i

THE PHYSIOLOGICAL AND MOLECULAR MECHANISM OF CHROMIUM TOLERANCE AND HYPERACCUMULATION IN Crambeabyssinica R.E.Fr.

By ASMA ZULFIQAR

AUGUST, 2011

DEPARTMENT OF BOTANY

A THESIS SUBMITTED FOR FULFILLMENT OF THE DEGREE OF DOCTOR OF PHILOSOPHYIN BOTANY

ii

DEDICATED TO MY PARENTS, MY HUSBAND & CHILDREN

iii

Table of Contents

Page No.

Acknowledgements iv

Summary vi

List of Tables viii

List of figures ix

List of Abbreviations xii

Chapter 1: Introduction 01

Chapter 2: Literature Review 07

Chapter 3: Material and Methods 15

Chapter 4:Genes induced in response to chromium exposure in Crambeabyssinica, a heavy metal accumulator 42

Chapter 5:Bacterial Complementation Assays 64

Chapter 6:Cloning Of Three Important Genes 74

Chapter 7:Physiological Studies ofCrambe 81

Chapter 8:Discussion 95

References 111

Conclusion xiii

Appendix xiv

iv

Acknowledgements I owe the foremost thanks to my country and my institution, The University of the Punjab, Lahore, Pakistan. The Higher Education Commission (HEC), Government of Pakistanprovided me funding to carry out this work. The financial support of the HEC for research work at University of Massachusetts, Amherst, USA, under a split Ph.Dprogram is highly acknowledged. During the course of this work, I have been fortunate to receive help, guidance and critical advice from a number of experienced and kind people. First of all, I owe my gratitude and sincere thanks to my supervisor, Prof. Dr. Firdaus-e-Bareen, Department of Botany, University of the Punjab, Lahore, whose patience, considerate attitude, insight to understand the situation will always be appreciated. I am deeply grateful to my co-Supervisor, Dr. Om ParkashDhanker, Assistant Professor, Department of Plant, Soil and Insect Sciences, University of Massachusetts, Amherst, USA for his vital instructions and intellectual guidance in the accomplishment of the proposed thesis work. Special thanks are also due to Prof. Dr. Khan RassMasood, Chairman, Department of Botany, University of the Punjab, and Lahore for his cooperation. I also owe my special thanks to Dr. Michelle Dacosta, Department of Plant, Soil and Insect Sciences for designing experiments on the physiological part of my thesis work. I am extremely thankful to Prof. Dr Allen V. Barker and Prof. Dr Stephen Herbert for their sincere cooperation. My special thanks are due to BibinPaulose, myreserach fellow and Graduatestudent at UMass from whom I got hands on training in molecular biology. His outstanding help extended towards mehelped in completing the molecular part of my thesis. In addition I am also thankful to my other lab fellows, IndrajitDutta, Anirudha Dixit, Denise Debrito, Kareem Musa, Sudesh for their nice association. I am greatly indebted to Muhammad IqbalZaman for his all-out efforts in my academic issues confronted abroad. I am especially indebted to my mother who looked after my affairs and my children in my absence and whose cooperation made it possible for me to avail this scholarship to UMass. My Husband and children (Haris&Hammad) are of special focus of my thanks as without their sacrifice I could not have been accomplished this project. I particularly owe thanks to my husband who encouraged me at each step in my academic pursuits. I am also thankful to my in-laws for taking care of my children. I would mention the name of my Brother-in-law Zahid Salman whose unending services towards my children are worth appreciation. v

I am deeply indebted to my colleagues Dr. HumeraAfrasiab, who took care of my professional affairs during my studies abroad and MsFarkahandaJabeen of whose cooperation and help I always speak high. AsmaZulfiqar 2011 vi

Summary

Chromium (Cr) pollution has received considerable attention in recent years. Chromate [Cr (VI)] is generally considered to pose a severe human health risk because of its being toxic, mutagenic, and carcinogenic nature. There is no cost-effective, environmental-friendly Cr remediation strategy available so far. Plants can be used to clean up the Cr contamination by accumulating, stabilizing or transformingCr into less toxic chromium ion [Cr (III)]. Preliminary studies showed crambe (CrambeabyssinicaHochst. ex R.E. Fries)to be a potential candidate for phytoremediation of Cr-contaminated soils and sediments. The present study was undertaken with an aim to isolate the genes induced in response to Cr stress in crambe. Seven-day-old seedlings of o crambe were exposed to 150 µM potassium chromate (K2CrO4) for 24 hours at 22 C. Differentially expressed genes in response to Cr were isolated by employing suppression subtraction hybridization (SSH). Forward and reverse subtraction approaches were used to identify Cr up-regulated and down-regulated genes, respectively. After subtraction and differential screening of clones from the isolated gene pool, a total of 72 differentially expressed subtracted cDNAs were sequenced and found to represent 43 genes. The subtracted cDNAs suggest that Cr stress significantly affects pathways related to stress/defense, ion transporters, sulfur assimilation, cell signaling, protein degradation, photosynthesis and cell metabolism. The regulation of Cr-modulated genes was further validated by semi-quantitative polymerase chain reaction (PCR). These genes code for chitinases, Thi-J-like protein, peroxidases, glutathione-S-transferases, gamma-glutamyl- cysteine synthetase, and glutathione synthetase, aquaporins, oxidoreductases, harpins, and YSL proteins. Many novel sequences were also reported to be present in the library. One of the strong signals communicated by this study is the severe toxicity of chromate almost invariably affecting genes associated with the important metabolic pathways in plants. The candidate genes can be used to engineer non-food, high- biomass crambe plants for phytoremediation of Cr-contaminated soil and sediments.

The potential of crambe for Cr tolerance has been evaluated on assessing the photosynthetic efficiency and activity of different antioxidants enzymes by exposing it with 150µM concentration of potassium chromate (VI) in a time dependent study. Cr stress resulted in significant decline in photochemical efficiency (Fv/Fm) only in delayed Cr treatment. Quantum yield of leaf (Fs/ Fms) exhibited a decline initially in the beginning of Cr-treatment, readjusting to some extent withthe passage of time and again exhibiting a significant decline in later stages. An increase in Superoxide dismutase (SOD) activity vii was observed in later stages of Cr exposure in root while it remained constantly lowered than control plants in leaf for the whole duration of experiment. Root APX and GPX also showed the same trend as that of leaf. Both enzymes showed a resistance to Cr stress in the whole seedlings. CAT activity remained high all along while in roots it increased with prolonged exposure of Cr. Lipid peroxidation showed a gradual increase with increase in concentration and duration of Cr (VI) treatment. In short, Cr stress in crambe was caused due to oxidative stress as reflected by a decline in antioxidant enzyme activities and consequent increases in lipid peroxidation in earlier treatments. Crambe was better adapted to Cr stress during later stages as exhibited by decline in lipid peroxidation and elevated antioxidant enzyme activities. Based upon these findings, it can be concluded that Cr resistance might be attributed towards an increased and prolonged maintenance of antioxidant enzymes activity. We can further infer that peroxidases and catalases could serve as important components of antioxidant defense mechanisms in crambe to combat metal induced oxidative injury.

Cloning of three differentially expressed genes i.e, AtTIL, AtHrpand TJLP1isolated in subtracted cDNA was successfully carried out and it may enable the engineering of non-food, high- biomass plants, including C. abyssinica, for phytoremediation of Cr- contaminated soils and sediments. The physiological functions of three genes i.e, Harpin (Hrp), Lipocaline (TIL1), Thij (Tjlp1) were investigated by cloning these genes into plasmid pGEM-T by PCR, creating plasmid (pHrp), (pTIL1) and (pTjlp1), respectively and transforming E. coli strains W3110 and RW3110 with these constructs. No conclusive results were obtained in all three complementation studies negating their implication in Cr metabolism based upon these findings.

viii

List of Tables

Serial No Description Page No

Table No 3.1 Interpretation of results 27

Table No 4.1 45 Relative frequency,identity and description of differentially expressed subtracted cDNA transcripts from C. abyssinica after 24 hr exposure to potassium chromate.

Table No 4.2 Identity and description of 57 down regulated subtracted cDNA transcripts from C. abyssinica after 24 hr exposure to potassium chromate

ix

List of Figures

SERIAL NO. DESCRIPTION PAGE NO.

Figure 3.1 Crambeabyssinicagrowing in flower beds (A). A closer 15 view of the flowering stage is shown in (B).

Figure 3.2 Different views of hydroponic setup supporting Crambe for 17 Cr-treatment

Figure 3.3 Overview of the PCR-Select procedure 19

Figure 3.4 A graphical view of the PCR- Select procedure 22

Figure 3.5 Flow chart for experimental set-up for PCR-Select cDNA 25 subtraction and differential screening

Figure 4.1 Effect of potassium chromate on fresh biomass of Crambe 42

Figure 4.2 Cr accumulation in shoots (A) and roots (B) 43

Figure 4.3 Colony array for differential screening of subtracted cDNA 47 hybridized with P32-labeled forward subtracted probe (A) and reverse subtracted probe (B).

Figure 4.4 Cr-induced subtracted cDNAs encoding proteins involved 48 in various functional categories

Figure 4.5 Semi-quantitative RT-PCR analysis of the 54 crambeabyssinica transcripts corresponding to the subtracted cDNAs after 0,6,12,and 24 hr of potassium chromate treatments.

Figure 4.6 Expression levels (fold-change) of Cr-induced mrna 55 transcripts relative to untreated controls measured as difference in relative band intensity using ImageJ

Figure 4.7 Differential screening of cDNA clones from the crambe 58 SSH library. Reverse Cr-treated plant specific library is shown. Duplicate dot-blots were prepared and the membranes were hybridized with radiolabeled probes. An array representing 193 clones from reverse SSH library hybridized with subtracted tester cDNA probe (non-treated Cr plant) (A) and substracted control cDNA probe (Cr- x

treated plant) (B).

Figure 4.8 Functional categories of Cr-responsive down regulated 59 genes isolated from reverse SSH

Library

Figure 5.1 Bacterial complementation studies of AtHrp, AtTIL1 and 63 AtTIJP in E. coli strains W3110 and AW3110 at LB Agar medium with various concentration of potassium chromate(A) Complete setup (B) closer view AT 0,20 and 25ppm.

2- Figure 5.2 Expression of AtHrp investigating tolerance to CrO4 65 bearing vector plasmid pGEM with the 20 ppm (A) and 2 25ppm (B) CrO4 - concentrations in liquid LB.

2- Figure 5.3 Expression of AtTIL1 investigating tolerance to CrO4 67 bearing vector plasmid pGEM with the 20 ppm (A) and 2- 25ppm (B) CrO4 concentrations in liquid LB.

2- Figure 5.4 Expression of Tjip1 investigating tolerance to CrO4 69 bearing vector plasmid pGEM with the 20 ppm (A) and 2- 25ppm (B) CrO4 concentrations in liquid LB.

Figure 6.1 Diagrams of AtTIL1, AtHrp, Tjlp1 constructs. Physical map 72 of AtTIL1, AtHrp and Tjlp1 cloned under the control of ACT2 promoter-terminator expression cassette, in binary vector pBIN1tomakeplasmid (A) pBIN19/Act2pt/AtTIL1,(B) pBIN19/Act2pt/AtHrp, (C)pBIN19/Act2pt/Tjlp1 for plant transformation respectively

Figure 6.2 2% Agarose gel showing the restriction digestion (A) and 74 ligation (B) of fragments for detection of Act2pt/TIL1

Figure 6.3 2% Agarose gel showing the ligation of Act2pt/AtHrp (A) 76 Act2pt cassette (B) and transformation of Agrobacterium tumefaciens(C) with Act2pt/AtHrp

Figure 6.4 2% Agarose gel showing the ligation of fragments for 77 detection of Act2pt/Tjlp1

Figure 7.1 Changes in Cr content for Cr treated and Control plants of 80 leaf (A) and root (B).

Figure 7.2 Effect of Cr-treatment (Stress) on the photochemical 81 efficiency (Fv/Fm) (A) and on quantum yield (Fs/Fms) (B) of Crambe leaves, xi

Figure 7.3 APX enzyme activity for leaf (A) and root (B) of Cr-treated 83 and control plants.

Figure 7.4 GPX enzyme activity for leaf (A) and root (B) of Cr-treated 85 and control plants.

Figure 7.5 CAT enzyme activity for leaf (A) and root (B) of Cr-treated 86 and control plants.

Figure 7.6 Sod enzyme activity for leaf (A) and root (B) of Cr-treated 88 and control plants.

Figure 7.7 Changes in the levels of lipid peroxidation, as measured 89 using MDA content for leaf (A) and root(B) of Cr-treated and control plants.

Figure 7.8 Changes in leaf electrolyte leakage (A) and RWC (B) in 91 leaves of Crambe of Cr-treated and control plants.

xii

List of Abbreviations

Abbreviations Description

APX ASCORBATE PEROXIDASE

ESTS EXPRESSED SEQUENCE TAGS GSHPX GLUTATHIONE PEROXIDASE GPX GUAIACOL PEROXIDASE GSH GLUTATHIONE mRNA MESSENGER RNA PCR POLYMERASE CHAIN

REACTION PS11 PHOTOSYSTEM II mRNA MESSENGER RNA PCR POLYMERASE CHAIN REACTION PS11 PHOTOSYSTEM II ROS REACTIVE OXYGEN SPECIES SOD SUPEROXIDE DISMUTASE

xiii

Conclusions

Our study revealed novel insights into the plant defense mechanisms and the regulation of genes and gene networks in response to chromium toxicity. Stimulation of glutathione metabolism, amino acid synthesis, activation of numerous stress or defense- related proteinsand upregulation of enzymes in the ubiquitination pathway of protein degradation as well as several unknown novel proteins serve as molecular evidence for the physiological responses to Cr stress in plants .a significant metabolic response to counteract the toxicity of Cr. Additionally, many of these cDNA clones showing strong upregulation due to chromate stress could be used as valuable markers. Further characterization of these differentially expressed genes would be useful to develop novel strategies for efficient phytoremediation as well as for engineering chromate tolerant crops with reduced Cr translocation to the edible parts of plants.

Crambe, being a non-food high biomass crop, may serve as an ideal candidate for phytoremediation of Cr and other toxic metals as it has already been reported in case of arsenate toxicity. In addition, crambe can be readily genetically modified to further improve its tolerance to various toxic metals.The present study is the first transcriptomic analysis that identifies the genes/ gene networks differentially regulated in response to Cr stress in a heavy metal tolerant crop with phytoremediation potential. The results obtained from this study clearly indicate that an intricate interplay of various metabolic pathways may be involved in conferring tolerance to and hyperaccumulation of Cr. This is the first transcriptomic study that identified the genes regulated in response to Cr stress. This finding will not only be helpful in understanding the physiological and molecular mechanisms involved in Cr tolerance and accumulation in plants but will also enable the development of genetically engineered plant material with enhanced resistance to Cr stress.

The common factor among various biotic and abiotic stresses is the disruption of cellular oxidation-reduction homeostasis which ultimately leads to the oxidative stress or generation of reactive oxygen species (ROS; Asada, 1994). Cr stress in crambe was associated with oxidative stress as exhibited by a general decline in antioxidant enzyme activities and subsequent increases in lipid peroxidation in earlier treatments. Crambe was better adapted to Cr stress during later stages as exhibited by decline in lipid peroxidation and elevated antioxidant enzyme activities. It can be concluded that improved resistance under Cr stress is associated with an elevated and prolonged maintenance of antioxidant enzymes activity. It can be further inferred that peroxidases and catalases could serve as xiv important components of antioxidant defense mechanisms in crambe to combat metal induced oxidative injury. Moreover, the results of this study also suggest that APX, GPX and CAT in crambe may also serve as a biochemical stress indicators for Cr pollution.

