Clemson University TigerPrints

All Theses Theses

August 2020

Investigating Rad51 and Dmc1 in Entamoeba histolytica: Homologous Recombinases with Drug Target Potential

Rachel Evelyn Ham Clemson University, [email protected]

Follow this and additional works at: https://tigerprints.clemson.edu/all_theses

Recommended Citation Ham, Rachel Evelyn, "Investigating Rad51 and Dmc1 in Entamoeba histolytica: Homologous Recombinases with Drug Target Potential" (2020). All Theses. 3392. https://tigerprints.clemson.edu/all_theses/3392

This Thesis is brought to you for free and open access by the Theses at TigerPrints. It has been accepted for inclusion in All Theses by an authorized administrator of TigerPrints. For more information, please contact [email protected].

INVESTIGATING RAD51 AND DMC1 IN ENTAMOEBA HISTOLYTICA: HOMOLOGOUS RECOMBINASES WITH DRUG TARGET POTENTIAL

A Thesis Presented to the Graduate School of Clemson University

In Partial Fulfillment of the Requirements for the Degree Master of Science Microbiology

by Rachel Evelyn Ham August 2020

Accepted by: Dr. Lesly A. Temesvari, Committee Chair Dr. James C. Morris Dr. Yanzhang Wei

ABSTRACT

Entamoeba histolytica is the causative agent of amebic dysentery and is prevalent in developing countries. It has a biphasic lifecycle: active, virulent trophozoites and dormant, environmentally-stable cysts. Only cysts are capable of establishing new infections, and are spread by fecal deposition. Many unknown factors influence stage conversion, and synchronous encystation of E. histolytica is not currently possible in vitro. E. histolytica infections are treated with nitroimidazole drugs, such as metronidazole (Flagyl™). However, several clinical isolates have shown metronidazole resistance. Enhancing the amebicidal mechanisms of metronidazole through drug combination therapy may allow for more effective treatment. Metronidazole may cause amebic death through double-stranded DNA breakage. Inhibiting homologous recombination in E. histolytica would prevent recovery from damage induced by metronidazole and may potentiate the action of this drug. Rad51 and Dmc1 are homologous DNA recombinases involved in double-stranded DNA repair that are expressed in E. histolytica. However, the physiological roles of these two proteins are unknown. Both Rad51 and Dmc1 are upregulated during encystation of Entamoeba invadens, an in vitro model organism. Additionally, Rad51 activity is decreased by small molecule inhibitors. To gain insight into the physiological roles of Rad51 and Dmc1 in E. histolytica, and to determine drug target potential, we developed two knockdown cell lines using the RNAi-mediated Trigger approach. We transfected healthy trophozoites with gene-specific Trigger plasmid constructs and verified knockdown status using RT-

PCR and Western blots. Neither Rad51 nor Dmc1 was consistently knocked down in

ii Trigger transfected cell lines. Because these knockdowns were potentially lethal to the cells, we also exposed healthy E. histolytica trophozoites to metronidazole combined with small molecule Rad51 inhibitors B02 and DIDS to determine if we could lower the

IC50 of metronidazole. Interestingly, B02 was not cytotoxic and did not consistently alter the IC50 of metronidazole. DIDS was only cytotoxic at high concentrations, but lower concentrations seemed effective in decreasing the IC50 of metronidazole, suggesting that

DIDS may be additive or synergistic. Overall, these data may suggest that combination therapy using B02 and metronidazole would not yield more effective treatment than standard metronidazole regimens. These data may also suggest that a combination of

DIDS and metronidazole would yield a more effective amebiasis treatment.

iii DEDICATION

This work is dedicated to both of my grandfathers, Donald E. Ham and Russell D.

Osenbach, who both passed away as I was completing this thesis.

Don-Don, thank you for your generosity, your laughter, and your attendance at so many

of my recitals and other events.

Grampy, your wide range of interests always inspired me to stay engaged and active in

the world around me.

iv ACKNOWLEGDEMENTS

I would like to express my sincere appreciation to my advisor, Dr. Lesly Temesvari, who has been a wonderful mentor since I met her during my undergraduate studies in 2015.

Not only has she guided me to be an excellent scientist and writer, but she has also exemplified the value of kindness and compassion in a professional environment.

Additionally, I am grateful to the members of the Temesvari lab for helping me learn techniques, edit manuscripts, and solve problems.

I would also like to thank my committee members, Dr. Jim Morris and Dr. Charlie Wei, for providing valuble insight into my research endevours.

A special thanks to Dr. Barbara Campbell and Dr. Krista Rudolph for encouraging me to pursue my scientific goals throughout both my undergraduate and graduate studies.

Many thanks to my family: my parents, Michael and Dr. Joan Ham, my sisters, Elizabeth,

Lydia, and Jinbi, and my grandmother, Dolores Ham. Thank you for supporting and encouraging me and for instilling a lifelong love of learning.

Finally, to the Singapogu and Reeves families, along with countless others, who have made Clemson home.

v TABLE OF CONTENTS Page

TITLE PAGE ...... i ABSTRACT ...... ii DEDICATION ...... iv ACKNOWLEDGEMENTS ...... v LIST OF FIGURES ...... vii

CHAPTER 1. Joining Forces: Leveraging Novel Combination Therapies to Combat Infections with Eukaryotic Pathogens (Invited Review for PLOS Pearls) ...... 1 I. Introduction ...... 2 II. Conventional Antimicrobial and Antifungal Agents - Better Together ...... 8 III. Statins - Harnessing Pleiotropic Effects ...... 10 IV. Antineoplastics - DNA Damage and Membrane Transport Disruption ...... 12 V. Natural Compounds - Expanding the Toolbox of Traditional Medicine ...... 13 VI. Surprisingly Successful Combinations - Repurposed Drugs ...... 15 VII. Future Perspectives - Nearly Endless Combinations ...... 17 VIII. Literature Cited ...... 19

CHAPTER 2. Determining Pairwise Drug Interactions of Rad51 Inhibitors, B02 and DIDS, with Metronidazole in Entamoeba histolytica ...... 23 I. Abstract ...... 24 II. Introduction ...... 25 III. Materials and Methods ...... 32 IV. Results ...... 36 V. Discussion ...... 51 VI. Acknowledgements ...... 55 VII. Literature Cited ...... 56

CHAPTER 3. Characterizing the roles of homologous recombinases Rad51 and Dmc1 in Entamoeba histolytica ...... 59 I. Abstract ...... 60 II. Introduction ...... 61 III. Materials and Methods ...... 66 IV. Results ...... 70 V. Discussion ...... 81 VI. Acknowledgements ...... 87 VII. Literature Cited ...... 88

vi LIST OF FIGURES AND TABLES Page

Figure 1.1 Isobologram of antagonistic, additive, and synergistic effects of drug combinations ...... 4

Figure 2.1 Isobologram of antagonistic, additive, and synergistic effects of drug combinations ...... 29 Figure 2.2 Proposed mechanism of drug synergy between metronidazole and B02 in E. histolytica ...... 36 Figure 2.3 Assessing FDA as a tool for tracking viability in E. histolytica cells ...... 38 Figure 2.4 Determination of metronidazole IC50 ...... 40 Figure 2.5 Distinguishing the mode of interaction of both DIDS and B02 against E. histolytica ...... 42 Figure 2.6 Relative fluorescent output of cells treated with either 3 µM B02 or DMSO control ...... 46 Figure 2.7 Relative fluorescent output of cell lysate treated with various concentrations of B02 ...... 48

Figure 3.1 Trigger induced RNAi mechanism in E. histolytica ...... 70 Figure 3.2 Trigger plasmids containing resistance genes and knockdown cassette ..... 72 Figure 3.3 Reverse Transcriptase PCR of ehRad51-KD ...... 74 Figure 3.4 Western blots of Rad51 protein in ehRad51A, ehRad51B, and luciferase control cell lines ...... 76 Figure 3.5 Reverse transcriptase PCR of ehRad51B-KD ...... 78

Table 1.1 Successful drug combination strategies to combat eukaryotic pathogen infections ...... 5-7 Table 2.1 Change in metronidazole IC50 with different concentrations of Rad51 inhibitors ...... 44

Supplemental Table 2.1 Change in metronidazole IC50 with different concentrations of Rad51 inhibitors ...... 50 Supplemental Table 3.1 Primer sequences for plasmid construction and RT-PCR analysis ...... 80

vii

CHAPTER 1:

Joining Forces: Leveraging Novel Combination Therapies to Combat Infections with

Eukaryotic Pathogens

Rachel E. Hama,b, Lesly A. Temesvaria,b

aDepartment of Biological Sciences, Clemson University, Clemson, SC, USA

bEukaryotic Pathogen Innovation Center, Clemson University, Clemson, SC, USA

(Invited literature review to be submitted to PLOS Pearls)

1 Introduction

Limited drugs are available for many pathogenic protozoan and fungal infections, and the recent emergence of resistant strains highlights the urgent need for new therapies.

Developing new treatments using combinations of approved drugs, can expedite clinical testing, which, in turn, reduces research costs and allows for faster practitioner access to new tools. Combination therapies may further reduce pharmaceutical costs by lowering the effective dosage of each drug and possibly shortening drug regimens. Combinations may also expand the therapeutic windows of drugs in which the treatments are harmful to pathogens but minimally toxic to the host. Finally, combination therapies may result in higher efficacy of current drugs, which prolongs their lifespans by minimizing the emergence of resistant organisms.

Using two or more drugs simultaneously does not guarantee that efficacy will exceed that of using single agents. Pairwise drug interactions can be classified as either antagonistic, additive, or synergistic. Antagonism occurs when the two drugs inhibit therapeutic effects of each other. Additivism occurs when the two drugs cause the combined predicted effect for both individual drugs. Synergism occurs when the combination of drugs exceeds the predicted effect of the combination [1]. Additionally, an inert agent, without an individual effect, can potentiate the action of a second drug [2]. These pairwise relationships can be determined mathematically through isobolograms, which reveal the relationship between half maximal inhibitory concentrations (IC50) of each drug (Figure

1.1). In designing combination therapies, synergism is an important goal as it has the

2 highest potential to lower off-target effects by decreasing doses (synergistic potency) and to improve clinical outcome by increasing desired effect (synergistic efficacy) [3]. Here, we discuss recent reports of drug combinations that exhibited synergy in the treatment of infectious diseases caused by eukaryotic pathogens. These successful combinations are summarized in Table 1.1.

3

Figure 1.1. Isobologram of antagonistic, additive, and synergistic effects of combinations of drugs A and B. Isoboles connect the points of IC50 of each drug. Antagonistic relationships require increased dosage of drugs for the same individual effects, additive effects require the same dosage of drugs for the same individual effects, and synergistic interactions require decreased dosage of drugs for the same individual effects. Image created in BioRender (adapted from Li, 2016). If the drugs are synergistic, the IC50 of agent A in the presence of B should be lower than agent A alone [27].

4 Extracellular Pathogens Combination 1 Combination 2 Combination 3 Combination 4 Combination 5 Amoebozoa Acanthamoeba simvastatin, - - - - castellanii voriconazole+ Blastocystis sp. atorvastatin, - - - - metronidazole* Entamoeba histolytica simvastatin, lonafarnib, - - - lonafarnib* metronidazole* Naegleria fowleri auranofin, - - - - amphotericin B* Fungi Aspergillus fumigatus posaconazole, caspofungin, - - - clofazamine+ clofazamine+ Aspergillus niger Mucuna stans and - - - - Leonotis nepetifolia extracts* Candida albicans fluconazole, caspofungin, Leonotis - - clofazamine+ clofazamine+ nepetifolia, Bidens pilosa extracts* Cryptococcus fluconazole, amphotericin B, Mucuna stans, - - neoformans amphotericin B+ Laminaecae Leonotis family extracts* nepetifolia extracts+ Fonsecaea terbinafine, - - - - monophora amphotericin B*

5 Combination 1 Combination 2 Combination 3 Combination 4 Combination 5 Helminths Echinococcus albendazole, 5- albendazole, albendazole, albendazole, - granulosus fluorouracil+ Zataria metformin+ Sophora microflora moorcroftiana extracts+ alkaloids+ Intracellular Pathogens Apicomplexans Babesia sp. diminizene atovaquone, diminizene atovaquone, - aceturate, eflornithine* aceturate, hydroxyurea* clofazamine+ synthetic chalcones+ Plasmodium falciparum B02, artemisinin* prochlorperazine, - - - chloroquine+ Plasmodium vivax chlorpheniramine, - - - - mefloquine+ Toxoplasma gondii clindamycin, ketofin, simvastatin, atorvastatin, - azithromycin+ pyrimethamine* pyrimethamine+ CS7* Trypanosomes Leishmania tamoxifen, - - - - amazonensis amphotericin B+

Leishmania lovastatin, - - - - donovani chromium chloride+

Leishmania propolis, nelfinavir, lopinavir, sorafinib, - infantum amphotericin B* amphotericin B* amphotericin B* auranofin, lopinivir*

6 Combination 1 Combination 2 Combination 3 Combination 4 Combination 5 Trypanosomes (con’t) Leishmania major paramomycin, 4- Moringa oleifera propolis, - aminoquinoline+ extracts, amphotericin B* amphotericin B* Leishmania allicin, - - - - martiniquensis amphotericin B* Leishmania mexicana paramomycin, 4- - - - - aminoquinoline+ Trypanosoma brucei temozolamide, temozolamide, - - - elflornithine+ malarsoprol+ Typanosoma congolense Anogeissus - - - - leiocarpus, Khaya senegalensis extracts, potash* Trypanosoma cruzi clofazamine, Chlamydomonas clomipramine, amiodarone, Lippia alba benznidazole* reinhardtii benznidazole* benznidazole+ terpenes extracts, (limonene, nifurtimax+ citral)* Table 1.1. Successful drug combination strategies to combat eukaryotic pathogen infections. Combinations marked with (+) are additive, and combinations marked with (*) are synergistic.

7 Conventional Antimicrobial and Antifungal Agents – Better Together

Combining conventional drugs that target eukaryotic pathogens has resulted in improved inhibition of pathogen growth. Furthermore, some antimicrobials that target prokaryotes have secondary antiparasitic targets and potentiate the action of standard antiprotozoal drugs. For example, neuro-invasive Toxoplasma gondii was successfully countered with the combination of clindamycin and azithromycin, both of which inhibit protein synthesis in bacteria. Although the antiparasitic mechanism is unclear, clindamycin effectively crosses the blood brain barrier and accumulates in tissues with high parasitic loads [4].

Diminizene aceturate is a DNA-binding drug commonly used to treat canine babesiosis

[5], but it has not been widely used in humans due to its narrow therapeutic window.

However, a combination therapy using diminizene aceturate and clofazimine, an anti- mycobacterial drug, showed that adding clofazamine to lower doses of diminizene aceturate produced the same in vivo outcomes as higher doses of diminizene aceturate in a mouse model of infection [6]. Both drugs bind AT-rich regions of DNA, which are common in Babesia sp., and such constrained DNA cannot be replicated, causing cell cycle arrest. Because clofazamine can lower the effective dose of diminizene aceturate, it may provide a larger therapeutic window for treating human babesiosis.

Clofazimine also inhibits trypanosomal proline transporters and enhances retention of benznidazole, commonly used to treat Trypanosoma cruzi infections [7]. Paramomycin is the conventional treatment for cutaneous leishmaniasis. 4-aminoquinoline chloroquine is

8 often used in combination with doxycycline to treat Q fever, which is caused by intracellular infections with the bacterium, Coxiella burnetii [8]. Together, paramomycin and 4-aminoquinoline synergized in the treatment against Leishmania major and

Leishmania mexicana; [9]. Both intracellular Leishmania amastigotes and C. burnetii bacteria induce acidification of macrophages, which decreases therapeutic activity of conventional drugs. Therefore, alkalization of macrophages induced by 4-aminoquinoline chloroquine enhanced the cytotoxic mechanisms of doxycycline and paramomycin.

Interestingly, clofazamine can also potentiate many antifungal drugs, including fluconazole, posaconazole, and caspofungin, to inhibit Candida sp. and Aspergillus fumigatus. Clofazamine elicits cell membrane stress and activates the Pkc1 signaling pathway, which is also activated in fluconazole and caspofungin response in C. albicans

[10]. Similarly, posaconazole and caspofungin both synergized with clofazimine and decreased hyphal growth of A. fumigatus [10].

