ext, PCR, Hyb Negative HRH

H15 Hog Manure, NW-1 Surface Manure 8/29/2002 8/30/2002 25g DNA Ext, PCR, Hyb Negative HRH

H16 Hog Manure, NW-6 Surface Manure 8/29/2002 8/30/2002 25g DNA Ext, PCR, Hyb Negative HRH

H17 Hog Manure, SW-6 Surface Manure 8/29/2002 8/30/2002 25g DNA Ext, PCR, Hyb Negative HRH

H18 Hog Manure, SW-8 Surface Manure 9/18/2002 9/19/2002 25g DNA Ext, PCR, Hyb Negative HRH

H19 Hog Manure, NW-7 Surface Manure 9/18/2002 9/19/2002 25g DNA Ext, PCR, Hyb Negative HRH

H20 Hog Manure, NW-8 Surface Manure 9/18/2002 9/19/2002 25g DNA Ext, PCR, Hyb Negative HRH

H21 Hog Manure, SW-8 Surface Manure 9/18/2002 9/19/2002 25g DNA Ext, PCR, Hyb Negative HRH

H22 Hog Manure, SW-10 Surface Manure 9/18/2002 9/19/2002 25g DNA Ext, PCR, Hyb Negative HRH

H23 Compost of manure bedding High Rise House - Herd 1 10/16/2002 10/17/2002 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H24 Compost of manure bedding High Rise House - Herd 1 10/16/2002 10/17/2002 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H25 Compost of manure bedding High Rise House - Herd 1 10/16/2002 10/17/2002 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H26 Compost of manure bedding High Rise House - Herd 1 10/16/2002 10/17/2002 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H27 Hog Manure , NW-2 Fresh Surface Manure - Herd 2 11/7/2002 11/8/2002 25g DNA Ext, PCR, Hyb Negative HRH

H28 Hog Manure, NW-6 Fresh Surface Manure - Herd 2 11/7/2002 11/8/2002 25g DNA Ext, PCR, Hyb Negative HRH

H29 Hog Manure, SW-8 Fresh Surface Manure - Herd 2 11/7/2002 11/8/2002 25g DNA Ext, PCR, Hyb Negative HRH

H30 Hog Manure, SW-41 Fresh Surface Manure - Herd 2 11/7/2002 11/8/2002 25g DNA Ext, PCR, Hyb Negative HRH

H31 Hog Compost, HC-1 Feces+Straw - Herd 1 11/7/2002 11/11/2002 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H32 Hog Compost, HC-2 Feces+Straw - Herd 1 11/7/2002 11/11/2002 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H33 Hog Compost, HC-3 Feces+Straw - Herd 1 11/7/2002 11/11/2002 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H34 Hog compost, HC-4 Feces+Straw - Herd 1 11/7/2002 11/11/2002 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H35 NCSU ATAD-1 Anaerobic Digestor-Tomato media 11/19/2002 11/21/2002 15g Sucrose, DNA Ext, PCR, Hyb Negative Ambient Digestor

H36 NCSU ATAD-2 Anaerobic Digestor-fresh fecal gest 11/19/2002 11/21/2002 15g DNA Ext, PCR, Hyb Negative Ambient Digestor

H37 NCSU ATAD-3 Anaerobic Digestor-fresh fecal farrowing 11/19/2002 11/21/2002 15g DNA Ext, PCR, Hyb Negative Ambient Digestor

H38 NCSU ATAD-4 Anaerobic Digestor-house effluent gest 11/19/2002 11/21/2002 15ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H39 NCSU ATAD-5 Anaerobic Digestor-house effluent farrowing 11/19/2002 11/21/2002 15ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H40 NCSU ATAD-6 Anaerobic Digestor-green house sample 11/19/2002 11/21/2002 15ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H41 NCSU ATAD-7 Anaerobic Digestor-biofilter #1 11/19/2002 11/21/2002 15ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H42 NCSU ATAD-8 Anaerobic Digestor-biofilter #2 11/19/2002 11/21/2002 15ml DNA Ext, PCR, Hyb Negative Ambient Digestor H43 NCSU ATAD-9 Anaerobic Digestor-storage pond 11/19/2002 11/21/2002 15ml DNA Ext, PCR, Hyb Negative Ambient Digestor

Continued

Table A.1 Swine operations samples description

154 Table A.1 continued

H43 NCSU ATAD-9 Anaerobic Digestor-storage pond 11/19/2002 11/21/2002 15ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H44 NCSU ATAD-10 Anaerobic digestor-digestor 11/19/2002 11/21/2002 15ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H45 Hog Manure, SW-6 - Herd 2 Fresh Surface Manure-High Rise House 11/21/2002 11/22/2002 25g DNA Ext, PCR, Hyb Negative HRH

H46 Hog Manure, SW-8 - Herd 2 Fresh Surface Manure-High Rise House 11/21/2002 11/22/2002 25g DNA Ext, PCR, Hyb Negative HRH

H47 Hog Manure, NW-2 - Herd 2 Fresh Surface Manure-High Rise House 11/21/2002 11/22/2002 25g DNA Ext, PCR, Hyb Negative HRH

H48 Hog Manure, NW-4 - Herd 2 Fresh Surface Manure-High Rise House 11/21/2002 11/22/2002 25g DNA Ext, PCR, Hyb Negative HRH

H48 Hog Manure, SW-1 - Herd 2 Fresh Surface Manure-High Rise House 12/4/2002 12/5/2002 25g DNA Ext, PCR, Hyb Negative HRH

H50 Hog Manure, SW-7 - Herd 2 Fresh Surface Manure-High Rise House 12/4/2002 12/5/2002 25g DNA Ext, PCR, Hyb Negative HRH

H51 Hog Manure, NW-2 - Herd 2 Fresh Surface Manure-High Rise House 12/4/2002 12/5/2002 25g DNA Ext, PCR, Hyb Negative HRH

H52 Hog Manure, NW-4 - Herd 2 Fresh Surface Manure-High Rise House 12/4/2002 12/5/2002 25g DNA Ext, PCR, Hyb Negative HRH

H53 NCSU - Hog House feces Constructed Wetland Solid Separation Plan 12/3/2002 12/6/2002 25g DNA Ext, PCR, Hyb Negative Constructed Wetland

H54 NCSU- House effluent Constructed Wetland Solid Separation Plan 12/3/2002 12/6/2002 30ml DNA Ext, PCR, Hyb Negative Constructed Wetland

H55 NCSU - Inner effluent Constructed Wetland Solid Separation Plan 12/3/2002 12/6/2002 30ml DNA Ext, PCR, Hyb Negative Constructed Wetland

H56 NCSU - Outer effluent Constructed Wetland Solid Separation Plan 12/3/2002 12/6/2002 30ml DNA Ext, PCR, Hyb Negative Constructed Wetland

H57 NCSU - Storage pond Constructed Wetland Solid Separation Plan 12/3/2002 12/6/2002 30ml DNA Ext, PCR, Hyb Negative Constructed Wetland

H58 NCSU - Inner Iffluent Constructed Wetland Solid Separation Plan 12/3/2002 12/6/2002 30ml DNA Ext, PCR, Hyb Negative Constructed Wetland

H59 NCSU - Outer Iffluent Constructed Wetland Solid Separation Plan 12/3/2002 12/6/2002 30ml DNA Ext, PCR, Hyb Negative Constructed Wetland

H60 NCSU - Solid from separation Constructed Wetland Solid Separation Plan 12/3/2002 12/6/2002 25g Sucrose, DNA Ext, PCR, Hyb Negative Constructed Wetland

H61 Hog Manure, Herd 2, SW2 Fresh Surface Manure-High Rise House 12/18/2002 12/19/2002 25g DNA Ext, PCR, Hyb Negative HRH

H62 Hog Manure, Herd 2, SW3 Fresh Surface Manure-High Rise House 12/18/2002 12/19/2002 25g DNA Ext, PCR, Hyb Negative HRH

H63 Hog Manure, Herd 2, SW8 Fresh Surface Manure-High Rise House 12/18/2002 12/19/2002 25g DNA Ext, PCR, Hyb Negative HRH

H64 Hog Manure, Herd 2, NW5 Fresh Surface Manure-High Rise House 12/18/2002 12/19/2002 25g DNA Ext, PCR, Hyb Negative HRH

H65 Hog Manure, Herd 2, SW1 Fresh Surface Manure-High Rise House 1/8/2003 1/9/2003 25 g DNA Ext, PCR, Hyb Negative HRH

H66 Hog Manure, Herd 2, SW8 Fresh Surface Manure-High Rise House 1/8/2003 1/9/2003 25 g DNA Ext, PCR, Hyb Negative HRH

H67 Hog Manure, Herd 2, SC2 Fresh Surface Manure-High Rise House 1/8/2003 1/9/2003 25 g DNA Ext, PCR, Hyb Negative HRH

H68 Hog Manure, Herd 2, NW9 Fresh Surface Manure-High Rise House 1/8/2003 1/9/2003 25 g DNA Ext, PCR, Hyb Negative HRH

H69 Hog Compost #1, Herd 1 Feces and straw-High Rise House 1/8/2003 1/9/2003 25 g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H70 Hog Compost #2, Herd 1 Feces and straw-High Rise House 1/8/2003 1/9/2003 25 g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H71 Hog Compost #3, Herd 1 Feces and straw-High Rise House 1/8/2003 1/9/2003 25 g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H72 Hog Compost #4, Herd1 Feces and straw-High Rise House 1/8/2003 1/9/2003 25 g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H73 Hog Manure, SW3, Herd 2 fresh surface manure-High Rise House 1/16/2003 1/17/2003 25 g DNA Ext, PCR, Hyb Negative HRH

H74 Hog Manure, SW5, Herd 2 fresh surface manure-High Rise House 1/16/2003 1/17/2003 25 g DNA Ext, PCR, Hyb Negative HRH

H75 Hog Manure, SW10, Herd 2 fresh surface manure-High Rise House 1/16/2003 1/17/2003 25 g DNA Ext, PCR, Hyb Negative HRH

H76 Hog Manure, NW7, Herd 2 fresh surface manure-High Rise House 1/16/2003 1/17/2003 25 g DNA Ext, PCR, Hyb Negative HRH

H77 Lagoon Water NCSU Conventional Swine operation 1/28/2003 1/30/2003 25 ml DNA Ext, PCR, Hyb Negative Conventional Swine Operation

H78 House effluent Water NCSU Conventional Swine operation 1/28/2003 1/30/2003 25 ml DNA Ext, PCR, Hyb Negative Conventional Swine Operation

H79 Fresh fecal sample NCSU Conventional Swine operation 1/28/2003 1/30/2003 25g DNA Ext, PCR, Hyb Negative Conventional Swine Operation

H80 Hog Manure, NW6, Herd 2 Fresh Surface Manure-High Rise House 2/10/2003 2/11/2003 25g DNA Ext, PCR, Hyb Negative HRH

H81 Hog Feces, NW7, Herd 2 Fresh Surface feces-High Rise House 2/10/2003 2/11/2003 25g DNA Ext, PCR, Hyb Negative HRH

H82 Hog Feces, NW10, Herd 2 Fresh Surface feces-High Rise House 2/10/2003 2/11/2003 25g DNA Ext, PCR, Hyb Negative HRH

H83 Hog Feces, NW12, Herd 2 Fresh Surface feces-High Rise House 2/10/2003 2/11/2003 25g DNA Ext, PCR, Hyb Negative HRH

H84 Hog Compost #1, surface sample Feces and Straw-High Rise House 2/10/2003 2/11/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H85 Hog Compost #1, Subsurface sample Feces and Straw-High Rise House 2/10/2003 2/11/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH H86 Hog Compost #2, surface sample Feces and Straw-High Rise House 2/10/2003 2/11/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

Continued

155 Table A.1 continued

H87 Hof Compost #2, subsurface samp[le Feces and Straw-High Rise House 2/10/2003 2/11/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H88 Hog Compost #3, surface sample Feces and Straw-High Rise House 2/10/2003 2/11/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H89 Hog Compost #3, subsurface sample Feces and Straw-High Rise House 2/10/2003 2/11/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H90 Hog Compost #4, surface sample Feces and Straw-High Rise House 2/10/2003 2/11/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H91 Hog Compost #4, subsurface sample Feces and Straw-High Rise House 2/10/2003 2/11/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H92 Hog Compost #1, composite sample Feces and Straw-High Rise House 3/5/2003 3/5/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H93 Hog compost #2, composite sample Feces and Straw-High Rise House 3/5/2003 3/5/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H94 Hog Compost #3, composite sample Feces and Straw-High Rise House 3/5/2003 3/5/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H95 Hog Compost #4, composite sample Feces and Straw-High Rise House(HRH) 3/5/2003 3/5/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H96 Manure bedding #1, Herd 2 Feces, sawdust, shavings-HRH 3/17/2003 3/18/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H97 Manure bedding #2, Herd 2 Feces, sawdust, shavings-HRH 3/17/2003 3/18/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H98 Manure bedding #3, Herd 2 Feces, sawdust, shavings-HRH 3/17/2003 3/18/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H99 Compost #1, Herd 1-HRH Feces and straw-Don Young Farm 3/17/2003 3/18/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H100 Compost #2, Herd 1-HRH Feces and straw-Don Young Farm 3/17/2003 3/18/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H101 Compost #3, Herd 1-HRH Feces and straw-Don Young Farm 3/17/2003 3/18/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H102 Compost #4, Herd 1-HRH Feces and straw-Don Young Farm 3/17/2003 3/18/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H103 up-flow biofiltration-Ecokkon Facility Fresh feces- NCSU 4/8/2003 4/10/2003 25g DNA Ext, PCR, Hyb Negative Ekokan-up-flow biofiltration

H104 up-flow biofiltration-Ecokkon Facility House effluent-NCSU 4/8/2003 4/10/2003 25ml DNA Ext, PCR, Hyb Negative Ekokan-up-flow biofiltration

H105 up-flow biofiltration-Ecokkon Facility Separated liquids-NCSU 4/8/2003 4/10/2003 25ml DNA Ext, PCR, Hyb Negative Ekokan-up-flow biofiltration

H106 up-flow biofiltration-Ecokkon Facility Separated solids-NCSU 4/8/2003 4/10/2003 25g DNA Ext, PCR, Hyb Negative Ekokan-up-flow biofiltration

H107 up-flow biofiltration-Ecokkon Facility equilization tank-NCSU 4/8/2003 4/10/2003 25ml DNA Ext, PCR, Hyb Negative Ekokan-up-flow biofiltration

H108 up-flow biofiltration-Ecokkon Facility biofilter effluent, filter composite-NCSU 4/8/2003 4/10/2003 25ml DNA Ext, PCR, Hyb Negative Ekokan-up-flow biofiltration