1

Introduction

A surge in plant trace metal homeostasis research has occurred rapidly over the past decade (Van Hoff et al., 2001). This area was partly driven by the development of idea that metal-accumulating plants could be used for the decontamination of polluted soils (Chaney et al., 1997). The release of potentially toxic metals into the biosphere over the past 150 years diverted the attention towards this idea due to worldwide industrialization (Kerkeb and Kramer, 2003). Biological systems require a number of metal ions as micronutrients. Presence of excess essential or nonessential metal ions can disrupt numerous enzymatic and cellular functions (Clemens, 2002). The potentially harmful effects of metal ions are due to their high binding affinities for proteins, membranes and organic metabolites as well as the ability of some metals to undergo and catalyze redox reactions (Kerkeb and Kramer, 2003) causing oxidative stress in living tissues (Panda, 2007). Transition metals are usually present in the environment as trace elements. The transition metal chromium (Cr) is an important environmental pollutant. In recent years, contamination of the environment by Cr has become a major area of concern (Shiavon et al., 2008). Chromium is used on a large scale in different industries, including metallurgical, electroplating, paints, pigments and tanning industries, wood preservation, manufacturing of Cr chemicals and paper (Dixit et al., 2002). The cytotoxic effects of this metal on animals and plants are well documented and its mutagenicity turns it into the cause of different types of human cancer (Vajpayee et al., 2001). Chromium contaminated land is increasingly becoming an important environmental, health, economic and planning issue in Pakistan (Khan, 2001). The tanning industry, being a major contributor towards the foreign exchange earning of the country, holds the primary responsibility for Cr pollution. Almost 600 tanneries are operating under the control of government, among 50% of these are located in Kasur, a district of the Punjab province, with a long-standing tradition of leather tanning (Tariq et al., 2005). The effluents discharged from the leather processing units are discarded without any proper methods of waste disposal and recovery in most of the developing countries (Schloz and Lucas, 2003). The dissolved chemicals from these effluents infiltrate into the surrounding soil, rendering it unfit for the cultivation (Kisku et al., 2000). Plant growth and development are generally arrested by exposure to excess heavy metals (Hagemeier, 2004). High levels of Cr are toxic for plants, arresting their growth. A 2 number of toxic effects have been reported to be induced by Cr, including elicitation of polyamine synthesis followed by a reduction in growth (Jacobsen et al., 1992), interveinal chlorosis of young leaves and tissue necrosis (Sharma et al., 1995), altered water content of leaves (Barcelo et al., 1986), root system damage (Shanker et al., 2005), impaired uptake of various mineral nutrients (Dube et al., 2003; Gardea-Torresdey et al., 2005) and oxidative damage to cell membranes due to the formation of reactive oxygen species ( Stohs and Bagchi,1995; Pandey et al., 2005). Chromium occurs in several oxidation states, ranging from Cr (II) to Cr (VI). Trivalent Cr (III) and hexavalent Cr (VI) states are the most stable and common forms in the terrestrial environment (Dubey et al., 2010). Chromium (VI) can be easily transported across the cell membrane as well as through the phosphate-sulfate carrier. On the other hand, Cr (III) does not utilize any specific membrane carrier and hence enters into the cell through simple diffusion (Shanker et al., 2005). Use of wild type or engineered plants for extracting contaminant metals from polluted soils has received much attention in the recent past (Meagher, 2000). Current research has been focused on the plants showing potential for removing the toxic heavy metals from contaminated soil. Phytoremediation, a cost effective and non-intrusive technology that uses the remarkable ability of plants to concentrate elements and compounds from the environment and to metabolize various molecules in their tissues, appears very promising for the removal of heavy metals from the environment (Alkorta et al., 2004). This particular approach is based on the ability of plants to absorb toxic metals from the soil and translocate them to the shoot. Subsequently, by harvesting the shoots, contaminants are removed. Plants for phytoextraction should have the characteristics to tolerate high levels of metal, to accumulate reasonably high levels of the metal, to show rapid growth rate, to produce reasonably high biomass in the field and a profuse root system (Garbisu et al., 2002). The idea of using plants to remediate metal polluted soils came from the identification of ‘hyperaccumulator plants’ often endemic to naturally mineralized soils, that accumulate high concentrations of metal in their foliage. Various plant species are considered as natural hyperaccumulators for different heavy metals (Alkorta et al., 2004). Hyperaccumulator has been defined as the plant species accumulating >1000 mg kg-1 in its above ground tissues in the native habitat (Brooks et al., 1977; Reeves, 1992). Only about two species could be identified as Cr hyperaccumulators (Reeves and Baker, 2000), i.e., Dicoma niccolifera (Wild,1974) and Sutera fodina Wild (Baker and Brooks, 1989) in Zimbabwe, of which the maximum Cr 3 concentrations in the dry leaves were 1500 mg kg−1 and 2400 mg kg−1, respectively. Hyper accumulating species are considered those which accumulate more than 100 mg kg-1 of Cd, 1000 mg kg-1 of Cu, Cr, Pb and Ni or 10,000 mg kg-1 of Zn in the above ground parts of plants in dry weight of tissues (Brooks 1998; Baker et al. 1998; Schmidt 2003). From a biotechnological point of view, the identification of Cr-induced genes could lead to new strategies for the creation of transgenic plants that can accumulate this toxic metal in their harvestable part for phytoextraction. Gene expression patterns change when plants encounter excessive amounts of heavy metals (Jonak et al., 2004). Understanding the response of a plant to a stress requires a comprehensive evaluation of stress-induced changes in gene expression (Kreps et al., 2002). The success of phytoremediation depends upon an improved understanding of the biology involved in metal acquisition, movement of the metal inside the plant and shoots accumulation. Researchers have begun to address the major differences between the metal homeostasis networks of closely related metal hyperaccumulators and nonaccumulator plants at the molecular level. Using single gene and transcriptomic approaches, the most notable differences observed in hyperaccumulator plants compared to closely related nonaccumulator ones were high relative transcript levels (RTLs) of several candidate genes (Talke et al., 2006). In the past few years, a great progress has been made in identifying and characterizing metal accumulating genes. To improve phytoremediation of heavy metal polluted sites, a detailed molecular investigation on metal induced /regulated genes and their role in hyperaccumulation and/or tolerance in plants is needed. Molecular tools such as SSH, mRNA differential display and cDNA-AFLP have been successfully used to study the heavy metal regulated gene expression in various plants such as Arabidopsis, Brassica, Datura and Sesbania (Venkatachalam et al., 2008). Metabolomics can provide biochemical and physiological knowledge about plants subject to toxic metal stress, providing a much more details understanding of the molecular basis of hyperaccumulation. In addition The development of DNA and RNA microarray chip technologies in systematic genome mapping, sequencing, functioning and experimentation may allow the identification and genotyping of mutations and polymorphisms, allowing better insight into structure-function interaction of genome complexity under toxic metal stress (Mudgal et al., 2010). The Suppression Subtraction Hybridization (SSH) is a powerful technique that enables cloning of Expressed Sequence Tags (ESTs) representing genes that are differentially expressed in two different populations. Combining the 4 suppression Polymerase Chain Reaction (PCR) technique with the normalization and subtraction steps in a single reaction increases the possibility of identifying rarely expressed genes (Diatchenko et al., 1999). Earlier SSH has been applied in many studies to identify abiotic stress-regulated gene transcripts of plants (Hinderhofer and Zentgraf, 2001; Mahalingam et al., 2003; Watt, 2003). In the recent past, SSH has been used to study the differential expression of metal stress induced genes by Cd (Louie et al., 2003),

Al (Watt, 2003) and Cs (Sahr et al., 2004). Suppression subtractive hybridization (SSH) strategy was also employed more recently to isolate and characterize genes that are induced in response to high P in sunflower ( Padmanabhan and Sahi, 2011). Members of the plant family Brassicaceae have a key role in phytoremediation technology. Many wild Brassica species are known to hyperaccumulate heavy metals and possess genes for resistance or tolerance to the toxic effects of a wide range of metals (Palmer et al., 2001). Almost 87 Brassica species have been reported as hyperaccumulators of metals with the ability to tolerate very high level of heavy metals in the soil and more importantly in the shoots (Milner et al., 2008). Crambe (Crambe abyssinica Hochst. ex R. E. Fries) has the same lineage as the Brassicas. Many members of Brassicaceae are well adapted to a range of environmental conditions and some have demonstrated the potential for moderate levels of heavy metal accumulation under experimental conditions (Brooks et al., 1998). Keeping that in view, the physiological potential of Crambe for Cr decontamination of soil and sediments was explored in the present study. The aim of the first part of the study was to investigate the molecular mechanism involved in Cr tolerance and accumulation in Crambe abyssinica. In this study, crambe was used to investigate gene activation under Cr exposure towards the ultimate goal of elucidating the molecular responses to Cr. SSH was used in the present study to capture and enrich rare transcripts expressed in shoot and root tissues as a consequence of exposure to a demonstrably phytotoxic level of the Cr. In addition, induction specificity of the differentially expressed genes was further validated by semi-quantitative RT-PCR. Few studies have been performed on the molecular and physiological basis of Cr tolerance and accumulation in the plant. This is the first report of Cr induced transcriptomic studies in plants. Gene expression could be correlated to physiological processes that occurred in response to Cr stress. Plants have developed an antioxidant defense system in response to the generation of ROS (Reactive oxygen species) within plant tissues. The antioxidant 5 defense system comprises of enzymatic and non-enzymatic components that can be divided into two different types of repair mechanisms, production of antioxidants or antioxidant enzymes that directly react with and scavenge reactive oxygen species (ROS) including superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), peroxidase (POD) and α- tocopherol and production of enzymes that regenerate oxidized antioxidants such as glutathione, glutathione reducatase, ascorbate and ascorbate reductase. Accumulation of AOS results in increased antioxidant enzymes activities, providing indirect evidence for the extent of generation of ROS and the importance of these enzymes in scavenging free radicals. Under conditions of severe plant stress, the production of ROS may exceed the scavenging capacity of the antioxidant defense system (Breusegem et al., 1998). As a consequence, ROS can accumulate and cause cellular damage such as lipid peroxidation or the oxidation of phospholipids and other unsaturated lipids. Peroxidation results in the breakdown of lipids and membrane function by causing loss of fluidity, lipid crosslinking and inactivation of membrane enzymes. The extent of lipid peroxidation can be calculated by measurement of malondialldehyde (MDA) content, which is a secondary breakdown product of lipid peroxidation (Gutteridge, 1995). MDA content is commonly used for assessing lipid peroxidation and oxidative damage in both leaves and roots (Radic et al., 2005). Identifying and understanding the function of antioxidant defense mechanisms are important for developing Cr tolerant plants. The objective of this work was to determine whether Cr resistance in crambe could be associated with elevated and prolonged maintenance of antioxidant enzyme levels in response to Cr stress. Chlorophyll fluorescence analysis has become one of the most powerful and widely used techniques available to plant physiologists and Eco physiologists. No investigation into the photosynthetic performance of plants under field conditions seems complete without some fluorescence data. Fluorescence can give insights into the ability of a plant to tolerate environmental stresses and into the extent to which those stresses have damaged the photosynthetic apparatus (Maxwell and Johnson, 2000). In this study, in vivo chlorophyll fluorescence technique was applied also to Cr exposed plants and some fluorescence data was reported in this regard. Characterization of particular genes is usually carried out by expressing those genes in bacteria and plants. For this purpose the next step comprised of cloning of genes of interest to decipher the role of those encoded genes. Various molecular approaches 6 could ultimately characterize these genes including bacterial complementation studies. An investigation was also carried out in this direction.

7

Literature Review

The idea that plants can be used for environmental remediation is old and cannot be traced to any particular source. The work on plant metal tolerance and hyperaccumulation spanning the period from 1980’s and early 1990’s led to the realization that plants could be used to phytoextract metal pollutants from the soil (Salt, 2006). Hyper accumulation was a term first coined by Brooks et al. (1977) for plants that are endemic to metalliferous soils and are able to tolerate and accumulate metals in their aboveground tissues to very high concentrations (approx. 100 times that of a non accumulator plant species). The accumulation of higher metal concentration in shoots than in roots has been described as a characteristic of hyperaccumulation in both hydroponic and soil culture (Weber et al., 2004) The term “heavy metal” should be defined in relation to the position of the element in the period table, because this position is related to the chemical properties of compounds that include the element. Its definition should not be based on the density of the metal in elemental form as it was previously considered (Appenroth, 2010). Heavy metal ions play essential roles in many physiological processes. In trace amounts, several of these ions are required for metabolism, growth, and development. However, problems arise when cells are confronted with an excess of these vital ions or with non-nutritional ions that lead to cellular damage (Avery, 2001; Schützendübel and Polle, 2002; Gaetke and Chow, 2003; Polle and Schuützendübel, 2003). Heavy metal toxicity comprises of inactivation of biomolecules by either blocking essential functional groups or by displacement of essential metal ions (Goyer, 1997). In addition autoxidation of redox- active heavy metals and production of Reactive Oxygen Species (ROS) by the Fenton Reaction causes cellular injury (Stohs and Bagchi, 1995). There are believed to be over 450 plant species from a number of different families such as the Asteraceace, Brassicaceae, Caryophyllaceae, Fabaceae Poaceae, and Violaceae that possess the ability to tolerate very high levels of heavy metals in the soil and, more importantly, in the plant shoot. The Brassicaceae is the best represented amongst these metal-hyperaccumulator families with 87 Brassica species classified as metal hyperaccumulators. Hyperaccumulators can accumulate exceptional concentrations of trace elements in their aerial parts without visible toxicity symptoms. Over 450 plant species in 45 plant families (0.2% of angiosperms) have been identified as 8 hyperaccumulators of trace metals (Zn, Ni, Mn, Cu, Co and Cd), metalloids (As) and nonmetals (Se), the majority of them being Ni hyperaccumulators (Reeves & Baker, 2000; Ellis and Salt, 2003; Reeves, 2003, 2006; Sors et al., 2005; Milner & Kochian, 2008; Kramer, 2010). Members of the Brassicaceae family have attracted the interest of plant biologists for over a century because of their ability to colonize calamine and serpentine soils containing naturally elevated levels of heavy metals such as Zn, Pb, Cd, Ni, Cr, and Co (Pence et al., 2000). Arabidopsis halleri, is an emerging model species for the molecular elucidation of metal tolerance and hyperaccumulation (Becher et al., 2004; Weber et al., 2004; Craciun et al., 2006; Filatov et al., 2006). This species belongs to the family Brassicaceae and shares about 94% DNA sequence identity within coding regions with the non-metal-tolerant plant species, Arabidopsis thaliana (Becher et al., 2004). The practical utility of many hyperaccumulators for phytoremediation may be limited, because many of the species are slow-growing and produce little shoot biomass. This severely constrains their potential for large-scale decontamination of polluted soils (Ebbs et al., 1997). Transference of the genes responsible for the hyperaccumulating phenotype to higher shoot-biomass-producing plants has been suggested as a potential avenue for enhancing phytoremediation as a viable commercial technology (Rugh et al., 1998). Progress towards this goal has been hindered by a lack of understanding of the basic molecular, biochemical, and physiological mechanisms involved in heavy metal hyperaccumulation (Pence et al., 2000). Understanding of the basic mechanisms of metal tolerance and hyperaccumulation has come a long way in the past 5 years (Salt, 2006). A better understanding of the molecular and biochemical basis of this metal accumulation process should lead to development of both mineral nutrient fortified crops and plants suitable for phytoremediation of metal polluted soils and waters (Guerinot and Salt, 2001). The ecology and physiology of metal hyperaccumulator plants have been investigated since the 1970s, but researchers have addressed the molecular mechanisms underlying metal hyperaccumulation only recently (Kramer, 2010). Despite recent advances, the mechanisms underlying metal hyperaccumulation have not been clearly defined (Peer et al., 2006). Metal tolerance and hyperaccumulation are thought to have evolved through adaptation of metal homeostasis processes including metal uptake, chelation, trafficking, and storage (Pence et al., 2000; Pollard et al., 2002; Kramer, 2005; Clemens, 2006). Chelation of metals by the thiol-rich peptides, the phytochelatins, is involved in stress 9 responses to many metals in nonaccumulator plants (Cobbett and Goldsbrough, 2002). In contrast, phytochelatins appear to play no role in metal binding, tolerance, or accumulation in hyperaccumulator plants (Ebbs et al., 2002; Schat et al. 2002; Ueno et al. 2005). Nicotianamine (NA) is a low-molecular weight metal chelator that is required to maintain Fe, Zn, and Cu homeostasis in Arabidopsis thaliana and other plants. It exhibits higher stability constants for the binding of all transition metal cations and is present in higher concentrations in the hyperaccumulators, A. halleri and Noccaea caerulescens, than in closely related nonaccumulators. Metal-NA complexes are substrates of membrane transporters of the yellow stripe-like (YSL) and possibly other protein families, for some of which transcript levels are higher in hyperaccumulator plants than in non-accumulators. Metal toxicity can manifest itself through the interference between a metal present in excess and other micronutrient metals. Several candidate genes identified on the basis of their high expression in metal hyperaccumulators may function to maintain the homeostasis of nonaccumulated micronutrient metals in the presence of high fluxes or high amounts of the hyperaccumulated metal. To exploit the full potential of phytoremediation, it is obligatory to investigate the mechanisms responsible for tolerance and hyperaccumulation, using natural hyperaccumulators as model plant species (Baker et al., 2000). Many stresses including extreme environment and pollutants cause oxidative damage in part, at least. Evidence has indicated that Cd toxicity in plants is related to oxidative stress in plants through increased generation of reactive oxygen species and lipid peroxidation (Zhang et al., 2007). Majority of ROS scavenging pathways in plants involve SOD found in almost all cellular compartments, the water-water cycle in chloroplasts, the ascorbic acid –glutathione cycle in chloroplasts, cytosol, mitochondria, apoplast and peroxisomes, glutathione peroxidase

