Interaction of Rice Dwarf Virus Outer Capsid P8 Protein with Rice Glycolate Oxidase Mediates Relocalization of P8

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

FEBS Letters 581 (2007) 34–40

Interaction of rice dwarf virus outer capsid P8 protein with rice glycolate oxidase mediates relocalization of P8

Feng Zhou, Gang Wu1, Wulan Deng1, Yingying Pu, Chunhong Wei, Yi Li* Peking-Yale Joint Center for Plant Molecular Genetics and Agrobiotechnology, The National Laboratory of Protein Engineering and Plant Genetic Engineering, National Center for Plant Gene Research (Beijing), College of Life Sciences, Peking University, Beijing 100871, PR China

Received 9 October 2006; revised 23 November 2006; accepted 28 November 2006

Available online 6 December 2006

Edited by Shou-Wei Ding

nated viroplasms that consist of electron-dense inclusions with Abstract Yeast two-hybrid and coimmunoprecipitation assays indicated that P8, an outer capsid protein of Rice dwarf phyto- virus-like particles interspersed within or distributed at the reovirus (RDV), interacts with rice glycolate oxidase (GOX), a periphery of the matrix [6,7]. typical enzyme of peroxisomes. Confocal immunofluorescence Rice dwarf virus (RDV) is a member of the phytoreovirus microscopy revealed that P8 was colocalized with GOX in per- genus in the family of Reoviridae [8]. It is the major cause of oxisomes. Time course analysis demonstrated that the localiza- a serious rice disease in southern Asia [9,10]. The genome of tion of P8 in Spodoptera frugiperda cells changed from diffuse RDV is composed of 12 segmented double-stranded RNAs to discrete, punctuate inclusions during expression from 24 to (S1–S12 based on their immigration rates in agarose gel elec- 48 h post inoculation. Coexpression of GOX with P8 may target trophoresis). Seven structural proteins and at least five non- P8 into peroxisomes, which serve as replication sites for a num- structural proteins are encoded by the genome segments (S1– ber of viruses. Therefore, we conclude that the interaction of P8 S12). The seven structural proteins are products of segments with the GOX of host cells leads to translocation of P8 into peroxisomes and we further propose that the interaction between P8 S1, S2, S3, S5, S7, P8 and S9. The viral particle is an icosahe- ˚ and GOX may play important roles in RDV targeting into the dral shape of approximately 700 A diameter and consists of replication site of host cells. Our findings have broad significance two concentric layers of proteins that encapsidate 12 segments in studying the mechanisms whereby viruses target appropriate of double-stranded (ds) RNAs as the genome. The core parti- replication sites and begin their replication. cle is composed of P1, P5 and P7 with the single copy of the 2006 Federation of European Biochemical Societies. dsRNA genome and it is encapsidated with a thin layer of Published by Elsevier B.V. All rights reserved. P3 core protein. The outer layer is mainly composed of P8 proteins with a molecular weight of 46 kDa, P9 protein and a Keywords: Glycolate oxidase; Peroxisome; Rice dwarf small number of P2 proteins. The five non-structural proteins hytoreovirus; Capsid protein P8; Interaction are products of S4, S6, and S10–S12 [11,12]. RDV replicates both in insect vector and rice cells but can only be transmitted by insects such as leafhopper (Nephotettix cincticeps or Recilia dorsalis). Previous cytopathological studies of RDV-infected leafhoppers have found inclusions similar to those in other reo- 1. Introduction virus, including (i) dense cytoplasmic inclusions typical of viroplasms or viral factories, and (ii) tubular structures, in addition The sites of replication and assembly of viruses are localized to para-crystalline or scattered viral particles [13]. in specific subcellular fractions in virus-infected cells, such as Using confocal immunofluorescence microscopy and immu- on the outer mitochondrial membranes for flock house virus nofluorescence microscopy in RDV-infected monolayers cells [1], at chloroplast envelopes for tymoviruses [2], on the actin (VCMs), Wei et al. demonstrated that Pns12 protein of RDV cytoskeleton for human parainfluenza virus type 3 [3], in cyto- is essential for the formation of viroplasms and the nucleation plasmic inclusions for vaccinia virus [4], and in nuclear inclu- of viral assembly complexes [14]. The interior region of the viro- sions for herpes simplex virus [5]. Early cytopathological plasms contains non-structural proteins (Pns6, Pns11, and studies of plant reoviruses in infected plants and vector insects Pns12), core proteins (P1, P3, P5 and P7) and core viral parti- have identified two distinct cytopathological structures desig- cles. By contrast, the accumulation of the outer capsid proteins (P2, P8 and P9) and the accumulation of intact viral particles were detected at the peripheral regions of the viroplasm. * Corresponding authors. Fax: +86 10 6275 4427. Intact double-layered RDV particles were found in the ves- E-mail address: [email protected] (Y. Li). icles of monolayer cells 2 h after infection, which indicated that 1Present address: Biology Department, University of Pennsylvania, RDV may enter cells by endocytosis [15]. How does RDV tar- Leidy Labs, 304 Mudd 415 South University Avenue, Philadelphia, PA get into the proper location of host cells and begin to replicate, 19104, USA. and are there cellular factors involved in this process. These Abbreviations: RDV, Rice dwarf virus; GOX, glycolate oxidase; VC- open questions remain unclear. Ms, vector cells in monolayers; Sf9, Spodoptera frugiperda; TBSV, As outer capsid proteins, P2 and P8, are presumed to be Tomato bushy stunt virus early proteins that interact with host factors. In this study,