H109 up-flow biofiltration-Ecokkon Facility biofilter backwash, four filter composite-NCSU 4/8/2003 4/10/2003 25ml DNA Ext, PCR, Hyb Negative Ekokan-up-flow biofiltration

H110 up-flow biofiltration-Ecokkon Facility lagoon L1, treated liquis storage-NCSU 4/8/2003 4/10/2003 25ml DNA Ext, PCR, Hyb Negative Ekokan-up-flow biofiltration

H111 up-flow biofiltration-Ecokkon Facility lagoon L2, biosolids reservoir-NCSU 4/8/2003 4/10/2003 25ml DNA Ext, PCR, Hyb Negative Ekokan-up-flow biofiltration

H112 up-flow biofiltration-Ecokkon Facility lagoon L3, lagoon-NCSU 4/8/2003 4/10/2003 25ml DNA Ext, PCR, Hyb Negative Ekokan-up-flow biofiltration

H113 Initial compost #1, Herd 2-HRH manure+ground wood-Dan Young Farm 4/15/2003 4/15/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H114 Initial compost #2, Herd 2-HRH manure+ground wood-Dan Young Farm 4/15/2003 4/15/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H115 Initial compost #3, Herd 2-HRH manure+ground wood-Dan Young Farm 4/15/2003 4/15/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H116 Initial compost #4, Herd 2-HRH manure+ground wood-Dan Young Farm 4/15/2003 4/15/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H117 Herd #2, North Pile-HRH Compost #1 @ 1 month, manure+sawdust 4/15/2003 4/15/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H118 Herd #2, North Pile-HRH Compost #2 @ 1 month, manure+sawdust 4/15/2003 4/15/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H119 Super Soil site-NCSU Fresh fecal sample 4/21/2003 4/23/2003 25g DNA Ext, PCR, Hyb Negative Super Soil

H120 Super Soil site-NCSU House effluent liquid 4/21/2003 4/23/2003 25ml DNA Ext, PCR, Hyb Negative Super Soil

H121 Super Soil site-NCSU Homo. Tank liquid 4/21/2003 4/23/2003 25ml DNA Ext, PCR, Hyb Negative Super Soil

H122 Super Soil site-NCSU Separated solids 4/21/2003 4/23/2003 25g DNA Ext, PCR, Hyb Negative Super Soil

H123 Super Soil site-NCSU separated liquids 4/21/2003 4/23/2003 25ml DNA Ext, PCR, Hyb Negative Super Soil

H124 Super Soil site-NCSU Pre-Phosphorus Removal liquid 4/21/2003 4/23/2003 25ml DNA Ext, PCR, Hyb Negative Super Soil

H125 Super Soil site-NCSU Post-Phosphorus removal liquid 4/21/2003 4/23/2003 25ml DNA Ext, PCR, Hyb Negative Super Soil

H126 Super Soil site-NCSU Bagged final product solid 4/21/2003 4/23/2003 15g Sucrose, DNA Ext, PCR, Hyb Negative Super Soil

H127 Super Soil site-NCSU Fresh fecal sample 4/30/2003 5/1/2003 25g DNA Ext, PCR, Hyb Negative Super Soil

H128 Super Soil site-NCSU House effluent liquid 4/30/2003 5/1/2003 25ml DNA Ext, PCR, Hyb Negative Super Soil

H129 Super Soil site-NCSU Homo Tank liquid 4/30/2003 5/1/2003 25ml DNA Ext, PCR, Hyb Negative Super Soil H130 Super Soil site-NCSU Separated solids 4/30/2003 5/1/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative Super Soil

Continued

156 Table A.1 continued

H131 Super Soil site-NCSU separated liquids 4/30/2003 5/1/2003 25ml DNA Ext, PCR, Hyb Negative Super Soil

H132 Super Soil site-NCSU Pre-Phosphorus Removal liquid 4/30/2003 5/1/2003 25ml DNA Ext, PCR, Hyb Negative Super Soil

H133 Super Soil site-NCSU Post-Phosphorus removal liquid 4/30/2003 5/1/2003 25ml DNA Ext, PCR, Hyb Negative Super Soil

H134 Super Soil site-NCSU Bagged final product solid 4/30/2003 5/1/2003 15g Sucrose, DNA Ext, PCR, Hyb Negative Super Soil

H135 NCSU Conventional House Fresh fecal sample 5/14/2003 5/15/2003 25g DNA Ext, PCR, Hyb Negative Conventional Swine Operation

H136 NCSU Conventional House House effluent liquid 5/14/2003 5/15/2003 25ml DNA Ext, PCR, Hyb Negative Conventional Swine Operation

H137 NCSU Conventional House Lagoon 5/14/2003 5/15/2003 25ml DNA Ext, PCR, Hyb Negative Conventional Swine Operation

H138 Compost #1, Herd 2-HRH manure+ground wood-Dan Young Farm 6/2/2003 6/3/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H139 Compost #2, Herd 2-HRH manure+ground wood-Dan Young Farm 6/2/2003 6/3/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H140 Compost #3, Herd 2-HRH manure+ground wood-Dan Young Farm 6/2/2003 6/3/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H141 Compost #4, Herd 2-HRH manure+ground wood-Dan Young Farm 6/2/2003 6/3/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H142 Herd #2, North Pile-HRH Compost sample #1, manure+sawdust 6/2/2003 6/3/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H143 Herd #2, North Pile-HRH Compost sample #2, manure+sawdust 6/2/2003 6/3/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H144 Herd #2, North Pile-HRH Compost sample #3, manure+sawdust 6/2/2003 6/3/2003 25g Sucrose, DNA Ext, PCR, Hyb Negative HRH

H145 Ambient Digestor-Swine Technology fresh fecal sample-NCSU 6/16/2003 6/18/2003 25g DNA Ext, PCR, Hyb Negative Ambient Digestor

H146 Ambient Digestor-Swine Technology separated solid-NCSU 6/16/2003 6/18/2003 25g DNA Ext, PCR, Hyb Negative Ambient Digestor

H147 Ambient Digestor-Swine Technology separated liquids-NCSU 6/16/2003 6/18/2003 25ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H148 Ambient Digestor-Swine Technology house effluent-NCSU 6/16/2003 6/18/2003 25ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H149 Ambient Digestor-Swine Technology treated liquid storage-NCSU 6/16/2003 6/18/2003 25ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H150 Ambient Digestor-Swine Technology biosolids reservoir-NCSU 6/16/2003 6/18/2003 25ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H151 Ambient Digestor-Swine Technology lagoon-NCSU 6/16/2003 6/18/2003 25ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H152 Ambient Digestor-Swine Technology equilization tank effluent-NCSU 6/16/2003 6/18/2003 25ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H153 Ambient Digestor-Swine Technology biofilter effluent-NCSU 6/16/2003 6/18/2003 25ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H154 Ambient Digestor-Swine Technology biofilter backwash-NCSU 6/16/2003 6/18/2003 25ml DNA Ext, PCR, Hyb Negative Ambient Digestor

H155 Anbient Digester System, NCSU Fresh Fecal Specimen, Gestation House 08/04/03 08/05/03 25 gm DNA Ext, PCR, Hyb Negative Ambient Digestor

H156 Anbient Digester System, NCSU Fresh Fecal Specimen, Farrowing House 08/04/03 08/05/03 25 gm DNA Ext, PCR, Hyb Negative Ambient Digestor

H157 Anbient Digester System, NCSU House effluent, Gestation House 08/04/03 08/05/03 25 gm DNA Ext, PCR, Hyb Negative Ambient Digestor

H158 Anbient Digester System, NCSU House effluent, Farrowing House 08/04/03 08/05/03 25 gm DNA Ext, PCR, Hyb Negative Ambient Digestor

H159 Anbient Digester System, NCSU Anaerobic Digester 08/04/03 08/05/03 25 gm DNA Ext, PCR, Hyb Negative Ambient Digestor

H160 Anbient Digester System, NCSU Biofilter 1 08/04/03 08/05/03 25 gm DNA Ext, PCR, Hyb Negative Ambient Digestor

H161 Anbient Digester System, NCSU Anaerobic Digester 08/04/03 08/05/03 25 gm DNA Ext, PCR, Hyb Negative Ambient Digestor

H162 Anbient Digester System, NCSU Biofilter 2 08/04/03 08/05/03 25 gm DNA Ext, PCR, Hyb Negative Ambient Digestor

H163 Anbient Digester System, NCSU Tomato Greenhouse liquid 08/04/03 08/05/03 25 gm DNA Ext, PCR, Hyb Negative Ambient Digestor

H164 Anbient Digester System, NCSU Tomato Greenhouse tomato media 08/04/03 08/05/03 25 gm Sucrose, DNA Ext, PCR, Hyb Negative Ambient Digestor

H165 ORBIT, NCSU, Swine Technology Port 1 9/22/2003 9/25/2003 25 gm DNA Ext, PCR, Hyb Negative ORBIT

H166 ORBIT, NCSU, Swine Technology Port 2 9/22/2003 9/25/2003 25 gm DNA Ext, PCR, Hyb Negative ORBIT

H167 ORBIT, NCSU, Swine Technology Port 3 9/22/2003 9/25/2003 25 gm DNA Ext, PCR, Hyb Negative ORBIT

H168 ORBIT, NCSU, Swine Technology Port 4 9/22/2003 9/25/2003 25 gm DNA Ext, PCR, Hyb Negative ORBIT

H169 ORBIT, NCSU, Swine Technology Port 5 9/22/2003 9/25/2003 25 gm DNA Ext, PCR, Hyb Negative ORBIT

H170 ORBIT, NCSU, Swine Technology Port 6 9/22/2003 9/25/2003 25 gm DNA Ext, PCR, Hyb Negative ORBIT

157 Sample Sample Sample Date Date Code Identification Description Taken Received Amount Procedure Results Technology

P1 NC-B-1a Drag swab 8/13/2002 8/14/2002 1 swab Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P2 NC-B-1a Manure 8/13/2002 8/14/2002 25 gm DNA Ext, PCR, Hyb Negative Broiler House

P3 NC-B-2a Drag swab 8/13/2002 8/14/2002 1 swab Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P4 NC-B-2a Manure 8/13/2002 8/14/2002 25 gm DNA Ext, PCR, Hyb Negative Broiler House

P5 NC-B-2a Drag Swab 8/20/2002 8/21/2002 1 swab Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P6 NC-B-2a Manure 8/20/2002 8/21/2002 25 gm DNA Ext, PCR, Hyb Negative Broiler House

P7 NC-B-2b Drag Swab 8/20/2002 8/21/2002 1 swab Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P8 NC-B-2b Manure 8/20/2002 8/21/2002 25 gm DNA Ext, PCR, Hyb Negative Broiler House

P9 NC-B-3a Drag Swab 9/25/2002 9/25/2002 1 swab Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P10 NC-B-3a Manure 9/25/2002 9/25/2002 25 gm DNA Ext, PCR, Hyb Negative Broiler House

P11 NC-B-3b Drag Swab 9/25/2002 9/25/2002 1 swab Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P12 NC-B-3b Manure 9/25/2002 9/25/2002 25 gm DNA Ext, PCR, Hyb Negative Broiler House

P13 Broiler Farm 2, House A, NC-B-2a Manure 12/17/2002 12/19/2002 25 gm DNA Ext, PCR, Hyb Negative Broiler House

P14 Broiler Farm 2, House B, NC-B-2a Manure 12/17/2002 12/19/2002 25 gm DNA Ext, PCR, Hyb Positive Broiler House

P15 Broiler Farm 3, House A, NC-B-3a, 42 days old Manure 12/17/2002 12/19/2002 25 gm DNA Ext, PCR, Hyb Negative Broiler House

P16 Broiler Farm 3, House b, NC-B-3a, 42 days old Manure 12/17/2002 12/19/2002 25 gm DNA Ext, PCR, Hyb Negative Broiler House

P17 Turkey House 1, House A, NC-T-1A, 20 days old bedding litter 1/7/2003 1/9/2003 25 gm Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P18 Turkey House 1, House A, NC-T-1A, 20 days old Manure 1/7/2003 1/9/2003 25 gm DNA Ext, PCR, Hyb Negative Turkey House

P19 Turkey House 1, House B, NC-T-1B, 20 days old bedding litter 1/7/2003 1/9/2003 25 gm Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P20 Turkey House 1, House B, NC-T-1B, 20 days old Manure 1/7/2003 1/9/2003 25 gm DNA Ext, PCR, Hyb Negative Turkey House

P21 Turkey House 2, House A, NC-T-2A, 20 days old bedding litter 1/7/2003 1/9/2003 25 gm Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P22 Turkey House 2, House A, NC-T-2A, 20 days old Manure 1/7/2003 1/9/2003 25 gm DNA Ext, PCR, Hyb Negative Turkey House

P23 Turkey House 2, House B, NC-T-2B, 20 days old bedding litter 1/7/2003 1/9/2003 25 gm Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P24 Turkey House 2, House B, NC-T-2B, 20 days old Manure 1/7/2003 1/9/2003 25 gm DNA Ext, PCR, Hyb Negative Turkey House

P25 Turkey Farm 3, House A, NC-T-3A, 20 days old NC Poultry House, bedding litter 1/13/2003 1/14/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P26 Turkey Farm 3, House A, NC-T-3A, 20 days old NC Poultry House, Manure 1/13/2003 1/14/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P27 Turkey Farm 3, House B, NC-T-3B, 20 days old NC Poultry House, bedding litter 1/13/2003 1/14/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P28 Turkey Farm 3, House B, NC-T-3B, 20 days old NC Poultry House, Manure 1/13/2003 1/14/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P29 Turkey Farm 4, House A, NC-T-4A, 20 days old NC Poultry House, bedding litter 1/13/2003 1/14/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P30 Turkey Farm 4, House A, NC-T-4A, 20 days old NC Poultry House, Manure 1/13/2003 1/14/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P31 Turkey Farm 4, House B, NC-T-4B, 20 days old NC Poultry House, bedding litter 1/13/2003 1/14/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P32 Turkey Farm 4, House B, NC-T-4B, 20 days old NC Poultry House, Manure 1/13/2003 1/14/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P33 Turkey Farm 5, House A, NC-T-5A, 3 weeks old NC Poultry House, bedding litter 1/28/2003 1/30/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P34 Turkey Farm 5, House A, NC-T-5A, 3 weeks old NC Poultry House, Manure 1/28/2003 1/30/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P35 Turkey Farm 5, House b, NC-T-5B, 3 weeks old NC Poultry House, bedding litter 1/28/2003 1/30/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P36 Turkey Farm 5, House b, NC-T-5B, 3 weeks old NC Poultry House, Manure 1/28/2003 1/30/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P37 Turkey Farm 6, House A, NC-T-6A, 3 weeks old NC Poultry House, bedding litter 1/28/2003 1/30/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P38 Turkey Farm 6, House A, NC-T-6A, 3 weeks old NC Poultry House, Manure 1/28/2003 1/30/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P39 Turkey Farm 6, House B, NC-T-6B, 3 weeks old NC Poultry House, bedding litter 1/28/2003 1/30/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P40 Turkey Farm 6, House B, NC-T-6B, 3 weeks old NC Poultry House, Manure 1/28/2003 1/30/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P41 Turkey Farm 7, House A, NC-T-7A, 19 weeks old NC PH, Manure 2/3/2003 2/4/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P42 Turkey Farm 7, House A, NC-T-7B, 19 weeks old NC PH, Manure 2/3/2003 2/4/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House P43 Turkey Farm 8, House A, NC-T-8A, 19 weeks old NC PH, Manure 2/3/2003 2/4/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