(GSHPX) and catalases( CAT) in peroxisomes (Mittler, 2002). The SOD catalyses the dismutation of O2-radicles to molecular oxygen and hydrogen which is subsequently reduced to H2O2 and O2 by CAT, guaiacol peroxidase (GPX) and ascorbate peroxidase (APX) (Aravind and Prasad, 2005). GSH (glutamylcyststeinyl glycine) functions well as an antioxidant because of its unique structural properties, broad redox potential, abundance and wide distribution in plants. Increased GSH levels were found to be related with exogenous Cd stress tolerance (Pietrini et al., 2003) and enhanced GSH biosynthesis has been reported to be an intrinsic response of plants against Cd stress (May et al., 1999). Plants have many potential sources of reactive oxygen species (ROS). Some are unavoidable byproducts of reactions involved in normal metabolism, such as 10 photosynthesis and respiration. Other sources of ROS belong to pathways enhanced during abiotic stresses. These include drought stress and desiccation, salt stress, chilling, heat shock, heavy metals, ultraviolet radiation, air pollutants such as ozone and SO2, mechanical stress, nutrient deprivation, pathogen attack and high light stress (Mittler, 2002). ROS can be viewed both as cellular indicators of stress as well as secondary messengers involved in the stress-response signal transduction pathway. Plant cells require two different mechanisms to regulate their intracellular ROS concentrations by scavenging of ROS, one that will enable the fine modulation of low levels of ROS for signaling purposes, and one that will enable the detoxification of excess ROS, especially during stress. Plants require a range of transition metals as essential micronutrients for normal growth and development. The transition metal Cr is an important environmental pollutant. Chromium is a primary noxious substance and is considered to pose a significant potential risk to human health because of its mutagenic and carcinogenic properties (Chaney et al., 1997; USEPA, 2000). In recent years, Cr pollution has become a serious problem worldwide, and as a consequence the remediation of Cr-contaminated areas has received considerable interest (Zayed and Terry, 2003). Chromite is known to occur with serpentine and other rocks of peridotite family in the North West of Pakistan. Chromite bearing rocks are mainly concentrated in the Quetta- Pishin and the Zhob basins in the Quetta Division and in the south and north Waziristan areas (Siddiqui, 1968). Cr contaminated land is increasingly becoming an important environmental, health, economic and planning issue in Pakistan (Khan, 2001). The leather product sector represents one of the most labor-intensive industrial commodities. Almost 600 tanneries are located either in residential area or industrial zones in close vicinity of agricultural lands. This industry has posed a serious threat to the urban life and sustainability. This industry uses a wider range of chemicals during various tannery processes. A large number of small scale tanneries located within the country have no access to the common treatment plants and discharge their waste into open fields or ditches. Toxic chemicals present in these effluents take diverse routes to reach human beings in food chain, i.e. by passing from soil to plants, and then via herbivorous animals to meat or milk. The use of sludge as a chief manure in agricultural practices is also common. These indiscrete methods of waste disposal contaminate the groundwater and soil in the vicinity of tanneries (Tariq et al., 2005) 11

Chromium is unique among regulated toxic elements in the environment in that the different species of Cr specifically Cr (III) and Cr (VI) are regulated in different ways, in contrast to other toxic elements where the oxidation state is not distinguished. The two common oxidation states of Cr present in the environment, i.e. Cr (III) and Cr (VI), are drastically different in charge, physicochemical properties as well as chemical and biochemical reactivity. Cr (VI) compounds are usually highly soluble, mobile and available compared to sparingly soluble trivalent Cr species. Cr (III) is considered to be a trace element essential for the proper functioning of living organisms. It was reported to be responsible for the control of glucose and lipid metabolism in mammals (Anderson, 1989). Occupational exposure of Cr (VI) leads to a variety of clinical problems. There is no evidence that Cr has any physiological function in plants. Although Cr is not considered to be essential for plant growth and development, some studies have indicated that at low concentrations (1 µM), Cr stimulates plant growth (Bonet et al., 1991). Chromium is toxic for agronomic plants at about 0.5 to 5.0 µg mL-1 in nutrient solution and 5 to 100 µg g-1 of available Cr in soil. Under normal conditions, the concentration of Cr in the plant is < 1 µg g-1. Chromium uptake by plants is mainly non- specific, probably as a result of plant uptake of essential nutrients and water. Plants can absorb both Cr (VI) and Cr (III). Chromium (VI) uptake has been reported to occur by an active mechanism, whereas Cr (III) uptake is passive, indicating that the two forms do not share a common uptake mechanism (Skeffington et al., 1976). Chromium is potentially toxic to higher plants at total tissue concentrations of approximately 0.1 mmol kg-1 dry weight (Mengel and Kirkby, 1982). Cr has a direct toxic effect on roots and a direct or indirect effect on leaves. The initial symptoms of Cr toxicity appeared as severe wilting and chlorosis of plants (Turner and Rust, 1971). Chlorosis, which appears in the upper leaves of Cr-affected plants, has been proposed as an indirect effect of Cr, probably due to the retardation of Fe and Zn translocation. Using non-hyperaccumulator plants has shown that Cr is mainly accumulated in the roots, and much less of the total Cr in a plant is in the leaves (Shewry and Peterson, 1974; Cary et al., 1977). The distribution of Cr between root and shoot in hyperaccumulator plants, however, indicated that the leaves also contained a much higher Cr concentration than that of nonhyperaccumulator plants, suggesting better translocation of Cr from root to shoot for hyperaccumulator plants. Although the detailed mechanisms of Cr translocation are not understood, there are reports that Fe-deficient and P-deficient plants can better translocate Cr from roots to shoots (Cary et al., 1977; Bonet et al., 1991). 12

These results lead to the hypothesis that Fe- and P-deficiency induced accumulation of organic acids, e.g., citric acid (Landsberg, 1981; De Vos et al., 1986; Johnson et al., 1994),which may play an important role in Cr translocation. Using a hyperaccumulator plant, Leptospermum scoparium, Lyon et al. (1969a,b) found that soluble Cr in leaf tissue 3- was present as the trioxalatochromium (III) ion, [Cr (C2O4)3] . It is known that even when taken up as Cr (VI), Cr will soon be reduced in the plant to Cr (V), Cr (IV) and finally Cr (III) (Micera et al, 1997). Chromium (III) should be insoluble at the physiological pH, so organic acids must increase the solubility of Cr (III) within the plant, thus enhancing Cr translocation. James and Bartlett (1983) determined that Cr (III) citrate remains soluble up to pH 7.5. Chromium hyperaccumulator plants probably have a different metabolism from that of nonhyperaccumulator plants. More organic complexing agents are produced to increase Cr translocation from root to shoot. Iron is translocated in plants predominantly as the Fe (III)-citrate complex (Tiffin, 1966), and Ni is readily complexed by organic acids and is very mobile in the plant. The majority of Ni in the plant is present in the leaves rather than in the roots (Baker and Brooks, 1989). Soluble Cr concentration is positively correlated with Fe (Cary et al., 1977) and Ni (Shewry and Peterson, 1976) in plant leaves and roots. The positive correlation indicates that some Fe or Ni hyperaccumulator plants may also be Cr hyperaccumulators, and implies that Cr may have similar translocation and compartmentation mechanisms to those of Fe and Ni. There is little information about Cr compartmentation in plants. The vacuole is considered to be the major storage site for most heavy metals (e.g., Cd, Zn, Mn, and Ni) (Wagner et al., 2001). There is limited knowledge about the form and fate of Cr in plants and how plants detoxify Cr and it is important to determine where Cr is compartmentalized. After finding that much of the soluble Cr in leaf tissue of Leptospermum scoparium was present in a complexed form with organic acids, Lyon et al. (1969) assumed that the function of the Cr-organic acid complex was to reduce the cytoplasmic toxicity of Cr. However, there is no conclusive evidence for this assumption. A few Cr hyperaccumulator species have been identified to date (Baker and Brooks, 1989). The species found to accumulate Cr are largely exotic. Research into the mechanisms of Cr hyperaccumulation is surprisingly scarce. For plants to be able to hyperaccumulate Cr from soil, where most Cr exists as insoluble Cr (III), the plants have to be efficient in a series of processes including solubilization of Cr in soil, absorption of soluble Cr, and translocation, compartmentation, and detoxification of absorbed Cr within 13 plant. The failure of any of these processes will prevent the plant from hyperaccumulating Cr from soils. Given the chemistry of Cr in the soil, solubilization of Cr could be a limiting process. Several studies have reported that plant uptake of Cr increased with increased soluble Cr in the media (McGrath, 2001). The selective factors causing the evolution of hyperaccumulation are unknown and difficult to identify retrospectively. The different non-mutually exclusive hypotheses in the literature are increased metal tolerance, protection against herbivores or pathogens, inadvertent uptake, drought tolerance, and allelopathy (Boyd and Martens, 2007; Galeas et al, 2007). The hypothesis of protection against herbivores and pathogens is certainly the most popular one (Boyd, 2007). Despite the overall tendency to keep Cr stored in the root, plants show quantitative differences in their ability to translocate Cr. Plants that accumulate Cr in their shoot are potentially useful for environmental cleanup of Cr. Among high biomass crops, Brassica. juncea (Indian mustard) has been widely used in phytoremediation. This species is able to take up and accumulate in its aboveground tissues appreciable quantities of heavy metals like Cd, Cu, Ni, Zn, Pb, hexavalent Cr, and Se (Bañuelos et al., 2005; Le Duc and Terry, 2005). Apart from the role of sulfate transporters in Cr uptake, S metabolism may affect Cr tolerance and accumulation due to the capacity of certain reduced S compounds to bind and detoxify metals and metalloids (Freeman et al., 2004). In phytoextraction, crop biomass yield is less important than the metal concentration in plant tissues (McGrath, 1998). It can therefore be concluded that no plants other than hyperaccumulators should be used for phytoextraction. However, it seems also reasonable to search for crop-related, non-hyperaccumulator, plants showing promising features for phytoextraction. Despite the knowledge gained in the last two decades, soil clean up by means of growing plants is not yet a finished product either by hyperaccumulators or high biomass crops (McGrath et al., 2001). In the past few years a great progress has been made in identifying and characterizing metal accumulating genes. To improve phytoremediation of heavy metal polluted sites, a detailed molecular investigation on Cr induced /regulated genes and their role in hyperaccumulation and/or tolerance in plants is needed. Molecular tools such as SSH, mRNA differential display and cDNA-AFLP have been successfully used to study the heavy metal regulated gene expression in various plants such as Arabidopsis, Brassica, Datura and Sesbania (Venkatachalam et al., 2008). In addition The development of DNA and RNA microarray chip technologies in systematic genome mapping, sequencing, functioning and experimentation may allow the identification and genotyping of mutations 14 and polymorphisms, allowing better insight into structure-function interaction of genome complexity under toxic metal stress (Mudgal et al., 2010). SSH is a powerful technique that enables cloning of ESTs representing genes that are differentially expressed in two different populations. Combining the suppression PCR technique with the normalization and subtraction steps in a single reaction increases the possibility of identifying rarely expressed genes (Diatchenko et al., 1999). Earlier SSH has been applied in many studies to identify abiotic stress-regulated gene transcripts of plants (Hinderhofer and Zentgraf, 2001; Mahalingam et al., 2003; Watt, 2003). One parameter useful for physiological studies derived from the fluorescence measurement is photochemical efficiency. In particular the ratio of variable florescence

(Fv) to maximum fluorescence yield (Fm) i.e Fv/Fm measured after a period of dark adaptation can be used to assess the maximum photochemical efficiency of PSII. Emerging knowledge will hopefully lead to new discoveries and the identification of new plants useful for remediation of metal polluted soils. Dissecting the molecular alterations underlying the high expression levels of candidate genes in metal hyperaccumulators will be an eminent future research direction.

15

Materials and Methods A. Molecular studies Selection of Crambe abyssinica Hochst. ex R. E. Fries Members of the Brassicaceae plant family have a key role in phytoremediation technology. Crambe abyssinica Hochst. ex R. E. Fries, a member of Brassicaceae commonly known as Abyssinian mustard, is a non-food, high biomass crop with short life cycle that holds potential for efficient phytoremediation of various heavy metal contaminated soils and sediments (Paulose et al., 2010). It is believed to be a native of the Mediterranean area and is an erect, cool-season, annual herb producing oil for industrial products (Fig.1). Crambe appears to be an important non-food crop with a high amount of oil having high erucic acid content (Lazzeri et al., 1994). Crambe oil in fact has shown better technological features than medium-chain food oils currently available in the market, such as those of sunflower, rapeseed or soybean (Bondioli et al., 1998). It has a wide climatic and agronomic adaptation and is considered more heat and drought-tolerant than soybeans and canola (Brassica napus L.) at all stages of growth (Johnson et al., 1995). Crambe is also considered to be a crop tolerant to cold (Papathanasiou and Lessman, 1966). It is moderately tolerant to salinity stress during germination over a range of 10 to 30oC temperature (Fowler, 1991). It has been particularly reported as highly resistant to As and accumulates significantly higher levels of As as compared to other Brassica species (Artus, 2006). A promising feature of this crop is that it does not outcross with any food oilseed crops eliminating the problem of gene flow (Li et al., 2011). Several cultivars of Crambe abyssinica have been released in USA since 1970. Currently it has been cultivated in America, Canada and several European countries (Wang et al., 2000)). It has also been found agronomically acceptable in Pakistan (Hamid, 1987), India (Lazzeri et al., 1994) and China (Wang et al., 2000).

16

Figure 3.1: Crambe abyssinica growing in flower beds (a). A closer view of the flowering stage is shown in (b). 17

Crambe was selected to study the molecular mechanism of Cr accumulation and 2- detoxification as well identification of genes that are differentially regulated by CrO4 exposure. Crambe also qualifies the criterion of having high aerial biomass and fast growth, which is considered one of the most desirable features for metal phytoextraction from contaminated soils and sediments (Schiavon et al., 2008). Plant growth conditions and Cr treatment Crambe abyssinica cv. BelAnn seeds were obtained from North Dakota Agricultural Experiment Station, at North Dakota University, Fargo, ND and surface disinfected with 70% ethanol for five minutes followed by 30% Clorox for 30 minutes. Seeds were washed four times with sterile deionized water and then germinated on 0.5x MS (Murashige and Skoog, 1962) medium supplemented with (1% w/v) sucrose and solidified with phytagar (Caisson Labs, North Logan, UT) as the gelling agent at 220C, 14- h photoperiod, 65% relative humidity, and 400 µmol m-2 s-1 photosynthetic photon flux density in growth chamber. Germinated seeds were aseptically transferred to 0.5 x MS liquid media in 250 ml flasks and grown under controlled conditions (16/8 hour light/dark periods at 220C) with constant shaking at 120 rpm. After 10 days, potassium chromate

(K2CrO4 Sigma- Aldrich, St-Louis, MO) at various concentrations (0,100,150,200,250 µM) was added to the medium and plants were grown for an additional 7 days to determine the optimum concentration for Cr treatment. A final concentration of 150 µM 2- CrO4 , where plants showed significant reduction in biomass without exhibiting severe toxicity symptoms, was then used for treating plants for cDNA subtraction experiment. 2-, Ten days old seedlings were exposed to CrO4 for 24 hrs for early molecular response and later the seedlings were harvested, frozen in liquid nitrogen, ground to a powder and then stored at -800C for further processing. Determination of Cr content In order to analyze the Cr in Crambe abyssinica root and shoot tissues, the seeds were germinated in vermiculite and 7 days old seedlings were transferred to hydroponic system (Figure 3.2). After acclimatization for 5 days in Hoagland’s solution, plants were exposed to 0, 150 and 200 µM K2CrO4 for 5 days. Roots and shoots were harvested separately and were thoroughly washed with deionized water and 5 mM EDTA to remove Cr deposition on their surfaces. Tissues were dried at 70OC for 48 hours. Dried plant samples were crushed to fine powder, weighed, and digested in the concentrated nitric acid (10 mg-ml) with constant shaking for 48h at 120 rpm. Hydrogen peroxide (30%) was then 18 added to promote oxidation of organic matter and achieve complete digestion. Samples were centrifuged in Allegra® 6 series (Beckman Coulter International SA) at 3000 rpm (xg1077) for 10 min and the supernatant was diluted 10-fold with deionized water. Samples were analyzed by PerkinElmer SCIEX Elan DRC-e ( PerkinElmer Inc.) inductively coupled plasma-mass spectrometry (ICP-MS).

A B

19

C D

FigureConstruction 3.2: Different of Suppressionviews of hydroponic Subtract setupion supporting Hybridization Crambe (SSH)for Cr-treatment. Libraries. Differentially expressed Cr-resistance genes in response to Cr stress were isolated by employing suppression subtraction hybridization (SSH). Subtractive hybridization is a powerful technique by which a comparison is made between two populations of mRNA and to obtain clones of genes that are expressed in one population but not in the other. It is based on simple theory. First both mRNA populations are converted into cDNA. cDNA that contain specific (differentially expressed) transcript is referred as tester and the reference cDNA as driver. Tester and driver cDNAs are hybridized and the hybrid sequences are then removed. As a result the remaining unhybridized cDNAs represent genes that are expressed in the tester but absent from the driver mRNA. Molecular basis of Polymerase chain reaction (PCR) Select cDNA subtraction Figure 3.3 details the molecular events that occur during PCR-Select cDNA subtraction. Figure 3.4 illustrates those molecular events in detail. The following steps are involved in the construction of subtraction library. 20

Figure 3.3: Overview of the PCR-Select procedure. The cDNA in which specific transcripts are to be found is referred to as tester and the reference cDNA is referred to as driver. 21

RNA preparation 2- Total RNA was extracted from control and CrO4 treated samples using RNeasy Plant Mini Kit (Qiagen) followed by the Poly A+ RNA isolation using Nucleotrap mRNA isolation kit. Intact and pure Poly A+ RNA is essential for the synthesis of high-quality cDNA. Stringent precautionary measurements were taken to avoid RNA contamination and degradation. The isolated RNA samples were purified to reduce false positives. After total and poly A+ RNA isolation, RNA integrity was examined by electrophoresing samples on a denaturing, formaldehyde 1% agarose/Et Br gel. Intact total RNA typically exhibited two bright bands corresponding to ribosomal 28S and 18S RNA at 3 and 0.5 kb respectively for nonmammalian species with a ratio of intensities of ∼ 1.5-2.5: 1. Poor quality and /or degraded RNA was strongly discouraged as starting material. Double stranded cDNA Synthesis Double stranded cDNA synthesis was performed using the PCR select cDNA subtraction kit (Clontech, CA) according to the manufacturer’s protocol. Digestion with Endonuclease Rsa1 2-) Double stranded cDNA from driver (control) and tester (CrO4 were digested with endonuclease Rsa1. This step generated shorter, blunt –ended, double stranded (ds) cDNA fragments from experimental double stranded tester and driver cDNA, which were optimal for subtraction and required for adaptor ligation. Rsa1 is a four base cutting restriction enzyme. Adaptor ligation For differential screening of the subtracted library, subtraction in both forward and reverse directions for each tester/driver cDNA pair is performed. The forward subtraction experiment was designed to enrich for differentially expressed sequences present in tester population while reverse subtraction was to enrich for differentially expressed sequences present in driver poulation. The tester cDNA was then subdivided into two portions and each was ligated with a different cDNA adaptor. After the ligation reaction was set up, portions of each tester tube were combined so that the cDNA was ligated with both adaptors. Adaptors were not ligated to the driver cDNA. First Hybridization After preparing adaptor ligated tester cDNA, an excess of driver cDNA was added to each tester cDNA, samples were heat denatured, and allowed to anneal. The remaining single stranded (ss) cDNAs were dramatically enriched for differentially expressed 22 sequences because non-targeted cDNAs present in the tester and driver cDNA form hybrids. Second Hybridization The two samples from the first hybridization were mixed together and fresh denatured driver DNA was added to further enrich for differentially expressed sequences. PCR Amplification Differentially expressed sequences were selectively amplified during the above- mentioned two reactions. The missing strands of the adaptors were filled in by a brief incubation at 750C. In the first amplification, only double stranded cDNAs with different adaptor sequences on each end were exponentially amplified. In the second amplification nested PCR was used to further reduce the background and enrich for differentially expressed sequences. 23

Figure 3.4: A graphical view of the PCR- Select procedure. The detail is described in text.