0014-5793/$32.00 2006 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2006.11.073 F. Zhou et al. / FEBS Letters 581 (2007) 34–40 35 we used the P8 protein as bait in a yeast two-hybrid system to RDV P8 protein was examined by Western blotting with a FLAG-spe- screen a rice cDNA library and found that glycolate oxidase cific antibody. (GOX, 40 kDa) interacts with P8, and this interaction was further confirmed by immunoprecipitation assays and confocal 2.6. Co-immunoprecipitation and Western blot assay Transfection of 293T cells was performed with the standard calcium immunofluorescence microscopy. Our further investigations phosphate precipitation method [19]. The transfected 293T cells col- indicated that P8 is colocalized with GOX in the peroxisomes lected from a 100 mm petri dish were lysed as previously described of insect cells. GOX may target P8 into peroxisomes when [20]. For each assay, a 0.4 ml aliquot of lysate was incubated with GOX was coexpressed with P8. The biological significance of 0.5 lg of the indicated monoclonal antibody or control mouse IgG the interaction between P8 and GOX to target RDV into viro- and 25 ll of a 1:1 slurry of Gamma Bind A Plus-Sepharose (Amersham Biosciences) for at least 2 h. The Sepharose beads were washed three plasms is discussed. times with lysis buffer containing 0.5 M NaCl. The beads remaining after the last wash were reconstituted in 30 llof2· SDS–PAGE sam- ple buffer and boiled at 100 C for 5 min. Samples were analyzed by 2. Materials and methods Western blotting as described elsewhere [21].

2.1. Cells, viruses and antibodies 2.7. Immunostaining and immunofluorescent microscopy Spodoptera frugiperda (Sf9) cells were grown in 10% fetal bovine ser- Cells to be processed for immunofluorescent microscopy were fixed um-supplemented-TNMFH medium (Invitrogen). Recombinant bac- in 100% methanol for 10 min at 20 C. The cells were rehydrated in uloviruses were obtained as described by King and Possee [16]. TBS, blocked with 1% bovine serum albumin in PBS for 15 min, and Human embryonic kidney 293 cells (ATCC, American Type Culture incubated with both a mouse monoclonal anti-FLAG and a rabbit Collection, Manassas, VA, USA) were cultured in Dulbecco’s modified polyclonal anti-HA antibody in TBS 1% BSA at a final concentration Eagle’s medium (DMEM) (Hyclone) supplemented with 10% fetal bo- of 2lg/ml for 1 h at room temperature. The cells were rinsed with TBS vine serum (GIBCO), 1 mM sodium pyruvate (Hyclone), 100 U/ml and then incubated with both a goat anti-mouse antibody conjugated penicillin, and 100 lg/ml streptomycin (Hyclone) and grown in 5% with TRITC as well as a goat anti-rabbit antibody conjugated with CO2 at 37 C. Rabbit polyclonal antiserum against RDV P8 was FITC at room temperature for one hour in TBS 1% BSA. Coverslips prepared as described earlier [17]. Rabbit polyclonal anti-FLAG were incubated with 1 lg/ml Hoescht in PBS for 5 min to counterstain and mouse monoclonal anti-HA antibody were purchased from Sigma cell nuclei, briefly washed in PBS, and then mounted on glass slides Inc. with 50% glycerol. Samples were examined under a Leica Wetzlar GmbH inverted microscope equipped with phase-contrast and fluores- 2.2. PCR primer sequences cence optics. All images were processed and prepared for presentation The oligonucleotides used in this study are listed in Table 1. by using SPOT (version4.0.8).