Combining multiple antifungals with different drug targets has proven effective.

Amphotericin B is used as a conventional treatment for several fungal infections. This drug interferes with ion transport and membrane polarization, leading to high host toxicity. Additionally, amphotericin B interferes with membrane permeability by binding to ergosterol, a pathogen specific lipid that regulates outer membrane integrity.

Fluconazole, a broad-spectrum antifungal, inhibits ergosterol synthesis, synergizing with amphotericin B by allowing for an increased saturation rate in Cryptococcus neoformans

[11]. Terbinafine, the conventional drug treatment for chromoblastomycosis, causes

9 accumulation of an ergosterol intermediate that increases membrane permeability.

Amphotericin B and terbinafine synergized through rapid membrane alterations that led to enhanced lysis of melanized Fonsecaea monophora fungal cells [12].

Statins – Harnessing Pleiotropic Effects

Statins, such as simvastatin, atorvastatin, and lovastatin, are a class of drugs that inhibit

HMGR (3-hydroxy-3-methyl-glutaryl-coenzyme A reductase) activity and are routinely used to treat hypercholesterolemia. HMGR catalyzes the biosynthesis of many sterols through the conversion of HMG-CoA into 1-mevalonate, a sterol precursor [13, 14]. 1-

Mevalonate also functions as a biochemical precursor of isoprenoid groups, which serve as post-translational prenylations on many proteins. Statins are versatile because they have large therapeutic windows. Many parasites scavenge sterols from the host in addition to synthesizing sterols themselves. Therefore, combining multiple compounds that limit sterol synthesis in either pathogen or host is predicted to be synergistic.

Using simvastatin with the antifungal drug, voriconazole, represents a highly effective strategy that targeted two different biochemical steps in Acanthamoeba ergosterol synthesis [15]. Simvastatin blocked amebic HMG-CoA, while the antifungal drug, voriconazole, blocked 14α-demethylase, an enzyme responsible for assembling ergosterols [16]. In a mouse model of T. gondii infection, strong synergism was observed between atorvastatin, an HMG-CoA inhibitor of host cell sterol synthesis, and C7S, a bisphosphonate that also functions as an inhibitor of parasitic isoprenoid synthesis [17].

10 Statins have been shown to be particularly useful against intracellular parasites because the drugs can alter host cell membranes and modulate host immunity. Atorvastatin enhances host cellular membrane integrity during Blastocystis infection, preventing protozoan invasion and leaving parasites vulnerable to metronidazole [18]. Similarly, simvastatin decreased T. gondii tachyzoite adhesion and invasion, allowing a conventional anti-toxoplasmosis drug, pyrimethamine, to kill exposed parasites in the bloodstream [19]. Statins may enhance the oxidative stress, part of the immune response in the host. For example, combining lovastatin with the anti-leishmanial, chromium chloride, produced two varieties of reactive oxygen species in parasitic cells, which induced apoptosis in Leishmania donovani amastigotes [20].

Statins can pleiotropically inhibit protein prenylation of several highly conserved eukaryotic proteins, including the Ras superfamily of G-proteins. Farnesyltransferase is an essential enzyme that catalyzes the post-translational attachment of farnesyl groups on proteins. Combination therapy with simvastatin and lonafarnib, an antineoplastic that inhibits farnesyltransferase [21], was synergistic against Entamoeba histolytica [22]. This finding was unanticipated because genome data suggest that E. histolytica lacks HMGR.

Thus, the therapeutic efficacy of simvastatin was predicted to be due to pleiotropic effects in the isoprenoid biosynthesis pathway. Combination therapy with the standard anti- protozoal, metronidazole, and lonafarnib was also synergistic against E. histolytica [22].

This outcome may have been due to lonafarnib-induced membrane destabilization,

11 caused by impaired protein prenylation, which, in turn, intensified oxidative damage caused by metronidazole.

Antineoplastics – DNA Damage and Membrane Transport Disruption

Many antineoplastic drugs inhibit unrestrained tumor cell proliferation by targeting DNA or DNA repair. Such drugs may potentiate conventional antimicrobials that function by damaging DNA. The antiparasitic drug, atovaquone, which induces double-stranded

DNA breaks [23], synergized with either hydroxyurea or eflornithine, two antineoplastic agents, to block multiplication and differentiation of Babesia parasites [24].

Trypanosoma brucei growth was inhibited by combining the antineoplastic agent, temozolamide, with either eflornithine or malarsoprol. Temozolimde, developed for glioblastoma, is a DNA damaging agent that crosses the blood brain barrier. Thus, it is particularly advantageous for cases with brain migration of trypanosomes [25].

Temozolimide was shown to trigger trypanosomal cell cycle arrest through DNA damage, limiting proliferation and increasing parasitic susceptibility to standard treatments. Similarly, B02, an inhibitor of DNA repair [26], synergistically enhanced the

DNA damaging activity of artemisinin and chloroquine in Plasmodium falciparum [27].

Echinococcus cell division was limited by the DNA damaging antiparasitic drug, albendazole [28], and the anti-neoplastic, 5-fluoruracil, a nucleoside analog that is incorporated into DNA and produces toxic metabolites [29]. Tamoxifen, commonly used to inhibit human estrogen receptors, increases membrane depolarization in Leishmania amazonensis, and may also depolarize mitochondrial membranes, leading to synergy with amphotericin B [30].

12 Natural Compounds – Expanding the Toolbox of Traditional Medicine

Combination methodology is commonplace within traditional medicine because raw plant material contains bioactive compounds with unknown mechanisms. Chalcones are flavonoids that are plant-derived phenolic compounds. Synthetic chalcones inhibit glucose metabolism of Babesia and reduce the toxicity of diminizene aceturate through an unknown mechanism [31]. Amphotericin B synergizes with many phenolic plant extracts to inhibit the growth of several pathogens. Two models have been proposed for phenolic extract synergy with amphotericin B: enhanced lipophilic transport that increases drug permeation, and inhibition of outer membrane ergosterol exchange with intercellular membranes. Phenolic extracts from the Laminaecae family, including basil

(Ocimum basilicum), oregano (Origanum vulgare), and thyme (Thymus vulgaris), synergized with amphotericin B to inhibit the growth of C. neoformans through increased lipophilic transport of drug [32, 33]. Similarly, Moringa oleifera, a medicinal plant, also produced phenols that increased lipophilic transport of amphotericin B into L. major parasites [34]. The garlic-derived compound, allicin, inhibited outer membrane ergosterol exchange with vacuole membranes and increased the rate of amphotericin B interference with membrane ergosterol in Leishmania martiniquensis [35]. Phenolic compounds may also bind intracellular proteins and increase oxidative stress in L. martiniquensis, exacerbating negative effects of amphotericin B [35]. Albendazole activates macrophages and impairs motility of Echinococcus cells, and both of these activities can be improved with Zataria multiflora phenolic extracts. Z. multiflora extracts increased membrane permeability and altered parasite motility [36].

13 Other non-phenolic derived compounds can enhance standard antimicrobial treatments.

Tunisian propolis, one such compound, is a natural resinous product of trees that is harvested by bees for hive construction. It was shown to enhance the activity of amphotericin B by increasing macrophage activity and inhibiting intracellular invasion of

Leishmania infantum and L. major [37]. In this case, amphotericin B readily saturated parasitic membranes because amastigotes were not sequestered in host cells [37].

Similarly, microalgae extracts from Chlamydomonas reinhardtii inhibited T. cruzi intracellular invasion, potentiating the action of nifurtimax, a conventional treatment only active against bloodstream trypomastigotes [38]. Several natural compounds produce synergy through immune system stimulation and protection from drug-induced host toxicity. Benznidazole generates oxidative stress that damages both T. cruzi and host cells; however, supplementation with Lippia sp.-derived terpenes inhibited host inflammation and may have induced additional parasite-specific oxidative stress [39].

Trypanosoma congolense, the major agent of cattle trypanosomosis that also serves as a model organism for human T. brucei infection, exhibited impaired motility in a mouse model of infection caused by a combination of extracts from Anogeissus leiocarpus and

Khaya senegalensis along with potash salts, resulting in decreased parasitemia [40].

Albendazole treatment of Echinococcus infections can also be enhanced by a combination treatment with Sophora moorcroftiana alkaloids, which increase host complement activation [41].

14 Many fungal pathogens can be treated with combinations of natural compounds.

Aspergillus niger, C. neoformans, and C. albicans growth was inhibited by several pairwise combinations of Tanzanian plant extracts. Ethanolic extracts from Leonotis neperifolia and Bidens pilosa synergized strongly against C. albicans, Mucuna stans and

L. nepetifolia extracts displayed synergy against A. niger, and these two extract combinations had additive effects against C. neoformans [42]. However, three-way combinations of these same plant extracts were antagonistic in treating C. albicans, meaning therapeutic windows remain relevant to development of natural therapies.

Surprisingly Successful Combinations – Repurposed Drugs

Drug screening has revealed unexpected agents with antiparasitic activity. Furthermore, clinicians have observed improved outcomes from patients with protozoan infections already taking chemotherapeutics for unrelated conditions. Many repurposed drugs inhibit parasite replication. Patients infected with L. infantum taking nelfinavir, an antiretroviral for treatment of concurrent HIV, had better outcomes than HIV-negative patients taking only amphotericin B [43]. L. infantum infections were also cleared more quickly when treated with a combination of lopinavir and miltefosine [44]. Upon further investigation, it was shown that antiretrovirals prevented intracellular multiplication of amastigotes [43] and altered lipid membrane composition [44], leading to a reduced parasitic load and synergy with conventional anti-parasitics. Likewise, ketotifen, a tricyclic antihistamine, prevents host cell invasion by T. gondii through stabilization of outer cell membrane. This drug also inhibits intracellular parasite multiplication, which

15 increases the percentage of bloodstream parasites that are vulnerable to pyrimethamine

[45]. Interestingly, ketotifen may also reduce host cell inflammation, rendering infections less harmful [45]. Finally, metformin, a hydrophilic anti-hyperglycemic that also prevents parasitic proliferation, improved conventional albendazole treatment of echinococcosis through reducing the parasite load [46].

Several repurposed drugs may increase delivery of conventional drugs to target tissues.

Auranofin, an anti-arthritic drug, synergizes with conventional amphotericin B for nuero- invasive Naegleria fowleri infections [47]. Auranofin impairs the N. fowleri oxidative stress response through inhibiting both selenoprotein synthesis and thioreductase activity.

It also may improve drug delivery of amphotericin B across the blood brain barrier [47].

Conventional treatment of T. cruzi with benznidazole was enhanced with amiodarone, a cardiac antiarrhythmic drug often prescribed for symptomatic treatment of invasive cardiac cases of Chagas disease. Both drugs were shown to have distinct targets in T. cruzi and to reach therapeutic concentrations in myocardial tissue. Benznidazole caused oxidative stress and amiodarone inhibited parasitic ergosterol biosynthesis, and the combination decreased parasitic cell counts in vitro more effectively than single drug treatment [48].

Many repurposed drugs also exhibit binding to parasite-specific proteins. Clomipramine, a tricyclic antidepressant, binds trypanothione reductases and mitochondrial membranes in many trypanosomes, including L. amazonensis [49], T. brucei [50], and T. cruzi [51].

16 Trypanothione reductase is a critical protein in the antioxidant response of T. cruzi, so oxidative stress inflicted by benznidazole may be intensified by an inhibited antioxidant response mediated by clomipramine [51]. The antipsychotic drug, prochlorperazine [52], and the antihistamine, chlorpheniramine [53], both potentiate chloroquine and mefloquine by binding parasite-specific efflux pumps and ABC transporters in

Plasmodium vivax [52] or P. falciparum [53], forcing retention of these conventional antimalarial drugs.

Future Perspectives – Nearly Endless Combinations

Synergistic mechanisms show similarity across drug categories, although classes and mechanisms are diverse, and successful combination therapies have been reported for most infections with eukaryotic pathogens. Several drugs are enhanced by agents that limit parasitic replication and differentiation, while other agents disrupt membrane integrity and permeability, increasing diffusion of conventional drugs and triggering death pathways. Other treatments block invasion of intracellular parasites, forcing parasites to remain in tissues with higher concentrations of conventional drugs. Similarly, some agents increase concentration of conventional drugs in specific tissues with high parasite burden. Finally, both parasitic and host immunity are modulated by synergy- producing agents. Protective pathogen antioxidant enzymes can be inhibited by novel combinations, which enhances oxidative damage to pathogens caused by conventional drugs. Several combination therapies broaden the therapeutic window of conventional drugs by either upregulation of host immune response or reduction of drug-induced

17 inflammation. Capitalizing upon the wide variety of mechanisms can yield promising three-way combinations. For example, L. infantum infections have been successfully treated with a combination of sorafinib, a kinase inhibitor used to treat kidney cancer, lopinavir, an antiretroviral, and auranofin, an inflammation reducing anti-arthritic [54].

Pairwise combinations of these three drugs were additive, but the combination of all three produced synergy. As researchers gain a greater understanding of the modes of action of different drugs against eukaryotic pathogens, novel cocktails made up of three or more agents can be designed and tested, resulting in cost-effective treatments for this devastating group of pathogens.

18 Literature Cited

1. Chan GKY, Wilson S, Schmidt S, Moffat JG. Unlocking the potential of high- throughput drug combination assays using acoustic dispensing. J Lab Autom. 2016;21: 125-132. 2. Li R, Chen J, Cesario TC, Wang X, Yuan JS, Rentzepis PM. Synergistic reaction of silver nitrate, silver nanoparticles, and methylene blue against bacteria. Proc Nat Acad Sci USA. 2016;113: 13612-13617. 3. Meyer CT, Wooten DJ, Paudel BB, Bauer J, Hardeman KN, Westover D, et al. Quantifying drug combination synergy along potency and efficacy axes. Cell Syst. 2019;8: 97-108. e16. 4. Shiojiri D, Kinai E, Teruya K, Kikuchi Y, Oka S. Combination of clindamycin and azithromycin as alternative treatment for Toxoplasma gondii encephalitis. Emerg Infect Dis. 2019;25: 841-843. 5. Rajapakshage BKW, Yamasaki M, Hwang S, Sasaki N, Murakami M, Tamura Y, et al. Involvement of mitochondrial genes of Babesia gibsoni in resistance to diminazene aceturate. J Vet Med Sci. 2012;74:1139-1148. 6. Tuvshintulga B, Abou-Laila M, Sivakumar T, Tayebwa DS, Gantuya S, Naranbaatar K, et al. Chemotherapeutic efficacies of a clofazimine and diminazene aceturate combination against piroplasm parasites and their AT-rich DNA-binding activity on Babesia bovis. Sci Rep. 2017;7: 13888-0. 7. Saye M, Gauna L, Valera-Vera E, Reigada C, Miranda MR, Pereira CA. Crystal violet structural analogues identified by in silico drug repositioning present anti-Trypanosoma cruzi activity through inhibition of proline transporter TcAAAP069. PLoS Negl Trop Dis. 2020;14: e0007481. 8. Kersh GJ. Antimicrobial therapies for Q fever. Expert Rev Anti Infect Ther. 2013;11: 1207-1214. 9. Wijnant GJ, Van Bocxlaer K, Yardley V, Murdan S, Croft SL. Efficacy of paromomycin-chloroquine combination therapy in experimental cutaneous leishmaniasis. Antimicrob Agents Chemother. 2017;61: e00358-17. 10. Robbins N, Spitzer M, Yu T, Cerone RP, Averette AK, Bahn Y, et al. An antifungal combination matrix identifies a rich pool of adjuvant molecules that enhance drug activity against diverse fungal pathogens. Cell rep. 2015;13: 1481-1492. 11. Khan AA, Alanazi AM, Jabeen M, Khan S, Malik A. Additive potential of combination therapy against cryptococcosis employing a novel amphotericin B and fluconazole loaded dual delivery system. Eur J Pharm Sci. 2018;119:171-178. 12. Deng S, Lei W, de Hoog GS, Yang L, Vitale RG, Rafati H, et al. Combination of amphotericin B and terbinafine against melanized fungi associated with chromoblastomycosis. Antimicrob Agents Chemother. 2018;62: e00270-18. 13. Edwards PA, Ericsson J. Sterols and isoprenoids: signaling molecules derived from the cholesterol biosynthetic pathway. Annu Rev Biochem. 1999;68: 157-185. 14. Gazzerro P, Proto MC, Gangemi G, Malfitano AM, Ciaglia E, Pisanti S, et al. Pharmacological actions of statins: a critical appraisal in the management of cancer. Pharmacol Rev. 2012;64: 102-146.