Continued

Table A.2 Poultry operations samples description

158 Table A.2 continued

P44 Turkey Farm 8, House B, NC-T-8B, 19 weeks old NC PH, Manure 2/3/2003 2/4/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P45 Broiler Farm 3, House A, NC-B-3a Manure 2/4/2003 2/5/2003 25 g DNA Ext, PCR, Hyb Negative Broiler House

P46 Broiler Farm 3, House A, NC-B-3a litter 2/4/2003 2/5/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P47 Broiler Farm 3, House b, NC-B-3B Litter 2/4/2003 2/5/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P48 Broiler Farm 3, House b, NC-B-3B Manure 2/4/2003 2/5/2003 25 g DNA Ext, PCR, Hyb Negative Broiler House

P49 Turkey Farm 9, House A, NC-T-9A, 19 weeks old NC Poultry House, bedding litter 2/10/2003 2/11/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P50 Turkey Farm 9, House A, NC-T-9A, 19 weeks old NC Poultry House, Manure 2/10/2003 2/11/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P51 Turkey Farm 9, House B, NC-T-9B, 19 weeks old NC Poultry House, bedding litter 2/10/2003 2/11/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P52 Turkey Farm 9, House B, NC-T-9B, 19 weeks old NC Poultry House, Manure 2/10/2003 2/11/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P53 Turkey Farm 10, House A, NC-T-10A, 19 weeks old NC Poultry House, bedding litter 2/10/2003 2/11/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P54 Turkey Farm 10, House A, NC-T-10A, 19 weeks old NC Poultry House, Manure 2/10/2003 2/11/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P55 Turkey Farm 10, House B, NC-T-10B, 19 weeks old NC Poultry House, bedding litter 2/10/2003 2/11/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P56 Turkey Farm 10, House B, NC-T-10B, 19 weeks old NC Poultry House, Manure 2/10/2003 2/11/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P57 Broiler Farm 2, House A, NC-B-2a, 3 weeks old NC PH, Litter 2/10/2003 2/11/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P58 Broiler Farm 2, House A, NC-B-2a, 3 weeks old NC PH, Manure 2/10/2003 2/11/2003 25 g DNA Ext, PCR, Hyb Negative Broiler House

P59 Broiler Farm 2, House B, NC-B-2B, 3 weeks old NC PH, Litter 2/10/2003 2/11/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P60 Broiler Farm 2, House B, NC-B-2B, 3 weeks old NC PH, Manure 2/10/2003 2/11/2003 25 g DNA Ext, PCR, Hyb Positive Broiler House

P61 Turkey Farm 11, House A, NC-T-11A, 19 weeks old NC Poultry House, bedding litter 2/18/2003 2/20/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P62 Turkey Farm 11, House A, NC-T-11A, 19 weeks old NC Poultry House, Manure 2/18/2003 2/20/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P63 Turkey Farm 11, House B, NC-T-11B, 19 weeks old NC Poultry House, bedding litter 2/18/2003 2/20/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P64 Turkey Farm 11, House B, NC-T-11B, 19 weeks old NC Poultry House, Manure 2/18/2003 2/20/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P65 Turkey Farm 12, House A, NC-T-12A, 19 weeks old NC Poultry House, bedding litter 2/18/2003 2/20/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P66 Turkey Farm 12, House A, NC-T-12A, 19 weeks old NC Poultry House, Manure 2/18/2003 2/20/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P67 Turkey Farm 12, House B, NC-T-12B, 19 weeks old NC Poultry House, bedding litter 2/18/2003 2/20/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P68 Turkey Farm 12, House B, NC-T-12B, 19 weeks old NC Poultry House, Manure 2/18/2003 2/20/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P69 Broiler Farm 1, House A, NC-B-1a, 7 days old NC PH, Litter 2/18/2003 2/20/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P70 Broiler Farm 1, House A, NC-B-1a, 7 days old NC PH, Manure 2/18/2003 2/20/2003 25 g DNA Ext, PCR, Hyb Negative Broiler House

P71 Broiler Farm 1, House b, NC-B-1b, 7 days old NC PH, Litter 2/18/2003 2/20/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P72 Broiler Farm 1, House b, NC-B-1b, 7 days old NC PH, Manure 2/18/2003 2/20/2003 25 g DNA Ext, PCR, Hyb Negative Broiler House

P73 Turkey Farm 13, House A, NC-T-13A, 19 weeks old NC Poultry House, bedding litter 2/24/2003 2/25/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P74 Turkey Farm 13, House A, NC-T-13A, 19 weeks old NC Poultry House, Manure 2/24/2003 2/25/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P75 Turkey Farm 13, House B, NC-T-13B, 19 weeks old NC Poultry House, bedding litter 2/24/2003 2/25/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P76 Turkey Farm 13, House B, NC-T-13B, 19 weeks old NC Poultry House, Manure 2/24/2003 2/25/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P77 Turkey Farm 14, House A, NC-T-14A, 19 weeks old NC Poultry House, bedding litter 2/24/2003 2/25/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P78 Turkey Farm 14, House A, NC-T-14A, 19 weeks old NC Poultry House, Manure 2/24/2003 2/25/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P79 Turkey Farm 14, House b, NC-T-14b, 19 weeks old NC Poultry House, bedding litter 2/24/2003 2/25/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P80 Turkey Farm 14, House b, NC-T-14b, 19 weeks old NC Poultry House, Manure 2/24/2003 2/25/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P81 Broiler Farm 1, House A, NC-B-1a, 21 days old NC PH, Litter 3/10/2003 3/11/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P82 Broiler Farm 1, House A, NC-B-1a, 21 days old NC PH, Manure 3/10/2003 3/11/2003 25 g DNA Ext, PCR, Hyb Negative Broiler House

P83 Broiler Farm 1, House B, NC-B-1B, 21 days old NC PH, Litter 3/10/2003 3/11/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P84 Broiler Farm 1, House B, NC-B-1B, 21 days old NC PH, Manure 3/10/2003 3/11/2003 25 g DNA Ext, PCR, Hyb Negative Broiler House

P85 Turkey Farm 5, House A, NC-T-5A, 21 days old NC Poultry House, bedding litter 6/9/2003 6/11/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P86 Turkey Farm 5, House A, NC-T-5A, 21 days old NC Poultry House, Manure 6/9/2003 6/11/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House P87 Turkey Farm 5, House B, NC-T-5B, 21 days old NC Poultry House, bedding litter 6/9/2003 6/11/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

Continued

159 Table A.2 continued

P88 Turkey Farm 5, House B, NC-T-5B, 21 days old NC Poultry House, Manure 6/9/2003 6/11/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P89 Turkey Farm 6, House A, NC-T-6A, 21 days old NC Poultry House, bedding litter 6/9/2003 6/11/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P90 Turkey Farm 6, House A, NC-T-6A, 21 days old NC Poultry House, Manure 6/9/2003 6/11/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P91 Turkey Farm 6, House B, NC-T-6B, 21 days old NC Poultry House, bedding litter 6/9/2003 6/11/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P92 Turkey Farm 6, House B, NC-T-6B, 21 days old NC Poultry House, Manure 6/9/2003 6/11/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P93 Turkey Farm 9, House A, NC-T-9A, 19 days old NC Poultry House, bedding litter 6/23/2003 6/25/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P94 Turkey Farm 9, House A, NC-T-9A, 19 days old NC Poultry House, fecal sample 6/23/2003 6/25/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P95 Turkey Farm 9, House B, NC-T-9B, 19 days old NC Poultry House, bedding litter 6/23/2003 6/25/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P96 Turkey Farm 9, House B, NC-T-9B, 19 days old NC Poultry House, fecal sample 6/23/2003 6/25/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P97 Turkey Farm 10, House A, NC-T-10A, 19 days old NC Poultry House, bedding litter 6/23/2003 6/25/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P98 Turkey Farm 10, House A, NC-T-10A, 19 days old NC Poultry House, fecal sample 6/23/2003 6/25/2003 25 g DNA Ext, PCR, Hyb Positive Turkey House

P99 Turkey Farm 10, House B, NC-T-10B, 19 days old NC Poultry House, bedding litter 6/23/2003 6/25/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P100 Turkey Farm 10, House B, NC-T-10B, 19 days old NC Poultry House, fecal sample 6/23/2003 6/25/2003 25 g DNA Ext, PCR, Hyb Positive Turkey House

P101 Broiler Farm 3, House A, NC-B-3A, 3 weeks old NC PH, Litter 6/30/2003 7/2/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P102 Broiler Farm 3, House A, NC-B-3A, 3 weeks old NC PH, fecal sample 6/30/2003 7/2/2003 25 g DNA Ext, PCR, Hyb Negative Broiler House

P103 Broiler Farm 3, House B, NC-B-3B, 3 weeks old NC PH, Litter 6/30/2003 7/2/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P104 Broiler Farm 3, House B, NC-B-3B, 3 weeks old NC PH, fecal sample 6/30/2003 7/2/2003 25 g DNA Ext, PCR, Hyb Negative Broiler House

P105 Turkey Farm 11, House A, NC-T-11A, 19 days old NC Poultry House, bedding litter 6/30/2003 7/2/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P106 Turkey Farm 11, House A, NC-T-11A, 19 days old NC Poultry House, fecal sample 6/30/2003 7/2/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P107 Turkey Farm 11, House B, NC-T-11B, 19 days old NC Poultry House, bedding litter 6/30/2003 7/2/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P108 Turkey Farm 11, House B, NC-T-11B, 19 days old NC Poultry House, fecal sample 6/30/2003 7/2/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P109 Turkey Farm 12, House A, NC-T-12A, 19 days old NC Poultry House, bedding litter 6/30/2003 7/2/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P110 Turkey Farm 12, House A, NC-T-12A, 19 days old NC Poultry House, fecal sample 6/30/2003 7/2/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P111 Turkey Farm 12, House B, NC-T-12B, 19 days old NC Poultry House, bedding litter 6/30/2003 7/2/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P112 Turkey Farm 12, House B, NC-T-12B, 19 days old NC Poultry House, fecal sample 6/30/2003 7/2/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P113 Turkey Farm 2, House A, NC-T-2A, 3 weeks old NC Poultry House, bedding litter 7/7/2003 7/9/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P114 Turkey Farm 2, House A, NC-T-2A, 3 weeks old NC Poultry House, fecal sample 7/7/2003 7/9/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P115 Turkey Farm 2, House B, NC-T-2B, 3 weeks old NC Poultry House, bedding litter 7/7/2003 7/9/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P116 Turkey Farm 2, House B, NC-T-2B, 3 weeks old NC Poultry House, fecal sample 7/7/2003 7/9/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P117 Turkey Farm 13, House A, NC-T-13A, 19 days old NC Poultry House, bedding litter 7/7/2003 7/9/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P118 Turkey Farm 13, House A, NC-T-13A, 19 days old NC Poultry House, fecal sample 7/7/2003 7/9/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P119 Turkey Farm 13, House B, NC-T-13B, 19 days old NC Poultry House, bedding litter 7/7/2003 7/9/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P120 Turkey Farm 13, House B, NC-T-13B, 19 days old NC Poultry House, fecal sample 7/7/2003 7/9/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P121 Turkey Farm 14, House A, NC-T-14A, 19 days old NC Poultry House, bedding litter 7/7/2003 7/9/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P122 Turkey Farm 14, House A, NC-T-14A, 19 days old NC Poultry House, fecal sample 7/7/2003 7/9/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P123 Turkey Farm 14, House B, NC-T-14B, 19 days old NC Poultry House, bedding litter 7/7/2003 7/9/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P124 Turkey Farm 14, House B, NC-T-14B, 19 days old NC Poultry House, fecal sample 7/7/2003 7/9/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P125 Turkey Farm 2, House A, NC-T-2A, 3 weeks old NC Poultry House, litter sample 7/14/2003 7/16/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P126 Turkey Farm 2, House A, NC-T-2A, 3 weeks old NC Poultry House, fecal sample 7/14/2003 7/16/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P127 Turkey Farm 2, House B, NC-T-2B, 3 weeks old NC Poultry House, bedding litter 7/14/2003 7/16/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P128 Turkey Farm 2, House B, NC-T-2B, 3 weeks old NC Poultry House, fecal sample 7/14/2003 7/16/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P129 Broiler Farm 1, House A, NC-B-1A, 30 days old NC PH, Litter sample 7/15/2003 7/16/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P130 Broiler Farm 1, House A, NC-B-1A, 30 days old NC PH, fecal sample 7/15/2003 7/16/2003 25 g DNA Ext, PCR, Hyb Negative Broiler House P131 Broiler Farm 1, House B, NC-B-1B, 30 days old NC PH, Litter sample 7/15/2003 7/16/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

Continued

160 Table A.2 continued

P132 Broiler Farm 1, House B, NC-B-1B, 30 days old NC PH, fecal sample 7/15/2003 7/16/2003 25 g DNA Ext, PCR, Hyb Negative Broiler House

P133 Broiler Farm 1, House A, NC-B-1A, 20 days old NC PH, Litter sample 7/21/2003 7/23/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P134 Broiler Farm 1, House A, NC-B-1A, 20 days old NC PH, fecal sample 7/21/2003 7/23/2003 25 g DNA Ext, PCR, Hyb Negative Broiler House

P135 Broiler Farm 1, House B, NC-B-1B, 20 days old NC PH, Litter sample 7/21/2003 7/23/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Broiler House

P136 Broiler Farm 1, House B, NC-B-1B, 20 days old NC PH, fecal sample 7/21/2003 7/23/2003 25 g DNA Ext, PCR, Hyb Negative Broiler House