2.3. Yeast two-hybrid assay A rice seedling two-hybrid cDNA library from rice cv Xiu shui 11 3. Results was constructed with CLONTECH protocols. The titer of the library was determined after amplification and was approximately 6 · 108 cfu/ml [9]. The cDNA encoding full-length P8 protein was inserted 3.1. Identification of glycolate oxidase that interacts with RDV in frame into the GAL4 DNA binding domain vector pGBKT7 P8 (CLONTECH). The rice cDNA library in GAL4 activation domain RDV P8 was used as bait to screen a rice cDNA library (the vector pGADT7 was screened and the isolation of positive clones prey library) in a yeast two-hybrid system. Four positive clones was performed using MATCHMAKER GAL4 Two-Hybrid System 6 3 and Libraries (CLONTECH). were identified among the approximately 2 · 10 cDNA clones screened (Fig. 1). The cDNA fragments from all four positive 2.4. Preparation of constructs clones encode an identical polypeptide containing 181 amino In order to confirm the interactions between RDV-P8 and GOX, P8 acid residues (Fig. 2). We found that this polypeptide shares a and GOX were cloned into the pRK-FLAG-Neo or pRK-HA-Neo high degree of identity with glycolate oxidase from Oryza sativa vector (Dr. Hongbing Shu, Department of Immunology, National (GenBank Accession No. AAB82143, 99% identity), Arabidop- Jewish Medical and Research Center, University of Colorado Health Sciences Center, Denver, CO) [18]. cDNAs of RDV-S8 [17] and sis thaliana (GenBank Accession No. NP_850585, 83% iden- GOX were amplified through PCR with primer pairs F1/R1 and F2/ tity), Spinacia oleracea (GenBank Accession No. J03492.1, R2. The RDV-S8 fragments were digested with XhoI and NotI and li- 82% identity), Homo sapiens (GenBank Accession No. gated into the pRK-FLAG-Neo vector linearized with SalI and NotI. AAP69988, 53% identity), Drosophila pseudoobscura (GOX-like The GOX fragments were digested with SalI and NotI and ligated into protein) (GenBank Accession No. EAL25953, 53% identity), the pRK-HA-Neo vector linearized with SalI and NotI. These recombinant mammalian expression plasmids were designated pRK-FLAG- and Caenorhabditis elegans (GOX-like protein) (GenBank S8 and pRK-HA-GOX. All the constructs were sequenced from 50 and Accession No. NP_505218, 47% identity). The full-length 30 ends to confirm the sequences and open reading frames (ORF). ORF of the rice glycolate oxidase gene was then cloned through reverse transcription (RT)-PCR and primers were designed 2.5. Expression of RDV P8 and GOX proteins by baculovirus based on rice glycolate oxidase sequence information available The cDNAs of RDV S8 and GOX, cloned in pRK-FLAG-S8 and in NCBI. pRK-HA-GOX, were amplified by PCR using the F3/R3 and F4/R4 primers pairs corresponding to the N-terminal sequences of the FLAG/HA tag sequences and C-terminal sequences of the S8/GOX 3.2. Confirming binding between P8 and GOX by segment. After digestion with appropriate restriction enzymes (at the underlined sites), the RDV S8 and GOX cDNAs were ligated into immunoprecipitation assays the pFastBac donor plasmid (Invitrogen). Then recombinant pFastBac To verify the interaction between P8 and GOX, pRK- was introduced into DH10Bac (Invitrogen) for transposition into the FLAG-S8 and pRK-HA-GOX encoding FLAG-tagged P8 bacmid and the construct was sequenced completely to verify the open and HA (hemagglutinin)-tagged GOX were co-transfected to reading frame of the coding sequence. The recombinant bacmid was human embryonic kidney 293 cells (HEK293 cells). After isolated and used to transfect to S. frugiperda (Sf9) cells in the presence of CellFECTIN according to the instructions from Invitrogen. Then, 24 h post-transfection, the cells were harvested and lysed. 72 h after transfection, Sf9 cells were collected and expression of the The lysate aliquots were used to pull down proteins by either 36 F. Zhou et al. / FEBS Letters 581 (2007) 34–40

Table 1 Primers used in this study Primers Primer sequences RE Constructs F1 CTGACTCGAGCTGGTTAGACACAAGTGCT XhoI pRK-FLAG-Neo R1 CGATGCGGCCGCTAATTTGGTCTATAGTA NotI

F2 CAGTGTCGACTATGGGGGAGATCACCAATGT SalI pRK-HA-Neo R2 ATTAGCGGCCGCTCACAACCTGGGGAAGGG NotI

F3 ATGCCCATGGGACTACAAGGACGACGAT NcoI pFastBac R3 CGCGTCTAGAGATTTGGTCTATAGTATCT XbaI

F4 TACCCATACGATGTTCCTG R4 ATTAGCGGCCGCTCACAACCTGGGGAAGGG NotI RE – restriction enzyme.

with GOX as discrete, punctuate inclusions (Fig. 4A, g–i). The images from confocal immunofluorescence microscopy studies exhibited distinct fluorescence staining of P8 and GOX, confirming that P8 was co-localized with GOX in the peroxisomes of insect cells (Fig. 4B).