19 15. Sifaoui I, Martín-Navarro CM, López-Arencibia A, Reyes-Batlle M, Valladares B, Piñero JE, et al. Optimized combinations of statins and azoles against Acanthamoeba trophozoites and cysts in vitro. Asian Pac J Trop Med. 2019;12: 283. 16. Thomson S, Rice CA, Zhang T, Edrada-Ebel R, Henriquez FL, Roberts CW. Characterisation of sterol biosynthesis and validation of 14α-demethylase as a drug target in Acanthamoeba. Sci Rep. 2017;7:8247. 17. Li Z, Li C, Szajnman SH, Rodriguez JB, Moreno SN. Synergistic activity between statins and bisphosphonates against acute experimental toxoplasmosis. Antimicrob Agents Chemother. 2017;61(8): e02628-16 18. Basyoni MM, Fouad SA, Amer MF, Amer AF, Ismail DI. Atorvastatin: in-vivo synergy with metronidazole as anti-Blastocystis therapy. Korean J Parasitol. 2018;56: 105-112. 19. Sanfelice RA, da Silva SS, Bosqui LR, Machado LF, Miranda-Sapla MM, Panagio LA, et al. Pravastatin and simvastatin pretreatment in combination with pyrimethamine and sulfadiazine reduces infection process of Toxoplasma gondii tachyzoites (RH strain) in HeLa cells. Acta Parasitol. 2019;64: 612-616. 20. Verma AK, Laha B, Pandey M, Pal U, Ghosh M. Cholesterol-lowering drug, in combination with chromium chloride, induces early apoptotic signals in intracellular L. donovani amastigotes, leading to death. J Biosci. 2017;42: 427-438. 21. Ochocki JD, Distefano MD. Prenyltransferase inhibitors: treating human ailments from cancer to parasitic infections. Medchemcomm. 2013;4: 476-492. 22. Probst A, Nguyen TN, El-Sakkary N, Skinner D, Suzuki BM, Buckner FS, et al. Bioactivity of Farnesyltransferase Inhibitors against Entamoeba histolytica and Schistosoma mansoni. Front Cell Infect Microbiol. 2019;9: 180. 23. Gao X, Liu X, Shan W, Liu Q, Wang C, Zheng J, et al. Anti-malarial atovaquone exhibits anti-tumor effects by inducing DNA damage in hepatocellular carcinoma. Am J Cancer Res. 2018;8:1697-1711. 24. El-Saber Batiha G, Magdy-Beshbishy A, Adeyemi SO, Nadwa E, Rashwan E, Yokoyama N, et al. Safety and efficacy of hydroxyurea and eflornithine against most blood parasites Babesia and Theileria. PLoS One. 2020;15: e0228996. 25. Steverding D, Rushworth SA. Front-line glioblastoma chemotherapeutic temozolomide is toxic to Trypanosoma brucei and potently enhances melarsoprol and eflornithine. Exp Parasitol. 2017;178: 45-50. 26. Huang F, Mazin AV. A small molecule inhibitor of human RAD51 potentiates breast cancer cell killing by therapeutic agents in mouse xenografts. PloS one. 2014;9: e100993. 27. Vydyam P, Dutta D, Sutram N, Bhattacharyya S, Bhattacharyya MK. A small- molecule inhibitor of the DNA recombinase Rad51 from Plasmodium falciparum synergizes with the antimalarial drugs artemisinin and chloroquine. J Biol Chem. 2019;294: 8171-8183. 28. Castro L, Kviecinski MR, Ourique F, Parisotto EB, Grinevicius V, Correia J, et al. Albendazole as a promising molecule for tumor control. Redox biology. 2016;10: 90-99. 29. Pensel PE, Elissondo N, Gambino G, Gamboa GU, Benoit J, Elissondo MC. Experimental cystic echinococcosis therapy: in vitro and in vivo combined 5- fluorouracil/albendazole treatment. Vet Parasitol. 2017;245: 62-70.

20 30. Trinconi CT, Reimao JQ, Yokoyama-Yasunaka JK, Miguel DC, Uliana SR. Combination therapy with tamoxifen and amphotericin B in experimental cutaneous leishmaniasis. Antimicrob Agents Chemother. 2014;58: 2608-2613. 31. Batiha GE, Beshbishy AM, Tayebwa DS, Adeyemi OS, Shaheen H, Yokoyama N, et al. The effects of trans-chalcone and chalcone 4 hydrate on the growth of Babesia and Theileria. PLoS Negl Trop Dis. 2019;13: e0007030. 32. Cardoso NN, Alviano CS, Blank AF, Arrigoni-Blank MDF, Romanos MTV, Cunha MM, et al. Anti-cryptococcal activity of ethanol crude extract and hexane fraction from Ocimum basilicum var. Maria bonita: mechanisms of action and synergism with amphotericin B and Ocimum basilicum essential oil. Pharm Biol. 2017;55: 1380-1388. 33. Tullio VC, Scalas D, Roana J, Tardugno R, Ghisetti V, Benvenuti S, et al. Studies on activity of azoles and essential oils alone and in combination against Cryptococcus neoformans clinical isolates. . 2017: PO1697-2. 34. Hammi KM, Essid R, Tabbene O, Elkahoui S, Majdoub H, Ksouri R. Antileishmanial activity of Moringa oleifera leaf extracts and potential synergy with amphotericin B. S Afr J Bot. 2020; 129: 67-73. 35. Intakhan N, Chanmol W, Somboon P, Bates MD, Yardley V, Bates PA, et al. Antileishmanial activity and synergistic effects of amphotericin B deoxycholate with allicin and andrographolide against Leishmania martiniquensis in vitro. Pathogens. 2020;9: 49. 36. Moazeni M, Borji H, Saboor Darbandi M. Enhancement of the therapeutic effect of albendazole on cystic echinococcosis using a herbal product. J Invest Surg. 2019;32: 103- 110. 37. Jihene A, Rym E, Ines KJ, Majdi H, Olfa T, Abderrabba M. Antileishmanial potential of propolis essential oil and its synergistic combination with amphotericin B. Natural Product Communications. 2020;15: 1934578X19899566. 38. Veas R, Rojas-Pirela M, Castillo C, Olea-Azar C, Moncada M, Ulloa P, et al. Microalgae extracts: Potential anti-Trypanosoma cruzi agents? Biomedicine & Pharmacotherapy. 2020;127: 110178. 39. Moreno ÉM, Leal SM, Stashenko EE, García LT. Induction of programmed cell death in Trypanosoma cruzi by Lippia alba essential oils and their major and synergistic terpenes (citral, limonene and caryophyllene oxide). BMC Complement Altern Med. 2018;18:225. 40. Tauheed AM, Mamman M, Balogun EO, Ahmed A, Suleiman MM. In vitro and in vivo antitrypanosomal efficacy of combination therapy of Anogeissus leiocarpus, Khaya senegalensis and potash. J Ethnopharmacol. 2020: 112805. 41. Zhang F, Hu C, Cheng S, Wang S, Li B, Cao D, et al. The Investigation of the Effect and Mechanism of Sophora moorcroftiana alkaloids in combination with albendazole on echinococcosis in an experimental rats model. Evid Based Complement Alternat Med. 2018:3523126 42. Mbunde MVN, Mabiki F, Innocent E, Andersson PG. Antifungal activity of single and combined extracts of medicinal plants from Southern Highlands of Tanzania. Journal of Pharmacognosy and Phytochemistry. 2019;8: 181-187.

21 43. Valdivieso E, Mejías F, Carrillo E, Sánchez C, Moreno J. Potentiation of the leishmanicidal activity of nelfinavir in combination with miltefosine or amphotericin B. Int J Antimicrob Agents. 2018;52: 682-687. 44. Rebello KM, Andrade-Neto VV, Gomes CRB, de Souza MVN, Branquinha MH, Santos ALS, et al. Miltefosine-Lopinavir combination therapy against Leishmania infantum infection: in vitro and in vivo approaches. Front Cell Infect Microbiol. 2019; 9:229 45. Montazeri M, Rezaei K, Ebrahimzadeh MA, Sharif M, Sarvi S, Ahmadpour E, et al. Survey on synergism effect of ketotifen in combination with pyrimethamine in treatment of acute murine toxoplasmosis. Trop Med Health. 2017;45: 39. 46. Loos JA, Dávila VA, Rodrígues CR, Petrigh R, Zoppi JA, Crocenzi FA, et al. Metformin exhibits preventive and therapeutic efficacy against experimental cystic echinococcosis. PLoS Negl Trop Dis. 2017;11: e0005370. 47. Escrig JI, Hahn HJ, Debnath A. Activity of auranofin against multiple genotypes of Naegleria fowleri and its synergistic effect with amphotericin B in vitro. ACS Chem Neurosci. 2020. 48. Lourenço AM, Faccini CC, de Jesus-Costa CA, Mendes GB, Fragata Filho AA. Evaluation of in vitro anti-Trypanosoma cruzi activity of medications benznidazole, amiodarone hydrochloride, and their combination. Rev Soc Bras Med Trop. 2018;51:52- 56. 49. da Silva-Rodrigues JH, Miranda N, Volpato H, Ueda-Nakamura T, Nakamura CV. The antidepressant clomipramine induces programmed cell death in Leishmania amazonensis through a mitochondrial pathway. Parasitol Res. 2019;118: 977-989. 50. O’Sullivan MC, Durham TB, Valdes HE, Dauer KL, Karney NJ, Forrestel AC, et al. Dibenzosuberyl substituted polyamines and analogs of clomipramine as effective inhibitors of trypanothione reductase; molecular docking, and assessment of trypanocidal activities. Bioorg Med Chem. 2015;23: 996-1010. 51. García MC, Ponce NE, Sanmarco LM, Manzo RH, Jimenez-Kairuz AF, Aoki MP. Clomipramine and benznidazole act synergistically and ameliorate the outcome of experimental Chagas disease. Antimicrob Agents Chemother. 2016;60: 3700-3708. 52. Obaldia N, Milhous WK, Kyle DE. Reversal of chloroquine resistance of Plasmodium vivax in Aotus monkeys. Antimicrob Agents Chemother. 2018;62. 53. Osonwa UE, Majekodunmi SO, Osegbo E, Udobre A. Enhancement of antimalaria effect of mefloquine by chlorpheniramine. American Journal of Medicine and Medical Sciences. 2017;7: 248-264. 54. Abou-El-Naga IF, Mady RF, Mogahed NMFH. In vitro effectivity of three approved drugs and their synergistic interaction against Leishmania infantum. Biomédica. 2020;40: 89-101.

22 CHAPTER 2:

Determining Pairwise Drug Interactions of Rad51 Inhibitors, B02 and DIDS, with

Metronidazole in Entamoeba histolytica

Rachel E. Hama,b, Lesly A. Temesvaria,b

aDepartment of Biological Sciences, Clemson University, Clemson, SC, USA bEukaryotic Pathogen Innovation Center, Clemson University, Clemson, SC, USA

23 Abstract

Entamoeba histolytica, the causative agent of amebic dysentery, is most often treated clinically with nitroimidazole drugs, such as metronidazole (Flagyl™). Recently, several clinical E. histolytica isolates have demonstrated partial metronidazole resistance. Oral metronidazole is mostly absorbed in the small intestine; thus, achieving a colonic therapeutic concentration requires an extremely high dosage. Enhancing the amebicidal mechanisms of metronidazole, through drug combination therapy, may allow for effective colonic treatment at lower drug concentrations, which would slow the emergence of resistant strains. If the therapeutic dosage could be lowered, unpleasant side effects could also be reduced. Metronidazole may cause amebic death through many pathways, including double strand DNA breakage. These breaks are repaired by native homologous recombinases, such as Rad51. Inhibiting homologous recombination in E. histolytica would prevent recovery from damage induced by metronidazole and may potentiate the action of this drug. To determine if we could lower the effective dosage of metronidazole, we exposed healthy E. histolytica trophozoites to metronidazole combined with small molecule Rad51 inhibitors, either B02 or DIDS. Interestingly, B02 was not cytotoxic and did not consistently alter the IC50 of metronidazole. DIDS was only cytotoxic at high concentrations, but lower concentrations seemed effective in decreasing the IC50 of metronidazole, suggesting that DIDS may be additive or synergistic. Overall, these data may suggest that combination therapy using B02 and metronidazole would not yield more effective treatment than standard metronidazole regimens. These data may

24 also suggest that a combination of DIDS and metronidazole could yield a more effective amebiasis treatment.

Introduction

Entamoeba histolytica, the causative agent of amebiasis, infects 50 million people each year and causes 55,000 deaths annually [1]. Severity of E. histolytica infections ranges from asymptomatic large bowel colonization to extra-intestinal invasion of the brain and liver [2]. Invasive cases cause more adverse patient outcomes. The organism has a biphasic lifecycle: active, virulent trophozoites and environmentally stable cysts. Only cysts can be transmitted, and new infections are mainly acquired through cyst consumption from contaminated water sources [3]. Because of this, amebiasis is more common in countries with substandard water sanitation, which is usually associated with lower socioeconomic status. This has led to underfunded drug research and is one reason for the paucity of antiamebic drugs.

To prevent recurrence of invasive amebic colitis, all disseminated amebae within the tissues must be destroyed. Amebacidal agents fall into two categories: systemic amebacides and luminal amebacides [4]. Systemic amebacides are absorbed in the blood and are active in many tissues, while luminal agents are only active in the intestinal lumen. Luminal agents, including paramomycin, diloxanide furoate, nitazoxanide, and idoquinol, have broad-spectrum antimicrobial activity and are less effective at eliminating disseminated infections [4, 5]. Established systemic agents are currently limited to 5-nitroimidazoles, specifically metronidazole and tinidazole [2]. Metronidazole

25 is the drug of choice for amebiasis because it has high efficacy and is low-cost [4].

Additionally, because metronidazole diffuses into cells and is activated by reduction, it has low host toxicity because reduction only occurs in low oxygen environments [14].

However, metronidazole has lower tissue efficacy for the colon compared with the small intestine and extra-intestinal sites. Metronidazole may not reach therapeutic concentrations in the colon even at extremely high doses [6]. Therefore, clinicians often prescribe a luminal drug regimen with higher colonic efficacy to increase the clearance of lingering tissue-embedded cysts and cellular debris following metronidazole treatment

[7]. However, luminal agents are not effective as monotherapies against invasive amebic colitis [4]. Additionally, increasing the dosage of broad-spectrum antibiotics may destroy the protective intestinal microflora [8]. Therefore, a concurrent combination therapy that enhances metronidazole efficacy at lower colonic concentrations would promote clearance of amebae without reliance on lengthy drug regimens. Such a combination therapy could also eliminate the need for luminal antimicrobials in amebic colitis treatment and reduce spread of resistance in the microflora.

Since E. histolytica is eukaryotic, it is difficult to identify effective drug targets that avoid negative host effects. Development strategies have yielded only one alternative amebicide suitable for treatment of invasive infections, auranofin, a gold-based anti- arthritic drug [9]. However, early clinical trials show that the necessary amebacidal dosage of auranofin may cause too many side effects to be preferentially prescribed for amebiasis [10]. Because few alternative drugs are available, it is critical to extend the

26 lifespan and improve efficacy of metronidazole. This sense of urgency has increased due to several recent clinical isolates of E. histolytica displaying partial resistance to metronidazole [11]. Counteracting resistant infections with increased concentrations may work temporarily, but could ultimately lead to greater drug resistance. Additionally, normal side effects of metronidazole treatment include nausea, headache, metallic taste, dry mouth, and rashes. These are exaggerated in pediatric patients, who are also susceptible to rare but severe neurological events [12, 13]. High standard dosage will likely worsen these side effects for all patients.

Nitroimidazoles may kill amebae by inflicting double-stranded DNA breakage [14, 15,

16]. Inhibiting DNA repair mechanisms, native to E. histolytica, should increase the efficiency of metronidazole by preventing recovery, but few studies have evaluated this assumption. Two different types of DNA repair mechanisms are thought to exist in E. histolytica, non-homologous end-joining (NHEJ) and homologous recombination (HR).