P137 Turkey Farm 3, House A, NC-T-3A, 3 weeks old NC Poultry House, litter sample 7/21/2003 7/23/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P138 Turkey Farm 3, House A, NC-T-3A, 3 weeks old NC Poultry House, fecal sample 7/21/2003 7/23/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P139 Turkey Farm 3, House B, NC-T-3B, 3 weeks old NC Poultry House, bedding litter 7/21/2003 7/23/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P140 Turkey Farm 3, House B, NC-T-3B, 3 weeks old NC Poultry House, fecal sample 7/21/2003 7/23/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P141 Turkey Farm 4, House A, NC-T-4A, 3 weeks old NC Poultry House, litter sample 7/21/2003 7/23/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P142 Turkey Farm 4, House A, NC-T-4A, 3 weeks old NC Poultry House, fecal sample 7/21/2003 7/23/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P143 Turkey Farm 4, House B, NC-T-4B, 3 weeks old NC Poultry House, bedding litter 7/21/2003 7/23/2003 25 g Sucrose,DNA Ext, PCR, Hyb Negative Turkey House

P144 Turkey Farm 4, House B, NC-T-4B, 3 weeks old NC Poultry House, fecal sample 7/21/2003 7/23/2003 25 g DNA Ext, PCR, Hyb Negative Turkey House

P145 Chicken Layer House 8 Row #1 Composite 27 weeks old NC Poultry House, fecal Sample 9/23/2003 9/23/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P146 Chicken Layer House 8 Row #2 Composite 27 weeks old NC Poultry House, fecal Sample 9/23/2003 9/23/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P147 Chicken Layer House 8 Row #3 Composite 27 weeks old NC Poultry House, fecal Sample 9/23/2003 9/23/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P148 Chicken Layer House 8 Row #4 Composite 27 weeks old NC Poultry House, fecal Sample 9/23/2003 9/23/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P149 Chicken Layer House 8 Row #5 Composite 27 weeks old NC Poultry House, fecal Sample 9/23/2003 9/23/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P150 Chicken Layer House 8 Row #6 Composite 27 weeks old NC Poultry House, fecal Sample 9/23/2003 9/23/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P151 Chicken Layer House 4 Row #1 Composite Last week of moult NC Poultry House, fecal Sample 10/9/2003 10/14/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P152 Chicken Layer House 4 Row #2 Composite Last week of moult NC Poultry House, fecal Sample 10/9/2003 10/14/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P153 Chicken Layer House 4 Row #3 Composite Last week of moult NC Poultry House, fecal Sample 10/9/2003 10/14/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P154 Chicken Layer House 4 Row #4 Composite Last week of moult NC Poultry House, fecal Sample 10/9/2003 10/14/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P155 Chicken Layer House 4 Row #5 Composite Last week of moult NC Poultry House, fecal Sample 10/9/2003 10/14/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P156 Chicken Layer House 4 Row #6 Composite Last week of moult NC Poultry House, fecal Sample 10/9/2003 10/14/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P157 Chicken Layer House 4 Row #1 Composite 2nd peak egg production NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P158 Chicken Layer House 4 Row #2 Composite 2nd peak egg production NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P159 Chicken Layer House 4 Row #3 Composite 2nd peak egg production NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P160 Chicken Layer House 4 Row #4 Composite 2nd peak egg production NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P161 Chicken Layer House 4 Row #5 Composite 2nd peak egg production NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P162 Chicken Layer House 4 Row #6 Composite 2nd peak egg production NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P163 Chicken Layer House 5 Row #1 Composite 1st peak egg production NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P164 Chicken Layer House 5 Row #2 Composite 1st peak egg production NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P165 Chicken Layer House 5 Row #3 Composite 1st peak egg production NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P166 Chicken Layer House 5 Row #4 Composite 1st peak egg production NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P167 Chicken Layer House 5 Row #5 Composite 1st peak egg production NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P168 Chicken Layer House 5 Row #6 Composite 1st peak egg production NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P169 Chicken Layer House 10 Row #1 Composite Pullets just placed NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P170 Chicken Layer House 10 Row #2 Composite Pullets just placed NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P171 Chicken Layer House 10 Row #3 Composite Pullets just placed NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P172 Chicken Layer House 10 Row #4 Composite Pullets just placed NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P173 Chicken Layer House 10 Row #5 Composite Pullets just placed NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P174 Chicken Layer House 10 Row #6 Composite Pullets just placed NC Poultry House, fecal Sample 10/23/2003 10/27/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse P175 Chicken Layer House #10, Row #1 Composite, 26 week old NC Poultry House, fecal Sample 12/15/2003 12/17/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

Continued

161 Table A.2 continued

P176 Chicken Layer House #10, Row #2 Composite, 26 week old NC Poultry House, fecal Sample 12/15/2003 12/17/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P177 Chicken Layer House #10, Row #3 Composite, 26 week old NC Poultry House, fecal Sample 12/15/2003 12/17/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P178 Chicken Layer House #10, Row #4 Composite, 26 week old NC Poultry House, fecal Sample 12/15/2003 12/17/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P179 Chicken Layer House #10, Row #5 Composite, 26 week old NC Poultry House, fecal Sample 12/15/2003 12/17/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P180 Chicken Layer House #10, Row #6 Composite, 26 week old NC Poultry House, fecal Sample 12/15/2003 12/17/2003 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P181 Chicken Layer House #1, Row #1 Composite, 26 week old NC Poultry House, fecal Sample 1/12/2004 1/14/2004 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P182 Chicken Layer House #1, Row #2 Composite, 26 week old NC Poultry House, fecal Sample 1/12/2004 1/14/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P183 Chicken Layer House #3, Row #1 Composite, 26 week old NC Poultry House, fecal Sample 1/12/2004 1/14/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P184 Chicken Layer House #1, Row #4 Composite, 26 week old NC Poultry House, fecal Sample 1/12/2004 1/14/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P185 Chicken Layer House #1, Row #5 Composite, 26 week old NC Poultry House, fecal Sample 1/12/2004 1/14/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P186 Chicken Layer House #1, Row #6 Composite, 26 week old NC Poultry House, fecal Sample 1/12/2004 1/14/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P187 Chicken Layer House #3, Row #1 composite 66 weeks old, in molt NC Poultry House, fecal Sample 1/12/2004 1/14/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P188 Chicken Layer House #3, Row #2 composite 66 weeks old, in molt NC Poultry House, fecal Sample 1/12/2004 1/14/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P189 Chicken Layer House #3, Row #3 composite 66 weeks old, in molt NC Poultry House, fecal Sample 1/12/2004 1/14/2004 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P190 Chicken Layer House #3, Row #4 composite 66 weeks old, in molt NC Poultry House, fecal Sample 1/12/2004 1/14/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P191 Chicken Layer House #3, Row #5 composite 66 weeks old, in molt NC Poultry House, fecal Sample 1/12/2004 1/14/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P192 Chicken Layer House #3, Row #6 composite 66 weeks old, in molt NC Poultry House, fecal Sample 1/12/2004 1/14/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P193 Chicken Layer House #2, Row #1 composite 18 weeks old NC Poultry House, fecal Sample 2/26/2004 3/2/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P194 Chicken Layer House #2, Row #2 composite 18 weeks old NC Poultry House, fecal Sample 2/26/2004 3/2/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P195 Chicken Layer House #2, Row #3 composite 18 weeks old NC Poultry House, fecal Sample 2/26/2004 3/2/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P196 Chicken Layer House #2, Row #4 composite 18 weeks old NC Poultry House, fecal Sample 2/26/2004 3/2/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

P197 Chicken Layer House #2, Row #5 composite 18 weeks old NC Poultry House, fecal Sample 2/26/2004 3/2/2004 25 g DNA Ext, PCR, Hyb Negative Layer Haouse

P198 Chicken Layer House #2, Row #6 composite 18 weeks old NC Poultry House, fecal Sample 2/26/2004 3/2/2004 25 g DNA Ext, PCR, Hyb Positive Layer Haouse

162

BIBLIOGRAPHY

Abrahamsen MS, Templeton TJ, Enomoto S, Abrahante JE, Zhu G, Lancto CA, Deng M, Liu C, Widmer G, Tzipori S, Buck GA, Xu P, Bankier AT, Dear PH, Konfortov BA, Spriggs HF, Iyer L, Anantharaman V, Aravind L, Kapur V: Complete genome sequence of the apicomplexan, Cryptosporidium parvum. Science 2004;304:441-445.

Ahrendt, S.A., Halachmi, S., Chow, J.T., Wu, L., Halachmi, N., Yang, S.C., Wehage, S., Jen, J., and Sidransky, D. 1999. Rapid p53 sequence analysis in primary lung cancer using an oligonucleotide probe array. Proc Natl Acad Sci U S A 96:7382- 7387.

Akiyoshi, D.E., Dilo, J., Pearson, C., Chapman, S., Tumwine, J., and Tzipori, S. 2003. Characterization of Cryptosporidium meleagridis of human origin passaged through different host species. Infect Immun 71:1828-1832.

Alak JI, Wolf BW, Mdurvwa EG, Pimentel-Smith GE, Adeyemo O: Effect of Lactobacillus reuteri on intestinal resistance to Cryptosporidium parvum infection in a murine model of acquired immunodeficiency syndrome. J Infect Dis 1997;175:218-221.

Alvarez-Pellitero P, Sitja-Bobadilla A: Cryptosporidium molnari n. sp. (Apicomplexa: Cryptosporidiidae) infecting two marine fish species, Sparus aurata L. and Dicentrarchus labrax L. Int J Parasitol 2002;32:1007-1021.

Amadi B, Mwiya M, Musuku J, Watuka A, Sianongo S, Ayoub A, Kelly P: Effect of nitazoxanide on morbidity and mortality in Zambian children with cryptosporidiosis: a randomised controlled trial. Lancet 2002;360:1375-1380.

Anderson BC, Donndelinger T, Wilkins RM, Smith J: Cryptosporidiosis in a veterinary student. J Am Vet Med Assoc 1982;180:408-409.

163 Anderson BC: Cryptosporidiosis in bovine and human health. J Dairy Sci 1998;81:3036-3041.

Anderson BC: Prevalence of Cryptosporidium muris-like oocysts among cattle populations of the United States: preliminary report. J Protozool 1991;38:14S- 15S.

Argenzio RA, Lecce J, Powell DW: Prostanoids inhibit intestinal NaCl absorption in experimental porcine cryptosporidiosis. Gastroenterology 1993;104:440-447.

Armon, R., Gold, D., Brodsky, M., and Oron, G. 2002. Surface and subsurface irrigation with effluents of different qualities and presence of Cryptosporidium oocysts in soil and on crops. Water Sci Technol 46:115-122.

Armson A, Menon K, O'Hara A, MacDonald LM, Read CM, Sargent K, Thompson RC, Reynoldson JA: Efficacy of oryzalin and associated histological changes in Cryptosporidium-infected neonatal rats. Parasitology 2002;125:113-117.

Arrowood MJ, Mead JR, Mahrt JL, Sterling CR: Effects of immune colostrum and orally administered antisporozoite monoclonal antibodies on the outcome of Cryptosporidium parvum infections in neonatal mice. Infect Immun 1989;57:2283-2288.

Atherholt, T.B., LeChevallier, M.W., Norton, W.D., and Rosen, J.S. 1998. Effect of rainfall on Giardia and Cryptosporidium. J Am Water Works Assoc 90:66-80.

Atwill ER, Hou L, Karle BM, Harter T, Tate KW, Dahlgren RA: Transport of Cryptosporidium parvum oocysts through vegetated buffer strips and estimated filtration efficiency. Appl Environ Microbiol 2002;68:5517-5527.

Atwill ER, Johnson E, Klingborg DJ, Veserat GM, Markegard G, Jensen WA, Pratt DW, Delmas RE, George HA, Forero LC, Philips RL, Barry SJ, McDougald NK, Gildersleeve RR, Frost WE: Age, geographic, and temporal distribution of fecal shedding of Cryptosporidium parvum oocysts in cow-calf herds. Am J Vet Res 1999;60:420-425.

Atwill ER, Johnson EM, Pereira MG: Association of herd composition, stocking rate, and duration of calving season with fecal shedding of Cryptosporidium parvum oocysts in beef herds. J Am Vet Med Assoc 1999;215:1833-1838.

Atwill ER, Sweitzer RA, Pereira MG, Gardner IA, Van Vuren D, Boyce WM: Prevalence of and associated risk factors for shedding Cryptosporidium parvum oocysts and Giardia cysts within feral pig populations in California. Appl Environ Microbiol 1997;63:3946-3949.

164

Auckenthaler, A., Raso, G., and Huggenberger, P. 2002. Particle transport in a karst aquifer: natural and artificial tracer experiments with bacteria, bacteriophages and microspheres. Water Sci Technol 46:131-138. Awad-el-Kariem, F.M. 1996. Significant parity of different phenotypic and genotypic markers between human and animal strains of Cryptosporidium parvum. J Eukaryot Microbiol 43:70S.

Awad-El-Kariem, F.M., Robinson, H.A., Petry, F., McDonald, V., Evans, D., and Casemore, D. 1998. Differentiation between human and animal isolates of Cryptosporidium parvum using molecular and biological markers. Parasitol Res 84:297-301.

Baeumner AJ, Humiston MC, Montagna RA, Durst RA: Detection of viable oocysts of Cryptosporidium parvum following nucleic acid sequence based amplification. Anal Chem 2001;73:1176-1180.

Barker IK, Carbonell PL: Cryptosporidium agni sp.n. from lambs, and cryptosporidium bovis sp.n. from a calf, with observations on the oocyst. Z Parasitenkd 1974;44:289-298.

Barwick, R.S., Mohammed, H.O., White, M.E., and Bryant, R.B. 2000. Detectin of Cryptosporidium parvum and Cryptosporidium muris in soil samples. Biol Fertil Soils 31:385-390.

Barwick, R.S., Mohammed, H.O., White, M.E., and Bryant, R.B. 2003. Prevalence of Giardia spp. and Cryptosporidium spp. on dairy farms in southeastern New York state. Prev Vet Med 59:1-11.

Barwick, R.S., Mohammed, H.O., White, M.E., and Bryant, R.B. 2003. Factors associated with the likelihood of Giardia spp. and Cryptosporidium spp. in soil from dairy farms. J Dairy Sci 86:784-791.

Betancourt WQ, Rose JB: Drinking water treatment processes for removal of Cryptosporidium and Giardia. Vet Parasitol 2004;126:219-234.

Betsou, F., Beaumont, K., Sueur, J.M., and Orfila, J. 2003. Construction and evaluation of internal control DNA for PCR amplification of Chlamydia trachomatis DNA from urine samples. J Clin Microbiol 41:1274-1276.

Bicart-See A, Massip P, Linas MD, Datry A: Successful treatment with nitazoxanide of Enterocytozoon bieneusi microsporidiosis in a patient with AIDS. Antimicrob Agents Chemother 2000;44:167-168.