3.4. Time course examination of P8 in Sf9 cells We also examined the localization of P8 in cells in a time course of experiment. Sf9 cells were inoculated with recombinant baculovirus expressing P8, and incubated for various periods of time. The cells were then stained with P8-specific anti-serum conjugated to FITC. Immunofluorescence staining of P8 in Sf9 cells that grew on coverslips revealed that P8 was distributed diffusely in the cytoplasm at times less than 24 hpi, but relocalized to discrete, punctuate inclusions within the cells after 36 hpi (Fig. 4C). Thus translocation of P8 in Sf9 cells Fig. 1. Interaction of P8 with rice glycolate oxidase in yeast cells. The appears to be a consequence of interactions between P8 and transformants were plated on a SD/–Leu/–Trp/–His/–Ade medium. endogenous glycolate oxidase. Because glycolate oxidase is a pGBKT7 and pGADT7 are empty vectors, pGBKS8 contains RDV S8 highly conserved protein among eukaryotes (Fig. 2), we pre- and pGAD-D1, pGAD-D2, pGAD-D3 and pGAD-D4 were identified positive clones containing rice cDNA inserts. sume that similar mechanisms are used to target RDV to the cells of both plant and insect cells. anti-HA or anti-FLAG antibody. The results demonstrated 3.5. Interaction of truncated P8 with GOX that the anti-HA antibody could pull down HA-GOX and Previous studies have demonstrated that a site-specific cleav- FLAG-tagged P8; and conversely, the anti-FLAG antibody age of P8 occurs between the Asp362 and Pro363 residues to could pull down flag-tagged P8 and HA-tagged GOX. These produce both P80 and a minor peptide sp1 with a molecular immunoprecipitation (IP) experiments were well controlled weight of 5 kDa [17]. This cleavage exists not only in purified by using control IgG, and hence indicate that P8 and GOX virus, but also in RDV-infected rice, transgenic rice, the Esch- participate in direct binding interactions (Fig. 3). erichia coli expressed P8 product, and in vitro translation products of P8 [17,22]. Another cleavage site was found 3.3. Localization of P8 and GOX in Sf9 cells by using between the Asp56 and Pro57 residues in the E. coli expressed baculovirus system P8 product but not in purified virions. We prepared recombinant baculovirus that expressed To map binding interactions between P8 and GOX a series FLAG-tagged RDV P8 or HA-tagged GOX. The expression of truncated mutations were constructed P8 in frame with of the P8 and GOX proteins was verified by Western blotting Flag-tag. The mutants P8DC(1-362), P8DN(56-421) and using anti-Flag and anti-HA antibodies. The P8 and GOX P8DNC(56-362) were constructed into the pRK-FLAG-Neo proteins were detected first at 24 h post infection (hpi) and in- and pFastBAC vectors (Fig. 5A). Immunoprecipitation results creased to a maximum level at 72 hpi (data not shown). revealed that the HA antibody (specific for GOX) could pull To determine whether the binding between P8 and GOX af- down the truncated P8 molecules, suggesting that all three fects the subcellular localization of P8 in the insect cells, we P8 mutants interact with GOX (Fig. 5B). Furthermore, when examined the subcellular localization of P8 and GOX in Sf9 co-expressed with HA-GOX in Sf9 cells, and evaluated by cells at 24 hpi by immunofluorescence microscopy. When ex- fluorescence microscopy, these mutants and the full length pressed in Sf9 cells alone, P8 was distributed in a diffuse man- P8 exhibited similar punctate distribution in the cells (Data ner throughout the cytoplasm (Fig. 4A, a–c), and GOX was not shown). These results suggest that the site-specific cleav- distributed in discrete, punctuate inclusions (Fig. 4A, d–f). ages of RDV P8 have no effect on the interaction between However, when P8 was coexpressed with GOX, P8 colocalized P8 and GOX. F. Zhou et al. / FEBS Letters 581 (2007) 34–40 37

Fig. 2. Alignment of glycolate oxidases from Oryza sativa, Spinacia oleracea, Arabidopsis, Homo sapiens, Caenorhabditis elegans, and Drosophila. The alignment was made using DNAMAN (4.0). Identical and conservatively substituted amino acid residues are shown. The 181 amino acid residues identiﬁed in the yeast two-hybrid screening are underlined.

Fig. 3. Co-immunoprecipitation assays to detect RDV-P8 interaction with GOX. Human embryonic kidney 293T cells (2 · 106) were transfected with 10 lg of a plasmid expressing HA-tagged GOX, together with 10 lg of a plasmid expressing FLAG-tagged P8. Cell lysates were immunoprecipitated with anti-HA antibody (aHA), anti-FLAG antibody (aF) or control IgG (C), and Western blotting analysis was performed with anti-HA (A) or anti-FLAG (B) antibodies. Expression of the indicated plasmids was conﬁrmed by Western blotting analysis of the lysates (L) with anti-HA and anti-FLAG antibodies.