24 pGEM-T-Easy T/A cloning Secondary PCR products from the forward subtraction and reverse subtraction were cloned using a T/A -based cloning system. TA Cloning is one of the most popular methods of cloning the amplified PCR product using Thermus aquaticus (Taq) and other polymerases. These polymerases lack 5'-3' proofreading activity and are capable of adding adenosine triphosphate residue to the 3' ends of the double stranded PCR product. Such PCR amplified product can be cloned in a linearized vector with complementary 3' T overhangs. Such vectors are called T- vectors. The PCR product with A overhang, is mixed with this vector in high proportion. The complementary overhangs of a "T" vector and the PCR product hybridize. The result is a recombinant DNA, the recombination being brought about by DNA ligase. It was important to optimize the cloning efficiency, as a low cloning efficiency will result in a high background. To optimize cloning efficiency, the amount of DNA in the A-tailing reaction and the ligation volumes was adjusted depending on the molar yield of the purified PCR product. Blue/white screening identified recombinants. Usually clones containing PCR products produce white colonies, but blue colonies can result from PCR fragments that are cloned in-frame with the lacZ gene. The pGEM(R)-T Easy Vector has been linearized at base 60 with EcoRV and a T added to both 3ÅL-ends. The EcoRV site will not be recovered upon ligation of the vector and insert. pGEM(R)-T Easy 3 Vector is a high-copy-number vector containing T7 and SP6 RNA polymerase promoters flanking a multiple cloning region within the α-peptide coding region of the enzyme β galactosidase. Insertional inactivation of the α-peptide allows identification of recombinants by blue/white screening on indicator plates PCR-Select Differential Screening A differential screening procedure was used to eliminate the false positives in the subtracted cDNA library. Screening of the subtracted cDNA library was carried out using a PCR-select differential screening kit (Clontech Labs Inc., Mountain View, CA) against selected bacterial colonies. This is an efficient novel approach for the identification of differentially expressed genes. This approach has high reproducibility and enhanced sensitivity of display. Although the PCR-Select cDNA Subtraction method greatly enriches for differentially expressed sequences yet the subtracted sample will still contain some cDNAs common to both the tester and driver samples. The reason for this background may depend to some extent on the quality of RNA purification and the performance of the particular subtraction. 25

The approach adopted for screening of differentially expressed sequences in the subtracted library consists of hybridization with forward and reverse subtracted cDNA probes (Figure 3.5). The forward -subtracted probe is made from the same subtracted cDNA used to construct the subtracted library. To make the reverse subtracted probe subtractive hybridization is performed with the original tester cDNA as a driver and the driver cDNA as a tester. Clones representing mRNAs that are truly differentially expressed will hybridize only with the forward-subtracted probes, clones that hybridize only with the reverse-subtracted probe may be considered background. The forward subtracted cDNA was cloned and randomly selected clones were arrayed on four separate nylon membranes for screening. Generally using subtracted probes for differential screening yields more sensitive results than un-subtracted probes as rare sequences are retained and not lost. In order to perform differential screening with subtracted probes, PCR-Select subtraction was performed in both directions. In this procedure, the subtracted cDNA blotted onto the nylon membranes was hybridized with forward and reverse subtracted probes and the signals were compared for each clone. Colonies containing plasmids with cloned cDNAs were grown in liquid LB medium overnight and an equal amount of each culture was spotted in duplicate on two replicate nylon membranes, which were placed on LB plates and incubated at 370C overnight. Membranes containing the colonies were transferred to Whatmann filters pre-saturated with denaturing solution (0.5 M NaOH, 1.5 M NaCl), and then to Whatmann filters presaturated with neutralizing solution (0.5 M Tris-HCl, 1.5 M NaCl). Each membrane was air-dried and the DNA was fixed by baking the membranes at 80¢XC for 2 hours. These membranes were then hybridized with either 32P labeled forward or reverse subtracted probes overnight as described in the next section and washed with low stringency (2 x SSC, 0.5% SDS) and high stringency (0.2 x SSC, 0.5% SDS) wash buffer before exposing to X-ray film at -80¢XC overnight. The hybridization signal strength for each cDNA clone on membrane probed with forward subtracted cDNA was compared with cDNA clones on the duplicate membrane probed with reverse subtracted.

26

Figure 3.5: Flow chart for experimental set-up for PCR-Select cDNA subtraction and differential screening

Random primer labeling of cDNA probes This step is used to prepare the radioactive probes for hybridization to the subtracted cDNAs library. Both forward and reverse subtracted and unsubtracted cDNA probes were prepared. Later, these probes were radioactively labeled with phosphorus. DNA labeling is a central part of many molecular biology procedures. It enables the location of a particular 27

DNA molecule on a nitrocellulose or nylon membrane to be determined by detecting the signal emitted by the marker. Radioactive markers are frequently used for labeling DNA molecules. Nucleotides can be synthesized in which either one of the phosphorus atoms is replaced with 32P or 33P, one of the oxygen atoms in the phosphate group is replaced with 35S, or one or more of the hydrogen atoms is replaced with 3H. In this experiment 32P was used for labeling DNA of subtracted clones. The radioactive nucleotides acted as substrates for DNA polymerases and so were incorporated into a DNA molecule by any strand-synthesis reaction catalyzed by a DNA polymerase. The radioactive signal can be detected by scintillation counting, an X-ray-sensitive film (autoradiography) or a radiation-sensitive phosphorescent screen (phosphorimaging). The choice between the various radioactive labels depends on the requirements of the procedure. High sensitivity is possible with P32 because this isotope has high emission energy, but sensitivity is accompanied by low resolution because of signal scattering. Low-emission isotopes such as S35 or H3 give less sensitivity but greater resolution. After labeling the probes were purified from unincorporated dNTPs using exclusion spin chromatography. The specific activity of probes was determined by a scintillation counter. It exceeded > 107 cpm per probe. Interpretation of Hybridization Results The results of differential screening experiment can be interpreted by exposing the membranes to x-ray film for varying lengths of time. Guidelines for interpreting different combination of hybridization for each of the four probes are presented in the Table 3.1. 28

Table 3.1: Analysis of results

29

DNA Sequencing and gene identification Differentially expressed clones identified by dot-blot screening of forward and reverse SSH libraries were sequenced at DNA Sequencing Core Massachusetts General Hospital (Cambridge, MA). A total of 105 differentially expressed cDNA clones were sequenced both in forward and reverse orientations. DNA fragments were automatically sequenced by using fluorescently labeled dideoxy-nucleotide chain termination method employing the universal forward or reverse primers homologous to vector sequence (MGH, Cambridge, MA). Each sequence was edited to correct sequencing ambiguities and to remove the primer sequence. Unique expressed sequence tags (ESTs) were selected to identify their putative functions and annotated on the basis of the existing annotation of non redundant databases at the National Centre for Biotechnology Information (NCBI) and The Arabidopsis information Resource (TAIR) using BLASTN and BLASTX algorithm (http://.www.ncbi.nlm.nih.gov/BLAST). Semi-quantitative Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Analysis For RT-PCR, 10 days old crambe seedlings were treated with 150 µM potassium chromate and the samples were harvested after 6, 12 or 24 hours of treatment. Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen Inc.,Valencia, CA) and cDNA synthesized from total RNA using Thermoscript RT-PCR kit (Invitrogen Corporation Carlsbad, CA). Primers for each subtracted cDNA were designed using Primers 3. Threshold of the number of cycles was determined by an optimization step in which the PCR was performed from a known amount of cDNA for a range of cycles. The number of PCR cycles selected for the experiments were chosen from the plot where the trend line exhibited highest correlation to exponential amplification. Once the number of cycles for a few genes was optimized, it was extrapolated to all other genes in the library based on their microarray expression (ArrayExpress) values, as it represented the relative expression level of each mRNA. In addition, the constitutively expressed actin2 gene, ACT2, was used as an internal control to verify that an equal amount of cDNA template was used in each PCR reaction. A touchdown PCR was performed for all the transcripts with annealing temperature varying from 640C to 520C. 2 µg of total RNA as template and Thermoscript Reverse Transcriptase (ThermoscriptTM RT) in a 25 µl reaction mixture was used for cDNA synthesis. RT-PCR was performed with Eppendorf’s mastercycler in a 50 µl of solution containing a 1µl aliquot of the cDNA reaction, 0.2 µM gene-specific 30 primers, 10 mM dNTPs, and 1 unit of Platinum® Taq DNA polymerase (Takara Bio U.S.A. Madison, Wisconsin). PCR products were separated by electrophoresis on a 1.2% agarose gel. B. Bacterial Complementation Assay

Strain construction and plasmids W3110 is a wild-type strain of Escherichia coli; RW3110 cells are W3110 cells with the ZntA locus disrupted by insertion of the kanamycin gene (Noll and Lutsenko, 2000). These strains were transformed with pGEM TA cloning vector containing gene of interest and grown in Lauria Bertani (LB) medium supplemented with ampicillin. Cloning procedures (plasmid purification, restriction digestion, endonuclease and exonuclease digestion, gel electrophoresis, polymerase chain reaction (PCR), ligation, dephosphorylation and Escherichia coli transformation) were carried out as described below. The same E. coli strains were also transformed with empty plasmid pBS to serve as negative controls Metal sensitivity assays Two genetic complementation tests were performed in two E. coli strains (W3110 and RW3110) both in solid (0, 5, 10,15, 20, 25, 30ppm) and liquid media (20 and 25ppm). Strains were grown overnight at 37°C in Luria–Bertani medium (LB) with appropriate antibiotics and isopropyl D-thiogalactoside (IPTG). For the time-dependent liquid growth curve assays the cultures were diluted 100-fold into half-strength LB and grown for various time periods indicated in the presence of final concentrations of 100 mg_liter ampicillin, 50 mg_liter kanamycin, 1 mM IPTG, and respective potassium chromate concentration. Growth was monitored from the absorbance at 600 nm. The same E. coli strains were also transformed with empty plasmid pBS to serve as negative controls. C. Gene Cloning Restriction digestion Restriction digestion of the vectors and inserts for interested genes was carried out by making use of NEBs (New England Biolabs, 240 County Road, Ipswich, MA 01938) Enzymes. Appropriate restriction enzyme buffers for insert and vectors were selected. The following contents were combined in a microfuge tube; 2 µg DNA, 1 µL each Restriction

Enzyme, 3 µL 10x Buffer, 3 µL 10x BSA (if recommended), x µL H2O (to bring total volume to 30 µL). The tubes were incubated at 370C for I hour (Some enzymes require 31 different temperature and they were followed accordingly). Ligation All the ligation reactions were carried out by making use of NEBs (New England Biolabs, 240 County Road, Ipswich, MA 01938) ligation kit. Plasmid DNA insert DNA were digested with appropriate restriction enzymes. Ligation buffer was thawed and resuspended at room temperature. Plasmid DNA and DNA to be inserted was combined in a total volume of 5-10 µl. Ligation was brought about by T4 DNA Ligase. It was incubated at 16 0C overnight. Preparation of competent E.coli DH5α cells Lauria Bertani medium (5ml) was inoculated with DH5α strain of E. coli cells and incubated overnight. 500 µl (from 5ml culture) was added to 100 ml of LB and incubated 0 at 37 C, 200 rpm until OD600 (0.4-0.5). This typically takes 2 hours, 45 minutes. Polypropylene tubes (50 ml) were chilled in ice-cold water. Once OD was achieved, 50 ml portions to each of 2 chilled polypropylene tubes were transferred ascetically. Later, the 50-ml cultures were chilled on ice for 10-15 minutes. They were centrifuged at 400 rpm for 10 minutes at 4 0C. The supernatant was decanted by inverting the tubes to allow additional drainage of supernatant from pellets. Pellet was resuspended in 15 ml of ice- cold 0.1M CaCl2. CaCl2 suspended cells were incubated on ice for 1 hour. They were centrifuged for 5 minutes at 4000 rpm at 4 0C. Supernatant was again decanted by inverting the tubes to allow additional drainage of supernatant from pellets. The pellet was resuspended again in 0.1 M CaCl2 and ice-cold glycerol (80% stock concentration). Two micro liter (µl) of dimethyl sulfoxide (DMSO) was added and mixed by gently flicking the base of the tube. Competent cells were aliquoted in desired volume in 1.5 ml micro centrifuge tubes. Cells were frozen on ice before transferring to -80 0C. Preparation of competent cells of Agrobacterium tumefaciens (C 58) Agrobacterium tumefaciens strain (C 58) containing Ti plasmid was grown in 3 ml of YEP (Yeast Extract Peptone) medium overnight at 280C. Overnight culture of 2 ml was added to 50 ml YEP medium in a 250 ml flask and was shaken at 250 rpm at 280C until the culture grew to a log phase of (OD600 of 0.5 to 1.0). Culture was chilled on ice. Cell suspension was centrifuged at 3000 g for 5 minutes at 40C. Supernatant was discarded. Cells were resuspended in 1ml of ice-cold 20 mM CaCl2. Aliquots of 0.1 ml were dispensed into prechilled eppendorf test tubes. Super coiled plasmid DNA (1 ug) was added to the cells. Cells were frozen in liquid Nitrogen and stored at -700C. 32

Transformation and recovery of Agrobacterium tumefaciens Competent Agrobacterium cells were thawed on ice (It took more time to thaw than usual DH5 ( cells). Once thawed the ligated product or plasmid (5µl) was added to the cells and mixed gently. Cells were immediately transferred to -80 0C and incubated for 30 minutes. Water bath was pre-set at 37 0C for heat shock. A heat shock of 5 minute was given at 37 0C. Appropriate growth medium was added and culture was grown at 280C for 1‐1/2 hrs. Transformed cells (200 ul) were plated onto YEP agar containing 25µg/ml Kanamycin. Transformants would be visible after 40 hours. Transformation efficiency was 103 /ug supercoiled DNA. Plasmid transformation of E.coli DH5 cells Competent cells were directly placed on ice after removing from -800C storage. As the cells thawed, I0µ of ligated product was added to 100 µl of competent cells in eppendorf tube. Tube contents were flicked and placed immediately on ice for 30 minutes. Tubes were removed from ice and incubated for 2 minutes in a 42 0C water bath for a heat shock. After heat shock they were kept on ice for 10 minutes. Sterile LB broth (500 µl) was added to each tube and continued incubating at 37 0C for 1- 1/2 hour. 10 µl was plated on LBM + Amp plates using a glass spreader. They were incubated at 37 0C for 16 hours or until colonies were of the desired size. Disinfection of seeds and growth of plantlets of Arabidopsis thaliana Arabidopsis ecotype Col-0 seeds were surface disinfected with 70% ethanol for five minutes followed by 30% Clorox for 30 minutes. Seeds were washed four times with sterile deionized water and then germinated on 0.5x MS medium supplemented with (1% w/v) sucrose and solidified with phytagar (Caisson Labs, North Logan, UT) as the gelling agent at 220C in 65% relative humidity and 400 µmol m-2 s-1 photosynthetic photon flux density in growth chamber. Seeds were refrigerated for 48 h at 40C in the dark. Seeds were incubated at 28°C with a photoperiod of 16 h light and 8 h dark until the appearance of true leaves.

Agrobacterium-mediated transformation of Arabidopsis thaliana by using the vacuum infiltration method For floral dip transformation of Arabidopsis, plants were grown to a stage when 33 they just started to flower. Plants were dipped briefly in a suspension of Agrobacterium, 5% sucrose, and 500 microliters per litre of surfactant Silwet L-77 surfactant as modified by clough and Bent (1998). Plants were maintained for a few more weeks until mature and then progeny seeds were harvested. The seeds were germinated on selective medium (e.g. containing Kanamycin) to identify successfully transformed progeny.