165 Blagburn BL, Drain KL, Land TM, Kinard RG, Moore PH, Lindsay DS, Patrick DA, Boykin DW, Tidwell RR: Comparative efficacy evaluation of dicationic carbazole compounds, nitazoxanide, and paromomycin against Cryptosporidium parvum infections in a neonatal mouse model. Antimicrob Agents Chemother 1998;42:2877-2882. Brownstein DG, Strandberg JD, Montali RJ, Bush M, Fortner J: Cryptosporidium in snakes with hypertrophic gastritis. Vet Pathol 1977;14:606-617.

Bruder, C.E., Hirvela, C., Tapia-Paez, I., Fransson, I., Segraves, R., Hamilton, G., Zhang, X.X., Evans, D.G., Wallace, A.J., Baser, M.E., et al. 2001. High resolution deletion analysis of constitutional DNA from neurofibromatosis type 2 (NF2) patients using microarray-CGH. Hum Mol Genet 10:271-282.

Caccio, S., Homan, W., van Dijk, K., and Pozio, E. 1999. Genetic polymorphism at the beta-tubulin locus among human and animal isolates of Cryptosporidium parvum. FEMS Microbiol Lett 170:173-179.

Caccio, S., La Rosa, G., and Pozio, E. 1997. The beta-tubulin gene of Cryptosporidium parvum. Mol Biochem Parasitol 89:307-311.

Caccio, S.M. 2003. Molecular techniques to detect and identify protozoan parasites in the environment. Acta Microbiol Pol 52 Suppl:23-34.

Campbell I, Tzipori AS, Hutchison G, Angus KW: Effect of disinfectants on survival of cryptosporidium oocysts. Vet Rec 1982;111:414-415.

Carraway, M., Tzipori, S., and Widmer, G. 1997. A new restriction fragment length polymorphism from Cryptosporidium parvum identifies genetically heterogeneous parasite populations and genotypic changes following transmission from bovine to human hosts. Infect Immun 65:3958-3960.

Carreno RA, Martin DS, Barta JR: Cryptosporidium is more closely related to the gregarines than to coccidia as shown by phylogenetic analysis of apicomplexan parasites inferred using small-subunit ribosomal RNA gene sequences. Parasitol Res 1999;85:899-904.

CDC: Cryptosporidium and water: A public health handbook. Atlanta, GA, Center for Diseses Control and prevention, 1997.

CDC: Foodborne outbreak of Cryptosporidiosis--Spokane, Washington, 1997. JAMA 1998;280:595-596.

CDC: Outbreak of cryptosporidiosis associated with a water sprinkler fountain-- Minnesota, 1997. MMWR Morb Mortal Wkly Rep 1998;47:856-860.

166

CDC: Protracted outbreak of cryptosporidiosis associated with swimming pool use- Ohio and Nebraska, 2000. MMWR Morb Mortal Wkly Rep 2001;50:406-410.

CDC: Summary of Notifiable Diseases, United States, 1998. MMWR Morb Mortal Wkly Rep 1999;47:1-92. Chalmers RM, Sturdee AP, Bull SA, Miller A, Wright SE: The prevalence of Cryptosporidium parvum and C. muris in Mus domesticus, Apodemus sylvaticus and Clethrionomys glareolus in an agricultural system. Parasitol Res 1997;83:478-482.

Chan R, Chen J, York MK, Setijono N, Kaplan RL, Graham F, Tanowitz HB: Evaluation of a combination rapid immunoassay for detection of Giardia and Cryptosporidium antigens. J Clin Microbiol 2000;38:393-394.

Chechetkin, V.R., Turygin, A.Y., Proudnikov, D.Y., Prokopenko, D.V., Kirillov, E.V., and Mirzabekov, A.D. 2000. Sequencing by hybridization with the generic 6- mer oligonucleotide microarray: an advanced scheme for data processing. J Biomol Struct Dyn 18:83-101.

Chesnot, T., and Schwartzbrod, J. 2004. Quantitative and qualitative comparison of density-based purification methods for detection of Cryptosporidium oocysts in turbid environmental matrices. J Microbiol Methods 58:375-386.

Clark DP, Sears CL: The pathogenesis of cryptosporidiosis. Parasitol Today 1996;12:221-225.

Coleman SU, Klei TR, French DD, Chapman MR, Corstvet RE: Prevalence of Cryptosporidium sp in equids in Louisiana. Am J Vet Res 1989;50:575-577.

Cook N: The use of NASBA for the detection of microbial pathogens in food and environmental samples. J Microbiol Methods 2003;53:165-174.

Cornelissen, A.W., and Overdulve, J.P. 1985. Sex determination and sex differentiation in coccidia: gametogony and oocyst production after monoclonal infection of cats with free-living and intermediate host stages of Isospora (Toxoplasma) gondii. Parasitology 90 ( Pt 1):35-44.

Corona-Vaszuez B, Samuelson A, Rennecker JL, Marinas BJ: Inactivation of Cryptosporidium parvum oocysts with ozone and free chlorine. Water Res 2002;36:4053-4063.

167 Coyne MS, Gilfillen RA, Villalba A, Zhang Z, Rhodes RW, Dunn L, Blevins RL: Fecal bacteria trapping by grass filter strips during simulated rain. J Soil Water Conserv 1998;53:140-145.

Craik SA, Weldon D, Finch GR, Bolton JR, Belosevic M: Inactivation of Cryptosporidium parvum oocysts using medium- and low-pressure ultraviolet radiation. Water Res 2001;35:1387-1398.

CTIC. 2004. Conservation Technology Information Center. Conservation tillage and tillage types in United States, 1990-2004. 2004 National Crop Management Survey. http://www.ctic.purdue.edu/CTIC/CRM.html

Current WL, Reese NC, Ernst JV, Bailey WS, Heyman MB, Weinstein WM: Human cryptosporidiosis in immunocompetent and immunodeficient persons. Studies of an outbreak and experimental transmission. N Engl J Med 1983;308:1252-1257.

Current WL, Upton SJ, Haynes TB: The life cycle of Cryptosporidium baileyi n. sp. (Apicomplexa, Cryptosporidiidae) infecting chickens. J Protozool 1986;33:289- 296.

Current, W.L. 1990. Techniques and Laboratory maintenance of Cryptosporidium. In Cryptsoporidiosis of man and animals. R. Fayer, editor. Boca Raton, FL: CRC Press. 41-44.

Current, W.L., and Haynes, T.B. 1984. Complete development of Cryptosporidium in cell culture. Science 224:603-605.

Current, W.L., and Long, P.L. 1983. Development of human and calf Cryptosporidium in chicken embryos. J Infect Dis 148:1108-1113.

Curriero, F.C., Patz, J.A., Rose, J.B., and Lele, S. 2001. The association between extreme precipitation and waterborne disease outbreaks in the United States, 1948-1994. Am J Public Health 91:1194-1199.

Darnault, C.J., Garnier, P., Kim, Y.J., Oveson, K.L., Steenhuis, T.S., Parlange, J.Y., Jenkins, M., Ghiorse, W.C., and Baveye, P. 2003. Preferential transport of Cryptosporidium parvum oocysts in variably saturated subsurface environments. Water Environ Res 75:113-120.

Davies, C.M., Ferguson, C.M., Kaucner, C., Krogh, M., Altavilla, N., Deere, D.A., and Ashbolt, N.J. 2004. Dispersion and transport of Cryptosporidium Oocysts from fecal pats under simulated rainfall events. Appl Environ Microbiol 70:1151- 1159.

168 de Graaf DC, Spano F, Petry F, Sagodira S, Bonnin A: Speculation on whether a vaccine against cryptosporidiosis is a reality or fantasy. Int J Parasitol 1999;29:1289-1306. de Graaf DC, Vanopdenbosch E, Ortega-Mora LM, Abbassi H, Peeters JE: A review of the importance of cryptosporidiosis in farm animals. Int J Parasitol 1999;29:1269-1287.

Deng M, Rutherford MS, Abrahamsen MS: Host intestinal epithelial response to Cryptosporidium parvum. Adv Drug Deliv Rev 2004;56:869-884.

Doyle PS, Crabb J, Petersen C: Anti-Cryptosporidium parvum antibodies inhibit infectivity in vitro and in vivo. Infect Immun 1993;61:4079-4084.

Duffy, G., and Moriarty, E.M. 2003. Cryptosporidium and its potential as a food-borne pathogen. Anim Health Res Rev 4:95-107.

DuPont, H.L., Chappell, C.L., Sterling, C.R., Okhuysen, P.C., Rose, J.B., and Jakubowski, W. 1995. The infectivity of Cryptosporidium parvum in healthy volunteers. N Engl J Med 332:855-859.

Ebeid, M., Mathis, A., Pospischil, A., and Deplazes, P. 2003. Infectivity of Cryptosporidium parvum genotype I in conventionally reared piglets and lambs. Parasitol Res 90:232-235.

Edzwald JK, Tobiason JE, Parento LM, Kelley MB, Kaminski GS, Dunn HJ, Galant PB: Giardia and Cryptosporidium removals by clarifiaction and filtration under challenge conditions. J Am Water Works Ass 2000;92:70-84. el-Ahraf A, Tacal JV, Jr., Sobih M, Amin M, Lawrence W, Wilcke BW: Prevalence of cryptosporidiosis in dogs and human beings in San Bernardino County, California. J Am Vet Med Assoc 1991;198:631-634.

Enriquez C, Nwachuku N, Gerba CP: Direct exposure to animal enteric pathogens. Rev Environ Health 2001;16:117-131.

Entry JA, Hubbard RK, Thies JE, Fuhrmann JJ: The influence of vegetation in riparian filterstrips on coliform bacteria: I. Movement and survival in water. J Envron Qual 2000;29:1206-1214.

169 EPA. 2002. Land application of biosolids. (Office of Inspector General, Status Report 2002-S-biosolids) http://www.epa.gov/oig/reports/2002/BIOSOLIDS_FINAL_REPORT.pdf

Farthing MJ: Clinical aspects of human cryptosporidiosis. Contrib Microbiol 2000;6:50- 74.

Fayer R, Andrews C, Ungar BL, Blagburn B: Efficacy of hyperimmune bovine colostrum for prophylaxis of cryptosporidiosis in neonatal calves. J Parasitol 1989;75:393-397.

Fayer R, Ellis W: Paromomycin is effective as prophylaxis for cryptosporidiosis in dairy calves. J Parasitol 1993;79:771-774.

Fayer R, Farley AA, Earl EJ, Trout JM, Graczyk TK: Potential role of the Eastern oyster, Crassostrea virginica, in the epidemiology of Cryptosporidium parvum. Applied Environ Microbiol 1997;63:2086-2088.

Fayer R, Graczyk TK, Cranfield MR: Multiple heterogenous isolates of Cryptosporidium serpentis from captive snakes are not transmissible to neonatal BALB/c mice (Mus musculus). J Parasitol 1995;81:482-484.

Fayer R, Lewis EJ, Trout JM, Graczyk TK, Jenkins MC, Higgins J, Xiao L, Lal AA: Cryptosporidium parvum in oysters from commercial harvesting sites in the Chesapeake Bay. Emerg Infect Dis 1999;5:706-710.

Fayer R, Trout JM, Xiao L, Morgan UM, Lai AA, Dubey JP: Cryptosporidium canis n. sp. from domestic dogs. J Parasitol 2001;87:1415-1422.

Fayer, R. 2004. Cryptosporidium: a water-borne zoonotic parasite. Vet Parasitol 126:37-56.

Fayer, R., Nerad, T., Rall, W., Lindsay, D.S., and Blagburn, B.L. 1991. Studies on cryopreservation of Cryptosporidium parvum. J Parasitol 77:357-361.

Feng, X., Rich, S.M., Akiyoshi, D., Tumwine, J.K., Kekitiinwa, A., Nabukeera, N., Tzipori, S., and Widmer, G. 2000. Extensive polymorphism in Cryptosporidium parvum identified by multilocus microsatellite analysis. Appl Environ Microbiol 66:3344-3349.

Foster JC, Glass MD, Courtney PD, Ward LA: Effect of Lactobacillus and Bifidobacterium on Cryptosporidium parvum oocyst viability. Food Microbiol 2003;20:351-357.

170 Gagliardi, J.V., and Karns, J.S. 2000. Leaching of Escherichia coli O157:H7 in diverse soils under various agricultural management practices. Appl Environ Microbiol 66:877-883.

Garber LP, Salman MD, Hurd HS, Keefe T, Schlater JL: Potential risk factors for Cryptosporidium infection in dairy calves. J Am Vet Med Assoc 1994;205:86- 91.

Garcia LS, Bruckner DA, Brewer TC, Shimizu RY: Techniques for the recovery and identification of Cryptosporidium oocysts from stool specimens. J Clin Microbiol 1983;18:185-190.

Garcia LS, Shimizu RY: Evaluation of nine immunoassay kits (enzyme immunoassay and direct fluorescence) for detection of Giardia lamblia and Cryptosporidium parvum in human fecal specimens. J Clin Microbiol 1997;35:1526-1529.

Gargala, G., Delaunay, A., Favennec, L., Brasseur, P., and Ballet, J.J. 1997. In vitro interactions of human blood and intestinal intraepithelial lymphocytes with Cryptosporidium parvum and C. parvum permissive enterocytic cell lines. J Eukaryot Microbiol 44:71S-72S.

Gatei W, Greensill J, Ashford RW, Cuevas LE, Parry CM, Cunliffe NA, Beeching NJ, Hart CA: Molecular analysis of the 18S rRNA gene of Cryptosporidium parasites from patients with or without human immunodeficiency virus infections living in Kenya, Malawi, Brazil, the United Kingdom, and Vietnam. J Clin Microbiol 2003;41:1458-1462.

Gelletlie R, Stuart J, Soltanpoor N, Armstrong R, Nichols G: Cryptosporidiosis associated with school milk. Lancet 1997;350:1005-1006.

Gerba CP, Naranjo JE, Hansan MN: Evaluation of a combined portable reverse osmosis and iodine resin drinking water treatment system for control of enteric waterborne pathogens. J Envron Sci Health A-Envir 1997;32:2337-2354.

Gilles HM, Hoffman PS: Treatment of intestinal parasitic infections: a review of nitazoxanide. Trends Parasitol 2002;18:95-97.

Glaser CA, Safrin S, Reingold A, Newman TB: Association between Cryptosporidium infection and animal exposure in HIV-infected individuals. J Acquir Immune Defic Syndr Hum Retrovirol 1998;17:79-82.

Gobel E: Diagnosis and treatment of acute cryptosporidiosis in the calf. Tierarztl Umschau 1987;42:863-864.