4. Discussion icles that are intimately associated with modiﬁed cell organ- elles, including the early and late endomembrane systems, A number of DNA viruses must enter the nucleus to repli- the nuclear envelope, vacuoles, endosomes and lysosomes, per- cate, whereas most RNA viruses replicate in the cytosol. Pre- oxisomes, chloroplasts, and mitochondria [23]. vious studies showed that replication of several plant RNA Positive-stranded RNA viruses induce proliferation and/or viruses in diﬀerent taxonomic genera occurs in membrane ves- reorganization of the intracellular membranes of their hosts 38 F. Zhou et al. / FEBS Letters 581 (2007) 34–40

CmyRSV synthesizes its replication form and/or replicative viral RNA intermediates [27]. Subsequent studies found a CmyRSV 33-kDa protein (p33) and a 92-kDa (p92) fusion protein localized at the peroxisomal membrane in infected and transgenic plant cells. The information of targeting the CymRSV replication complex to peroxisomes is encoded in the ORF1 p33 protein [29,30]. Viral replication may take place in the vesicles of MVBs as suggested by the association of the p33/p92 proteins with modified peroxisomes in infected cells [31,32]. This mechanism appears to be applied to tombusviruses in general, such as tomato bushy stunt virus (TBSV) [33] and cucumber necrosis virus (CNV) [34]. Double-stranded RNA viruses also form viroplasms in the cytoplasm of infected host cells. Using BrUTP, Silvestri et al. [35] labeled rotavirus synthesized RNA in infected cells and found that labeled RNA accumulated in viroplasm forming punctate centers in the cytoplasm. In mammalian orthoreovi- ruses infected cells, large cytoplasmic inclusions believed to be the sites of viral replication and assembly are also found [36,37]. The reovirus non-structural protein lNS expressed in transfected cells can form inclusions that resemble the globular viral factories formed in cells infected with reovirus strain type 3 Dearing (T3DN) [36,38]. However, in none of these cases have host-encoded factors that interact with viral proteins been found to target viral replication sites or to be components of the viral factories. RDV Pns12 forms viroplasms with viral non-structural proteins of Pns6, Pns11, Pns12 and all of the structural proteins (P1, P2, P3, P5, P7, P8, and P9) are present in infected VCM cells of insect vector. As an outer capsid protein, P8 was observed concentrating at the periphery of discrete, punctate inclusions [14]. However, the mechanisms whereby Pns12 forms the viroplasms and how P8 accumulates in the viroplasms has not previously been shown. Our results reveal that P8 expressed in Sf9 cells alone is scat- Fig. 4. Subcellular localization of P8 and GOX. (A) Immunofluores- tered diffusely in the cytoplasm a before 24 hpi, and is distrib- cence microscopy assay. Sf9 cells were infected with virus encoding FLAG-P8 and/or HA-GOX. Cells expressing FLAG-P8 (a–c) or HA- uted in discrete, punctuate inclusions after 36 hpi, but not in GOX (d–f) were immunostained with a monoclonal FLAG or HA as the periphery of the cells (Fig. 4C). Rice GOX is distributed primary antiserum and a FITC-conjugated secondary antibody at in discrete, punctuate inclusions in Sf9 cells, and when P8 24 hpi. Cells co-expressing FLAG-P8 and HA-GOX (g–i) were was coexpressed with rice GOX, P8 is colocalized with GOX immunostained with a monoclonal FLAG conjugated with FITC- secondary antibody and a polyclonal HA conjugated with TRITC- in discrete, punctuate inclusions, not present in a diffuse man- secondary antibody. The FITC and TRITC signals are shown as green ner (Fig. 4A, g–i). The images from confocal immunofluores- and red, respectively. In the merged images (i), the overlapping signals cence microscopy studies exhibited distinct fluorescence of FLAG-P8 (g) and HA-GOX (h) appear as yellow. The nucleus staining of P8 and GOX, confirming that P8 was co-localized stained by Hoescht were shown as blue (b, e). (B). Confocal in the peroxisomes of insect cells with GOX (Fig. 4B). Immunofluorescence micrographs of Sf9 cells co-expressing FLAG- P8 and HA-GOX at 24 hpi. (j) FITC labeled FLAG-P8, (k) TRITC Glycolate oxidase is a highly conserved protein among labeled HA-GOX, (l) Merged image of j, k. (C). Subcellular localiza- eukaryotes. Rice GOX has about 80% identity to other plant tion of FLAG-P8 expressed in Sf9 cells, as determined at different GOX, e.g. Spinach and Arabidopsis, and about 50% identity times course pi. Cells were immunostained with a monoclonal FLAG to animal GOX, e.g. Caenorhabditis elegans, Drosophila, and as primary antiserum and a FITC-conjugated secondary antibody. Images were obtained by confocal microscopy. Immunostaining of P8 Homo sapiens. We presume that RDV P8 binds to glycolate is shown in green. Scale bars = 10 lm. oxidases of most eukaryotes. Thus the translocation of P8 in Sf9 cells results from the interaction between P8 and endogenous glycolate oxidase. to create a membrane compartments in which RNA replica- Peroxisomes are present in a wide variety of eukaryotic cells, tion takes place. These include chloroplasts in tymovirus in- from yeast to humans, and function in various metabolic path- fected cells [2,24–26] and peroxisomes in tombusvirus infected ways [39]. Peroxisomal proteins are encoded by nuclear genes cells [27]. Cymbidium ringspot virus (CymRSV) elicits the for- and are translated on free polyribosomes in the cytosol [40]. mation of vesiculated structures (multivesicular bodies, MVBs) These proteins are transported from their synthesis sites in that consist of a main body surrounded by many spherical to the cytoplasm to their final locations in the peroxisome matrix ovoid vesicles ranging from 80 to 150 nm in diameter that re- or membrane. Import of most peroxisomal matrix proteins is sult from proliferation of the limiting peroxisome membranes mediated by two types of cis-acting peroxisomal targeting sig- [28]. Thus, the peroxisome appears to be the organelle in which nals (PTSs): the C-terminal uncleavable tripeptide PTS1, -S/A/ F. Zhou et al. / FEBS Letters 581 (2007) 34–40 39