D. Physiological Studies Treatments and experimental Designs The experiment consisted of four-time -course dependent Cr treatment i.e., plants were subjected to 1, 5, 10 and 12 days of Cr exposure. The treatments were arranged in a completely randomized design with a total of 32 experimental units. All treatments were replicated four times with a corresponding set of the control at the same conditions and measurements were taken at multiple sampling dates during the treatment period. The treatments were ended after 12 days when the plants under Cr stress showed arrested growth. Photochemical efficiency The ratio of variable fluorescence (Fv) to maximum fluorescence (Fm), given as Fv/Fm, was measured to estimate the percent photochemical efficiency of intact leaves. This measurement gives information on inhibition of electron transport from photo system II (PSII) and serves as a useful indicator for changes in photosynthetic capacity attributable to stress. Fv/Fm was determined at each harvest using an OSI-FL modulated Flurometer (Opti-Sciences, Hudson, NH). Before measurements, plants were dark adapted for 30 minutes to obtain fully oxidized PSII. The chamber generating the fluorescence signals were placed on three different leaves per plant to obtain an average Fv/Fm value for each plant. Photosynthetic yield Photosynthetic yield (∆F/Fm’) is a more successful parameter in detecting the various stresses earlier than Fv/Fm. Yield of PSII is measured during photosynthesis at steady state photosynthetic conditions to determine actual achieved quantum efficiency under existing stress conditions. Like Fv/Fm it was also it was also measured at each harvest.

34

Relative Water Content (RWC) The relative water content (RWC) of leaf was measured at each harvest using 3 fully expanded leaves per pot according to Barrs and Weatherly (1962). Leaf samples were detached from the plants and immediately weighed to determine fresh weight (FW). They were placed in covered Petri dishes filled with water to attain full hydration. After 18 hours at 4oC, the leaf samples were blotted dry and weighed immediately to determine turgid weight (TW). Leaf tissue was then dried in an oven at 75oC for 72 hour to determine dry weight (DW). Leaf RWC was calculated as (FW-DW)/(TW-DW) *100. Leaf Electrolyte leakage (EL) Leaf electrolyte leakage (EL) was determined by the method of Blum and Ebercon (1981) and Marcum (1998) with modifications. Three leaf samples were detached from the plants and leaf disks of equal size were made and rinsed with deionized water. The same number of leaf disks was placed in test tubes containing 20ml deionized water and test tubes were shaken on a shaker table at 120 rpm for 24 h to dissolve electrolytes that had leaked from cells. After measuring conductivity (C1) with a conductivity meter, the tubes containing leaf samples were placed in an autoclave at 140 oC for 20 minutes to destroy all cell membranes. The respective tubes were shaken for 24 h to extract all electrolytes from the cells and then the conductivity (C2) was measured once again. The percentage of the total electrolytes was calculated as C1 /C2 X100. The lower EL indicates greater resistance to stresses like Cr in present studies. Extraction of antioxidant enzymes and MDA Sampling for antioxidant enzyme activities and lipid peroxidation was taken on the same days as Fv/Fm and yield determination. Approximately 200mg of fresh leaf tissue was randomly sampled from each plant, frozen in liquid nitrogen and stored at -80oC until further analysis. Extraction of SOD, CAT, APX, GPX and MDA was performed as previously described by He et al., (2001) with little modifications. Briefly frozen leaves were homogenized with 4ml of 150 mM ice-cold phosphate buffer (pH 7.0) with a pestle and centrifuged at 12,000 rpm for 20 minute at 4oC. The supernatant was collected and used for determination of enzyme activity and MDA content. Ascorbate peroxidase (APX) activity APX activity was determined based on the oxidation of ascorbate using the method of Nakano and Assada (1981) with modifications. The reaction solution (3ml) contained 100mM sodium acetate buffer (pH 5.8), 3µM ethylenediamine tetraacetic acid (EDTA), 35

5mM H2O2 and 100 µL of extracted solution. The reaction was initiated by adding the enzyme extract. Changes in absorbance at 290 nm were read after every 10 sec for 60 sec using a UV spectrophotometer (Genesys 10 UV Spectrophotometer, Thermo Scientific). One unit of APX activity was defined as an absorbance change of 0.01 per minute. Guaiacol peroxidase (GPX) activity Similarly GPX activity was measured based on oxidation of Guaiacol using the method of Chance and Maehly (1955). The reaction solution (3ml) contained 0.1M sodium acetate buffer (pH 5.0), 0.25% guaiacol, 0.75% H2O2 and 50µL of extracted solution were taken and the reaction was initiated by adding the enzyme extract. Changes in absorbance at 460 nm were recorded at interval of 10 sec for 60 sec using a spectrophotometer. One unit of APX activity was defined as an absorbance change of 0.01 per minute. Superoxide dismutase (SOD) activity SOD activity was determined by the method of Ginnapolis and Ries (1977) with modifications. The reaction solution (3ml) contained 50 mM phosphate buffer (pH 7.8), 60uM riboflavin (7,8 ‐dimethyl ‐10‐ribitylisallox azine), 195 mM methionine [2‐amino‐4‐(methyl‐thio)‐butyric acid] 3uM EDTA 1.125mM nitro blue tetrazolium[NBT;2,2‐di‐p‐nitrophenyl‐5,5‐diphenyl‐(3,3‐dimethoxy‐4,4diphenylene) ditetrazolium chloride], and 100μL of extracted solution. A solution containing no enzyme was used as the control. Test tubes were irradiated under fluorescent lights at 100 μmol. m‐2 s‐1 for 20 minutes and then transferred into the dark for 10 minutes. The absorbance of each solution was measured at 560 nm and one unit of enzyme activity was defined as the amount of enzyme that would inhibit 50% of NBT photo reduction. Catalase (CAT) activity

CAT activity was determined based on the oxidation of H2O2 using the method of Chance and Maehly (1955) with modifications. The reaction solution (3ml) contained 50 mM phosphate buffer (pH 7.0) 45 mM H2O2 and 100µl of extracted solution. The reaction was initiated by adding the enzyme solution. Changes in absorbance at 240 nm were read every 10 seconds for 60 seconds using a spectrophotometer. One unit of CAT activity was defined as the absorbance change of 0.01 per min. Lipid peroxidation 36

MDA was determined according to the methods described by Heath and packer (1968) and Dhindsa et al., (1981) with modifications. Briefly, 1 ml of extracted enzyme solution was added to 2 ml of a reaction solution containing 20 % (v/v) trichloroacetic acid and 0.5% (v/v) thiobarbituric acid. The solution was placed in a water bath at 95oC for 30 minute and then transferred to an ice water bath. The solution was then centrifuged at 12,000 rpm for 10 minutes. The absorbance of the supernatant was recorded at 532 and 600 nm. Non‐specific absorbance at 600 nm was subtracted from that at 532 nm, and MDA content was calculated using this adjusted absorbance and the extinction coefficient of 155 mm‐1.cm‐1 (Heath and Packer, 1968). Determination of Cr content In order to analyze the Cr in Crambe abyssinica root and shoot tissues, the seeds were germinated in vermiculite and 7 days old seedlings were transferred to hydroponic system. After acclimatization for 5 days in Hoagland’s solution, plants were exposed to 150 µM K2CrO4 for 1, 5, 10 and 12 days. Roots and shoots were harvested separately and were thoroughly washed with deionized water and 5 mM EDTA to remove Cr deposition on their surfaces. Tissues were dried at 70oC for 48 hours. Dried plant samples were crushed to fine powder, weighed, and digested in the concentrated nitric acid (10 mg per ml) with constant shaking for 48 h. Hydrogen peroxide (30%) was then added to promote oxidation of organic matter and achieve complete digestion. Samples were centrifuged at 3000 rpm for 10 min and the supernatant was diluted 10‐fold with deionized water. Samples were analyzed by Elan DRCe inductively coupled plasma‐mass spectrometry (ICP‐MS). E. Statistical Analysis

Effects of treatments at various time intervals were determined by analysis of variance according to the general linear model procedure of SAS (version 9.1; SAS Institute Cary, N.C). Differences between treatments means and control plants were separated by Fishe ‘s protected least significance difference (LSD) test at the 0.05p level.

37

List of Materials

3.1 LB Medium (Lauria-Bertani Medium) The following ingredients were added per liter of deionized water. Tryptone 10 g

Yeast extract 5 g Sodium chloride 10 g

Contents were shaken until the solutes dissolved. pH was adjusted to 7.0 with 5 N

NaOH (0.2 ml). Final volume of the solution was adjusted to 1 liter with deionized H2O. It was sterilized by autoclaving for 20 minutes at 15 psi (1.05 kg/cm2) on liquid cycle. 3.2 Medium containing Agar Liquid medium was prepared according to the recipe given above. Just before autoclaving Bacto Agar (15g/L) was added. It was sterilize by autoclaving for 20 minutes at 15 psi (1.05 kg/cm2) on the liquid cycle. The medium was allowed to cool to 50-600C before adding thermo labile substances. Plates were poured directly from flask. When the medium had hardened completely, the plates were inverted and stored at 40C until needed. The plates were removed from storage 1-2 hours before they were used. 3.3 YEP Medium Items Amount per liter Bacto- peptone 10 g

Bacto- yeast extract 10 g NaCl 5g

The flask was shaken until the solutes dissolved. The volume of the solution was adjusted to 1 liter with deionized H2O. Just before autoclaving Bacto Agar (15g/L) was added. It was sterilized by autoclaving for 20 minutes at 15 psi (1.05 kg/cm2) on a liquid cycle.

38

3.4 Liquid medium for germination of Crambe Items Amount per liter Murashige & Skoog 4.43 g (MS)

Sucrose (1% ) 10 g

The flask was shaken until the solutes dissolved. pH was adjusted to 5.8.The volume of the solution was adjusted to 1 liter with deionized H2O. Just before autoclaving 8g/L Phytagar (0.8%) was added. It was sterilized by autoclaving for 20 minutes at 15 psi (1.05 kg/cm2) on liquid cycle. 3.5 Antibiotic solutions Stock Solution Antibiotic Concentration Storage 0 Ampicillin 100 mg/ml in H2O -20 C 0 Kanamycin 100 mg/ml in H2O -20 C 0 Gentamycin 25 mg/ml in H2O -20 C 0 Rifampicin 50 mg/ml in H2O -20 C

3.6 Agarose gel (1%) BioRad high strength analytical grade agarose (0.25g) was weighed out and added to 25 ml of autoclaved 1x TAE. The solution was microwaved in order to dissolve the agarose. It was allowed cool to 600C. 1-2 µl of 10mg/mL ethedium bromide (EBr) was added at this point. Later, it was poured into the electrophoresis apparatus. After the gel has solidified, 1xTAE was poured into the gel box, and the comb was removed. Samples were loaded into the gel only after the buffer solution was in the gel box. A molecular weight marker was loaded into the first lane of the gel along with the samples in next lanes. Gel box was covered and the electrodes were plugged. The gel was run at 100V until the dye line was approximately 50-75% of the way down the gel. Finally the gel was removed from the gel box and observed under UV transilluminator. 3.7 50X TAE A 50x TAE stock buffer solution was prepared and diluted to 1x before use (1x= 20ml of 50 x brought up to 1 Liter) 39

Items Amount Tris base 242 g Glacial acetic acid 57.1ml EDTA disodium salt 37.2g

(C10H14O8N2Na2.2H2O)

pH of the solution was set at 8.0 and followed by autoclaving it. 3.8 X-gal Stock Solution (4% in DMF) Items Concentration X-gal (Boehringer Mannheim #745-740) 40 mg DMF (N, N Dimethylformamide) 1 ml

Solution was mixed until completely dissolved. It was store at –20 ºC and protected from light. 3.9 Isopropyl β-D-1-thiogalactopyranoside (IPTG) An amount of 1.2 g of IPTG was dissolved in 50 ml of dH2O in a sterile polypropylene. It was stored at -200C. 3.10 Arabidopsis Vacuum Infiltration Medium

0.5X MS salts 2.2 g

1X B5 Vitamin 1ml

Sucrose 50g

BAP (Benzal aminopurine) 100µl

Silwett L-77 200 µl

Mes (4. Morpholine ethanesulphonic acid) 0.5 g

pH was set at 5.7 with I N KOH. Silwett was added just before transformation. It helped to resuspend the bacterial cells evenly without forming clumps.

40

3.11 Formulation of Silwett L-77

1000 X B5 Vitamins 10 ml Myo-inositol 1000 mg

Thiamine –HCl 100 mg Nicotinic acid 10 mg Pyridoxine-HCl 10 mg

0 It was dissolved in distilled H2O and stored at -20 C.

41

Genes induced in response to chromium exposure in Crambe abyssinica, a heavy metal accumulator

In recent years, chromium (Cr) contamination has become a major environmental concern, primarily due to the toxic Cr burden in soil and water resulting from various industrial and agricultural activities (Chanda and Parmar, 2003; Schiavon et al., 2008). Chromium use is mainly prevalent in metallurgical, production of paints and pigments, tanning, wood preservation, and paper production industries (Dixit et al., 2002). In India alone, approximately 2,000- 3,200 tons of Cr is released into the environment annually from the tanning industries. Effluent concentrations ranging between 2000 and 5000 mg Cr l-1 have been detected (Chandra et al., 1997) a rate dramatically higher than the recommended limit of 2 mgl-1 for industrial effluents in India (http://www.ismenvis.nic.in/standard9.html, February 13, 2011), or in drinking water (100 mgl-1) (US EPA, 2010).

Chromium is a potential environmental risk and is a threat to human health because of it being the mutagenic and carcinogenic species (Chaney et al., 1997; US EPA, 2000). Chromium exists in trivalent (III) and hexavalent (VI) oxidation states in nature (Zayed et al., 1998); these states are interchangeable depending on biological, physical and chemical properties in waters and soils (Kotas and Stasicka, 2000). Chromium (VI) is more soluble, mobile and bioavailable than Cr(III). Chromium (VI) is typically an oxyanion under environmental conditions and conversion to Cr(III) is favored under reduced conditions. Due to its powerful oxidizing properties, Cr(VI) is extremely toxic and a potential cause of DNA damage. Conversely, Cr(III) is having lesser solubility and toxicity but at higher concentrations, will inhibit enzymatic activities such as root-associated Fe(III) reductases (Barceló and Poschenrieder, 1997).

High levels of Cr are also toxic to plants and may significantly limit biomass and yield. Noted phytotoxic effects of Cr include chlorosis of young leaves and necrosis of different tissues (Sharma et al., 1995), change in water content of leaves (Barceló et al., 1986), and causing damage to root system (Shanker et al., 2005). Impaired uptake of various mineral nutrients and oxidative stress because of generation of ROS has also been observed in response to Cr exposure (Gardea-Torresdey et al., 2005). Many plant species have evolved metal tolerance and/or hyperaccumulation abilities and are thus able to thrive in metal-contaminated soil (Baker and Brooks, 1989; Ma et al., 2001). However, no 42 plant with Cr hyperaccumulation ability has been identified. Additionally, Cr comes from the group of transition metals, which are recognized for inducing oxidative stress through a pathway termed as Fenton-type reaction (Luo et al., 1996), however, the basis of molecular mechanisms of Cr-induced oxidative stress and imparting tolerance in plants have not been fully explored yet.

Phytoremediation, a plant based and cost-effective strategy for the remediation of heavy metal contaminated soils, has garnered increasing attention in the last decade (Pilon-Smits, 2005). Plant-based remedial strategies utilized the natural abilities of plants to decontaminate polluted soil (Doty, 2008). Brassicaseae is the primary family for plants with the ability to tolerate and translocate high levels of heavy metals, including 87 Brassica species classified as metal hyperaccumulators (Milner et al., 2008).

Crambe abyssinica, a member of Brassicaseae and referred to here as crambe, is an annual herb, native of the Mediterranean area, and cultivated for primarily industrial oil (Wang et al., 1999). Crambe is a fast growing, high-biomass non-food crop with significant potential for the phytoremediation of toxic metals. Crambe can be cultivated in oilseed rape cultivated regions and it does not cross with other crops (Anon, 1993; European Union Strategic Research Agenda, 2005), thereby minimizing the risk of gene flow. Preliminary studies have shown that crambe is not only highly tolerant to other heavy metals including as, but also accumulates higher levels of those metals than various Brassica species (Artus, 2006; Paulose et al., 2010). A better understanding of the molecular as well as physiological mechanism of Cr uptake and detoxification in plants will help to develop feasible strategies for phytoremediation as well as for engineering of Cr tolerant crops with reduced Cr uptake.

In this study the molecular basis of accumulation and detoxification of Cr in crambe was studied. A PCR-Select suppression subtraction methodology was chosen to identify Cr regulated genes in response to Cr exposure. Many uncharacterized novel transcripts as well as those involved in known metabolic pathways are reported here that are differentially regulated due to Cr and other toxic metals exposure. 43

Results and discussion Growth characteristics and Cr tolerance in Crambe

Ten day old crambe seedlings were exposed to varying concentrations of K2CrO4 ranging from 0 to 250 µM for seven days. .A moderate reduction in fresh weight of plants occurred at 100 and 150 µM K2CrO4 concentration with no toxicity (Figure 4.1). Higher concentration of 200 and 250 µM of K2CrO4 was highly toxic, caused significant reduction in biomass and caused chlorosis and visible necrosis on leaves. Low levels of K2CrO4 (50 µM) had no tangible effect both on fresh weight and plant morphology. Therefore, 150

µM K2CrO4 was selected to expose crambe for Cr stress.

1

** Significance at P<0.01 0.9 0.8 * 0.7

0.6 ** (g) 0.5 ** wt

0.4 **

Fresh 0.3

0.2

0.1

0

0123456 50 100 150 200 250 K2CrO4 Concentrations(µM) Figure 4.1: Effect of potassium chromate on fresh weight of Crambe abyssinica. Fresh weight of 20 seedlings is shown here.