171 Gobel E: Possibilities of therapy of cryptosporidiosis in calves in problematic farms. Zbl Bakt-Int J Med M 1987;265:490.

Graczyk TK, Cranfield MR, Fayer R: Evaluation of commercial enzyme immunoassay (EIA) and immunofluorescent antibody (FA) test kits for detection of Cryptosporidium oocysts of species other than Cryptosporidium parvum. Am J Trop Med Hyg 1996;54:274-279.

Graczyk TK, Fayer R, Cranfield MR, Conn DB: Recovery of waterborne Cryptosporidium parvum oocysts by freshwater benthic clams (Corbicula fluminea). Appl Environ Microbiol 1998;64:427-430.

Graczyk TK, Fayer R, Lewis EJ, Trout JM, Farley CA: Cryptosporidium oocysts in Bent mussels (Ischadium recurvum) in the Chesapeake Bay. Parasitol Res 1999;85:518-521.

Graczyk, T.K., Evans, B.M., Shiff, C.J., Karreman, H.J., and Patz, J.A. 2000. Environmental and geographical factors contributing to watershed contamination with Cryptosporidium parvum oocysts. Environ Res 82:263-271.

Grimm, V., Ezaki, S., Susa, M., Knabbe, C., Schmid, R.D., and Bachmann, T.T. 2004. Use of DNA microarrays for rapid genotyping of TEM beta-lactamases that confer resistance. J Clin Microbiol 42:3766-3774.

Hafner CL, Brittingham MC: Evaluation of a Stream-Bank Fencing Program in Pennsylvania. Wildlife Society Bulletin 1993;21:307-315.

Hamels, S., Gala, J.L., Dufour, S., Vannuffel, P., Zammatteo, N., and Remacle, J. 2001. Consensus PCR and microarray for diagnosis of the genus Staphylococcus, species, and methicillin resistance. Biotechniques 31:1364-1366, 1368, 1370- 1362.

Harp JA, Woodmansee DB, Moon HW: Effects of colostral antibody on susceptibility of calves to Cryptosporidium parvum infection. Am J Vet Res 1989;50:2117- 2119.

Harp, J.A., Wannemuehler, M.W., Woodmansee, D.B., and Moon, H.W. 1988. Susceptibility of germfree or antibiotic-treated adult mice to Cryptosporidium parvum. Infect Immun 56:2006-2010.

Harper CM, Cowell NA, Adams BC, Langley AJ, Wohlsen TD: Outbreak of Cryptosporidium linked to drinking unpasteurised milk. Commun Dis Intell 2002;26:449-450.

172 Harrington, C.A., Rosenow, C., and Retief, J. 2000. Monitoring gene expression using DNA microarrays. Curr Opin Microbiol 3:285-291.

Hartman, L.J., Coyne, S.R., and Norwood, D.A. 2005. Development of a novel internal positive control for Taqman((R)) based assays. Mol Cell Probes 19:51-59.

Heine, J., and Boch, J. 1981. [Cryptosporidium infections in the calf: diagnosis, occurrence and experimental transmission]. Berl Munch Tierarztl Wochenschr 94:289

Heitman TL, Frederick LM, Viste JR, Guselle NJ, Morgan UM, Thompson RC, Olson ME: Prevalence of Giardia and Cryptosporidium and characterization of Cryptosporidium spp. isolated from wildlife, human, and agricultural sources in the North Saskatchewan River Basin in Alberta, Canada. Can J Microbiol 2002;48:530-541.

Higgins, J.A., Fayer, R., Trout, J.M., Xiao, L., Lal, A.A., Kerby, S., and Jenkins, M.C. 2001. Real-time PCR for the detection of Cryptosporidium parvum. J Microbiol Methods 47:323-337.

Hijjawi NS, Meloni BP, Ryan UM, Olson ME, Thompson RC: Successful in vitro cultivation of Cryptosporidium andersoni: evidence for the existence of novel extracellular stages in the life cycle and implications for the classification of Cryptosporidium. Int J Parasitol 2002;32:1719-1726.

Hijjawi, N.S., Meloni, B.P., Ng'anzo, M., Ryan, U.M., Olson, M.E., Cox, P.T., Monis, P.T., and Thompson, R.C. 2004. Complete development of Cryptosporidium parvum in host cell-free culture. Int J Parasitol 34:769-777.

Hill SL, Cheney JM, Taton-Allen GF, Reif JS, Bruns C, Lappin MR: Prevalence of enteric zoonotic organisms in cats. J Am Vet Med Assoc 2000;216:687-692.

Hlavsa, M.C., Watson, J.C., and Beach, M.J. 2005. Cryptosporidiosis surveillance-- United States 1999-2002. MMWR Surveill Summ 54:1-8.

Hoar BR, Atwill ER, Elmi C, Farver TB: An examination of risk factors associated with beef cattle shedding pathogens of potential zoonotic concern. Epidemiol Infect 2001;127:147-155.

Hojlyng N, Holten-Andersen W, Jepsen S: Cryptosporidiosis: a case of airborne transmission. Lancet 1987;2:271-272.

Hooda PS, Edwards AC, Anderson HA, Miller A: A review of water quality concerns in livestock farming areas. Science of the Total Environment 2000;250:143-167.

173

Hoover DM, Hoerr FJ, Carlton WW, Hisman EJ, Ferguson HW: Enteric cryptosporidiosis in a naso tang, Naso lituratus Bloch and Snider. J Fish Dis 1981;4:425-428.

Hoorman, J.J., and Shipitalo, M.J. 2005. Factors contributing to the movement of liquid animal wastes surfaces drains. J Soil Water Conserv (in press).

Horman A, Rimhanen-Finne R, Maunula L, von Bonsdorff CH, Rapala J, Lahti K, Hanninen ML: Evaluation of the purification capacity of nine portable, small- scale water purification devices. Water Sci Technol 2004;50:179-183.

Hunt E, Fu Q, Armstrong MU, Rennix DK, Webster DW, Galanko JA, Chen W, Weaver EM, Argenzio RA, Rhoads JM: Oral bovine serum concentrate improves cryptosporidial enteritis in calves. Pediatr Res 2002;51:370-376.

Hunter PR, Chalmers RM, Syed Q, Hughes LS, Woodhouse S, Swift L: Foot and Mouth Disease and Cryptosporidiosis: Possible Interaction between Two Emerging Infectious Diseases. Emerg Infect Dis 2003;9:109-112.

Irwin PJ: Companion animal parasitology: a clinical perspective. Int J Parasitol 2002;32:581-593.

Iseki M: Cryptosporidium felis sp.n. (Protozoa: Eimeriorina) from the domestic cat. Japanese J Parasitol 1979;28:285-307.

Jacangelo JG, Adham SS, Laine JM: Mechanism of Cryptosporidium, Giardia, and MS2 virus removal by MF and UF. J Am Water Works Ass 1995;87:107-121.

Jenkins MC: Advances and prospects for subunit vaccines against protozoa of veterinary importance. Vet Parasitol 2001;101:291-310.

Jenkins, M., Bowman, D., Forgaty, E., and Ghiorse, W. 2002. Cryptosporidium parvum oocysts inactivation in three soil types at various temperatures and water potentials. Soil Biol Biochem 34:1101-1109.

Jenkins, M., Trout, J.M., Higgins, J., Dorsch, M., Veal, D., and Fayer, R. 2003. Comparison of tests for viable and infectious Cryptosporidium parvum oocysts. Parasitol Res 89:1-5.

Jenkins, M.B., Walker, M.J., Bowman, D.D., Anthony, L.C., and Ghiorse, W.C. 1999. Use of a sentinel system for field measurements of Cryptosporidium parvum oocyst inactivation in soil and animal waste. Appl Environ Microbiol 65:1998- 2005.

174

Joachim, A. 2004. Human cryptosporidiosis: an update with special emphasis on the situation in Europe. J Vet Med B Infect Dis Vet Public Health 51:251-259.

Joachim, A., Eckert, E., Petry, F., Bialek, R., and Daugschies, A. 2003. Comparison of viability assays for Cryptosporidium parvum oocysts after disinfection. Vet Parasitol 111:47-57.

Johnson, D.W., Pieniazek, N.J., Griffin, D.W., Misener, L., and Rose, J.B. 1995. Development of a PCR protocol for sensitive detection of Cryptosporidium oocysts in water samples. Appl Environ Microbiol 61:3849-3855.

Johnston SP, Ballard MM, Beach MJ, Causer L, Wilkins PP: Evaluation of three commercial assays for detection of Giardia and Cryptosporidium organisms in fecal specimens. J Clin Microbiol 2003;41:623-626.

Juranek DD: Cryptosporidiosis: sources of infection and guidelines for prevention. Clin Infect Dis 1995;21 Suppl 1:S57-61.

Kaderali, L., and Schliep, A. 2002. Selecting signature oligonucleotides to identify organisms using DNA arrays. Bioinformatics 18:1340-1349.

Kaller, M., Ahmadian, A., and Lundeberg, J. 2004. Microarray-based AMASE as a novel approach for mutation detection. Mutat Res 554:77-88.

Kaminjolo JS, Adesiyun AA, Loregnard R, Kitson-Piggott W: Prevalence of Cryptosporidium oocysts in livestock in Trinidad and Tobago. Vet Parasitol 1993;45:209-213.

Kato, S., and Bowman, D.D. 2002. Using flow cytometry to determine the viability of Cryptosporidium parvum oocysts extracted from spiked environmental samples in chambers. Parasitol Res 88:326-331.

Kato, S., Jenkins, M., Fogarty, E., and Bowman, D. 2004. Cryptosporidium parvum oocyst inactivation in field soil and its relation to soil characteristics: analyses using the geographic information systems. Sci Total Environ 321:47-58.

Katsumata T, Hosea D, Ranuh IG, Uga S, Yanagi T, Kohno S: Short report: possible Cryptosporidium muris infection in humans. Am J Trop Med Hyg 2000;62:70- 72.

Kennedy GA, Kreitner GL, Strafuss AC: Cryptosporidiosis in three pigs. J Am Vet Med Assoc 1977;170:348-350.

175 Kistemann, T., Classen, T., Koch, C., Dangendorf, F., Fischeder, R., Gebel, J., Vacata, V., and Exner, M. 2002. Microbial load of drinking water reservoir tributaries during extreme rainfall and runoff. Appl Environ Microbiol 68:2188-2197.

Koch KL, Phillips DJ, Aber RC, Current WL: Cryptosporidiosis in hospital personnel. Evidence for person-to-person transmission. Ann Intern Med 1985;102:593-596.

Koudela B, Modry D: New species of Cryptosporidium (Apicomplexa, Cryptosporidiidae) from lizards. Folia Parasitol 1998;45:93-100.

Kramer MH, Sorhage FE, Goldstein ST, Dalley E, Wahlquist SP, Herwaldt BL: First reported outbreak in the United States of cryptosporidiosis associated with a recreational lake. Clin Infect Dis 1998;26:27-33.

Kuczynska, E., and Shelton, D.R. 1999. Method for detection and enumeration of Cryptosporidium parvum oocysts in feces, manures, and soils. Appl Environ Microbiol 65:2820-2826.

Landsberg JH, Paperna I: Ultrastructural-study of the coccidian Cryptosporidium sp from stomachs of juvenile cichlid fish. Dis Aquat Organ 1986;2:13-20.

Lantz, P.G., Matsson, M., Wadstrom, T., and Radstrom, P. 1997. Removal of PCR inhibitors from human faecal samples through the use of an aqueous two-phase system for sample preparation prior to PCR. J Microbiol Methods 28:159-167.

Laxer, M.A., Timblin, B.K., and Patel, R.J. 1991. DNA sequences for the specific detection of Cryptosporidium parvum by the polymerase chain reaction. Am J Trop Med Hyg 45:688-694.

LeChavallier MW, Norton WD, Lee RG: Giardia and Cryptosporidium spp. in filtered water supplies. Appl Environ Microbiol 1991;57:2617-2621.

LeChavallier MW, Norton WD, Lee RG: Occurence of Giardia and Cryptosporidium spp. in surface water supplies. Appl Environ Microbiol 1991;57:2610-2616.

LeChevallier MW, Di Giovanni GD, Clancy JL, Bukhari Z, Bukhari S, Rosen JS, Sobrinho J, Frey MM: Comparison of method 1623 and cell culture-PCR for detection of Cryptosporidium spp. in source waters. Appl Environ Microbiol 2003;69:971-979.

LeChevallier, M.W., and Norton, W.D. 1995. Giadia and Cryptosporidium in raw and finished water. J Am Water Works Assoc 87:54-68.

176 Lengerich EJ, Addiss DG, Marx JJ, Ungar BL, Juranek DD: Increased exposure to cryptosporidia among dairy farmers in Wisconsin. J Infect Dis 1993;167:1252- 1255.

Levine ND: Some corrections of coccidian (Apicomplexa: Protozoa) nomenclature. J Parasitol 1980;66:830-834.

Lim TT, Edwards DR, Workman SR, Larson BT, Dunn L: Vegetatited filter strip removal of cattle manure constituents in runoff. Trans Asae 1998;41:1375-1381.

Limor, J.R., Lal, A.A., and Xiao, L. 2002. Detection and differentiation of Cryptosporidium parasites that are pathogenic for humans by real-time PCR. J Clin Microbiol 40:2335-2338.

Lindsay DS, Blagburn BL, Sundermann CA, Giambrone JJ: Effect of broiler chicken age on susceptibility to experimentally induced Cryptosporidium baileyi infection. Am J Vet Res 1988;49:1412-1414.

Long, W.H., Xiao, H.S., Gu, X.M., Zhang, Q.H., Yang, H.J., Zhao, G.P., and Liu, J.H. 2004. A universal microarray for detection of SARS coronavirus. J Virol Methods 121:57-63.

MacKenzie WR, Schell WL, Blair KA, Addiss DG, Peterson DE, Hoxie NJ, Kazmierczak JJ, Davis JP: Massive outbreak of waterborne cryptosporidium infection in Milwaukee, Wisconsin: recurrence of illness and risk of secondary transmission. Clin Infect Dis 1995;21:57-62.

Majewska AC, Werner A, Sulima P, Luty T: Survey on equine cryptosporidiosis in Poland and the possibility of zoonotic transmission. Ann Agric Environ Med 1999;6:161-165.

Mallon ME, MacLeod A, Wastling JM, Smith H, Tait A: Multilocus genotyping of Cryptosporidium parvum Type 2: population genetics and sub-structuring. Infect Genet Evol 2003;3:207-218.

Mallon, M., MacLeod, A., Wastling, J., Smith, H., Reilly, B., and Tait, A. 2003. Population structures and the role of genetic exchange in the zoonotic pathogen Cryptosporidium parvum. J Mol Evol 56:407-417.