Fig. 5. Interaction of truncated P8 mutants with GOX. (A) Schematic representation of P8 various deletions. The two cleavage sites of P8 are indicated. (B) Co-immunoprecipitation (IP) assays to detect possible interaction between truncated P8 mutants and GOX. 293T cells were transfected with combinations of HA-tagged GOX, and FLAG-tagged truncated P8 mutants, respectively, P8DC (left), P8DNC (middle), or P8DN (right). Cell lysates were immunoprecipitated with anti-HA antibody (aHA), anti-FLAG antibody (aF) or control IgG (C), and Western blotting analysis was performed with anti-FLAG antibodies as described in Section 2.

CK/R/H-L/(M) [41,42], and the non-apeptide presequence [3] Gupta, S., De, B.P., Drazba, J.A. and Banerjee, A.K. (1998) PTS2, -(R/K)(L/V/I)X5(H/Q)(L/A)-, located at the N-terminus Involvement of actin microfilaments in the replication of human [43,44]. Glycolate oxidase is a very important enzyme in the parainfluenza virus type 3. J. Virol. 72, 2655–2662. [4] Tolonen, N., Doglio, L., Schleich, S. and Krijnse, L.J. (2001) peroxisome and the C-terminus of glycolate oxidase functions Vaccinia virus DNA replication occurs in endoplasmic reticu- as a targetting signal that directs GOX into plant leaf peroxi- lum-enclosed cytoplasmic mini-nuclei. Mol. Biol. Cell 12, 2031– somes [45,46]. 2046. RDV P8 contains neither PTS1 nor PTS2 signals, suggesting [5] Roizman, B. and Knipe, D.M. (2001) Herpes simplex viruses and their replication in: Fields Virology (Knipe, D.M., Howley, P.M., that it is localized to the peroxosomes via interactions with Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B. and other proteins. Based on our previous results and the present Straus, S.E., Eds.), 4th edn, pp. 2399–2460, Lippincott Williams & investigation, we conclude that RDV P8 interacts with the gly- Wilkins, Philadelphia, PA. colate oxidase and this interaction leads to P8 targeting into [6] Shikata, E. and Galvez, G.E. (1969) Fine flexuous threadlike the peroxisome. We further propose that peroxisomes partici- particles in cells of plants and insect hosts infected with rice hoja blanca virus. Virology 39, 635–641. pate in formation of the RDV replication complex in vivo by [7] Fukushi, T., Shikata, E. and Kimura, I. (1962) Some morpho- serving as the origin of the viroplasm. Host-encoded factors logical characters of rice dwarf virus. Virology 18, 192–205. play an important role in virus multiplication, acting in concert [8] Boccardo, G. and Milne, R. (1984) Plant reovirus group in: CM/ with virus-encoded factors. However, information regarding AAB Descriptions of Plant Viruses Commonwealth Mycological Institute and Association of Applied Biologists (Morant, A.F. the host factors involved in this process is limited. Our findings and Harrison, B.D., Eds.), p. 294, Unwin Brothers, Gresham have broad significance in studying the mechanisms whereby Press, Old Woking, England. viruses target the appropriate replication sites to begin their [9] Zhu, S., Gao, F., Cao, X., Chen, M., Ye, G., Wei, C. and Li, Y. replication. (2005) The rice dwarf virus P2 protein interacts with ent-kaurene oxidases in vivo, leading to reduced biosynthesis of gibberellins and rice dwarf symptoms. Plant Physiol. 139, 1935–1945. Acknowledgments: We thank Dr. Hong-Bing Shu (Department of [10] Zheng, H., Li, Y., Yu, Z.H., Li, W., Chen, M.Y. and Chen, Z.L. Immunology, National Jewish Medical and Research Center, Univer- (1997) Recovery of transgenic rice plants expressing the rice dwarf sity of Colorado Health Sciences Center, Denver, Colorado) for pro- virus outer coat protein(S8). Theor. Appl. Genet. 94, 522–527. viding Co-IP vectors and advice, and Dr. Xiaoqin Su (Peking [11] Cao, X., Zhou, P., Zhang, X., Zhu, S., Zhong, X., Xiao, Q., Ding, University) for technical support. This work was supported by Key B. and Li, Y. (2005) Identification of an RNA silencing Basic Research Program 973 (2006CB101903 to W.C.H.) and Key suppressor from a plant double-stranded RNA virus. J. Virol. Natural Science Foundation of China (30530030 to Y.L.). 79, 13018–13027. [12] Li, Y., Bao, Y.M., Wei, C.H., Kang, Z.S., Zhong, Y.W., Mao, P., Wu, G., Chen, Z.L., Schiemann, J. and Nelson, R.S. (2004) Rice dwarf phytoreovirus segment S6-encoded nonstructural References protein has a cell-to-cell movement function. J. Virol. 78, 5382– 5389. [1] Miller, D.J., Schwartz, M.D. and Ahlquist, P. (2001) Flock house [13] Shikata, E. (1981) Reoviruses in: Handbook of Plant Virus: virus RNA replicates on outer mitochondrial membranes in Infections and Comparative Diagnosis (Kurstak, E., Ed.), pp. Drosophila cells. J. Virol. 75, 11664–11676. 423–451, Elsevier/North-Holland Biomedical Press, Amsterdam. [2] Prod’homme, D., Le Panse, S., Drugeon, G. and Jupin, I. (2001) [14] Wei, T., Shimizu, T., Hagiwara, K., Kikuchi, A., Moriyasu, Y., Detection and subcellular localization of the turnip yellow mosaic Suzuki, N., Chen, H. and Omura, T. (2006) Pns12 protein of Rice virus 66K replication protein in infected cells. Virology 281, 88– dwarf virus is essential for formation of viroplasms and nucle- 101. ation of viral-assembly complexes. J. Gen. Virol. 87, 429–438. 40 F. Zhou et al. / FEBS Letters 581 (2007) 34–40