44

Chromium levels in crambe root and shoot tissues were analysed in the plants exposed to 0, 150, and 250 mM K2CrO4. Crambe plants translocated high levels, 180-200 ppm, in aboveground shoot tissues (Figure 4.2 A) and also retained a very high levels (1800-2000 ppm) in roots (Figure 4.2 B). Almost same results have been reported for As and Cd uptake in crambe (Paulose et al., 2010; Artus, 2006), suggesting that this plant may have has an intrinsic capacity to accumulate high levels of toxic metals. A. 200

180 Shoot

160

wt.) 140

dry 120

g/g 100

µ ( 80 Cr

60

Total 40 20

0 1230 150 200

B. K2CrO4 (µM) 4000 K2CrORoot4 (µM) 3500

3000

wt.)

dry 2500

g/g 2000 µ

(

Cr

1500

1000 Total 500

0 OuM0 150 150uM 200 200uM K2CrO4 (µM)

Figure 4.2: Accumulation of total Cr in C. abyssinica tissues. A. Cr accumulation in shoots. B. Cr accumulation in roots. 45

Isolation of differentially regulated transcripts of crambe in response to chromium stress

With the surge of the genomic era in the present decade, the attributes of various plant species for resistance to heavy metal stress are being evaluated at the molecular level. Since crambe genome is not sequenced and thus using the current genomic applications such as microarray analysis, is not a viable approach. A PCR- Select Suppression Subtraction Hybridization (SSH; Diatchenko et al., 1996) technique was employed to identify the differentially regulated genes in crambe seedlings in response to

K2CrO4 exposure. This technique is used to isolate differentially expressing transcripts between two populations of mRNA while simultaneously suppressing the common transcripts between the two populations. In the recent past, SSH has been used to study the differential expression of genes induced by toxic metals (Watt, 2003; Vanktatachalam et al., 2009; Paulose et al., 2010). Two parallel subtractions were performed by changing the driver/tester ratio and getting a total of 346 subtracted cDNA clones. The forward suppression subtraction hybridization library blots displayed strong hybridization signals for many clones with the probe from Cr-treated plants (Figure 4.3A), whereas most clones did not hybridize to the cDNA probe from control (Figure 4.3B). So those clones were identified as differentially regulated cDNAs specific to Cr-treated plants. The differential screening for forward subtracted library identified 73 clones containing the differentially regulated mRNA transcripts (Figure 4.3). All 73 cDNA sequences were subjected to homology searches against the NCBI nucleotide database and found that they represented 43 transcripts encoding different genes (Table 1). These crambe cDNA sequences were highly homologous to Arabidopsis transcripts and Brassica; an expected finding given that all three species come from the Brassicaceae family.

46

Table 4.1: Relative frequency, identity and description of differentially regulated subtracted cDNA transcripts from Crambe abyssinica after 24 hour exposure to potassium chromate.

Transcripts Description E-Value Max Genbank Functions relative ident Accession no. frequency ity (%) (%) 5 Chitin binding/chitinase (CHB) 9e-41 96% NM_129921 Stress/defense 1 Early Responsive to 7e-52 77% NM_180019 Stress Dehydration 15 (ERD15) 1 Malate dehydrogenase like 2e-51 96% FJ208590 Cell metabolism protein (MDH) 2 Brassica oleracea ACC oxidase 3e-62 95% X81628 Stress 1 (ACCOx1) 4 Brassica rapa ThiJ-like protein 1e-87 92% AY335489 Stress (TJLP1) 4 Glutamine amidotransferase- 6e-106 89% NM_001035621 Cd stress like superfamily protein (GAT) 2 A. thaliana Cobalamin- 0 94% AJ608673 AA metabolism independent methionine synthase (CIMS) 2 A. thaliana RAB Homolog 1 3e-124 94% NM_123881 Cell Signaling (RHA1) 1 A. thaliana SHEPHERD 0 89% NM_118552 Stress (SHD); contain HSP90-binding domain 1 A. thaliana Formate 2e-161 88 NM_121482 Cd stress dehydrogenase (FDH); NAD binding/ oxidoreductase 1 A. thaliana Ferredoxin- 0 91% NM_126017 Cell metabolism NADP(+)- oxidoreductase 1 (FNR1) 2 Raphanus sativus plasma 0 95% AB030695 Ion transport membrane aquaporin 1b (PAQ1b) 2 Harpins-induced protein/ 1e-55 76% NP_196250.1 Defense Harpin responsive protein (HRP) 1 A. thaliana Alternative oxidase 0 90% NM_113135 Cell metabolism 1A (AOX1A) 1 Thalaspi caerulescens Yellow 0 90% DQ366110 Ion transport Stripe Like transporter 3 (YSL3) 1 B. juncea Glutathione-S- 9e-94 92% AY299481 Stress Transferase 6 (GSTF6) 4 Sinapus alba cytosolic 4e-81 92% X04301 Cell metabolism Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) 1 A. thaliana Temperature- 7e-151 96% NM_125192 Stress induced lipocalin (TIL1) 3 B. juncea gamma- 0 97% NM_001036624 Stress glutamylcysteine synthetase 1 (ECS1) 1 A. thaliana 3-chloroallyl 0 90% NM_179476 Stress aldehyde 47

dehydrogenase/oxidoreductase (ALDH7B4) 2 A. thaliana) Ubiquitin- 3e-85 82% NM_118602 Protein associated /TS-N domain- degradation containing protein (UBA) 1 A. thaliana Monooxigenase 2e-40 86% NM_117667 Cell signaling 1/Oxidoreductase (MO1) 1 A. thaliana Alanine 9e-76 89% AA metabolism aminotransferase/ alanine NM_101591 transaminase (ALAAT1) 1 B. juncea Virus resistant 4e-92 92% DQ789595 Defense protein(RT) 1 B. napus peroxidase 1 (POX1) 0 92% DQ0787541 Stress 1 Brassica juncea -1,3- 0 93% NM_115584 Defense glucanase 3 (BG3) 4 A. thaliana Glutathione-S- 4e-129 85% NM_128500 Stress Transferase tau 4 (ATGSTU4) 1 A. thaliana Rubisco activase 6e-04 86% NM_1799890 Stress (RCA) 2 A. thaliana elongation factor 1- 5e-129 100% NM_100666 Cell metabolism alpha (EF-1 ) 1 Raphanus sativus antifungal 2e-132 89% ABJ09663 Defense rafp1 gene (Rafp1) 2 A. thaliana putative fructose- 5e-19 100 NM_120057 Cell metabolism bisphosphate aldolase (FBA) 1 A. thaliana PSBO2; Oxygen 0 93% NP_190651.1 Photosynthesis evolving mRNA 2 B. juncea Glutathione 0 99% Y10984 Stress Synthetase (GS) 2 Brassica carinata defense- 1e-139 100 AY030296 Defense related protein (CJAS1) 1 A. thaliana putative / NADP+ 5e-124 94% NM_105265 Cell metabolism isocitrate dehydrogenase (ICDH) 2 A. thaliana NHL3 (Non-race 3e-110 90% NM_120715 Defense specific disease resistance gene- NDR1) 1 A. thaliana phosphoric ester 3e-155 92% NM_115438 Cell metabolism hydrolase (SBPASE) /stress 2 A. thaliana curculin-like 1e-45 90% NM_106534 Cell signaling (mannose-binding) lectin family protein (Curculin) 1 A. thaliana Mago Nashi protein 1e-143 91% At1g02140 Unknown with unknown function (UNK1) 1 A. thaliana with Ubiquitin- 0 97% At4g24690 Unknown/ associated domain, unknown Protein function (UNK2) degradation 1 A. thaliana Arginosuccinate 1e-33 90% NP_194214.2 Unknown/ synthase family Unknown AA metabolism function (UNK3) 1 A. thaliana Unknown function 2e-12 92% NP_001119047 Unknown/ (UNK4) AA metabolism 1 A. thaliana Rab 6e-39 87% U89959.1 Unknown GTPase/unknown protein (UNK5)

48

A. Hybridized with forward B. Hybridized with reverse

subtracted cDNA probe subtracted cDNA probe

Figure 4.3: Colony array for differential selection of subtracted cDNA clones. Membranes containing colonies showing subtracted cDNAs hybridized with 32P-labeled forward subtracted probe (A) and reverse subtracted probe (B). White arrows point towards false positives and black arrows point towards positive colonies.

49

The NCBI database search identified definitive or putative functions for 38 differentially expressed cDNA clones based on significant protein homology to previously recognized or putative proteins in other plant species. However, five transcripts encode proteins yet to be characterized and that could be implicated in novel metabolic pathways of Cr metabolism. Based on the sequence homology and functions in different metabolic pathways, we categorized the transcripts into different functional groups (Figure 4.4). These groups include genes involved in functions related to stress and defense response (17 genes), glutathione-S-transferases and sulfur assimilation (4 genes), cellular metabolism (8 genes), amino acid (AA) metabolism (2 genes), cell signaling (3 genes), ion transporters (2 genes), protein degradation (1 gene), photosynthesis (1 gene), and unknown novel proteins (5 genes

Unknown

Photosynthesis Protein Degradation

Transport

Signaling

AA metabolism

GSTs and Sulfur metabolism

Cell metabolism

Stress/ Defense

0 5 10 15 20 25 Number of upregulated

Figure 4.4: Cr-induced subtracted cDNAs encoding proteins involved in various functional categories.

Stress/defense related genes

Proteins involved in various stress and defense response were highly represented in the subtracted cDNA library. A total of 17 cDNA clones had homology to known genes involved in various types of biotic and abiotic stress responses including heavy metal 50 stress. Identified proteins include chitin binding protein/chitinase (CHB), early response to dehydration 15 (ERD15), ACC Oxidase 1 (ACCOx1), ThiJ like proteins (TJLP1), Glutamine amido-transferase-like superfamily protein (GAT), HSP90 (SHD), formate dehydrogenase/ NAD binding/ oxidoreductase (FDH), harpin-induced proteins (HRP), lipocalins (TIL1), 3-chloroallyl aldehyde dehydrogenase/oxidoreductase (ALDH7B4), virus resistant proteins (RP), peroxidases (POX1), β-1,3 glucanase (BG3), Rubisco activase (RCA), antifungal protein (Rafp1), defense related proteins (CJAS1), and disease resistant proteins (NDR1).

Higher representation of stress or defense related genes in our library suggests that these Cr induces genes are involved in protecting the cell from elemental toxicity. Many of these Cr-induced genes have previously been implicated in stress or defense responses in plants. Elevated expression of β-1,3 glucanase genes was observed in Hg-treated plants (Vankatachalam et al., 2009). Lipocalins (TIL1) constitute a diverse family of small extra- cellular proteins involved in many important functions. A recent report demonstrated the involvement of Arabidopsis temperature-induced-lipocalin (AtTIL) in modulating tolerance to oxidative stress (Charron et al., 2008). Transcripts encoding harpin-induced protein (HRP) and ThiJ like proteins 1 (TJLP1) were strongly upregulated in our library. Harpins are the bacterial elicitors known to induce hypersensitive response in many non- host species (Lindgren, 1997). The upregulation of harpin-induced defense related genes in the Cr-induced cDNA library may be due to involvement in signaling machinery under biotic and abiotic stresses. An extensive cross-talk between plant signaling pathways for defense against pathogens and those involved in abiotic stresses has been suggested (Fujita et al., 2006). ThiJ is an enzyme involved in the thiamine biosynthesis and ThiJ-like proteins (TJLP are homologous to human DJ-1, a multiple functional protein implicated in oxidative stress; Xu et al., 2005). A clone homologous to A. thaliana chloroallyl aldehyde dehydrogenase (ALDH7B4) was also found in our library. Aldehyde dehydrogenases (ALDHs) are reported to be involved in the detoxification of aldehydes produced in plants under abiotic stress. Two ALDHs from Arabidopsis, ALDH3I1 and ALDH7B4, were reported not only to function as aldehyde-detoxifying enzymes but Kotchoni et al. (2006) also term them as active AOS chelators and acting as enzymes limiting membrane lipid peroxidation. Further, early response to dehydration (ERD) proteins has been involved to play a role in abiotic stresses such as drought, salt, and toxic metals (Kariola et al., 2006).

51

Glutathione transferases (GSTs) and assimilation of sulfur

Four genes involved in the glutathione-S-transeferases, and glutathione synthesis were represented in the cDNA subtracted library. Evidence for the role of sulfur metabolism in Cr tolerance and accumulation in B. juncea is supported by Schiavon et al. (2008). Glutathione (GSH), a sulfur containing tripeptide, is a major cellular antioxidant against ROS (Rouhier et al., 2008). Glutathione is not produced by means of classical protein synthesis. Instead of it it is produced through the operation of two successive enzymes: γ-glutamylcysteine synthase (γ-ECS) and glutathione synthetase (GS). The differential expression of transcripts corresponding to both γ-ECS and GS in our cDNA library further implicate their involvement in metal tolerance and detoxification. Increased production of GSH is suggested to provide protection against oxidative stress in various species of Thlaspi in response to Ni (Freeman et al., 2004) and Cd (van de Mortel et al., 2008). Two genes, GSTF6 and GSTU4, corresponding to the phi and tau subfamily, respectively, of glutathione-S-transferases (GSTs) specific to plants were present in our library. The upregulation of GSTs in response to various toxic metals and metalloids has been shown in several other studies (Paulose et al., 2010, Ahsan et al., 2008; Abercombie et al., 2008). GSTs are reported to be involved in detoxification of both the endogenous and xenobiotic compounds (Wagner et al., 2002). GSTs may minimize oxidative stress by other means as by ectopic expression of tomato GST significantly improving the tolerance of yeast to hydrogen peroxide induced oxidative stress (Kampranis et al., 2000). These findings suggest that glutathione metabolism may be a major component in alleviating Cr toxicity by regulating the cellular oxidative balance via GSH/ascorbate cycle (Schiavon et al., 2008).

Amino acid metabolism

To cope with the deleterious effects of heavy metals, overproduction of various amino acids (histidine, methionine, proline and alanine) by eukaryotic cells has been reported (Monselise et al., 2003). Alanine accumulation in plants and animals in response to stress conditions has been reported (Monselise et al., 2003), although the precise role of alanine in stress tolerance is unknown. A clone (ALAAT1) encoding alanine amino- transferase appeared to be strongly induced in the present library. This enzyme is involved in the transamination of pyruvate to alanine. Levine et al. (1996) have shown that amino acids vary in susceptibility to oxidative damage, with methionine residues being the most 52 vulnerable, followed by cysteine and tyrosine. A clone (CIMS) encoding Cobalamin- independent methionine synthase showed strong upregulation in our subtracted cDNA library. Random oxidation of methionine could act as a potential sink for reactive oxygen species and may constitute one of the mechanisms of detoxification of ROS (Stadtman et al., 2003).

Cellular signaling and metabolism related genes

Involvement of signal transduction pathways in stress responses caused by heavy metals in not well understood. A clone (RHA1) homologous to Arabidopsis RAB5 was a highly expressed Cr- responsive gene in our library. Little is known about the function of RHA1 in plant response to abiotic stress but the gene is known to play a critical role in vacuolar trafficking in plant cells (Lee et al., 2004). Another Cr-induced cDNA clone, Cucurlin, encodes a curculin-like (mannose-binding) lectin family protein, which has been implicated in signal transduction related to para-dormancy release in root buds of Euphorbia esula (Horvath et al., 2005). The upregulation of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is also an indication of enhanced cellular metabolism. This gene has been reported to be involved in cellular oxidation-reduction regulation (Baek et al., 2008). Further, an alternative oxidase (AOX1A) present in this library has been implicated in reducing the formation of ROS in various stresses in plants (Maxwell et al., 1999). Based upon this evidence, it may be implied that upregulation of AOX1A clone may be instrumental in reduction of ROS in Cr-induced oxidative stress. Another alternative role may be presumed to stimulate the synthesis of AOX by ROS as a signaling element (Amor et al., 2000).

Evidence for a correlation of metal tolerance and organic acid content has been reported in various plants (Krotz et al., 1989). Upregulation of two cDNAs encoding malate dehydrogenase (MDH) and isocitrate dehydrogenase (ICDH) might suggest enhanced organic acid production for metal chelation. Zinc and Ni were reported to be chelated with malate and citrate in above ground parts of Arabidopsis halleri (Sarret et al., 2001) and Thlaspi goesingense (Krämer et al., 2000), respectively. In this work, transcripts encoding ferridoxin NAD(+) oxidoreductase (FNR1) and formate dehydrogenate/ NAD(+) oxidoreductase (FDH) upregulated by Cr exposure were presumed to be involved in cellular respiration during heavy metal oxidative stress (Fusco et al., 2005). Chromium is known to induce oxidative stress and commonly induced 53

antioxidant genes such as ascorbate peroxidase, catalase, and superoxide dismutase were not present in this library. It is likely that these genes are either induced at early stages within 6 hr of Cr treatment or respond at longer exposure time beyond 24 hr used in our study.