Little is known about NHEJ in this pathogen, but HR has been partially characterized.

For example, E. histolytica possesses Rad51 (EhRad51), a well-conserved eukaryotic recombinase that participates in HR. It is expressed and has recombinase activity in vitro

[17, 18, 19]. In another eukaryotic parasite, Plasmodium falciparum, several small molecule inhibitors can synergize with DNA damaging drugs including artemisinin and chloroquine [20]. These inhibitors are B02 (3-(Phenylmethyl)-2-[(1E)-2-(3- pyridinyl)ethenyl]-4(3H)-quinazolinone) and DIDS (4,4′-diisothiocyanatostilbene-2,2′- disulfonate), and they decrease the in vivo activity of PfRad51. B02 and DIDS also

27 inhibit EhRad51 activity in vitro [21]. Additionally, metronidazole-resistant strains of the bacteria, Helicobacter pylori, overexpress RecA, the prokaryotic homolog of Rad51 [22].

This implies that homologous recombinases contribute to the metronidazole susceptibility of cells. It would seem that further investigations are needed to determine if these inhibitors also enhance the DNA damaging effects of metronidazole in E. histolytica.

Pairwise drug interactions can be classified as either antagonistic, additive, or synergistic.

Antagonism occurs when two drugs prevent the therapeutic effects of each other.

Additivism occurs when the two drugs cause the combined predicted effect for both individual drugs. Synergism occurs when the combination of drugs exceeds the predicted effect of the combination [23]. Certain combinations include an inert agent that has no individual effect, but can potentiate the action of a second drug [24]. These pairwise relationships can be determined mathematically through isobolograms that compare the half maximal inhibitory concentration (IC50), which is calculated through four-parameter logistic (4PL) curve fitting (Figure 2.1). If the drugs are synergistic, there should be a leftwards shift in the IC50 curve (4PL), and the IC50 of agent A should be greater than the

IC50 of agent A in the presence of B [20].

28

Figure 2.1. Isobologram of antagonistic, additive, and synergistic effects of combinations of drugs A and B. Isoboles connect the points of IC50 of each drug. Antagonistic relationships require increased dosage of drugs for the same individual effects, additive effects require the same dosage of drugs for the same individual effects, and synergistic interactions require decreased dosage of drugs for the same individual effects. Image created in BioRender (based on Li et.al. 2016).

29 Combination therapy with conventional metronidazole and a Rad51 inhibitor may be synergistic. Few studies have addressed potentiating metronidazole with DNA repair inhibitors. Oxidative radicals generated by metronidazole may cause lethal DNA damage, but most cytotoxicity is thought to arise from global cellular damage caused at a faster rate [16]. Combination with either Rad51 inhibitor may allow metronidazole to kill cells directly through double strand breakage because lethal DNA damage will accumulate at a rate that surpasses cellular repair capabilities (Figure 2). DNA damage may also block cell replication machinery. Positive pairwise interactions of metronidazole with B02 or

DIDS could result in a lower IC50 for metronidazole and reduce selective pressure for resistant strains of E. histolytica, but this has yet to be established.

Additionally, B02 and DIDS may have different binding sites, so combining both chemicals with metronidazole simultaneously may allow for the same pharmacological effect while reducing host toxicity of high dosages of a single inhibitor [25]. B02 binds directly to human Rad51 and DIDS prevents Rad51-mediated D-loop formation and competes with ssDNA binding [21]. Since both chemicals inhibit EhRad51 and disable

HR, it is hypothesized that E. histolytica DNA would be more highly sensitized to double strand breakage caused by metronidazole in a three-way combination therapy. However, it remains unclear if the inhibitory effects of DIDS and B02 can be compounded and if the binding sites are distinct.

30 Rad51 inhibitors potentiate other DNA damaging drugs by inhibiting HR. For example, artemisinin, an antimalarial compound that causes double stranded DNA breakage, was potentiated by B02 in P. falciparum [20]. Therefore, we examined the pairwise drug interactions of B02 and metronidazole, as well as DIDS and metronidazole. We report that the IC50 of metronidazole against E. histolytica in our system is 11.9 ± 3.98 µM. This is similar other reported IC50 values of the same strain, recently 13.2 µM [26].

Additionally, the IC50 of metronidazole did not show a consistent decrease in the presence of increasing concentrations of B02. These results suggest that B02 does not potentiate metronidazole in the same manner as other DNA damaging agents like artemisinin. Finally, lower concentrations of DIDS lowered the IC50 of metronidazole, which may indicate a positive pairwise interaction at appropriate concentrations.

However, the IC50 of metronidazole increased when treated with higher concentrations of

DIDS, which may indicate an antagonistic relationship through an unknown mechanism.

31 Materials and Methods

Culturing cells in 96 well plates

E. histolytica (strain HM-1:1MSS) trophozoites were cultured axenically in TYI-S33 medium at 37 °C. Cells were passaged into fresh media every 72–96 hours and were grown in 15 mL glass screw cap culture tubes [27]. To harvest cells, these tubes were incubated on ice for 8 minutes to detach cells, and the contents were transferred to 15 mL conical tubes and centrifuged for 5 minutes at 23°C and 500xg. Viable cells were counted through Trypan Blue (VWR, Radnor, PA, USA) exclusion using an automatic cell counter (Luna LB-L10001, Logos Biosystems, Annandale, VA, USA). 2.85 x 104 parasites were inoculated in 280 µL of complete media into each well of a sterile 96-well plate, then plates were covered with SealPlate films (Sigma Aldrich, St. Louis MO, USA) and incubated for 24 hours at 37°C [28]. Each well was examined for ≥ 80% confluency prior to drug exposure.

Determining the IC50 of metronidazole

A two-fold serial dilution of metronidazole (Sigma Aldrich, St. Louis, MO) was created using a 77 mM stock solution dissolved in dimethyl sulfoxide (DMSO; MP Biomedicals,

Solon, OH, USA). Metronidazole was diluted 1.5-fold in DMSO to 51 mM. This stock solution was diluted 10-fold in serum free media (SFM). In a sterile 96-well plate, 30 µL of SFM containing 10% (v/v) DMSO was dispensed in horizontal rows of 11 wells.

Thirty uL of metronidazole, diluted in SFM, was added to the first well, mixed via pipetting, and 30 uL was transferred to the next well. This was repeated sequentially for

32 all remaining wells in the row, resulting with 60 µL in the final well. Thirty µL was removed and discarded from this well [29].

The growth media over cells grown in 96 well plates was aspirated with a multichannel pipette and replaced with 260 µL of SFM. Twenty µL of each serial drug dilution was transferred to individual wells in triplicate, bringing the total well volume to 280 µL.

Plates were covered with fresh SealPlate films and incubated 4 hours at 37°C. After incubation, the drug treatment media was aspirated and replaced with SFM containing 20

µg/mL fluorescein diacetate (FDA; Sigma Aldrich). Plates were covered with SealPlate films and incubated for 30 minutes at 37°C. FDA-SFM was removed and replaced with

100 µL of 1X PBS [28]. Fluorescence output was quantified at 490 nm excitation and 526 nm emission with a plate reader (Synergy H1 Hybrid Reader, BioTek, Winooski, VT).

Results were fit to four parameter logistic curves to estimate IC50 values (Gen5, version

5.09, BioTek, USA).

Assessing IC50 values of metronidazole in combination with B02

A two-fold serial dilution of metronidazole was created as described previously. B02

(Millipore Sigma, Burlington, MA, USA) was diluted 24-fold to 420 µM with DMSO from a 10 mM stock solution dissolved in DMSO. The 420 µM stock was diluted 5-fold in SFM (84 µM).

33 Cells were grown in 96-well plates, then the growth media was aspirated with a multichannel pipette and replaced with 250 µL of SFM. Twenty µL of each serial metronidazole dilution was transferred to individual wells in triplicate, bringing the total well volume to 270 µL. Ten µL of diluted 84 µM B02 SFM was added to each well, for a final concentration of 3 µM B02 delivered in 2 µL DMSO. Plates were covered with fresh SealPlate films and incubated 4 hours at 37°C. After incubation, the drug treatment media was aspirated and replaced with SFM containing 20 µg/mL FDA. FDA viability assay was performed as described previously. Results were fit to four parameter logistic curves to estimate IC50 values (Gen5).The 10 mM B02 stock was also diluted 12-fold and 6-fold to 840 µM and 1680 µM, respectively. These dilutions yielded final treatment concentrations of 6 µM and 12 µM.

Analyzing cell lysate fluorescence when treated with B02

E. histolytica trophozoites were grown in 15 mL tubes for 72 hours and harvested as described above. Viable cells were counted and diluted in 1 mL serum free media to a concentration of 1.7 x 106 parasites/mL. The cell suspension was poured into a syringe fitted with a filter holder containing two 8-µm polycarbonate filters (Poretics, Livermore,

CA) stacked on top of one another. The cells were forced through the filters with the plunger, creating a homogenous lysate [30]. The lysate was diluted with serum free media to contain the equivalent of 3.7 x 105 cells/mL. Two hundred and seventy uL of lysate was dispensed into each well, providing 1.0 x 105 lysed cells per well. Two hundred and seventy uL of serum free media was also dispensed to the same number of

34 wells as a negative control. 10 mM B02 was diluted 12-fold, 18-fold, and 24-fold in

DMSO to 840 uM, 630 uM, and 420 uM, respectively. These drug stocks were diluted 5- fold in serum free media, and 10 uL of each drug solution was added to six wells, three containing lysate and three negative controls. The final concentrations of B02 in wells were 6 uM, 4.5 uM, and 3 uM, delivered in 2 uL DMSO to 280 uL total well volume.

Plates were covered with SealPlate films and incubated 4 hours at 37°C, then films were removed and fluorescent output was detected with a plate reader at 490 nm excitation and

526 nm emission wavelengths.

Assessing IC50 values of metronidazole in combination with DIDS

A two-fold serial dilution of metronidazole was created as described previously. DIDS

(Millipore Sigma) was diluted 7-fold to 2860 µM with DMSO from a 20 mM stock solution dissolved in DMSO. The 2860 µM stock was diluted 5-fold in SFM (572 µM).

Cells were grown in 96-well plates, then the growth media was aspirated with a multichannel pipette and replaced with 250 µL of SFM. Twenty µL of each serial metronidazole dilution was transferred to individual wells in triplicate, bringing the total well volume to 270 µL. Ten µL of diluted 572 µM DIDS SFM was added to each well, for a final concentration of 20 µM DIDS delivered in 2 µL DMSO. Plates were covered with fresh SealPlate films and incubated 4 hours at 37°C. After incubation, the drug treatment media was aspirated and replaced with SFM containing 20 µg/mL FDA. FDA viability assay was performed as described previously. Results were fit to four parameter logistic curves to estimate IC50 values (Gen5).

35 Results

Figure 2.2. Proposed mechanism of drug synergy between metronidazole and B02 in E. histolytica. After metronidazole diffuses into the cell, it is reduced into harmful radicals. These radicals cause oxidative damage to proteins and other cellular components, leading to cell death. In addition, the radicals inflict double strand DNA breakage. Normally, the breakages are repaired through homologous recombination (HR) mediated by Rad51 and other recombinases, leading to cell recovery. B02 inhibits Rad51, so the double stranded breaks linger and cause more cell death than metronidazole alone. Image created with ChemDraw (v. 19.1, PerkinElmer, Waltham, MA, USA) and BioRender (Toronto, ON, Canada).

36 Figure 2.2 depicts the possible synergistic effects of metronidazole and B02. Under anaerobic conditions, metronidazole is reduced into radicals after diffusing into cells, and the radicals inflict double stranded DNA breaks. E. histolytica repairs double stranded breaks through homologous recombination, including the recombinase, Rad51. B02 inhibits action of Rad51, allowing DNA damage to accumulate. The damage may be repaired through error prone mechanisms, increasing mutation rate and activating cell death. Normally, double strand DNA damage will not directly kill cells treated with metronidazole [16], but adding B02 inhibition may increase the likelihood of death through these means. Metronidazole-induced redox damage to non-DNA cellular components will not be inhibited by B02.

37

Figure 2.3. Assessing FDA as a tool for tracking viability in E. histolytica cells. A. Parasite viability estimation comparing two staining methods: fluorescein diacetate (FDA) and Trypan blue. Healthy cells were treated for 1 hour with 10% DMSO by volume, then quantified with one of two methods. B. Relationship between living parasites and FDA signal output (relative fluorescent units). Four different quantities of cells were seeded in plates, grown for 24 hours, and exposed to FDA for 30 min. Fluorescent output shows a logarithmic pattern of signal production. The data represent the mean +/- standard deviation of n ≥ 3 biological replicates.

38 Fluorescein diacetate (FDA) is a membrane permeable vital stain that is converted into fluorescein by viable cells. Therefore, higher numbers of viable cells yield higher fluorescent outputs [31]. To determine if FDA was a viable alternative method of tracking cell viability, we treated cells with 10 % (v/v) DMSO and measured viability using both our standard protocol of Trypan blue exclusion [32] and experimental FDA staining protocols. Figure 2.3 shows that FDA cell viability staining is a valid alternative approach to quantifying the number of living ameba after exposure to damaging agents.

In particular, after one-hour exposure to 10% (v/v) DMSO, 15-20% of the cells died. The differences between cell counts using either Trypan blue or FDA were negligible and fell within the range of error. Importantly, the RFU output increased logarithmically correlated to the number of living cells. As the number of viable cell increased, more

FDA was cleaved into fluorescent byproducts (Figure 3). At a certain point, the number of cells likely exceeded the availability of FDA molecules, or the cells became overcrowded in the well. Within the linear range of this curve, RFU output was an appropriate quantification tool of cell viability.

39 D). 50% IC Trial RFU 50 R2 (µM) output

1 4823 9.772 0.794

2 19788 12.918 0.722

3 494447 8.263 0.868 Mean 11.9 ± - - ±SD 3.98 A).

Figure 2.4. Determination of metronidazole IC50. A-C. Drug response curves for metronidazole. E. histolytica trophozoites grown in 96 well plates were exposed to two- fold serial dilutions of metronidazole ranging from 0.36- 374 µM for 4 hours. Remaining cells were incubated with FDA to quantify viability. Fluorescence was recorded in relative fluorescent B). units (R FU). Results were plotted as four parameter logistic (4PL) curves to estimate IC50 values (Gen5, version 5.09, BioTek, USA). D. 4PL estimation values of IC50 for individual trials. Triplicate experiments revealed the IC50 of metronidazole is 11.9 ± 3.98 µM. These data represent the mean +/-

C).

40 To determine the IC50 of metronidazole against E. histolytica cells grown in 96 well plates, we treated cells with a range of drug concentrations from 0.37 µM to 370 µM and quantified survival with FDA staining. Figure 2.4 displays three representative survival curves from a range of metronidazole concentrations against E. histolytica. The four- parameter logistic curve model produced expected sigmoidal curves typical of drug response patterns. Each trial produced two clusters, an upper group as well as a lower group. The upper group emerged from more dilute drug exposure, where less of the agent was present to inflict cell damage. The higher concentrations caused extensive cell death, which led to the formation of the lower group. The linear portion between these two groups revealed that the IC50 of metronidazole was 11.9 ± 3.98 µM, comparable to the literature reference range of 9.5 - 30 µM [26]. Additionally, the R2 values for all curves were greater than 0.7, which indicates that the separate data points fit well to the sigmoidal function.

41

Figure 2.5. Distinguishing the mode of interaction of both DIDS and B02 combined with the IC50 of metronidazole. Viability of cells treated with various concentrations of DIDS and B02. A. Cells were incubated for 4 hours with 2-80 µM DIDS+ 12µM met. B. Cells were incubated for 4 hours with 1-20 µM B02+ 12µM met. Remaining cells were incubated with FDA to quantify viability. Fluorescence was recorded in relative fluorescent units (RFU). 100% viability was set with cells incubated in DMSO. These data represent the mean +/- standard deviation of n ≥ 3 technical replicates.