[15] Omura, T., Yan, J., Zhong, B., Wada, M., Zhu, Y., Tomaru, M., [31] Lupo, R., Rubino, L. and Russo, M. (1994) Immunodetection of Maruyama, W., Kikuchi, A., Watanabe, Y., Kimura, I. and the 33 K/92 K polymerase proteins in cymbidium ringspot virus- Hibino, H. (1998) The P2 protein of rice dwarf phytoreovirus is infected and in transgenic plant tissue extracts. Arch. Virol. 138, required for adsorption of the virus to cells of the insect vector. J. 135–142. Virol. 72, 9370–9373. [32] Rubino, L. and Russo, M. (1998) Membrane targeting sequences [16] King, L.A. and Possee, R.D. (1992). The Baculovirus Expression in tombusvirus infections. Virology 252, 431–437. System. A Laboratory Guide, Chapman & Hall, London. [33] McCartney, A.W., Greenwood, J.S., Fabian, M.R., White, K.A. [17] Mao, Z.J., Li, Y., Xu, H., Zheng, H.H., Schiemann, J., Casper, R. and Mullen, R.T. (2005) Localization of the tomato bushy stunt and Chen, Z.L. (1998) The 42K protein of rice dwarf virus is a virus replication protein p33 reveals a peroxisome-to-endoplasmic post-translational cleavage product of the 46K outer capsid reticulum sorting pathway. Plant Cell 17, 3513–3531. protein. Arch. Virol. 143, 1831–1838. [34] Panavas, T., Hawkins, C.M., Panaviene, Z. and Nagy, P.D. [18] Huang, J., Teng, L., Li, L., Liu, T., Li, L., Chen, D., Xu, L.G., (2005) The role of the p33:p33/p92 interaction domain in RNA Zhai, Z. and Shu, H.B. (2004) ZNF216 Is an A20-like and replication and intracellular localization of p33 and p92 proteins IkappaB kinase gamma-interacting inhibitor of NFkappaB acti- of Cucumber necrosis tombusvirus. Virology 338, 81–95. vation. J. Biol. Chem. 279, 16847–16853. [35] Silvestri, L.S., Taraporewala, Z.F. and Patton, J.T. (2004) [19] Sambrook, J., Fritch, E.F. and Maniatis, A. (1989) Molecular Rotavirus replication: plus-sense templates for double-stranded Cloning: A Laboratory Manual, 2nd edn, Cold Spring Harbor RNA synthesis are made in viroplasms. J. Virol. 78, 7763–7774. Laboratory Press, Cold Spring Harbor, New York. [36] Broering, T.J., Kim, J., Miller, C.L., Piggott, C.D., Dinoso, J.B., [20] Han, K.J., Su, X., Xu, L.G., Bin, L.H., Zhang, J. and Shu, H.B. Nibert, M.L. and Parker, J.S. (2004) Reovirus nonstructural (2004) Mechanisms of the TRIF-induced interferon-stimulated protein mu NS recruits viral core surface proteins and entering response element and NF-kappaB activation and apoptosis core particles to factory-like inclusions. J. Virol. 78, 1882–1892. pathways. J. Biol. Chem. 279, 15652–15661. [37] Coombs, K.M. (2006) Reovirus structure and morphogenesis. [21] Hu, W.H., Johnson, H. and Shu, H.B. (2000) Activation of NF- Curr. Top. Microbiol. Immunol. 309, 117–167. kappaB by FADD, Casper, and caspase-8. J. Biol. Chem. 275, [38] Broering, T.J., Arnold, M.M., Miller, C.L., Hurt, J.A., Joyce, 10838–10844. P.L. and Nibert, M.L. (2005) Carboxyl-proximal regions of [22] Zheng, H., Yu, L., Wei, C., Hu, D., Shen, Y., Chen, Z. and Li, Y. reovirus nonstructural protein muNS necessary and sufficient for (2000) Assembly of double-shelled, virus-like particles in trans- forming factory-like inclusions. J. Virol. 