Ion transporters

Two membrane transporters encoding plasma membrane aquaporin 1b (PAQ1b) and Yellow Stripe Like transporter 3 genes (YSL3) were found to be upregulated. Recently, an aquaporin (BjPIP1) from the heavy-metal accumulator B. juncea was reported to have a role in plant drought and heavy metal stress response (Zhang et al., 2008). Although aquaporins are involved primarily in movement of water across biological membranes, compelling evidence also exists that aquaporins can transport other physiologically important molecules. The NIP subfamily of aquaporins actively transports arsenite and boron across membranes (Bienert et al., 2008). A report by (Anthony et al., 2000) suggests that mammalian aquaglyceroporin, AQP1, is involved in the transport of cations. AQP7 and AQP9 are also implicated in the transport of metalloid such as arsenite (Liu et al., 2002). A cDNA clone with a strong homology to YSL3 family of genes in Arabidopsis thaliana was also identified. The YSL family members are shown to be implicated in the translocation of Nicotianamine-metal chelates and delivery of Fe in the seeds (Waters et al., 2006)

Protein degradation pathway

Upregulation of two ubiquitin-associated protein (UBA) identified in this study is presumed to be required for increased protein turnover in Cr-treated plants. It has previously been shown that the ubiquitination system has a pivotal role in number of plant processes such as plant developmental and responses to various abiotic and biotic stresses (Zeng et al., 2006). A strong accumulation of ubiquitin-associated-protein in tomato (Solanum lycopersicum L.) was observed by exposure to Cd (Feussner et al., 1997). Differential expression of ubiquitin-associated proteins in response to Cr exposure (this study) and arsenic exposure (Paulose et al., 2010) strongly suggest the role of these proteins in ameliorating the proteotoxicity effect caused by heavy metals stresses. 54

Unknown novel proteins

Five subtracted cDNA sequences did not match any characterized proteins. However, they have distinct homologs in Arabidopsis and in other plants with a high sequence identity to proteins with no known function.Further characterization of these novel sequences seeks to elucidate their role in Cr metabolism by plants.

Confirmation of differential expression of subtracted cDNA transcripts by semi-quantitative RT-PCR

The up regulation of the subtracted cDNA clones in response to Cr exposure was confirmed by semi-quantitative RT-PCR. It was performed for the majority of genes identified in the subtracted cDNA library. RT-PCR analysis revealed that most of the subtracted cDNA clones showed induction of the corresponding mRNA transcripts upon Cr exposure. The time-dependent transcript upregulation of the Cr-responsive cDNAs are shown in Figure 4.5. The quantification of mRNA expression levels using ImageJ is shown in Figure 4.6. For most of the cDNA clones, transcript level started to increase at 6 hr and reached the highest level at 24 hr. RHA1, SHD, TIL1, UBA, POX1, GSTU4, and UNK2 were induced more than 8-fold at 12 and 24 hr. Several genes corresponding to subtracted cDNAs such as CHB, TJPL1, HRP, Rafp1, ICDH, UNK1, and UNK4 showed more than 6-fold induction in Cr-exposed crambe tissues as compared to controls (Figure 5 and 6). The transcript levels start increasing as early as 6 hr and continued to increase up to 24 hr. Transcripts encoding ERD15, MDH, ACCOX1, FDH, YSL3, GSTF6, ALAAT1, MO1, ECS1, BG3, GS, CJAS1, UNK3, and UNK5 showed more than two-fold induction in response to Cr exposure. Transcripts corresponding to the cDNA clones encoding SHD, MDH, PAQ1, POX1, and BG3 exhibited strong upregulation only at 24hr. A transient expression was observed for RHA1, FDH, FNR1, TIL1, Rafp1, UNK1, UNK2, and UNK3 as their expression appeared to be induced at 6 or 12h, with variable response at 24 hr. Our results showed that the expression of most of the subtracted cDNAs was strongly induced in response to Cr exposure. The differential regulation of these subtracted cDNA transcripts highly indicate a role in Cr metabolism. The upregulation of most of these stress-related proteins has also been observed in response to other biotic or abiotic stresses, suggesting possible common metabolic responses to different stresses. 55

Chromate No. of GENE Chromate No. of GENE PCR PCR NAME 0 6 1 24hrs NAME 0 6 1 24hrs cycle cycle 2 2 25 CHB 28 UBA

ALAAT1 25 ERD15 25

MDH 24 MO1 25

ACCOX1 26 POX1 24

TJLP1 28 BG3 26

GSTU4 RHA1 25 28

SHD 24 Rafp1 30

GS 25 FDH 26

FNR1 27 CJAS1 27

PAQ1 24 ICDH 24

UNK1 25 HRP 28

UNK2 25 YSL3 25 UNK3 25 GSTF6 26 UNK 4 28 TIL1 25 UNK 5 30 ECS1 28 ACT2 25 ACT2 25

Figure 4.5: Semi-quantitative RT-PCR analysis of the Crambe abyssinica transcripts corresponding to the subtracted cDNAs after 0, 6, 12 and 24 hr of potassium chromate treatments. The number of optimized PCR cycles used for amplification for each cDNA clone is written on the right hand side of the panel. ACT2, was selected as an internal control.

56

14 6h 12h 24h 12

10

(fold) 8

6

control 4 to

2

0 relative

5 1 H 1 1 1 1 X1 IL1 CHB SHD FD HRP T CS RD MDH RHA1 FNR PAQ YSL3 E E CCO TJLP GSTF6

level A

12 6h 12h 24h 10

Expression 8

6

4

2

0

A 1 1 H 4 5 B T O1 X1 p GS S1 D K K U A M BG3 af NK1 NK2 NK3 PO R JA IC U U U N UN GSTU4 C U ALA

Figure 4.6: Expression levels (fold-change) of Cr-induced mRNA transcripts relative to untreated controls measured as difference in relative band intensity using ImageJ. 57

Reverse cDNA subtraction library

A reverse-subtracted cDNA library was constructed with untreated plants serving as tester and Cr-treated plants as driver (Figure 4.7A/B). Cr-induced reverse subtracted cDNAs encoding proteins are mainly genes involved in photosynthetic and ribosomal proteins functional categories (Figure 4.8). Inhibition of photosynthesis by heavy metals is well documented (Joshi & Mohanty, 2004). Earlier studies demonstrated that heavy metal toxicity is associated generally with inhibition of chlorophyll biosynthesis and damage to the photosynthetic apparatus (Heidenreich, 2001). Almost all of the clones identified as down regulated belonged to the photosynthetic machinery reflecting the severity of Cr toxicity to plants. The present data clearly indicated that Cr had affected invariably light reactions and Calvin-Benson cycle alike. Transcripts encoding both the components of photosynthetic light reactions as well as the Calvin-Benson cycle (Table 4.2) were down regulated in our study. These results are in consonance with previous studies in Arabidopsis and tobacco, in which a short-term, S-deficiency stress resulted in down- regulation of several genes encoding chlorophyll a/b binding proteins and components of PSII as well as rubisco activase (Hirai et al., 2003; Wawrzyn´ska et al., 2005). 58

Down- Homology/putative identity E- Maximu Genebank regulated Value m accession identity no. (%) D-1m Arabidopsis thaliana LHCB3 6e-162 92% NM124807 D-2 Brassica rapa PsbQ2 mRNA for 0 94% AB300310 oxygen-evolving enhancer protein3-2 D-5 Arabidopsis thaliana 18S rRNA 4e-122 96% NR022795 D-16 Arabidopsis thaliana: PSAE-2 1e-26 89 (photosystem I subunit E-2) D-22 Arabidopsis thaliana protease 0 77% inhibitor/seed storage/lipid transfer protein (LTP) family protein D-25n Arabidopsis thaliana PSBO-2/PSBO2 0 71% NM114942 (PHOTOSYSTEM II SUBUNITO-2) D-34o RuBisCO small subunit 2B (RBCS-2B) 7e-84% 76% DQ242646. (ATS2B) D-41 Arabidopsis thaliana): PSBR 0 72% (photosystem II subunit R) D-44 Arabidopsis thaliana PSAO 0 62% (photosystem I subunit O) (PSAO) D-56 B.juncea mRNA for chlorophyll a/b- 5e-147 96% X95727 binding protein D-64 Arabidopsis thaliana mRNA-binding 2e-101 91% NM116179 protein, putative (AT3G63140) mRN

D-71 Arabidopsis thaliana: RCA (RUBISCO 8e-100 88% NM129531 ACTIVASE) D-73 Atl5 (A. thaliana ribosomal protein l5) 0 89% NM113448 structural constituent of ribosome D-83 Musa acuminata 23S ribosomal RNA 0 100% EU017008 (rrn23) gene, partial sequence D-85 Arabidopsis thaliana): 60S ribosomal 6e-116 92% NM179773 protein L10A (RPL10aB) D-100 Arabidopsis thaliana): hypothetical 3e-77 93% NM120469 protein D-129 Brassica napus fructose-1,6- 1e-40 91% AF081796 bisphosphatase precursor (FBP) mRNA

D-138 SKS5 (SKU5 Similar 5) copper ion 0 37% binding oxidoreductase D-151 Brassica juncea mRNA for glutathione 6e-98 94% AJ561120 transporter GT1 D-156 Brassica napus chloroplast chlorophyll 0 91% DQ645428 a/b binding protein mRNA D-162 Arabidopsis thaliana putative 0 87% AF360265 chloroplast 50S ribosomal protein L6 D-170 Arabidopsis thaliana PSBO-2/PSBO2; 0 93% NM 114942 oxygen evolving (PSBO-2/PSBO2) D-176 Arabidopsis thaliana): acid 74% 74% phosphatase class B family protein

Table 4.2: Identity and description of down regulated subtracted cDNA transcripts from crambe abyssinica after 24 hours exposure to potassium chromate 59

Down- Homology/putative identity E- Maximu Genebank regulated Value m accession identity no. (%) m D-1 Arabidopsis thaliana LHCB3 6e-162 92% NM124807 D-2 Brassica rapa PsbQ2 mRNA for 0 94% AB300310

oxygen-evolving enhancer protein3-2 D-5 Arabidopsis thaliana 18S rRNA 4e-122 96% NR022795 D-16 Arabidopsis thaliana: PSAE-2 1e-26 89 (photosystem I subunit E-2) D-22 Arabidopsis thaliana protease 0 77% inhibitor/seed storage/lipid transfer protein (LTP) family protein D-25n Arabidopsis thaliana PSBO-2/PSBO2 0 71% NM114942 (PHOTOSYSTEM II SUBUNITO-2) o D-34 RuBisCO small subunit 2B (RBCS-2B) 7e-84% 76% DQ242646. (ATS2B) D-41 Arabidopsis thaliana): PSBR 0 72%

(photosystem II subunit R) D-44 Arabidopsis thaliana PSAO 0 62% (photosystem I subunit O) (PSAO) D-56 B.juncea mRNA for chlorophyll a/b- 5e-147 96% X95727 binding protein D-64 Arabidopsis thaliana mRNA-binding 2e-101 91% NM116179 protein, putative (AT3G63140) mRN D-71 Arabidopsis thaliana: RCA (RUBISCO 8e-100 88% NM129531 ACTIVASE) D-73 Atl5 (A. thaliana ribosomal protein l5) 0 89% NM113448 structural constituent of ribosome D-83 Musa acuminata 23S ribosomal RNA 0 100% EU017008

(rrn23) gene, partial sequence D-85 Arabidopsis thaliana): 60S ribosomal 6e-116 92% NM179773 protein L10A (RPL10aB) D-100 Arabidopsis thaliana): hypothetical 3e-77 93% NM120469 protein D-129 Brassica napus fructose-1,6- 1e-40 91% AF081796 bisphosphatase precursor (FBP) mRNA D-138 SKS5 (SKU5 Similar 5) copper ion 0 37% binding oxidoreductase D-151 Brassica juncea mRNA for glutathione 6e-98 94% AJ561120 transporter GT1 D-156 Brassica napus chloroplast chlorophyll 0 91% DQ645428

a/b binding protein mRNA D-162 Arabidopsis thaliana putative 0 87% AF360265 chloroplast 50S ribosomal protein L6 D-170 Arabidopsis thaliana PSBO-2/PSBO2; 0 93% NM 114942 oxygen evolving (PSBO-2/PSBO2) D-176 Arabidopsis thaliana): acid 74% 74% phosphatase class B family protein

60

A

B

Figure 4.7: Differential screening of cDNA clones from the crambe SSH library. Reverse Cr-treated plant specific library is shown. Duplicate blots were constructed and the they were hybridized with radiolabeled probes (A) An array representing 193 clones from reverse library hybridized with subtracted tester cDNA probe (non- treated Cr plant) (B) An array representing 193 clones from reverse library hybridized with substracted control cDNA probe (Cr-treated plant). 61

Figure 4.8: Functional categories of Cr-responsive down regulated genes in reverse SSH library. 62

Conclusions Crambe, being a non-food high biomass crop, is an ideal candidate for phytoremediation of Cr and other toxic metals. In addition, crambe can be readily genetically modified to further improve its tolerance to various toxic metals. The present study is the first transcriptomic analysis that identifies the genes/ gene networks differentially regulated in response to Cr stress a heavy metal tolerant crop with phytoremediation potential. The results obtained from this study clearly indicate that an intricate interplay of various metabolic pathways may be involved in the determinant in conferring tolerance to and hyperaccumulation of Cr. Stimulation of glutathione metabolism, amino acid synthesis, activation of numerous stress or defense-related proteins is evidence for a significant metabolic response to counteract the toxicity of Cr. Characterization of these differentially regulated genes will enable us to develop different approaches for an expedite phytoremediation of Cr in non-food high biomass crops as well as to engineer food crops for reduced Cr uptake in the edible parts.

63

Bacterial Complementation Assays

Chromium is found in the environment innumber of forms but the stable one are two of them i.e., Cr (III) and Cr (VI). The properties of these two species are remarkably 2- different due to difference in their abilities to cross biological membranes. CrO4 is actively transported across biological membranes via sulfate containing transporting proteins. It is immediately converted to Cr+3 in roots presumably by an iron reductase enzyme (Zayed et al., 1998). Absorption of Cr3+ is passive and is adsorbed by cation exchange on cell wall (Marchner, 1995).

P-type ATPases consist of a large family of cation-transporting proteins of membranes. P -type ATPases that catalyze transport of transition or heavy metal ions are termed soft-metal-transporting P-type ATPases. A recently identified subfamily of putative soft metal P-type ATPases has been implicated in metal homeostasis. In the case of soft metals that are only toxic, existence of specific uptake systems has not been reported. It has been speculated that they may be accumulated via other existing transport systems (Rensing et al., 1999).

The physiological functions of three genes i.e, Harpin (Hrp), Lipocaline (TIL1) and Thij (Tjlp1) were investigated by cloning these genes into plasmid pGEM-T by polymerase chain reaction forming plasmid (pHrp), (pTIL1) and (pTjlp1), respectively.. Escherichia coli strains W3110 and RW3110 were transformed with these constructs. Empty plasmid pBSK served as negative controls after transforming it into RW3110 E.coli strain. Metal inhibition was tested both in liquid and solid media. The growth of the two strains was compared in liquid LB having 20 and 25 ppm concentration of potassium chromate and at of 0, 5, 10, 15, 20, 25, 30 ppm at solid LB medium. Results and Discussion

A. Complementation studies on solid medium

Functional complementation of yeast mutants, displaying selectable phenotypes, has been used very successfully in the past years to isolate many plant genes involved in signaling, stress response or metabolic pathways (Mehlmer et al., 2009). The Zn (II)- translocating P-type ATPase has been identified as the first product of 732 bp fragment, a potential gene identified in the sequencing of the Escherichia coli genome. This gene, termed zntA, was disrupted by insertion of a kanamycin gene through homologous 64 recombination (Rensing et al., 1997). The mutant strain was hypersensitive to Zn and Cd salts indicating a role in homeostasis of Zn in E. coli.

To examine whether AtHrp enhances Cr resistance, the AtHrp was cloned into an E.coli vector pGEM-T and expressed in E. coli strains, W3110 and RW3110. When 2- grown on CrO4 spiked Luria-Bertani (LB) solidified medium with agar, no difference could be observed between cells expressing AtHrp exposed to Cr (VI) and wild type W3110 and RW3110 strains at various concentrations of 0, 5, 10, 15, 20, 25 and 30 ppm Cr (VI) (Figure 5.1 A/B).

Similarly to investigate whether AtTIL1 enhances Cr resistance, the AtTIL1 was cloned into an E. coli vector pGEM-T and expressed in E. coli strains, W3110 and 2- RW3110. When grown on CrO4 spiked Luria-Bertani (LB) medium, no difference could be observed between cells expressing AtTIL1 and wild type W3110 and RW3110 strains at various concentrations of 0, 5, 10, 15, 20, 25 and 30 ppm Cr (VI). (Figure 5.1 A/B).

To check whether (Tjlp1) enhances Cr resistance the (Tjlp1) gene was cloned into an E coli vector pGEM-T and expressed in E. coli strains, W3110 and RW3110. When 2- grown on Cro4 spiked Luria-Bertani (LB) medium, no difference could be observed between cells expressing Tjlp1 wild type W3110 and RW3110 strains at various concentrations of 0, 5, 10, 15, 20, 25 and 30 ppm Cr (VI) (Figure 5.1 A/B).

65

A

B

Figure 5.1: Bacterial complementation studies of AtHrp, AtTIL1 and AtTIJP in E. coli strains W3110 and AW3110 at LB Agar medium with various concentration of potassium chromate (A) Complete setup (B) closer view AT 0, 20 and 25ppm

W 66

B. Complementation studies on liquid medium

The effect of the AtHrp for imparting the resistance against CrO42- ions was tested in two bacterial strains. Mutant E. coli strain RW3110 is lacking in the Zn and Cd export transporter, zntA, and is supersensitive to Cd. The Cd supersensitive strain showed strong 2- resistance to CrO4 when it contained pGEM/AtHrp plasmid at 20 ppm (Figure 5.2 A). The anomalous results were obtained at 25 ppm where RW3110 strain was most sensitive to Cr while cells expressing AtHrp imparted no tolerance against Cr (Figure 5.2B). At both concentrations of 20 and 25 ppm the found results were difficult to interpret. Moreover, the wild type strain W3110 showed extreme sensitivity at both conditions in comparison to RW3110. This finding might suggest that Zn transport pump have no role in Cr Transport and AtHrp does not complement the ZntA. 67

A

Absorbance 600nm Absorbance

Time (hrs) B

Absorbance 600nm

Time (hrs) Figure 5.2: Expression of AtHrp investigating tolerance to CrO42- bearing vector plasmid pGEM with the 20 ppm (A) and 25ppm (B) CrO42- concentrations in liquid LB. 68

2- In case of RW3110 cells expressing AtTIL1, at 20 and 25 ppm CrO4 concentration entirely different results were obtained (Figure 5.3 A and B). The RW3110 did not show 2- 2- sensitivity to CrO4 ions and the cells expressing AtTIL1were more sensitive to CrO4 and did not impart tolerance to E.coli strain RW3110 against Cr. 69

A

Absorbance 600nm

Time (hrs) B

Absorbance 600nm

Time (hrs) Figure 5.3: Expression of AtTIL1 investigating tolerance to CrO42- bearing vector plasmid pGEM with the 20 ppm (A) and 25ppm (B) CrO42- concentrations in liquid LB.