Marshall AT, LaMont JT: Cryptosporidiosis and public health. Hosp Pract (Off Ed) 1997;32:11, 15-16, 23.

177 Mawdsley, J.L., Brooks, A.E., and Merry, R.J. 1996. Movement of the protozoan pathogen Cryptosporidium parvum through three contrasting soil types. Biology and Fertility of Soils 21:30-36.

McLauchlin J, Amar C, Pedraza-Diaz S, Nichols GL: Molecular epidemiological analysis of Cryptosporidium spp. in the United Kingdom: results of genotyping Cryptosporidium spp. in 1,705 fecal samples from humans and 105 fecal samples from livestock animals. J Clin Microbiol 2000;38:3984-3990.

Medema, G.J., and Schijven, J.F. 2001. Modelling the sewage discharge and dispersion of Cryptosporidium and Giardia in surface water. Water Res 35:4307-4316.

Meisel JL, Perera DR, Meligro C, Rubin CE: Overwhelming watery diarrhea associated with a cryptosporidium in an immunosuppressed patient. Gastroenterology 1976;70:1156-1160.

Meyer, R.C., Bohl, E.H., and Kohler, E.M. 1964. Procurement and Maintenance of Germ-Free Seine for Microbiological Investigations. Appl Microbiol 12:295- 300.

Millard PS, Gensheimer KF, Addiss DG, Sosin DM, Beckett GA, Houck-Jankoski A, Hudson A: An outbreak of cryptosporidiosis from fresh-pressed apple cider. Jama 1994;272:1592-1596.

Miron D, Kenes J, Dagan R: Calves as a source of an outbreak of cryptosporidiosis among young children in an agricultural closed community. Pediatr Infect Dis J 1991;10:438-441.

Molbak K, Andersen M, Aaby P, Hojlyng N, Jakobsen M, Sodemann M, da Silva AP: Cryptosporidium infection in infancy as a cause of malnutrition: a community study from Guinea-Bissau, west Africa. Am J Clin Nutr 1997;65:149-152.

Moon HW, Woode GN, Ahrens FA: Attempted chemoprophylaxis of cryptosporidosis in calves. Veterinary Record 1982;110:181.

Morgan U, Weber R, Xiao L, Sulaiman I, Thompson RC, Ndiritu W, Lal A, Moore A, Deplazes P: Molecular characterization of Cryptosporidium isolates obtained from human immunodeficiency virus-infected individuals living in Switzerland, Kenya, and the United States. J Clin Microbiol 2000;38:1180-1183.

Morgan UM, Sargent KD, Deplazes P, Forbes DA, Spano F, Hertzberg H, Elliot A, Thompson RC: Molecular characterization of Cryptosporidium from various hosts. Parasitology 1998;117 ( Pt 1):31-37.

178 Morgan UM, Xiao L, Monis P, Fall A, Irwin PJ, Fayer R, Denholm KM, Limor J, Lal A, Thompson RC: Cryptosporidium spp. in domestic dogs: the "dog" genotype. Appl Environ Microbiol 2000;66:2220-2223.

Morgan, U.M., Constantine, C.C., Forbes, D.A., and Thompson, R.C. 1997. Differentiation between human and animal isolates of Cryptosporidium parvum using rDNA sequencing and direct PCR analysis. J Parasitol 83:825-830.

Morgan-Ryan UM, Fall A, Ward LA, Hijjawi N, Sulaiman I, Fayer R, Thompson RC, Olson M, Lal A, Xiao L: Cryptosporidium hominis n. sp. (Apicomplexa: Cryptosporidiidae) from Homo sapiens. J Eukaryot Microbiol 2002;49:433-440.

Mosier DA, Oberst RD: Cryptosporidiosis. A global challenge. Ann N Y Acad Sci 2000;916:102-111.

Mtambo MM, Nash AS, Blewett DA, Smith HV, Wright S: Cryptosporidium infection in cats: prevalence of infection in domestic and feral cats in the Glasgow area. Vet Rec 1991;129:502-504.

Muench TR, White MR: Cryptosporidiosis in a tropical freshwater catfish (Plecostomus spp.). J Vet Diagn Invest 1997;9:87-90.

Mumy, K.L., and Findlay, R.H. 2004. Convenient determination of DNA extraction efficiency using an external DNA recovery standard and quantitative- competitive PCR. J Microbiol Methods 57:259-268.

Nielsen CK, Ward LA: Enhanced detection of Cryptosporidium parvum in the acid-fast stain. J Vet Diagn Invest 1999;11:567-569.

Nime FA, Burek JD, Page DL, Holscher MA, Yardley JH: Acute enterocolitis in a human being infected with the protozoan Cryptosporidium. Gastroenterology 1976;70:592-598.

O'Donoghue, P.J. 1995. Cryptosporidium and cryptosporidiosis in man and animals. Int J Parasitol 25:139-195.

Okhuysen PC, Chappell CL, Crabb J, Valdez LM, Douglass ET, DuPont HL: Prophylactic effect of bovine anti-Cryptosporidium hyperimmune colostrum immunoglobulin in healthy volunteers challenged with Cryptosporidium parvum. Clin Infect Dis 1998;26:1324-1329.

Olson ME, Thorlakson CL, Deselliers L, Morck DW, McAllister TA: Giardia and Cryptosporidium in Canadian farm animals. Vet Parasitol 1997;68:375-381.

179 Ong CS, Eisler DL, Alikhani A, Fung VW, Tomblin J, Bowie WR, Isaac-Renton JL: Novel cryptosporidium genotypes in sporadic cryptosporidiosis cases: first report of human infections with a cervine genotype. Emerg Infect Dis 2002;8:263-268.

Ortega-Mora LM, Wright SE: Age-related resistance in ovine cryptosporidiosis: patterns of infection and humoral immune response. Infect Immun 1994;62:5003-5009.

Palmer CJ, Xiao L, Terashima A, Guerra H, Gotuzzo E, Saldias G, Bonilla JA, Zhou L, Lindquist A, Upton SJ: Cryptosporidium muris, a rodent pathogen, recovered from a human in Peru. Emerg Infect Dis 2003;9:1174-1176.

Panciera RJ, Thomassen RW, Garner FM: Cryptosporidiosis in a calf. Vet Pathol 1971;8:479-484.

Pavlasek I, Lavickova M, Horak P, Kral J, Kral B: Cryptosporidium varanii n. sp. (Apicomplexa: Cryptosporidiidae) in Emerald monitor (Varanus prasinus Schlegel, 1893) in captivity at Prague zoo. Gazella 1995;22:99-108.

Pavlasek I: Findings of Cryptosporidia in the stomach of chickens and of exotic and wild birds. Veterinarstvi 2001;51:103-108.

Pedraza-Diaz S, Amar C, Iversen AM, Stanley PJ, McLauchlin J: Unusual cryptosporidium species recovered from human faeces: first description of Cryptosporidium felis and Cryptosporidium 'dog type' from patients in England. J Med Microbiol 2001;50:293-296.

Pedraza-Diaz S, Amar CF, McLauchlin J, Nichols GL, Cotton KM, Godwin P, Iversen AM, Milne L, Mulla JR, Nye K, Panigrahl H, Venn SR, Wiggins R, Williams M, Youngs ER: Cryptosporidium meleagridis from humans: molecular analysis and description of affected patients. J Infect 2001;42:243-250.

Peng MM, Xiao L, Freeman AR, Arrowood MJ, Escalante AA, Weltman AC, Ong CS, Mac Kenzie WR, Lal AA, Beard CB: Genetic polymorphism among Cryptosporidium parvum isolates: evidence of two distinct human transmission cycles. Emerg Infect Dis 1997;3:567-573.

Pereira SJ, Ramirez NE, Xiao L, Ward LA: Pathogenesis of human and bovine Cryptosporidium parvum in gnotobiotic pigs. J Infect Dis 2002;186:715-718.

Perz JF, Le Blancq SM: Cryptosporidium parvum infection involving novel genotypes in wildlife from lower New York State. Appl Environ Microbiol 2001;67:1154- 1162.

180

Pieniazek NJ, Bornay-Llinares FJ, Slemenda SB, da Silva AJ, Moura IN, Arrowood MJ, Ditrich O, Addiss DG: New cryptosporidium genotypes in HIV-infected persons. Emerg Infect Dis 1999;5:444-449.

Priha, O., Hallamaa, K., Saarela, M., and Raaska, L. 2004. Detection of Bacillus cereus group bacteria from cardboard and paper with real-time PCR. J Ind Microbiol Biotechnol 31:161-169.

Quilez J, Sanchez-Acedo C, Clavel A, del Cacho E, Lopez-Bernad F: Prevalence of Cryptosporidium infections in pigs in Aragon (northeastern Spain). Vet Parasitol 1996;67:83-88.

Quintero-Betancourt W, Peele ER, Rose JB: Cryptosporidium parvum and Cyclospora cayetanensis: a review of laboratory methods for detection of these waterborne parasites. J Microbiol Methods 2002;49:209-224.

Quiroz ES, Bern C, MacArthur JR, Xiao L, Fletcher M, Arrowood MJ, Shay DK, Levy ME, Glass RI, Lal A: An outbreak of cryptosporidiosis linked to a foodhandler. J Infect Dis 2000;181:695-700.

Radstrom, P., Knutsson, R., Wolffs, P., Lovenklev, M., and Lofstrom, C. 2004. Pre- PCR processing: strategies to generate PCR-compatible samples. Mol Biotechnol 26:133-146.

Reese NC, Current WL, Ernst JV, Bailey WS: Cryptosporidiosis of man and calf: a case report and results of experimental infections in mice and rats. Am J Trop Med Hyg 1982;31:226-229.

Rickard LG, Siefker C, Boyle CR, Gentz EJ: The prevalence of Cryptosporidium and Giardia spp. in fecal samples from free-ranging white-tailed deer (Odocoileus virginianus) in the southeastern United States. J Vet Diagn Invest 1999;11:65- 72.

Riggs MW, Schaefer DA, Kapil SJ, Barley-Maloney L, Perryman LE: Efficacy of monoclonal antibodies against defined antigens for passive immunotherapy of chronic gastrointestinal cryptosporidiosis. Antimicrob Agents Chemother 2002;46:275-282.

Roach, P.D., Olson, M.E., Whitley, G., and Wallis, P.M. 1993. Waterborne Giardia cysts and Cryptosporidium oocysts in the Yukon, Canada. Appl Environ Microbiol 59:67-73.

181 Robertson, L.J., Campbell, A.T., and Smith, H.V. 1992. Survival of Cryptosporidium parvum oocysts under various environmental pressures. Appl Environ Microbiol 58:3494-3500.

Rochelle, P.A., De Leon, R., and E.R., A. 2000. Intra-isolate heterogeneity and reproducibility of PCR-based genotyping of Cryptosporidium parvum using the beta-tubulin gene. Quant Microbiol 2:87-101.

Ross, M.E., Mahfouz, R., Onciu, M., Liu, H.C., Zhou, X., Song, G., Shurtleff, S.A., Pounds, S., Cheng, C., Ma, J., et al. 2004. Gene expression profiling of pediatric acute myelogenous leukemia. Blood 104:3679-3687.

Rossignol JF, Ayoub A, Ayers MS: Treatment of diarrhea caused by Cryptosporidium parvum: a prospective randomized, double-blind, placebo-controlled study of Nitazoxanide. J Infect Dis 2001;184:103-106.

Rossignol JF, Hidalgo H, Feregrino M, Higuera F, Gomez WH, Romero JL, Padierna J, Geyne A, Ayers MS: A double-'blind' placebo-controlled study of nitazoxanide in the treatment of cryptosporidial diarrhoea in AIDS patients in Mexico. Trans R Soc Trop Med Hyg 1998;92:663-666.

Rotkiewicz T, Rotkiewicz Z, Depta A, Kander M: Effect of Lactobacillus acidophilus and Bifidobacterium sp. on the course of Cryptosporidium parvum invasion in New-Born Piglets. Bull. Vet. Inst. Pulawy 2001;45:187-195.

Ryan MJ, Sundberg JP, Sauerschell RJ, Todd KS, Jr.: Cryptosporidium in a wild cottontail rabbit (Sylvilagus floridanus). J Wildl Dis 1986;22:267.

Ryan UM, Monis P, Enemark HL, Sulaiman I, Samarasinghe B, Read C, Buddle R, Robertson I, Zhou L, Thompson RC, Xiao L: Cryptosporidium suis n. sp. (Apicomplexa: Cryptosporidiidae) in pigs (Sus scrofa). J Parasitol 2004;90:769- 773.

Ryan UM, Xiao L, Read C, Sulaiman IM, Monis P, Lal AA, Fayer R, Pavlasek I: A redescription of Cryptosporidium galli Pavlasek, 1999 (Apicomplexa: Cryptosporidiidae) from birds. J Parasitol 2003;89:809-813.

Saif, L.J., and Ward, L.A. 1999. Pathogenesis and Animal Models. In Rotaviruses: Methods and Protocols. J. Gray, and U. Desselberger, editors. Totowa, NJ: Humana Press, Inc. 101-117.

182 Sharp SE, Suarez CA, Duran Y, Poppiti RJ: Evaluation of the Triage Micro Parasite Panel for detection of Giardia lamblia, Entamoeba histolytica/Entamoeba dispar, and Cryptosporidium parvum in patient stool specimens. J Clin Microbiol 2001;39:332-334.

Sheffield RE, Mostaghimi S, Vaughan DH, Collins ER, Allen VG: Off-stream water sources for grazing cattle as a stream bank stabilization and water quality BMP. Transactions of the Asae 1997;40:595-604.

Sherwood, D., Angus, K.W., Snodgrass, D.R., and Tzipori, S. 1982. Experimental cryptosporidiosis in laboratory mice. Infect Immun 38:471-475.

Shipitalo, M.J. 2002. Earthworm and structure. In Encyclopedia of Soil Science. R. Lal, editor. 1255-1258.

Shipitalo, M.J., Dick, W.A., and Edwards, W.M. 2000. Conservation tillage and macropore factors that affect water movement and the fate of chemicals. Soil & Tillage Research 53:167-183.

Shipitalo, M.J., Edwards, W.M., Dick, W.A., and Owens, L.B. 1990. Initial storm effects on macropore transport of surface applied chemicals in no-till soil. Soil Sci Soc Am J 54:1530-1536. Simpson VR: Wild animlas as reservoirs of infectious diseases. Vet J 2002;163:128- 146.

Sischo WM, Atwill ER, Lanyon LE, George J: Cryptosporidia on dairy farms and the role these farms may have in contaminating surface water supplies in the northeastern United States. Prev Vet Med 2000;43:253-267.