79, 6194–6206. genic rice plants expressing two major structural proteins of rice [39] van den, B.H., Schutgens, R.B., Wanders, R.J. and Tager, J.M. dwarf virus. J. Virol. 74, 9808–9810. (1992) Biochemistry of peroxisomes. Annu. Rev. Biochem. 61, [23] Smith, A.E. and Helenius, A. (2004) How viruses enter animal 157–197. cells. Science 304, 237–242. [40] Lazarow, P.B. and Fujiki, Y. (1985) Biogenesis of peroxisomes. [24] Jakubiec, A., Notaise, J., Tournier, V., Hericourt, F., Block, Annu. Rev. Cell Biol. 1, 489–530. M.A., Drugeon, G., van Aelst, L. and Jupin, I. (2004) Assembly [41] Gould, S.J., Keller, G.A., Hosken, N., Wilkinson, J. and of turnip yellow mosaic virus replication complexes: interaction Subramani, S. (1989) A conserved tripeptide sorts proteins to between the proteinase and polymerase domains of the replication peroxisomes. J. Cell Biol. 108, 1657–1664. proteins. J. Virol. 78, 7945–7957. [42] Miura, S., Kasuya-Arai, I., Mori, H., Miyazawa, S., Osumi, T., [25] Prod’homme, D., Jakubiec, A., Tournier, V., Drugeon, G. and Hashimoto, T. and Fujiki, Y. (1992) Carboxyl-terminal consensus Jupin, I. (2003) Targeting of the turnip yellow mosaic virus 66K Ser-Lys-Leu-related tripeptide of peroxisomal proteins functions replication protein to the chloroplast envelope is mediated by the in vitro as a minimal peroxisome-targeting signal. J. Biol. Chem. 140K protein. J. Virol. 77, 9124–9135. 267, 14405–14411. [26] Matthews, R.E. (1981) Portraits of viruses: turnip yellow mosaic [43] Osumi, T., Tsukamoto, T., Hata, S., Yokota, S., Miura, S., virus. Intervirology 15, 121–144. Fujiki, Y., Hijikata, M., Miyazawa, S. and Hashimoto, T. (1991) [27] Russo, M., Di Franco, A. and Martelli, G.P. (1983) The fine Amino-terminal presequence of the precursor of peroxisomal 3- structure of Cymbidium ringspot virus infections in host tissues. ketoacyl-CoA thiolase is a cleavable signal peptide for peroxi- III. Role of peroxisomes in the genesis of multivesicular bodies. J. somal targeting. Biochem. Biophys. Res. Commun. 181, 947–954. Ultrastruct. Res. 82, 52–63. [44] Swinkels, B.W., Gould, S.J., Bodnar, A.G., Rachubinski, R.A. [28] Russo, M., Di Franco, A. and Martelli, G.P. (1987) Cytopathol- and Subramani, S. (1991) A novel, cleavable peroxisomal target- ogy in the identification and classification of tombusviruses. ing signal at the amino-terminus of the rat 3-ketoacyl-CoA Intervirology 28, 134–143. thiolase. EMBO J. 10, 3255–3262. [29] Navarro, B., Rubino, L. and Russo, M. (2004) Expression of the [45] Volokita, M. (1991) The carboxy-terminal end of glycolate Cymbidium ringspot virus 33-kilodalton protein in Saccharomy- oxidase directs a foreign protein into tobacco leaf peroxisomes. ces cerevisiae and molecular dissection of the peroxisomal Plant J. 1, 361–366. targeting signal. J. Virol. 78, 4744–4752. [46] Brickner, D.G., Harada, J.J. and Olsen, L.J. (1997) Protein [30] Burgyan, J., Rubino, L. and Russo, M. (1996) The 50-terminal transport into higher plant peroxisomes. In vitro import assay region of a tombusvirus genome determines the origin of provides evidence for receptor involvement. Plant Physiol. 113, multivesicular bodies. J. Gen. Virol. 77 (Pt 8), 1967–1974. 1213–1221.