42 To determine if DIDS or B02 were cytotoxic agents, we treated the cells with various concentrations of each drug separately and in combination with metronidazole. DIDS without metronidazole exhibited cytoxicity at 80 uM, but did not affect cell viability at lower concentrations (Figure 2.5). However, DIDS lowered the IC50 of metronidazole at these same concentrations, indicating a potential positive interaction. In contrast, B02 did not appear to be cytotoxic as a single agent. When cells were treated with B02 without metronidazole, the apparent viability was consistently above 100% set with DMSO and did not vary greatly between concentrations (Figure 2.5). This may indicate B02 potentiates metronidazole rather than producing synergy. Additionally, when B02 concentrations were higher, the fluorescent output was elevated in both control cells and cells treated with metronidazole, indicating either potential antagonism with metronidazole at higher B02 concentrations or excessive fluorescence unrelated to viability.

43 Table 2.1. Change in metronidazole IC50 with different concentrations of Rad51 inhibitors. A set concentration of either B02 or DIDS was added to each well in addition to the serial dilution of metronidazole ranging from 0.37-374 µM. Cells were incubated with both drugs for 4 hours, then media was replaced with FDA diluted in media to quantify viability. IC50 of metronidazole was calculated through 4PL sigmoidal curve estimations (Gen5). These data represent the mean +/- standard deviation of n ≥ 3 technical replicates.

2 Drug Treatment Trial IC50 of Metronidazole R DMSO Control 11.9 ± 3.98 µM - 3 µM B02 1 159.1 µM 0.721 2 33.0 µM 0.932 3 33.3 µM 0.866 Mean ±SD 75.11 ± 72.7 µM - 6 µM B02 1 2.6 µM 0.749 2 8.5 µM 0.803 3 156.4 µM 0.869 Mean ±SD 5.55 ± 4.18 µM - 12 µM B02 21.3 µM 0.909 41.1 µM 0.953 48.2 µM 0.931 Mean ±SD 73.27 ± 130.22 µM - 10 uM DIDS 1 7.15 µM 0.554 2 0.53 µM 0.746 3 2.6 µM 0.931 Mean ±SD 3.42 ± 3.39 µM - 20 uM DIDS 1 81.1 µM 0.966 2 19.8 µM 0.865 3 41.7 µM 0.901 Mean ±SD 19.98 ± 26.16 µM -

44 To determine if B02 or DIDS has an additive or synergistic relationship with metronidazole, we treated the cells again with a serial dilution of metronidazole in the presence of constant concentrations of B02 at 3 µM, 6 µM, or 12 µM or DIDS at 10 µM or 20 µM, and quantified viability with FDA (Table 2.1). The four-parameter logistic curve model did not produce accurate sigmoidal curves for B02, and the calculated

2 metronidazole IC50 values had wide margins of error, as demonstrated by instances of R

< 0.7 and high standard deviation values. Additionally, several of the B02 replicates showed higher fluorescent output when exposed to the combination of metronidazole and

B02 than the DMSO controls, which again suggests that some fluorescence may have been unrelated to cell viability. DIDS lowered the IC50 of metronidazole at 10 µM, suggesting a positive pairwise relationship. However, higher concentrations of DIDS did not consistently lower the IC50, indicating these concentrations lie outside the therapeutic range. The 4PL curves were better approximations at higher drug concentrations for both

B02 and DIDS as indicated by R2 > 0.9. Full data sets are shown in Supplemental Table

2.1.

45

Figure 2.6. Relative fluorescent output of cells treated with either 3 µM B02 or DMSO control. Cells were exposed to either 3 µM B02 or 1.5% v/v DMSO control for 4 hours. After treatments, both populations were rinsed and incubated with FDA for 30 minutes and quantified with a plate reader. Fluorescent output of cells exposed to B02 was more intense. These data represent the mean of 3 technical replicates.

46 To determine if the higher fluorescent output, from the cells treated with a combination of B02 and metronidazole, was representative of higher cell viability, we treated cells with either 3 µM B02 or 1.5% (v/v) DMSO (control) for 4 hours (Figure 2.6). When exposed to B02 alone, the cells produced a higher FDA-fluorescent signal than DMSO alone. Sterile FDA dissolved in DMSO does not show higher fluorescent output than plain DMSO (Ham 2020, data not shown). This might indicate that prolonged exposure to B02 produces a fluorescent signal unrelated to FDA viability staining.

47

Figure 2.7. Relative fluorescent output of cell lysate treated with various concentrations of B02. Cells were mechanically lysed with polycarbonate filters, and homogenized lysate was divided into a 96-well plate. Lysate aliquots were treated with a range of B02 concentrations for 4 hours with serum free media controls. After incubation, fluorescence was quantified with a plate reader. No difference was seen between fluorescent output of lysate and serum free media. The data represent the mean +/- standard deviation of 3 technical replicates.

48 Because cells treated with B02 produced a higher fluorescent signal than the DMSO treated counterparts, we lysed cells and treated the lysate with several concentrations of

B02 to determine if B02 was interacting with cellular components to create a fluorescent byproduct (Figure 2.7). Because the cells were mechanically lysed, the lysates remained enzymatically active. There was no marked increase in fluorescent output of lysates compared to sterile media controls. This indicates that intracellular enzymes, in the context of a lysate, are not responsible for altering the structure of B02 and increasing fluorescent output at FDA detection wavelengths.

49 Supplemental Table 2.1. Change in metronidazole IC50 in the presence of different concentrations of Rad51 inhibitors. A set concentration of B02 or DIDS was added to each well in addition to the serial dilution of metronidazole ranging from 0.37-374 µM. Cells were incubated with both drugs for 4 hours, then media was replaced with FDA diluted in media to quantify viability. These data represent the mean +/- standard deviation of n ≥ 3 technical replicates. 2 Drug Treatment Trial IC50 of Metronidazole R 3 µM B02 1 159.1 µM 0.721 2 33.0 µM 0.932 3 33.3 µM 0.866 Mean ±SD 75.11 ± 72.7 µM - 6 µM B02 1 2.6 µM 0.749 2 8.5 µM 0.803 3 156.4 µM 0.869 Mean ±SD 5.55 ± 4.18 µM - 12 µM B02 1 21.3 µM 0.909 2 41.1 µM 0.953 3 48.2 µM 0.931 4 392.7 µM 0.783 5 12.3 µM 0.750 6 0.60 µM 0.868 7 21.4 µM 0.822 8 48.9 µM 0.881 Mean ±SD 73.27 ± 130.22 µM - 10 uM DIDS 1 7.15 µM 0.554 2 0.53 µM 0.746 3 2.6 µM 0.931 Mean ±SD 3.42 ± 3.39 µM - 20 uM DIDS 1 81.1 µM 0.966 2 19.8 µM 0.865 3 7.4 µM 0.789 4 12.3 µM 0.918 5 0.23 µM 0.285 6 0.35 µM 0.409 7 10.0 µM 0.63 8 6.8 µM 0.939 9 41.7 µM 0.901 Mean ±SD 19.98 ± 26.16 µM -

50 Discussion

In this study we have shown that the IC50 of metronidazole in our system is 11.9 µM.

This value is comparable to other drug studies evaluating the IC50 of metronidazole against this strain of E. histolytica [26, 33]. We have also established that fluorescein diacetate staining of E. histolytica is a valid viability approximation comparable to

Trypan blue. To our surprise, we found that B02 does not synergize with metronidazole to reduce its IC50, since there is no consistent decrease or a leftward shift in the sigmoidal curve as would be expected [23]. To our knowledge this is the first study to test pairwise drug interactions between B02 and metronidazole in E. histolytica. Additionally, we found that DIDS possibly synergized with metronidazole at lower concentrations, with potential antagonism at higher concentrations.

One explanation for a putative lack of interaction between B02 and metronidazole is that metronidazole does not cause double strand breakage in E. histolytica and its other cytotoxic effects are responsible for all antiamebic action. Double strand breakage in the presence of metronidazole has not been demonstrated in E. histolytica, only in metronidazole-susceptible bacteria [16]. A second explanation is that B02 does not inhibit EhRad51 in vivo.

Because the cellular fluorescent signal increased dramatically after prolonged exposure to

B02, even at low concentrations, this might indicate that cellular uptake of B02 leads to an alteration in its chemical structure resulting in a fluorescent byproduct. If B02

51 byproducts are contributing to the fluorescent output, this might obscure the viability signal from FDA, which confounds the assay. When we treated trophozoite lysate with

B02 to evaluate potential enzymatic alteration, the fluorescent output did not increase, indicating that the higher signal was not produced by intercellular changes to B02. The lysate was created with mechanical stress to prevent denaturation of enzymes. This might indicate that B02 structure is changed as it crosses the cell membrane. To further understand the cellular interaction with B02, we could treat live trophozoites with B02 for 4 hours, harvest and mechanically lyse cells, fractionate the lysate, isolate the responsible fluorescent compound, and characterize it through analytical techniques [Dr.

Daniel Whitehead, Dept. of Chemistry, Clemson University, personal communication].

To overcome this fluorescent interference, we could modify the colorimetric tetrazolium viability assay previously adapted for E. histolytica [34]. This assay measures viability through absorbance at wavelengths unrelated to the excitation and emission range of

FDA and potential B02 byproducts.

Because DIDS has been previously established as an inhibitor of EhRad51 in vitro [17], an additive or synergistic interaction with metronidazole would indicate that Rad51 is directly involved in metronidazole response. Our data showed that higher concentrations of DIDS antagonized metronidazole and may have caused metronidazole to be less effective. However, lower concentrations of DIDS may have increased the effectiveness of metronidazole, indicating a positive pairwise interaction. Because DIDS functions as a voltage dependent anion channel (VDAC) blocker in mammalian cells, it may have a

52 broad range of cytotoxic effects in addition to Rad51 inhibition [35, 36]. However, E. histolytica lacks genes for VDACs, relying instead on lineage-specific trans-membrane

β barrel transporters that are structurally distinct from other eukaryotes [37, 38].

Therefore, it is likely that DIDS has higher specificity to Rad51 in E. histolytica than in other eukaryotic cell lines. The mechanism of negative interaction between high concentrations metronidazole and DIDS remains unclear.

DIDS was cytotoxic at high concentrations, while B02 did not appear to cause amebic death as a single agent. Because DIDS can potentially be used as a single agent, we could further examine its pairwise interactions with metronidazole using a checkerboard assay

[29]. This would allow us to differentiate between an additive or synergistic relationship and would reveal the ideal concentrations of a combination therapy.

Cells treated with DIDS did not produce excessive fluorescent signal at the same wavelength as FDA treated cells, so the IC50 values were accurately detected with the viability assay. A three-way combination of B02, DIDS, and metronidazole may induce similar pharmacological effects while reducing host toxicity of high dosages of a single agent. Combining all three chemicals at their established IC50 concentrations may reveal greater reduction of viable cells. Additionally, we could use a checkerboard method developed to detect interactions between three agents to determine if a three-way combination is advantageous [29].

53 We used a high throughput 96-well-based assay. Advantages of such high throughput viability screening include increased sample size and higher efficiency and accuracy.

However, cells are not visualized after drug treatments, so the relative health of the cells could not be evaluated. This is one shortcoming of our study that could be overcome with microscopy in the future.

Our study design assumes that the drugs are amebacidal and kill cells rather than prevent cell division. However, some effects of metronidazole and the combination treatments may require longer exposure duration than four hours to be detectable, so synergy may be concealed under current experimental conditions. Additionally, the mechanism of B02 may be static, as it can prevent cells with DNA damage from replicating [20]. Treating actively growing amebae with metronidazole, B02, or the combination for 48 hours may allow detection of static drug effects. It may also provide individual IC50 values for each agent separately, allowing direct comparison of the combination with the fractional IC50

(FIC). If these values can be uncovered, we could define the class of pairwise drug interaction for the combination therapy. If the relationship between B02 and metronidazole is either additive or synergistic, then combination therapy can be implemented with a lower IC50 dosage of metronidazole, regardless of whether B02 is static or cidal. If B02 proves to be static, it may still contribute to an effective combination therapy.

54 Acknowledgements

The authors would like to thank the members of the Temesvari lab for technical assistance in completing this project. A special thanks to Dr. Michael Sehorn,

Department of Genetics and Biochemistry at Clemson University, for donating the human

Rad51 antibody. Additional thanks to Ms. Jillian Milanes and Mr. Eli Harding (Dr. James

Morris lab, Clemson University) for training in Prism and Gen5 software to calculate IC50 values.

Financial support for this work was provided by NIH COBRE GM10904, awarded to Dr.

Lesly Temesvari. The funding agency had no role in the study design, data collection and analysis, or manuscript preparation. This content is the responsibility of the authors and does not necessarily represent the views of the National Institutes of Health. Additional funding was provided by the Clemson University Department of Biological Sciences through a Teaching Assistantship.

55 Literature Cited

1. Walsh JA. 1986. Problems in recognition and diagnosis of amebiasis: estimation of the global magnitude of morbidity and mortality. Rev Infect Dis. 8:228-238. 2. Shirley DT, Farr L, Watanabe K, Moonah S. 2018. A review of the global burden, new diagnostics, and current therapeutics for amebiasis. Open Forum Infect Dis. 5(7): ofy161 3. Debnath A, Rodriguez MA, Ankri S. 2019. Recent progresses in amebiasis. Front Cell Infect Microbiol. 9:247. 4. Carrero, JC, Reyes-López, M, Serrano-Luna, J, Shibayama, M, Unzueta, J, León- Sicairos, N, de la Garza, M. 2020. Intestinal amoebiasis: 160 years of its first detection and still remains as a health problem in developing countries. Int J Med Microbiol. 310:151358. 5. Stanley, SL. 2003. Amoebiasis. Lancet. 361:1025-1034 6. Haque, R, Huston, CD, Hughes, M, Houpt, E, Petri Jr, WA. 2003. Amebiasis. N Engl J Med. 348:1565-1573. 7. Gonzales ML, Dans LF, Sio‐Aguilar J. 2019. Antiamoebic drugs for treating amoebic colitis. Cochrane Database Syst Rev. 1(1):CD006085 8. Kedia, S, Rampal, R, Paul, J, Ahuja, V. 2016. Gut microbiome diversity in acute infective and chronic inflammatory gastrointestinal diseases in North India. J Gastroenterol. 51:660-671. 9. Debnath A, Parsonage D, Andrade RM, He C, Cobo ER, Hirata K, Chen S, García-Rivera G, Orozco E, Martínez MB, Gunatilleke SS. 2012. A high-throughput drug screen for Entamoeba histolytica identifies a new lead and target. Nat Med. 18(6):956-960. 10. Capparelli EV, Bricker-Ford R, Rogers MJ, McKerrow JH, Reed SL. 2017. Phase I clinical trial results of auranofin, a novel antiparasitic agent. J Antimicrob Chemother. 61(1):e01947-16. 11. Iyer LR, Banyal N, Naik S, Paul J. 2017. Antioxidant enzyme profile of two clinical isolates of Entamoeba histolytica varying in sensitivity to antiamoebic drugs. World J Clin Infect. Dis. 7:21-31. 12. Bouraoui R, Limaiem R, Bouladi M, Mghaieth F, El LM. 2016. Neuro-ophthalmic adverse effects of metronidazole treatment in children: Two case studies. Arch pediatr. 23:167-70. 13. Yazdani RM, Kayfan S, Cao J, Clarke RL, Pfeifer CM. 2019. MRI findings of metronidazole neurotoxicity in a pediatric patient with chronic diarrhea. J Radiol Case Rep. 14:75-78. 14. Leitsch D. 2017. A review on metronidazole: an old warhorse in antimicrobial chemotherapy. Parasitology. 146:1167-1178 15. Ceruelos AH, Romero-Quezada LC, Ledezma JR, Contreras LL. 2019. Therapeutic uses of metronidazole and its side effects: an update. Eur Rev Med Pharmacol Sci. 23(1):397-401. 16. Dingsdag, SA, Hunter, N. 2018. Metronidazole: an update on metabolism, structural cytotoxicity and resistance mechanisms. J Antimicrob Chemother. 73:265-279.