Slavin D: Cryptosporidium meleagridis sp. nov. J Pathol Ther 1955;65:262-266.

Slifko, T.R., Smith, H.V., and Rose, J.B. 2000. Emerging parasite zoonoses associated with water and food. Int J Parasitol 30:1379-1393.

Smerdon WJ, Nichols T, Chalmers RM, Heine H, Reacher MH: Foot and mouth disease in livestock and reduced cryptosporidiosis in humans, England and wales. Emerg Infect Dis 2003;9:22-28.

Snyder SP, England JJ, McChesney AE: Cryptosporidiosis in immunodeficient Arabian foals. Vet Pathol 1978;15:12-17.

Solo-Gabrielle, H., and Neumeister, S. 1996. US outbreaks of cryptosporidiosis. J Am Water Works Assoc 88:76-86.

183 Spano F, Putignani L, Crisanti A, Sallicandro P, Morgan UM, Le Blancq SM, Tchack L, Tzipori S, Widmer G: Multilocus genotypic analysis of Cryptosporidium parvum isolates from different hosts and geographical origins. J Clin Microbiol 1998;36:3255-3259.

Sreevatsan, S., Bookout, J.B., Ringpis, F., Perumaalla, V.S., Ficht, T.A., Adams, L.G., Hagius, S.D., Elzer, P.H., Bricker, B.J., Kumar, G.K., et al. 2000. A multiplex approach to molecular detection of Brucella abortus and/or Mycobacterium bovis infection in cattle. J Clin Microbiol 38:2602-2610.

Sreter T, Szell Z, Varga I: Anticryptosporidial prophylactic efficacy of enrofloxacin and paromomycin in chickens. J Parasitol 2002;88:209-211.

Sreter T, Varga I: Cryptosporidiosis in birds--a review. Vet Parasitol 2000;87:261-279.

Straub, T.M., Daly, D.S., Wunshel, S., Rochelle, P.A., DeLeon, R., and Chandler, D.P. 2002. Genotyping Cryptosporidium parvum with an hsp70 single-nucleotide polymorphism microarray. Appl Environ Microbiol 68:1817-1826.

Strong, W.B., Gut, J., and Nelson, R.G. 2000. Cloning and sequence analysis of a highly polymorphic Cryptosporidium parvum gene encoding a 60-kilodalton glycoprotein and characterization of its 15- and 45-kilodalton zoite surface antigen products. Infect Immun 68:4117-4134.

Sturdee AP, Bodley-Tickell AT, Archer A, Chalmers RM: Long-term study of Cryptosporidium prevalence on a lowland farm in the United Kingdom. Vet Parasitol 2003;116:97-113.

Sturdee AP, Chalmers RM, Bull SA: Detection of Cryptosporidium oocysts in wild mammals of mainland Britain. Vet Parasitol 1999;80:273-280.

Sulaiman IM, Morgan UM, Thompson RC, Lal AA, Xiao L: Phylogenetic relationships of Cryptosporidium parasites based on the 70-kilodalton heat shock protein (HSP70) gene. Appl Environ Microbiol 2000;66:2385-2391.

Sulaiman IM, Xiao L, Lal AA: Evaluation of Cryptosporidium parvum genotyping techniques. Appl Environ Microbiol 1999;65:4431-4435.

Sulaiman IM, Xiao L, Yang C, Escalante L, Moore A, Beard CB, Arrowood MJ, Lal AA: Differentiating human from animal isolates of Cryptosporidium parvum. Emerg Infect Dis 1998;4:681-685.

184 Sulaiman, I.M., Lal, A.A., and Xiao, L. 2001. A population genetic study of the Cryptosporidium parvum human genotype parasites. J Eukaryot Microbiol Suppl:24S-27S.

Sulaiman, I.M., Lal, A.A., Arrowood, M.J., and Xiao, L. 1999. Biallelic polymorphism in the intron region of beta-tubulin gene of Cryptosporidium parasites. J Parasitol 85:154-157.

Sundberg JP, Hill D, Ryan MJ: Cryptosporidiosis in a gray squirrel. J Am Vet Med Assoc 1982;181:1420-1422.

Tacal JV, Jr., Sobieh M, el-Ahraf A: Cryptosporidium in market pigs in southern California, USA. Vet Rec 1987;120:615-616.

Tamburrini, A., and Pozio, E. 1999. Long-term survival of Cryptosporidium parvum oocysts in seawater and in experimentally infected mussels (Mytilus galloprovincialis). Int J Parasitol 29:711-715.

Tanriverdi, S., Arslan, M.O., Akiyoshi, D.E., Tzipori, S., and Widmer, G. 2003. Identification of genotypically mixed Cryptosporidium parvum populations in humans and calves. Mol Biochem Parasitol 130:13-22.

Tate KW, Nader GA, Lewis DJ, Atwill ER, Connor JM: Evaluation of buffers to improve the quality of runoff from irrigated pastures. J soil Water Conserv 2000;55:473-478.

Tate, K.W., Atwill, E.R., George, M.R., McDougald, N.K., and Larsen, R.E. 2000. Cryptosporidium parvum transport from cattle fecal deposits on California rangelands. J Range Management 53:295-299.

Theodos CM, Griffiths JK, D'Onfro J, Fairfield A, Tzipori S: Efficacy of nitazoxanide against Cryptosporidium parvum in cell culture and in animal models. Antimicrob Agents Chemother 1998;42:1959-1965.

Tibayrenc, M., and Ayala, F.J. 1991. Towards a population genetic of microorganisms: the clonal theory of parasitic protozoa. Parasitol Today 7:228-232.

Tsai, Y.L., and Olson, B.H. 1992. Rapid method for separation of bacterial DNA from humic substances in sediments for polymerase chain reaction. Appl Environ Microbiol 58:2292-2295.

Tyrrel, S.F., and Quinton, J.N. 2003. Overland flow transport of pathogens from agricultural land receiving faecal wastes. J Appl Microbiol 94 Suppl:87S-93S.

185 Tyzzer EE: A sporozoan found in the peptide glands of the common mouse. Proc Soc Exp Biol Med 1907;5:12-13.

Tyzzer EE: An extracellular coccidium, Cryptosporidium muris (gen. et sp. nov.), of the gastric glands of the common mouse. J Med Res 1910;18.

Tyzzer EE: Cryptosporidium parvum (sp. nov.), a coccidium found in the small intestine of the common mouse. Archiv für Protistenkunde 1912;26:394-412.

Tzipori S, McCartney E, Lawson GH, Rowland AC, Campbell I: Experimental infection of piglets with cryptosporidium. Res Vet Sci 1981;31:358-368.

Tzipori S, Smith M, Makin T, Halpin C: Enterocolitis in piglets caused by Cryptosporidium sp. purified from calf faeces. Vet Parasitol 1982;11:121-126.

Tzipori, S., and Widmer, G. 2000. The biology of Cryptosporidium. Contrib Microbiol 6:1-32.

Upton SJ, McAllister CT, Freed PS, Barnard SM: Cryptosporidium spp. in wild and captive reptiles. J Wildl Dis 1989;25:20-30.

USFDA. US Food and Drug Administration. 1992. Foodborne Pathogenic Microorganisms and Natural Toxins Handbook. Center for Food Safety and Applied Nutrition: College Park, Maryland.

USFDA: US Food and Drug Administration Web site. FDA Talk Paper. FDA approves new treatment for parasitic infections in pediatric patients. Available at: http://www.fda.gov/bbs/topics/ANSWERS/2002/ANS01178.html. 2002

Vesey, G., Slade, J.S., Byrne, M., Shepherd, K., Dennis, P.J., and Fricker, C.R. 1993. Routine monitoring of Cryptosporidium oocysts in water using flow cytometry. J Appl Bacteriol 75:87-90.

Vetterling JM, Jervis HR, Merrill TG, Sprinz H: Cryptosporidium wrairi sp. n. from the guinea pig Cavia porcellus, with an emendation of the genus. J Protozool 1971;18:243-247.

Vitovec, J., and Koudela, B. 1988. Location and pathogenicity of Cryptosporidium parvum in experimentally infected mice. Zentralbl Veterinarmed B 35:515-524.

Vitovec, J., and Koudela, B. 1992. Pathogenesis of intestinal cryptosporidiosis in conventional and gnotobiotic piglets. Vet Parasitol 43:25-36.

186 Walker, M.J., Montemagno, C., Bryant, J.C., and Ghiorse, W.C. 1998. Method detection limits of PCR and immunofluorescence assay for Cryptosporidium parvum in soil. Appl Environ Microbiol 64:2281-2283.

Wang, Z., Vora, G.J., and Stenger, D.A. 2004. Detection and genotyping of Entamoeba histolytica, Entamoeba dispar, Giardia lamblia, and Cryptosporidium parvum by oligonucleotide microarray. J Clin Microbiol 42:3262-3271.

Ward, L.A., and Wang, Y. 2001. Rapid methods to isolate Cryptosporidium DNA from frozen feces for PCR. Diagn Microbiol Infect Dis 41:37-42.

Weber R, Bryan RT, Bishop HS, Wahlquist SP, Sullivan JJ, Juranek DD: Threshold of detection of Cryptosporidium oocysts in human stool specimens: evidence for low sensitivity of current diagnostic methods. J Clin Microbiol 1991;29:1323- 1327.

Weinberg, S. 2004. Emergent FDA biodefense issues for microarray technology: process analytical technology. Expert Rev Mol Diagn 4:779-781.

Whitmore, T.N., and Robertson, L.J. 1995. The effect of sewage sludge treatment processes on oocysts of Cryptosporidium parvum. J Appl Bacteriol 78:34-38.

Widmer, G. 2004. Population genetics of Cryptosporidium parvum. Trends Parasitol 20:3-6.

Widmer, G., Akiyoshi, D., Buckholt, M.A., Feng, X., Rich, S.M., Deary, K.M., Bowman, C.A., Xu, P., Wang, Y., Wang, X., et al. 2000. Animal propagation and genomic survey of a genotype 1 isolate of Cryptosporidium parvum. Mol Biochem Parasitol 108:187-197.

Widmer, G., Tchack, L., Chappell, C.L., and Tzipori, S. 1998. Sequence polymorphism in the beta-tubulin gene reveals heterogeneous and variable population structures in Cryptosporidium parvum. Appl Environ Microbiol 64:4477-4481.

Wilson RB, Holscher MA, Lyle SJ: Cryptosporidiosis in a pup. J Am Vet Med Assoc 1983;183:1005-1006, 1965.

Wilson, I.G. 1997. Inhibition and facilitation of nucleic acid amplification. Appl Environ Microbiol 63:3741-3751.

Wilson, W.J., Strout, C.L., DeSantis, T.Z., Stilwell, J.L., Carrano, A.V., and Andersen, G.L. 2002. Sequence-specific identification of 18 pathogenic microorganisms using microarray technology. Mol Cell Probes 16:119-127.

187 WL, Garcia LS: Cryptosporidiosis. Clin Microbiol Rev 1991;4:325-358.

Wu, Z., Nagano, I., Boonmars, T., Nakada, T., and Takahashi, Y. 2003. Intraspecies polymorphism of Cryptosporidium parvum revealed by PCR-restriction fragment length polymorphism (RFLP) and RFLP-single-strand conformational polymorphism analyses. Appl Environ Microbiol 69:4720-4726.

Xiao L, Alderisio K, Limor J, Royer M, Lal AA: Identification of species and sources of Cryptosporidium oocysts in storm waters with a small-subunit rRNA-based diagnostic and genotyping tool. Appl Environ Microbiol 2000;66:5492-5498.

Xiao L, Bern C, Arrowood M, Sulaiman I, Zhou L, Kawai V, Vivar A, Lal AA, Gilman RH: Identification of the cryptosporidium pig genotype in a human patient. J Infect Dis 2002;185:1846-1848.

Xiao L, Bern C, Limor J, Sulaiman I, Roberts J, Checkley W, Cabrera L, Gilman RH, Lal AA: Identification of 5 types of Cryptosporidium parasites in children in Lima, Peru. J Infect Dis 2001;183:492-497.

Xiao L, Escalante L, Yang C, Sulaiman I, Escalante AA, Montali RJ, Fayer R, Lal AA: Phylogenetic analysis of Cryptosporidium parasites based on the small-subunit rRNA gene locus. Appl Environ Microbiol 1999;65:1578-1583.

Xiao L, Herd RP: Epidemiology of equine Cryptosporidium and Giardia infections. Equine Vet J 1994;26:14-17.

Xiao L, Herd RP: Infection pattern of Cryptosporidium and Giardia in calves. Vet Parasitol 1994;55:257-262.

Xiao L, Herd RP: Review of equine Cryptosporidium infection. Equine Vet J 1994;26:9-13.

Xiao L, Morgan UM, Fayer R, Thompson RC, Lal AA: Cryptosporidium systematics and implications for public health. Parasitol Today 2000;16:287-292.

Xiao L, Morgan UM, Limor J, Escalante A, Arrowood M, Shulaw W, Thompson RC, Fayer R, Lal AA: Genetic diversity within Cryptosporidium parvum and related Cryptosporidium species. Appl Environ Microbiol 1999;65:3386-3391.

Xiao L, Ryan UM, Graczyk TK, Limor J, Li L, Kombert M, Junge R, Sulaiman IM, Zhou L, Arrowood MJ, Koudela B, Modry D, Lal AA: Genetic diversity of Cryptosporidium spp. in captive reptiles. Appl Environ Microbiol 2004;70:891- 899.

188 Xiao L, Ryan UM: Cryptosporidiosis: an update in molecular epidemiology. Curr Opin Infect Dis 2004;17:483-490.

Xiao, L., Escalante, L., Yang, C., Sulaiman, I., Escalante, A.A., Montali, R.J., Fayer, R., and Lal, A.A. 1999. Phylogenetic analysis of Cryptosporidium parasites based on the small-subunit rRNA gene locus. Appl Environ Microbiol 65:1578-1583.

Xiao, L., Fayer, R., Ryan, U., and Upton, S.J. 2004. Cryptosporidium taxonomy: recent advances and implications for public health. Clin Microbiol Rev 17:72-97.

Xu P, Widmer G, Wang Y, Ozaki LS, Alves JM, Serrano MG, Puiu D, Manque P, Akiyoshi D, Mackey AJ, Pearson WR, Dear PH, Bankier AT, Peterson DL, Abrahamsen MS, Kapur V, Tzipori S, Buck GA: The genome of Cryptosporidium hominis. Nature 2004;431:1107-1112.

Yakub, G.P., and Stadterman-Knauer, K.L. 2004. Immunomagnetic separation of pathogenic organisms from environmental matrices. Methods Mol Biol 268:189- 197.

189