56 17. Kelso AA, Goodson SD, Chavan S, Say AF, Turchick A, Sharma D, Ledford LL, Ratterman E, Leskoske K, King AV. 2016. Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase. Mol Biochem Parasitol. 210:71-84. 18. Singh N, Bhattacharya A, Bhattacharya S. 2013. Homologous recombination occurs in Entamoeba and is enhanced during growth stress and stage conversion. PLoS One. 8:e74465. 19. Shabardina, V, Kischka, T, Kmita, H, Suzuki, Y, Makałowski, W. 2018. Environmental adaptation of Acanthamoeba castellanii and Entamoeba histolytica at genome level as seen by comparative genomic analysis. Int J Biol Sci. 14:306. 20. Vydyam P, Dutta D, Sutram N, Bhattacharyya S, Bhattacharyya MK. 2019. A small-molecule inhibitor of the DNA recombinase Rad51 from Plasmodium falciparum synergizes with the antimalarial drugs artemisinin and chloroquine. J Biol Chem. 294:8171-8183. 21. Kelso, AA, Say, AF, Sharma, D, Ledford, LL, Turchick, A, Saski, CA, King, AV, Attaway, CC, Temesvari, LA, Sehorn, MG. 2015. Entamoeba histolytica Dmc1 catalyzes homologous DNA pairing and strand exchange that is stimulated by calcium and Hop2-Mnd1. PloS One. 10:e0139399. 22. Land, KM, Johnson, PJ. 1999. Molecular basis of metronidazole resistance in pathogenic bacteria and protozoa. Drug Resist Updat. 2:289-294. 23. Chan GK, Wilson S, Schmidt S, Moffat JG. 2016. Unlocking the potential of high- throughput drug combination assays using acoustic dispensing. J Lab Autom. 21(1):125- 32. 24. Li R, Chen J, Cesario TC, Wang X, Yuan JS, Rentzepis PM. 2016. Synergistic reaction of silver nitrate, silver nanoparticles, and methylene blue against bacteria. Proc Natl Acad Sci USA. 113(48):13612-7. 25. Budke, B, Lv, W, Kozikowski, AP, Connell, PP. 2016. Recent developments using small molecules to target RAD51: how to best modulate RAD51 for anticancer therapy? ChemMedChem. 11:2468-2473. 26. Bansal D, Sehgal R, Chawla Y, Mahajan RC, Malla N. 2004. In vitro activity of antiamoebic drugs against clinical isolates of Entamoeba histolytica and Entamoeba dispar. Ann Clin Microbiol Antimicrob. 3(1):27. 27. Diamond, LS, Harlow, DR, and Cunnick, CC. 1978. A new medium for the axenic cultivation of Entamoeba histolytica and other Entamoeba. Trans R Soc Trop Med Hyg 72(4): 431-432. 28. Ehrenkaufer, GM, Suresh, S, Solow-Cordero, D, Singh, U. 2018. High-throughput screening of Entamoeba identifies compounds which target both life cycle stages and which are effective against metronidazole resistant parasites. Front Cell Infect Microbiol. 8:276. 29. Cokol-Cakmak, M, Feray B, Selim C, and Cokol, M. 2018. Diagonal Method to Measure Synergy Among Any Number of Drugs. J Vis Exp. 136: e57713. 30. Temesvari, LA, Harris, EN, Stanley Jr, SL, Cardelli, JA. 1999. Early and late endosomal compartments of Entamoeba histolytica are enriched in cysteine proteases,

57 acid phosphatase and several Ras-related Rab GTPases. Mol Biochem Parasitol. 103:225- 241. 31. Medzon, EL, Brady, ML. 1969. Direct measurement of acetylesterase in living protist cells. J Bacteriol. 97:402-415. 32. Byekova, YA, Powell, RR, Welter, BH, Temesvari, LA. 2010. Localization of phosphatidylinositol (3, 4, 5)-trisphosphate to phagosomes in Entamoeba histolytica achieved using glutathione S-transferase-and green fluorescent protein-tagged lipid biosensors. Infect Immun. 78:125-137. 33. Upcroft, P, Upcroft, JA. 2001. Drug targets and mechanisms of resistance in the anaerobic protozoa. Clin Microbiol Rev. 14:150-164. 34. Cedillo-Rivera, R, Ramirez, A, Munoz, O. 1992. A rapid colorimetric assay with the tetrazolium salt MTT and phenazine methosulfate (PMS) for viability of Entamoeba histolytica. Arch Med Res. 23:59-61. 35. Dinnen, RD, Mao, Y, Qiu, W, Cassai, N, Slavkovich, VN, Nichols, G, Su, GH, Brandt-Rauf, P, Fine, RL. 2013. Redirecting apoptosis to aponecrosis induces selective cytotoxicity to pancreatic cancer cells through increased ROS, decline in ATP levels, and VDAC. Mol Cancer Ther. 12:2792-2803. 36. George, K, Thomas, NS, Malathi, R. 2020. 4, 4’-Diisothiocyanatostilbene-2, 2’- disulfonate modulates voltage-gated K current and influences cell cycle arrest in androgen sensitive and insensitive human prostate cancer cell lines. Toxicol Mech Methods. 30(5):358-369. 37. Santos, HJ, Imai, K, Makiuchi, T, Tomii, K, Horton, P, Nozawa, A, Okada, K, Tozawa, Y, Nozaki, T. 2019. Novel lineagespecific transmembrane beta barrel proteins in the endoplasmic reticulum of Entamoeba histolytica. FEBS J. 286:3416-3432. 38. Makiuchi, T, Mi-ichi, F, Nozaki, T. 2015. Mitosomes in Entamoeba histolytica, p. 305-327. In Amebiasis. Springer.

58 CHAPTER 3:

Characterizing the roles of homologous recombinases Rad51 and Dmc1 in Entamoeba

histolytica

Rachel E. Hama,b, Lesly A. Temesvaria,b

aDepartment of Biological Sciences, Clemson University, Clemson, SC, USA

bEukaryotic Pathogen Innovation Center, Clemson University, Clemson, SC, USA

59 Abstract

Entamoeba histolytica is the causative agent of amebic dysentery and is prevalent in developing countries. It has a biphasic lifecycle: active, virulent trophozoites and dormant, environmentally-stable cysts. Only cysts are capable of establishing new infections, and are spread by fecal deposition. Many unknown factors influence stage conversion, and synchronous encystation of E. histolytica is not currently possible in vitro. Rad51 and Dmc1, homologous DNA recombinases involved in double stranded

DNA repair and meiotic recombination, are expressed in E. histolytica. The physiological roles of these two proteins are unknown, although their recombinase activity has been authenticated in vitro. Both Rad51 and Dmc1 are upregulated during encystation of

Entamoeba invadens, an in vitro model of encystation. To gain insight into the physiological roles of Rad51 and Dmc1 in E. histolytica, we developed two knockdown cell lines using the RNAi-mediated Trigger approach. We transfected healthy trophozoites with gene-specific Trigger plasmid constructs and verified knockdown status using RT-PCR and western blots. Neither Rad51 nor Dmc1 was consistently knocked down in Trigger transfected cell lines, suggesting that expression of these genes cannot be reduced through Trigger RNAi methodology. Additionally, cell lines harboring the Trigger plasmid with Dmc1 did not survive selection, which may indicate that Dmc1 knockdown is lethal in E. histolytica trophozoites. Lack of Trigger specific knockdowns add to a growing body of evidence that the Trigger RNAi approach can only knockdown a subset of E. histolytica genes.

60 Introduction

Entamoeba histolytica infects 10% of the world population and causes up to 55,000 deaths annually [1]. E. histolytica is the waterborne etiological agent of many diseases, including acute amebic dysentery, chronic localized intestinal amebiasis, chronic non- dysenteric colitis, and amebic liver abscesses [2]. However, upwards of 95% of cases result in asymptomatic intestinal infections, which leads to unmitigated spread in communities with poor water sanitation. Additionally, asymptomatic patients remain carriers for several months [3, 4].

E. histolytica has a biphasic life cycle and alternates between active, virulent trophozoites and dormant, infectious cysts. Environmentally hardy cysts cause new infections when they are ingested by a human host. Upon reaching the small intestine, the cysts convert to motile trophozoites and rapidly proliferate within the small intestine and colon [5]. In rare cases, trophozoites escape intestinal tissues and disseminate to other sites in the body including the liver, lungs, and brain. Trophozoites are capable of inflicting damage to host cells as well as inciting an inflammatory immune response. When the infection is established, a portion of the colonic trophozoite population encysts and these cysts are deposited in fecal material. Any trophozoites that exit the body through feces die within

24 hours. Because humans and non-human primates are the sole reservoirs for E. histolytica, prevention of cyst formation and deposition would quickly limit transmission and establishment of new infections.

61 Both encystation and excystation are poorly understood in E. histolytica. Cellular mechanisms and environmental signals causing stage conversion remain unknown.

Additionally, physiological differences between trohpozoites and cysts are only partially characterized, because E. histolytica does not readily encyst in vitro. Cysts must be collected from clinical samples for characterization. Mature infectious cysts are tetranucleated and are surrounded by a thick chitin wall [6]. Immature cysts have been induced in vitro, so early features of stage conversion can be partially studied [7].

However, later stages of cyst maturation cannot be studied without clinical isolates.

Instead, Entamoeba invadens, a related species that infects reptiles, serves as an encystation model because it encysts in axenic conditions in vitro [8]. Transcriptomic analysis of encysting E. invadens revealed distinct expression profiles between both stages, indicating higher expression of homologous recombinases and meiotic genes in encysting cells [9]. Additionally, homologous recombination is increased during both encystation and excystation in E. invadens [10]. Little is known about the role of homologous recombinases or meiotic proteins in Entamoeba virulence or encystation.

According to transcriptomic data, widespread expression of DNA replication machinery increases at the same time point as upregulation of homologous recombinases and meiotic genes in E. invadens, which might indicate genomic recombination between nuclei or daughter cells [8, 11]. Both E. invadens and E. histolytica trophozoites are uninucleate and mature cysts are tetranucleate. DNA polymerase levels are increased during early stage conversion in E. invadens, indicating that genome copying occurs

62 during encystation, but before cysts are mature [12]. However, genome replication is difficult to assess in Entamoeba species because ploidy is unknown [11]. If uninucleated trophozoites have many genome copies, replication may not be necessary to redistribute the copies to tetranucleated cysts. Furthermore, trophozoite division is uneven and leads to anucleate, uninucleate, and binucleate daughter cells, complicating the relationship between genomic replication and stage conversion [13]. If DNA replication occurs during stage conversion, this provides a potential role for meiotic recombinases, since these facilitate genetic recombination between sister chromatids during meiotic ploidy increases.

Meiotic DNA binding proteins may contribute to redistribution of genetic material during encystation; however, the possibility of a sexual lifecycle in E. histolytica cannot be ruled out. Whole genome analysis of several clinically isolated strains indicate previous genomic recombination events related to a sexual lifecycle [14]. Furthermore, the persistence of meiotic gene groups in current members of the Amoebozoa family may indicate that Entamoeba precursors were ancestrally sexual [10, 15, 16, 17, 18]. Because trophozoites replicate asexually by binary fission, laboratory strains can remain viable while masking any potential sexual phase. Other single cell parasites harbor cryptic sexual lifecycles and display unisexual mating, including Giardia lamblia, Leishmania major, and Toxoplasma gondii [19], indicating possible sexual pathways in E. histolytica and other amebic species. Alternatively, meiotic genes may have been repurposed for genetic redistribution during encystation. This may provide cysts with an evolutionary

63 advantage through increased genetic diversity and fitness of excysting descendants without the energy cost of meiosis [20]. Because meiotic recombinase activity in E. histolytica may increase genetic diversification, emergent drug resistance genes may be spread more rapidly [21, 22]. Sexual and parasexual lifecycles have been recently uncovered in multidrug resistant fungal pathogens, and these genetic recombination events have increased dispersion of resistance genes among strains [23]. Inhibiting meiotic homologous recombination may limit emergence of multidrug resistant populations of E. histolytica.

We chose to characterize the physiological roles of two representative homologous recombinases to determine their significance in E. histolytica. Both Rad51, a mediator of double strand DNA breakage repair, and Dmc1, a meiotic recombinase, are orthologs of prokaryotic RecA [24]. Eukaryotic Dmc1 likely arose from an early gene duplication event, and Rad51 and Dmc1 retained high sequence homology [25]. We have previously shown that E. histolytica expresses authentic Rad51 and Dmc1 recombinases capable of facilitating DNA recombination in vitro [16]. Additionally, E. invadens homologs of these two genes are upregulated during encystation [8]. Rad51 participates in double strand breakage repair in DNA damaging conditions, and may facilitate strand exchange between sister chromatids in meiosis. Dmc1 exclusively performs meiotic homologous recombination across sister chromatids [15]. We attempted to create two knockdown cell lines to reduce expression of either Rad51 or Dmc1 in E. histolytica, using an RNAi based method known as the Trigger approach [26]. This method capitalizes upon

64 synthesizing antisense siRNAs for a specific gene transcript. We analyzed cell lines with

RT-PCR and Western blots to reveal any expression differences at both the transcriptional and translational levels. However, our data demonstrated that we were not able to specifically knockdown expression of Rad51 in E. histolytica, which suggests that its role is essential. Although we successfully constructed a knockdown plasmid containing Dmc1, the cell line did not survive the selection process, indicating that a

Dmc1 knockdown may be lethal.

65 Materials and Methods

Culturing cells

E. histolytica (strain HM-1:1MSS) trophozoites were cultured axenically in TYI-S33 medium at 37 °C. Cells were passaged into fresh media every 72–96 h and were grown in

15 mL glass screw cap culture tubes [27]. To harvest cells, these tubes were incubated on ice for 8 minutes to detach cells, and the contents were transferred to 15 mL conical tubes and centrifuged for 5 minutes at 23°C and 500xg. Viable cells were counted through

Trypan Blue (VWR, Radnor, PA, USA) exclusion using an automatic cell counter (Luna

LB-L10001, Logos Biosystems, Annandale, VA, USA).

Constructing EhRad51 knockdown plasmids

E. histolytica genes Rad51 (EHI_031220) and Dmc1 (EHI_050430) were amplified via

PCR from genomic DNA extracted from wild type E. histolytica trophozoites (Wizard

Genomic DNA Purification Kit, Promega). Forward primers for each gene were designed with an XmaI/SmaI restriction enzyme cut site, and reverse primers were designed with an XhoI cut site. Following PCR amplification, each product was subcloned into an intermediate backbone, pCR3.1 (QIAprep Spin Miniprep Kit, Qiagen, Germantown, MD,

USA). OneShot E. coli were transformed with these intermediate plasmids, grown in batches, and a high quantity of plasmid DNA was extracted from the cells (QIAprep Spin

Maxiprep Kit, Qiagen). The genes from these plasmids were subcloned into the Trigger backbone (gift from Dr. Upinder Singh, Stanford University School of Medicine, Palo

Alto, CA) using restriction enzyme digestion and ligation (Fast-Link DNA Ligation Kit,

66 Epicentre, Madison, WI). Successful cloning and correct frame were confirmed by restriction digestions and sequencing.

Transfection

E. histolytica trophozoites were transfected with 140 µg of EhTriggerRad51 plasmid

DNA using electroporation [28]. Cells were grown to >90% confluence in 50 mL plugged untreated cell culture flasks. Confluent flask contents were transferred to 50 mL conical tubes and centrifuged for 5 minutes at 4°C and 500xg. All cell pellets were combined and resuspended in 10 mL ice cold 1 X PBS, centrifuged for 5 minutes at 4°C and 500xg, counted with an automatic cell counter (Luna LB-L10001, Logos Biosystems,

Annandale, VA, USA), and diluted to 3.0 x 106 cells/mL in electroporation solution. 100

µL DNA and 800 µL cells in solution were added to a cold cuvette and electroporated at

25 mF and 1.2 kV. Immediately, cells were transferred to a 50 mL flask containing 50 mL pre-warmed TYI-S33 medium at 37°C.

Mutant cell lines transfected with EhTriggerRad51 constructs were incubated at 37°C in

TYI-S33 medium in 50 mL culture flasks. After mutant cells were >80% confluent, drug selection for cells harboring the plasmid was added at a final concentration of 3 µg/mL

G418. The concentration was increased to 6 µg/ml G418 once the cells could tolerate half selection. EhTrigger cell lines were transferred into 13 mL glass tubes and maintained at

6 µg/ml G418.

67 Western blotting

Western blots were performed to find translational evidence of Rad51 knockdown in both wild type and mutant cell lines. Cell lysates were prepared using cells incubated on ice for 8 minutes to dislodge viable amebae from the glass. Cells were counted with an automatic cell counter (Luna, Logos Biosystems) and 3.0 x 105 cells were centrifuged for

5 minutes at 23°C and 500xg. Cells were resuspended in NuPAGE LDS sample buffer

(Life Technologies, Carlsbad, CA, USA) and heated for 5 minutes at 100°C. The lysates were loaded onto a precast NuPAGE 12% Bis-Tris Gel (Life Technologies), which was electrophoresed at 200 V for 45 minutes. Separated proteins were transferred using a blotter to polyvinylidene difluoride membranes (PVDF; Life Technologies) at 12 V for

1.5 hrs in Towbin transfer buffer.

The membranes were blocked with 5% w/v Blotting Grade powdered milk blocker (Bio-

Rad Laboratories, Hercules, CA) and 0.5% w/v bovine gelatin (Sigma-Aldrich, St. Louis,

MO, USA) in TBST (50 mM Tris, 150 mM NaCl, 0.5% (v/v) Tween 20) for 35 minutes at 37°C. Once the membranes were blocked, they were exposed either to Rad51 rabbit monoclonal antibody (diluted 1:1000 in TBST) (gift from Dr. Michael Sehorn, Clemson

University, Department of Genetics and Biochemistry, Clemson, SC, USA) or actin mouse monoclonal antibody (diluted 1:2000 in TBST) (Abcam, Cambridge, MA) and incubated at 4°C overnight.

68 The membranes were washed in TBST for 45 minutes with 6 buffer changes, and incubated with the appropriate peroxidase-conjugated secondary antibody for 1 hour at

22°C. (both goat anti-rabbit and goat anti-mouse were diluted 1:5000 in TBST) (Fisher

Scientific). After conjugation with antibodies, the membranes were washed for 45 minutes in TST (50 mM Tris, 328 mM NaCl, 0.05% v/v Tween20) with 6 buffer changes.

The blots were developed using a commercially available Enhanced ChemiLuminescence

Western Blotting detection system (ThermoScientific) according to the manufacturer's instructions. To quantify load, either gels were stained with Bio-Safe G250 Coomassie

Stain (Bio-Rad Laboratories) or membranes were stained with Ponceau Red (Sigma-

Aldrich) [29].

Reverse transcriptase polymerase chain reaction (RT-PCR)

Total RNA was isolated from both wild type and mutant cell lines by TRIzol (Invitrogen,

Carlsbad, CA) to find transcriptional evidence of knockdown. 2 µg of total RNA was reverse transcribed into cDNA (SuperScript III First Strand Synthesis Kit, Invitrogen). 2

µg of resulting cDNA was used as template for Rad51 or Dmc1 specific primer sets with ssRNA primers as controls (Table S1). PCR amplification of Rad51 was performed over

35 cycles. DNA was denatured at 95°C, annealed at 58°C, and extended at 72°C (GoTaq

DNA Polymerase, Promega, Madison, WI), and each step lasted 30 seconds. The final extension occurred for 10 minutes at 72°C. Resulting products were visualized using 1% agarose gel electrophoresis and ethidium bromide staining [30].

69 Results

Figure 3.1. Trigger induced RNAi mechanism in E. histolytica. Normal endogenous genes are transcribed and exported as mRNA from the nucleus. The Trigger plasmid genes are also transcribed, and some are produced as small RNAs (sRNAs). The Trigger sequence will only initiate the RNAi pathway if it is also expressed from genomic DNA. Target gene mRNA forms dsRNA complexes with sRNA from Trigger plasmid. These complexes may be digested by E. histolytica noncanonical Dicer (PDB ID: 5F3Q). Once processed by RNAi proteins, the dsRNA complexes are not translated. This causes a knockdown of expressed target gene protein. (Created in BioRender, Toronto, ON, Canada).

70 Figure 3.1 depicts the proposed Trigger plasmid pathway that results in RNAi mediated knockdown in E. histolytica [26, 31]. The Trigger sequence must be expressed from endogenous DNA for activation of RNAi, so sequences are chosen in a strain dependent manner. Many Trigger sequences exist and are expressed; these genes produce small antisense RNAs with unknown functions. These native siRNAs cause activation of transcription of target gene siRNAs originating from the Trigger plasmid.

71

Figure 3.2. Trigger plasmids containing ampicillin and neomycin resistance genes and A Trigger knockdown cassette. Cassette contains a CS promoter from EHI_024230, 132 bp fragment from Trigger gene from EHI_048600, target gene for knockdown flanked by XmaI and XhoI restriction cites, and the 3’UTR region of CS gene. A). EhTriggerLuc is the control plasmid containing full 1.7 kb sequence for firefly luciferase. B). EhTriggerRad51 is designed to knockdown Rad51, 1.1 kb EHI_ 031220. C). EhTriggerDmc1 is B designed to knockdown Dmc1, 1.0 kb EHI_050430. (Created with SnapGene version 5.1, GSL Biotech, San Diego CA, USA).

C

72 To create genetic knockdown cell lines, we designed and constructed gene specific plasmids using the Trigger vector. Figure 3.2 shows three plasmid maps of the plasmids used to subclone genes for knockdown cells. The knockdown gene cassette is composed of a target genetic sequence located downstream of a 132 bp ‘Trigger’ sequence from

EHI_048600. This is flanked by an upstream promoter and a 3’UTR from the E. histolytica cysteine synthetase gene (CS), EHI_024230. The vector also includes genes to confer resistance to the selectable markers, ampicillin, for subcloning in E. coli, and neomycin (G418), for selection in E. histolytica. Target genes for these three plasmids are firefly luciferase (negative control), Rad51 (EHI_031220), and Dmc1 (EHI_050430).

Each plasmid is designed to specifically knockdown only one gene. The Trigger system has been used to successfully knock down several genes, including Rhomboid protease 1 and a Myb transcription factor [31]. These plasmids were constructed and transfected into wild type E. histolytica, and G418 selection was used to maintain stable transformants.

None of the cells transfected with Dmc1 knockdown plasmids survived the selection process.

73 Figure 3.3. Reverse Transcriptase PCR of ehRad51-KD. E. histolytica cells were electroporated with TriggerRad51 plasmid DNA and grown under G418 selection. Two clones of the cell line survived the selection protocol, Rad51A (3A) and Rad51B (3B). RNA was extracted from 18-hour ehRad51 culture flasks using TRIzol and phase separation. cDNA was produced using SuperScript III kit (Invitrogen). PCR primers amplified 200 bp fragments of either the control gene (ssrRNA) or Rad51 (Table S1). Fig. 3.3A: The internal control showed an equal load of PCR product for wild type, Rad51A, and Luc. Rad51 PCR product was slightly increased in Rad51A cell line, but was present in all three samples. No contamination was seen in -ss reactions or the water control. Fig. 3.3B: The internal control showed an equal load of PCR product, but may have supersaturated the detection system. There was more Rad51 PCR product in wild type cDNA than either the Rad51B or Luc cell lines maintaining Trigger.

74 To determine if either transfected cell line, ehRad51A or ehRad51B, had experienced

RNAi-mediated knock down of Rad51, we performed reverse transcriptase PCR with

Rad51-specific primers on each cell line. A stable cell line transfected with Trigger plasmids containing a non-endogenous luciferase (Luc) gene served as control for nonspecific genetic effects due to the vector. Figure 3.3 shows that neither ehRad51A nor ehRad51B produced less mRNA for Rad51, indicating no phenotypic change at the transcriptional level. ehRad51A produced slightly more Rad51 mRNA than either wild type or the luciferase control, indicating this mutant cell line could be an overexpressing

Rad51 (Figure 3.3A). However, ehRad51B and luciferase produced approximately the same amount of Rad51 mRNA, and wild type cells produced more than either cell line bearing variants of Trigger plasmid (Figure 3.3B). This could indicate that the plasmid causes non-specific down regulation of Rad51 expression.

75

Figure 3.4. Representative western blots of Rad51 protein in ehRad51A, ehRad51B, and luciferase control cell lines. Cells were grown in 13 mL tubes for 24 hours. After counting the cells, equal numbers of cells were centrifuged, lysed, and boiled. Samples were electrophoresed via SDS PAGE and transferred to PDFV membranes and incubated with Rad51 Rb or actin Mo antibodies overnight. The membranes were treated with appropriate HRP antibodies, stained, and developed on film. In both trials, a dense cluster of bands was present near the expected size of EhRad51 (~41 kDa) in all three cell lines. In Trial 1, control and Rad51 cell lines had similar intensity of Rad51 Ab binding, while Rad51B was slightly decreased. The actin control showed similar quantities of protein. However, in Trial 2, Rad51B intensity was greater than both control and Rad51A. Ponceau red staining of the PDFV membrane showed similar quantities of protein in all wells. Trial 2 also detected a unique band near 37 kDa present in the Luc control but absent in both KD cell lines. This may be Dmc1 due to sequence homology; it is estimated to be 37 kDa. However, this band could not be replicated in subsequent blots.

76 We performed Western blots on three the transfected cell lines, luciferase control, ehRad51A, and ehRad51B, to detect decreased translation of Rad51. Figure 3.4 shows clustered bands in both cell lines and luciferase control near 41 kDa, the expected molecular weight of Rad51. This clustering may indicate that the human Rad51 antibody lacks high specificity against the E. histolytica Rad51 homolog. The blots also revealed that expression of Rad51 was inconsistent across the transfected cell lines. While the

Trial 1 blot showed decreased Rad51 binding in ehRad51B, the Trial 2 blot showed that the level of Rad51 protein expression was increased in this cell line when compared to the others. These differences could not be quantified due to the uncertainty of antibody specificity. Actin levels were consistent across the cell lines, indicating even lysate loads.

Ponceau red staining also was consistent across all the cell lines in Trial 2, indicating even lysate loads. In addition, the Trial 2 blot detected a unique band near 37 kDa in the luciferase control, even while it was absent in both knockdown cell lines. This may indicate specific Trigger mediated knockdown. Interestingly, the molecular weight of this band matched Dmc1, the paralog of Rad51, which has partial genetic sequence homology. This could indicate off-target effects of RNAi Trigger suppression via siRNAs. However, this band could not be replicated in subsequent blots.

77

Figure 3.5. Reverse transcriptase PCR of ehRad51B-KD. RNA was extracted from 18-hour ehRad51B culture flasks using TRIzol and phase separation. cDNA was produced using SuperScript III kit (Invitrogen). PCR primers amplified 200 bp fragments of either the control gene (ssrRNA) or Dmc1 (Table S1). 15 uL were loaded into each well along with loading dye. The internal control showed equal cDNA load in each well. Dmc1 is expressed more highly in wild type cells than in either cell line carrying a Trigger construct (Rad51B or Luc). Expression of Dmc1 was low. No contamination was seen in the –ss lanes or the water control. The light bands in all lanes are likely primer dimers.

78 To investigate the potential off-target partial silencing of Dmc1 in TriggerRad51 cell lines, we performed reverse transcriptase PCR with Dmc1-specific primers on ehRad51B.

Figure 3.5 shows neither ehRad51B nor luciferase control produced detectable levels of

Dmc1 mRNA, while wild type cells had low levels of transcription. However, all three cell lines possessed high levels of ssrRNA transcripts, indicating ample concentrations of cDNA. Because both cell lines containing Trigger vector produced less Dmc1 mRNA than the wild type, this could indicate that plasmid maintenance causes down regulation of Dmc1 expression.

79 Supplementary Table 3.1. Primer sequences for plasmid construction and RT-PCR analysis. EhRad51FwdXmaI 5’ ATACCCGGGATGAGTGCCAAGCAAATAC 3’ EhRad51RevXhoI 5’ CCCTCGAGTTAATCATCTTTAACATCTTCAATCCC 3’ EhDmc1FwdXmaI 5’ ATACCCGGGATGACTGAGGTGAAAAG 3’ EhDmc1RevXhoI 5’ CCCTCGAGCTTTAGCATCAATAATTCC 3’ EhRad51 RT Fwd 5’ GCACAGAAGGAAGAGCTATTTA 3’ EhRad51 RT Rev 5’ AATTCTCCTCTTCCACTGTAATC 3’ EhDmc1 RT Fwd 5’ GTCTCTGTTCAGGGTTGATTT 3’ EhDmc1 RT Rev 5’ CTCCTCCTGGATCACTCATTA 3’ ssrRNA RT Fwd 5’ ACGGGAAACTACCAAGACCGAACA 3’ ssrRNA RT Rev 5’ AGACGCATGCACCACTACCCAATA 3’

80 Discussion

In this study, we have shown that Rad51 and Dmc1 cannot be specifically knocked down utilizing Trigger RNAi methods in E. histolytica. RT-PCR results showed that both

Rad51 and Dmc1 transcription were not consistently reduced across multiple clonal cell lines. Additionally, Dmc1 knockdown may be lethal for trophozoites. Western blot analyses demonstrated inconsistent translational knockdown and potential non-specificity of human Rad51 antibody binding.

RT-PCR analysis showed that Rad51 transcription in clonal knockdown cell lines was not consistent. Additionally, maintenance of any Trigger plasmid may decrease Rad51 expression. Both luciferase and Rad51A cell lines showed a decreased level of Rad51 transcripts compared to that in wild type cells. However, Rad51 expression was slightly increased in one of the clonal cell lines, Rad51B, when compared to the wild type and luciferase control cell lines. This is the opposite of what is expected for the Trigger system. We have observed upregulation previously in other attempted knockdowns utilizing the Trigger system [32]. One possibility is that stress imparted by the maintenance of the Trigger plasmid may cause an upregulation of Rad51 expression.

Rad51 is upregulated in E. histoltyica exposed to DNA damaging agents [33]. Another possibility is that the promoter in the Trigger plasmid is behaving in such a way that there is anomalous expression of Rad51 transcripts from the plasmid, rather than siRNA species. Although the Rad51A and Rad51B clones were expected to exhibit similar knockdown phenotypes, these clones were not phenotypically equivalent. However, in

81 previous studies, only some clonal cell lines underwent specific gene silencing, indicating an underlying regulatory mechanism [34]. In order to confirm that Trigger knockdown is not possible for Rad51 and Dmc1, we could use a second E. histolytica cell line with a modified genome containing the luciferase gene to verify that TriggerLuc is effectively knocking down the target gene.

Western blot analysis confirmed that Rad51 expression differed in the clonal Rad51 knockdown cell lines, as well as within replicates of the same cell line. One blot showed a higher expression of Rad51in the Rad51B cell line, compared to that in both the luciferase control and Rad51A cell lines. Furthermore, a biological replicate showed decreased expression in the Rad51B cell line when compared to luciferase control. This inconsistency might indicate that unknown factors influence expression of Rad51.

Additionally, western blots showed that human Rad51 antibody may not have high specificity for the native E. histolytica Rad51 because there were multiple bands around the relevant molecular weight, making the data difficult to interpret. This was unexpected because previous studies have shown this antibody has high specificity to recombinant E. histolytica Rad51 [16]. Thus, it is possible that there are lot-to-lot variations in commercial anti-Rad51 antibody. Additionally, western blot analysis showed potential off-target RNAi silencing of Dmc1 or potential cross reactivity of human Rad51 monoclonal antibodies with E. histolytica Dmc1. The close evolutionary relationship between Rad51 and Dmc1 and genetic sequence homology may allow for imprecise

82 antibody and Trigger-generated siRNA binding. However, we could not replicate these results, which could indicate that unknown factors also influence expression of Dmc1.

To further investigate the effects of harboring an EhTriggerRad51 plasmid on Dmc1 expression, we performed another RT-PCR. No consistent knockdown effect was detected in the Rad51B clone, verifying that Trigger knockdowns are gene specific, even among highly similar genes. These data also showed that Dmc1 expression was low in wild type, Rad51B, and luciferase cell lines. Wild type cells had slightly higher Dmc1 expression than either transfected cell line, but expression levels were much lower than ssrRNA controls. This indicates that Dmc1 is not highly expressed in healthy trophozoites. Our data align with transcriptomic evidence from E. invadens that meiotic genes, including Dmc1, are only upregulated during stage conversion [8]. Additionally, the transcriptome of E. histolytica trophozoites shows low expression of Dmc1 [35].

Because Dmc1 is minimally expressed in trophozoites, a minor reduction in expression could be lethal if the function is essential. This may explain why cells transfected with

EhTriggerDmc1 plasmids died under full G418 selection in three separate trials.

The choice of control genes may have impacted our ability to detect changes in Rad51 and Dmc1 expression through RT-PCR. Transcriptomic data from E. histolytica trophozoites shows that ssrRNA genes are expressed tenfold higher than Rad51 and twentyfold higher than Dmc1 [35]. These large transcriptional differences may have complicated resolution and the adjustment of cDNA loads. If we reduced the load to

83 avoid gel oversaturation, we could not detect Rad51 or Dmc1 cDNA. In future experiments, we suggest utilizing control genes with similar expression levels to target genes. Similarly, we used actin antibodies as a load control in Western blots. Actin is highly expressed in E. histolytica, and bands were visible after very short exposure periods. It was challenging to correct for load differences after ample exposure for Rad51 detection due to actin oversaturation and minimal expression of Rad51 in unstressed trophozoites.

To our surprise, Rad51 could not be knocked down with Trigger RNAi methods, unlike many other native E. histolytica genes. However, robust gene silencing is not equally effective for all E. histolytica genes. Many genes are not inhibited by Trigger and only some clonal cell lines undergo specific gene silencing [34]. Epigenetic modifications may regulate differences in Trigger efficacy, but little work has been done regarding this possibility [36]. These findings, along with our data, suggest the possibility of underlying regulatory mechanisms governing Trigger-mediated RNAi response in E. histolytica.

Additionally, RNAi can present unique challenges in polyploid organisms because of variable gene copy numbers. Because RNAi targets mRNA transcripts, no effect may be seen if the organism can produce transcripts from alternate gene copies. E. histolytica has variable ploidy in the trophozoite stage, so this mechanism may allow clones to evade robust knockdown through RNAi [13].

84 In other protozoan parasites, RNAi methodology is only partially effective at generating knockdown cell lines. The first parasitic organism studied through robust RNAi techniques was Trypanosoma brucei, but only 30% of genes could be effectively knocked down via this pathway [37, 38]. In several Leshmania species, RNAi is the preferred tool for reducing expression of high copy number genes where homologous recombination knockouts are not feasible, but success remains highly variable [39]. RNAi methods are inefficient at silencing genes in Giardia lamblia, perhaps due to tetraploid genetics [40,

41, 42]. Due to the challenges of ensuring efficient gene knockdown in polyploid organisms via RNAi, it may not be possible to knock down Rad51 or Dmc1 in E. histolytica.

Because Trigger-mediated knockdown was ineffective for Rad51 and Dmc1, we could not characterize their physiological roles in E. histolytica. Here, we propose two alternate approaches: knockdown and overexpression. An older dsRNA knockdown system for E. histolytica utilizes a modified Bacillus subtilis plasmid backbone. This system has successfully knocked down several native genes, but because it relies on RNAi machinery, the same limitations we encountered with Trigger may arise [43].

Alternatively, overexpressing Rad51 and Dmc1 may enhance quantifiable physiological traits, such as phagocytosis, DNA repair, and stress response. Our lab has successfully produced several tetracycline inducible overexpression cell lines using the pGIR209/pGIR308 system [44]. Overexpression may be the preferable method to characterize Dmc1, since its basal expression in trophozoites is low.

85 This study cannot address encystation phenotypes of Rad51 or Dmc1 knockdowns because synchronous encystation currently cannot be executed in vitro for E. histolytica.

Fortunately, an RNAi Trigger plasmid has been developed to generate knockdown E. invadens cell lines, which currently serves as an in vitro model of encystation [46]. To characterize the role of Rad51 and Dmc1 during different time points of stage conversion, knockdown E. invadens cell lines could be produced and evaluated with RT-PCR and

Western blots. Rad51 and Dmc1 expression could be quantified with Western blot at staggered time points during the encystation protocol. Finally, encystation efficiency could be quantified with flow cytometry to assess any limitations in encystation due to knockdown [47]. Encystation of E. invadens was prevented by the Rad51 inhibitor DIDS

(4,4′-diisothiocyanatostilbene-2,2′-disulfonate) without decreasing trophozoite viability, which may indicate that homologous recombination is essential to cyst formation [15].

However, DIDS also inhibits excystation of Giardia muris by blocking vacuoles and lysosomal acidification, so it may impact stage conversion through other pathways [48].

Changes in E. invadens encystation related to Rad51 or Dmc1 knockdown will clarify the role of meiotic proteins that are overexpressed during stage conversion, and the role of the proteins will likely bear similarity in E. histolytica.

86 Acknowledgements

The authors would like to thank the members of the Temesvari lab for technical assistance in completing this project. Specifically, I would like to thank Mr. Rony Orobio and Ms. Heather Walters for assistance with RT-PCR and Western blot analysis.

Additional thanks to Ms. Brenda Welter for advice in creating transfected cell lines. A special thanks to Dr. Upinder Singh, Professor of Medicine and Infectious Diseases at

Stanford University, for donating the EhTrigger plasmid backbone.

Financial support for this work was provided by NIH COBRE GM10904, awarded to Dr.

Lesly Temesvari. The funding agency had no role in the study design, data collection and analysis, or manuscript preparation. This content is the responsibility of the authors and does not necessarily represent the views of the National Institutes of Health. Additional funding was provided by the Clemson University Department of Biological Sciences through a Teaching Assistantship.

87 Literature Cited

1. World Health Organization, 1997. Amoebiasis.Wkly Epidemiol Rec. 72(14):97-9. 2. Ravdin, JI, and Guerrant, RL. 1986. Current problems in diagnosis and treatment of amoebic infections. Curr Clin Trop Infect Dis. 7:82-111. 3. Haque, R, Huston, CD, Hughes, M, Houpt, E, Petri Jr, WA. 2003. Amebiasis. N Engl J Med. 348:1565-1573. 4. Blessmann, J, Ali, IKM, Nu, PAT, Dinh, BT, Viet, TQN, Le Van, A, Clark, CG, Tannich, E. 2003. Longitudinal study of intestinal Entamoeba histolytica infections in asymptomatic adult carriers. J Clin Microbiol. 41:4745-4750. 5. Stanley, SL. 2003. Amoebiasis. The Lancet. 361:1025-1034 6. Clark, CG, Espinosa Cantellano, M, Bhattacharya, A. 2000. Entamoeba histolytica: an overview of the biology of the organism, p. 1-45. In Amebiasis. World Scientific. 7. Aguilar-Díaz, H, Díaz-Gallardo, M, Laclette, JP, Carrero, JC. 2010. In vitro induction of Entamoeba histolytica cyst-like structures from trophozoites. PLoS Negl Trop Dis. 4(2):e607. 8. Ehrenkaufer, GM, Weedall, GD, Williams, D, Lorenzi, HA, Caler, E, Hall, N, Singh, U. 2013. The genome and transcriptome of the enteric parasite Entamoeba invadens, a model for encystation. Genome Biol. 14:R77. 9. Naiyer, S, Bhattacharya, A, Bhattacharya, S. 2019. Advances in Entamoeba histolytica biology through transcriptomic analysis. Front. Microbiol. 10:1921. 10. Singh N, Bhattacharya A, Bhattacharya S. 2013. Homologous recombination occurs in Entamoeba and is enhanced during growth stress and stage conversion. PLoS One. 8:e74465. 11. Singh, N, Bhattacharya, S, Paul, J. 2011. Entamoeba invadens: dynamics of DNA synthesis during differentiation from trophozoite to cyst. Exp. Parasitol. 127:329-333. 12. Makioka, A, Kumagai, M, Ohtomo, H, Kobayashi, S, Takeuchi, T. 1999. DNA polymerase activity in encysting Entamoeba invadens. Parasitol Res. 85:604-606. 13. Mukherjee, C, Majumder, S, Lohia, A. 2009. Inter-cellular variation in DNA content of Entamoeba histolytica originates from temporal and spatial uncoupling of cytokinesis from the nuclear cycle. PLoS Negl Trop Dis. 3(4):e409. 14. Weedall, GD, Clark, CG, Koldkjaer, P, Kay, S, Bruchhaus, I, Tannich, E, Paterson, S, Hall, N. 2012. Genomic diversity of the human intestinal parasite Entamoeba histolytica. Genome Biol. 13:R38. 15. Kelso, AA, Say, AF, Sharma, D, Ledford, LL, Turchick, A, Saski, CA, King, AV, Attaway, CC, Temesvari, LA, Sehorn, MG. 2015. Entamoeba histolytica Dmc1 catalyzes homologous DNA pairing and strand exchange that is stimulated by calcium and Hop2-Mnd1. PloS One. 10:e0139399. 16. Kelso AA, Goodson SD, Chavan S, Say AF, Turchick A, Sharma D, Ledford LL, Ratterman E, Leskoske K, King AV. 2016. Characterization of the recombination activities of the Entamoeba histolytica Rad51 recombinase. Mol Biochem Parasitol. 210:71-84.

88 17. Tekle, YI, Wood, FC, Katz, LA, Cerón-Romero, MA, Gorfu, LA. 2017. Amoebozoans are secretly but ancestrally sexual: evidence for sex genes and potential novel crossover pathways in diverse groups of amoebae. Genome Biol Evol. 9:375-387. 18. Hofstatter, PG, Brown, MW, Lahr, DJ. 2018. Comparative genomics supports sex and meiosis in diverse Amoebozoa. Genome Biol Evol. 10:3118-3128. 19. Feretzaki, M, Heitman, J. 2013. Unisexual reproduction drives evolution of eukaryotic microbial pathogens. PLoS Pathog. 9:. 20. Maciver, SK. 2016. Asexual amoebae escape Muller's ratchet through polyploidy. Trends Parasitol. 32:855-862. 21. Orozco, E, Lopez, C, Gomez, C, Perez, DG, Marchat, L, Banuelos, C, Delgadillo, DM. 2002. Multidrug resistance in the protozoan parasite Entamoeba histolytica. Int J Parasitol. 51:353-359. 22. Pramanik, PK, Alam, MN, Chowdhury, DR, Chakraborti, T. 2019. Drug resistance in protozoan parasites: an incessant wrestle for survival. J Glob Antimicrob Resist. 18:1-11. 23. Heitman, J, Carter, DA, Dyer, PS, Soll, DR. 2014. Sexual reproduction of human fungal pathogens. Cold Spring Harb Perspect Med. 4:a019281. 24. Sung, P, Klein, H. 2006. Mechanism of homologous recombination: mediators and helicases take on regulatory functions. Nat Rev Mol Cell Biol. 7:739-750. 25. Lin, Z, Kong, H, Nei, M, Ma, H. 2006. Origins and evolution of the recA/RAD51 gene family: evidence for ancient gene duplication and endosymbiotic gene transfer. Proc Natl Acad Sci USA. 103:10328-10333. 26. Morf, L, Pearson, RJ, Wang, AS, Singh, U. 2013. Robust gene silencing mediated by antisense small RNAs in the pathogenic protist Entamoeba histolytica. Nucleic Acids Res. 41:9424-9437. 27. Diamond, LS, Harlow, DR, and Cunnick, CC. 1978. A new medium for the axenic cultivation of Entamoeba histolytica and other Entamoeba. Trans R Soc Trop Med Hyg. 72(4): 431-432. 28. Purdy JE, Mann BJ, Pho LT, Petri WA. 1994. Transient transfection of the enteric parasite Entamoeba histolytica and expression of firefly luciferase. Proc Natl Acad Sci. USA. 91:7099-7103. 29. Welter BH, Laughlin RC, Temesvari LA. 2002. Characterization of a Rab7-like GTPase, EhRab7: a marker for the early stages of endocytosis in Entamoeba histolytica. Mol Biochem Parasit. 121:254-264. 30. Zhang H, Ehrenkaufer GM, Manna D, Hall N, Singh U. 2015. High Throughput Sequencing of Entamoeba 27nt Small RNA Population Reveals Role in Permanent Gene Silencing But No Effect on Regulating Gene Expression Changes during Stage Conversion, Oxidative, or Heat Shock Stress. PLoS One. 10(8):e0134481 31. Khalil, MI, Foda, BM, Suresh, S, Singh, U. 2016. Technical advances in trigger- induced RNA interference gene silencing in the parasite Entamoeba histolytica. Int J Parasitol. 46:205-212. 32. Rock, ML. 2016. The Intermediate Subunit of the Gal/Galnac Lectin May Play a Role in Erythrophagocytosis in Entamoeba histolytica. All Theses. 2441. https://tigerprints.clemson.edu/all_theses/2441

89 33. López-Casamichana, M, Orozco, E, Marchat, LA, López-Camarillo, C. 2008. Transcriptional profile of the homologous recombination machinery and characterization of the EhRAD51 recombinase in response to DNA damage in Entamoeba histolytica. BMC Mol Biol. 9:35. 34. Matthiesen, J, Lender, C, Haferkorn, A, Fehling, H, Meyer, M, Matthies, T, Tannich, E, Roeder, T, Lotter, H, Bruchhaus, I. 2019. Trigger-induced RNAi gene silencing to identify pathogenicity factors of Entamoeba histolytica. FASEB J. 33:1658- 1668. 35. Shabardina, V, Kischka, T, Kmita, H, Suzuki, Y, Makałowski, W. 2018. Environmental adaptation of Acanthamoeba castellanii and Entamoeba histolytica at genome level as seen by comparative genomic analysis. Int. J. Biol. Sci. 14:306. 36. Pompey, JM, Morf, L, Singh, U. 2014. RNAi pathway genes are resistant to small RNA mediated gene silencing in the protozoan parasite Entamoeba histolytica. PLoS One. 9(9): e106477. 37. Subramaniam, C, Veazey, P, Redmond, S, Hayes-Sinclair, J, Chambers, E, Carrington, M, Gull, K, Matthews, K, Horn, D, Field, MC. 2006. Chromosome-wide analysis of gene function by RNA interference in the African trypanosome. Eukaryot Cell. 5:1539-1549. 38. Kolev, NG, Tschudi, C, Ullu, E. 2011. RNA interference in protozoan parasites: achievements and challenges. Eukaryot Cell. 10:1156-1163. 39. de Paiva, RMC, Grazielle-Silva, V, Cardoso, MS, Nakagaki, BN, Mendonca- Neto, RP, Canavaci, AMC, Melo, NS, Martinelli, PM, Fernandes, AP, Duarte daRocha, W. 2015. Amastin knockdown in Leishmania braziliensis affects parasite- macrophage interaction and results in impaired viability of intracellular amastigotes. PLoS Pathog. 11(12): e1005296. 40. Krtková, J, Paredez, AR. 2017. Use of translation blocking morpholinos for gene knockdown in Giardia lamblia, p. 123-140. In Anonymous Morpholino Oligomers. Springer. 41. Marcial-Quino, J, Gómez-Manzo, S, Fierro, F, Rufino-González, Y, Ortega- Cuellar, D, Sierra-Palacios, E, Vanoye-Carlo, A, González-Valdez, A, Torres- Arroyo, A, Oria-Hernández, J. 2017. RNAi-mediated specific gene silencing as a tool for the discovery of new drug targets in Giardia lamblia; evaluation using the NADH oxidase gene. Genes. 8:303. 42. Jex, AR, Svärd, S, Hagen, KD, Starcevich, H, Emery-Corbin, SJ, Balan, B, Nosala, C, Dawson, SC. 2020. Recent advances in functional research in Giardia intestinalis. Academic Press. 43. Kaur, G, Lohia, A. 2004. Inhibition of gene expression with double strand RNA interference in Entamoeba histolytica. Biochem Biophys Res Commun. 320:1118-1122. 45. Ramakrishnan, G, Vines, RR, Mann, BJ, Petri Jr, WA. 1997. A tetracycline- inducible gene expression system in Entamoeba histolytica. Mol Biochem Parasitol. 84:93-100. 46. Suresh, S, Ehrenkaufer, G, Zhang, H, Singh, U. 2016. Development of RNA interference trigger-mediated gene silencing in Entamoeba invadens. Infect Immun. 84:964-975.

90 47. Welter, BH, Sehorn, MG, Temesvari, LA. 2017. Flow cytometric characterization of encystation in Entamoeba invadens. Mol. Biochem. Parasitol. 218:23-27. 48. Feely, DE, Gardner, MD, Hardin, EL. 1991. Excystation of Giardia muris induced by a phosphate-bicarbonate medium: localization of acid phosphatase. J Parasitol. 441- 448.

91