70

The effect of the Tjip1 imparting the resistance against CrO42- ions was also investigated in RW3110 strain (Figure 5.4 A and B). The cells expressing Tjip1 showed 2- resistant to CrO4 ions gradually with the passage to time in comparison to RW3110 at 20 ppm. This occurred late in the assay starting at 16 hours and continuing till 22 hours. RW3110 strain expressing Tjip1 was resistant to Cr at both 20 and 25 ppm. The same anomalous results were obtained with reference to W3110 wild type strain as it showed extreme sensitivity to Cr at both concentrations. Only a few studies report on thiamin biosynthesis in plants, implicating Tjip1 (Kim et al., 1998). Based upon this finding we cannot presume that Tjip1 complements ZntA in Cr metabolism also. 71

A

Absorbance 600nm

Time (hrs) B

Absorbance 600nm

Time (hrs)

Figure 5.4: Expression of Tjlp1 investigating tolerance to CrO42- bearing vector plasmid pGEM with the 20 ppm (A) and 25ppm (B) CrO42- concentrations in liquid LB. 72

In summary it can be concluded that the results are not consistent in all three complementation studies and their implication cannot be predicted in Cr metabolism based upon these findings.

73

Cloning Of Three Important Genes

Introduction

Heavy metal contaminated soils pose an environmental and health threat to animal and plant health. Use of plants that hyperaccumulate specific metals in decontamination efforts were discovered over the last 20 years (Rascio et al., 2011). As far as Cr is concerned, it is particularly a problem of developing countries causing contamination in drinking water and soil. Several plant species particularly Brassicaceae members have been identified as suitable candidates for phytoremediation. Despite the prolific literature on Cr contamination, comprehensive understanding and detoxification of Cr is still rudimentary. Thus an advanced understanding at the molecular as well as physiological mechanism of Cr metabolism in plants is highly prerequisite to develop different strategies for phytoremediation. It will also enable us to engineer Cr resistant crops with reduced Cr accumulation. For this purpose an extensive characterization of structure and functions of these genes is required. There is a strong need to develop plants that actively transport Cr to aerial parts for the decontamination of soils. The genes that have been least studied in hyperaccumulation and tolerance in plant species have been selected for cloning. Results and Discussion

A pictorial scheme of cloning of all the three genes is given in figure 6.1 74

Figure 6.1: Diagrams of AtTIL1, AtHrp, Tjlp1 constructs. Physical map of AtTIL1, AtHrp and Tjlp1 cloned under the control of ACT2 promoter- terminator expression cassette, in binary vector pBIN1tomakeplasmid (A) pBIN19/Act2pt/AtTIL1, (B) pBIN19/Act2pt/AtHrp, (C)pBIN19/Act2pt/Tjlp1 for plant transformation respectively

75

Cloning of Lipocalins (TILs)

Lipocalins proteins have been characterized in bacteria as well as in animals. Very few studies are available about plant lipocalins. They exist in two forms, one termed as temperature-induced lipocalins (TILs), are induced upon temperature stress and other are confined to chloroplast as chloroplastic lipocalins (CHLs). They have been implicated in abiotic stress tolerance in wheat and their expression is linearly correlated with the plant freezing tolerance capacity.Another putative function assigned to lipocalins is the protection of the photosynthetic apparatus against temperature stress and this attribute of lipocalins is widely suggested (Charron et al., 2008).

The AtTIL1 cDNA sequence (accession NM_125192) was PCR amplified from Arabidopsis flower cDNA library using the forward primer 5′- TACGTCGTCATGACAGAGAAGAAAGAGATG -3′ and reverse primer 5′- TAGCTGGGATCCGATATCCTATTTGCCGAAGAGAGATTT -3′. The PCR conditions used for AtTIL1 amplification were: 2 minutes at 94°C, followed by 30 cycles of 45 seconds at 94°C, 1 minute at 55°C, 45 seconds at 72°C, and finally extending for ten minutes at 72°C. As a result of it the PCR product was introduced as Nco1/BamH1 fragment under the control of an Actin2 gene promoter and terminator expression cassette (ACT2pt) (Dhanker et al., 2002) to make the construct ACT2pt/AtTIL1 (Figure 6.2) and sequences were confirmed. The sequenced construct was sub-cloned as a KpnI/SacI fragment into the plant binary vector pBIN19 making pBIN19/ACT2pt/ AtTIL1.

Subcloning of the the entire chimeric gene including the Act2 promoter, the lipocalin coding sequence, and the 3’nos transcription terminator sequence was done into the plant expression T-DNA binary vector pBIN19 (Clonetech Palo Alto, Calif.) that has the selectable Kanamycin-resistanance marker (NPTII). Wild type Arabidopsis thaliana (ecotype Columbia) plants were transformed with the recombinant Agrobacterium tumefaciens strain (GIBCO/BRL, Gaithersburg, Md) using the Vacuum infiltration procedure. Later the TI generation seeds of A. thaliana were screened for Kanamycin resistance.

It is reported that AtTIL1 is not only expressed under dehydration and oxidative stresses, but it is also induced upon ABA treatment, indicating a possible link between theses stresses (Francois Ouellet, 2008).

76

Figure 6.2: 2% Agarose gel showing the restriction digestion (A) and ligation (B) of fragments for detection of Act2pt/TIL1 77

Cloning Of Harpin Induced Genes (Hrp)

“Harpin” is a proteinaceous elicitor known to be involved in the plant defense reaction named as hypersensitive response (HR) .It was isolated from Erwinia amylovora, the bacterium causing fire blight of pearand different members of rosacea family. This elicitor is also responsible to trigger the hypersensitive response in a number of non-host plants. Genes induced as a result of elicitation of harpins in plants was identified in tobacco and named Harpin-induced (Hin) genes. A tobacco homolog of Hin gene has also been identified in rice (Rakwal et al., 2003).

The AtHrp cDNA sequence (accession NP_196250.1) was PCR amplified from Arabidopsis flower cDNA library using the forward primer 5′- TACGTCGCCATGGCGGACTTAAACGGTGCGTAT -3′ and reverse primer 5′- TAGCTGCTCGAGTCAAAAGTCAACGTCACACTT -3′. The PCR conditions used for AtHrp1 amplification were: 2 minutes at 94°C, followed by 35 cycles of 45 seconds at 94°C, 1 minute at 55°C, 45 seconds at 72°C, and finally extending ten minutes at 72°C. As a result of it the PCR product was introduced as NcoI/XhoI fragment under the control of an Actin2 gene promoter and terminator expression cassette (ACT2pt) (Dhanker et al., 2002) to make the construct ACT2pt/ AtHrp (Figure 6.3) and sequences were confirmed. The sequenced construct was sub-cloned as a KpnI/SacI fragment into the plant binary vector pBIN19 making pBIN19/ACT2pt/AtHrp. Ecotype Columbia plants of Wild type Arabidopsis thaliana were transformed with the recombinant Agrobacterium tumefaciens strain (GIBCO/BRL, Gaithersburg, Md) using the Vacuum infiltration procedure. Again the TI generation seeds of A. thaliana were screened for Kanamycin resistance.

Finding of a recent research suggested that overexpression of a Harpin-encoding gene hrf1 in rice increased drought tolerance through Abscisic Acid (ABA) signaling (Zhang et al., 2011).

78

Figure 6.3: 2% Agarose gel showing the ligation of Act2pt/AtHrp (A) Act2pt cassette (B) and transformation of Agrobacterium tumefaciens (C) with Act2pt/AtHrp

Cloning of ThiJ genes (Tjlp1)

A cDNA clone (ThiJ) was induced after treating with salicylic acid in Brassica rapa subsp. Pekinensi and it was characterized. Thij is a thiamin biosynthesis enzyme catalyzing the phosphorylation of hydroxymethylpyrimidine to HMP monophosphate. Al This gene not only shows a similarity to bacterial Thij genes, it is also homologous to the human DJ-1, a protein performing many functions. It is involved in regulation of transcription, male fertility, and Parkinsonism. The brassica ThiJ-like gene is highly induced upon salicylic acid treatment and upon infection of a nonhost pathogen, Pseudomonas syringae pv. tomato, which evokes a hypersensitive response in Brassica rapa (Oh et al., 2003). It is worth mentioning that DJ-1 is induced by oxidative stress

(such as H2O2), since H2O2 is rapidly generated by NADPH oxidase at the site of pathogen infection in plants (Hammond- Kosack and Jones, 1996). 79

Brassica rapa ThiJ-like protein (TJLP1) AY335489 cDNA sequence (accession AY335489) was PCR amplified from Arabidopsis flower cDNA library using the forward primer 5′- TACGTCGCCATGGCTTCATTTACGAAAACGGTTTTG -3′ and reverse primer 5′- TAGCTGCTCGAGTCACACAAGTGTTGCCTTTCCGAG -3′. The PCR conditions used for AtTIL1 amplification were: 2 minutes at 94°C, followed by 45 cycles of 45 seconds at 94°C, 1 minute at 55°C, 45 seconds at 72°C, and finally extending for ten minutes at 72°C. As a result of it the PCR product was introduced as NcoI/XhoI fragment under the control of an Actin2 gene promoter and terminator expression cassette (ACT2pt) to make the construct ACT2pt/ Tjlp1 (Figure 6.4) and sequences were confirmed. The sequenced construct was sub-cloned as a KpnI/SacI fragment into the plant binary vector pBIN19 making pBIN19/ACT2pt/ Tjlp1. Arabidopsis thaliana (ecotype Columbia) plants were transformed with the recombinant Agrobacterium tumefaciens strain (GIBCO/BRL, Gaithersburg, Md) using the Vacuum infiltration procedure same as in the above described manner. Later the TI generation seeds of A. thaliana were screened for Kanamycin resistance.

Figure 6.4: 2% Agarose gel showing the ligation of fragments for detection of Act2pt/Tjlp1

80

Physiological studies of crambe

The Phytoremediation simply uses the natural ability of plants to decontaminate polluted soil (Pilon-Smits, 2005; Doty, 2008; Newman & Reynolds, 2005; Suresh & Ravishankar, 2004; Pilon-Smits & Freeman, 2006). The suitable features of a plant species for phytoremediation process are tolerance of heavy metal, its accumulation and prolific biomass production (Schiavon et al., 2008). These desired traits and their potential exploitation for the phytoremediation of metal contaminated soil have stimulated intensive research on plant systems.

A number of Brassicaceae members have a pivotal role in phytoremediation technology. Many wild Brassica plants are reported to hyperaccumulate heavy metals and are repository of genes imparting tolerance against toxicity of various metals (Palmer et al., 2001). Almost 87 Brassica species have been reported as metal hyperaccumulator with the ability to tolerate a high level of heavy metals in soil as well in shoots (Milner et al., 2008). Many members of Brassicaceae are well adapted to a broad environmental stresses and have exhibited a moderate potential of heavy metal accumulation subjected to various experimental treatments (Brooks et al., 1998).

Contamination of the environment by Cr has become a serious concern in the recent years (Shiavon et al., 2008). Chromium is utilized on a large scale in different industrial units of wide range applications such as metallurgy, electroplating, tanning, production of Cr based chemicals, and production of paper (Dixit et al., 2002). The cytotoxic effects of this metal on animals and plants are well documented, and its mutagenicity turns it into the cause of different types of human cancer (Vajpayee et al., 2001). It exists in trivalent and the hexavalent oxidation states in nature (Zayed et al., 1998. These states are interchangeable depending on biological, physical and chemical properties in waters and soils (Kotas and Stasicka, 2000). They differ in their levels of toxicity. Chromium (VI) is extremely toxic and causes damage to cell structure and DNA architecture because of its oxidizing properties. Contrary to that, Cr (III) is less toxic having less solubility and toxicity but inhibiting at high concentrations to different enzymatic systems or by reacting with organic molecules (Barcelo and Poschenrieder, 1997).

Plants produce constantly active oxygen species (AOS) and free radicals, i.e., superoxide, H2O2, and singlet oxygen upon normal cellular metabolism. Plants rapidly 81 convert these AOS by means of antioxidant enzymes and metabolites (Asada, 1999) under normal conditions. Various environmental stresses including heavy metal stress can cause excess AOS production, and necessitate additional defense responses. Cr is documented in the induction of reactive oxygen species causing oxidative damage (Choudhury and Panda, 2005). The changes in antioxidant stress enzyme activities in response to Cr may be taken as an evidence for the enhanced detoxification capacity of plants towards reactive oxygen species.

Keeping in view the efficiency of Brassicacea family, the physiological potential of Crambe for chromium decontamination of soil and sediments was explored in the present study. A native of the Mediterranean region having a herbaceous habit is used in the production of oil for industrial products (Lazzeri et al., 1994). Crambe oil has better technological features than those of sunflower, rapeseed or soybean (Bondioli et al., 1998). It is considered more heat and drought-tolerant than soybeans and canola (Brassica napus L) at all stages of growth (Johnson et al., 1995). Crambe gets adapted to cold also (Papathanasiou and Lessman, 1966). It is moderate resistance to salinity stress during germination over a range of 10 to 30oC temperature (Fowler, 1991). Crambe also qualifies the criterion of having high aerial biomass and fast growth, which is considered one of the most desirable features for metal phytoextraction from, contaminated soils and sediments (Schiavon et al., 2008).

A study into the physiology of heavy metal tolerance in crambe will be helpful in evaluating its potential for phytoremediation. The metal accumulation tolerance potential was studied at different time intervals. The tolerance to Cr was assessed on the basis of the damage done as a result of lipid peroxidation and response of crambe to counteract this stress with enhanced levels of antioxidant enzymes induced under stress. RESULTS

A linear relationship in Cr content of shoots and roots was exhibited by crambe as shown in Figure 7.1A & Figure 7.1B respectively. Throughout the experiment Cr contents kept on increasing significantly in both roots and leaves. Roots accumulated much more Cr as compared to shoots.

82

60 Control Leave 50 Treated *

40 *

30 *

20

10 *

0 151012 1000 Roots Control * Treated * 800 *

Chromium content (ppm) 600

400 * 200

0 1 5 10 12

Days of treatment

Figure 7.1: Changes in Cr content for Cr treated and Control plants of leaves (A) and roots (B). Vertical bars shows the standard error bars values (p<0.05) for comparisons at a given day of treatment.

Fv/Fm is a measure of the intrinsic and inherent efficiency of PSII Photochemistry in the dark -adapted state. It was not significantly affected by the Cr concentration in the initial days of treatments. But it became more evident during later treatment. Results of the Fv/Fm of the treated plant are shown in Figure 7.2 A, which indicates that for the first 10 days of treatment, Fv/Fm of Cr-treated plants remained at the same levels as that of 83 control plants (80%). However, at 12th day of Cr treatment, Fv/Fm declined to 5% for Cr- treated plants as compared to control plants, which were maintained at the same levels of 80%.

100 Control A Treated 80 *

60

40

20

0 1 5 10 12 100 Control B Treated * 80 Percentage (%) ** ** 60

40

20

0 1 5 10 12

Days of treatment

Figure 7.2: Effect of Cr-treatment on the photochemical efficiency (Fv/Fm) (A) and on quantum yield (Fs/Fms) (B) of Crambe leaves, Vertical bars shows the standard error bars values (p<0.05) for comparisons at a given day of treatment.

84

The quantum yield i.e., Fs/ Fms of Cr-treated plant is presented in Figure 7.2 B which shows that the Fs/Fms of Cr-treated plants declined significantly to 33% as compared to control plants by the first day of Cr-treatment. For the 5 to 10 days of Cr treatment, Fs/Fms of Cr-stressed plants recovered to 10% and 9% respectively as compared to control plants. Whereas at the end of treatment i.e., 12th day of Cr exposure, the respective Fs/Fms again declined significantly to 28 % to that of control plants.

Figure 7.3 A and Figure 7.3 B represents the APX of control and Cr-treated plants of leaves and roots respectively. Differences in root APX enzyme activities were detected very early between Cr treated and control plants by the very first day of treatment when APX activity was 155% higher for Cr treated plants compared to control plants. During the last treatments of days 10 and 12 APX activity in Cr treated plants increased to 56% and 207% compared to their respective controls of the corresponding days. Cr stress had no effect on leaf APX enzyme activity on initial days of Cr treatment whereas it surged significantly to 485% and 508 % at 10 and 12d of Cr treatment compared to respective control plants. An unusual observation was noted on fifth day when there was a decline of 16% in root APX activity.

85

0.16 Control Leave 0.14 Treated * 0.12 *

0.1

0.08

0.06

0.04 protein)

-1 0.02

0 151012

0.5 * Root* 0.45 Control Treated 0.4 *

0.35 APX activity (units mg (units APX activity 0.3 * 0.25 * 0.2

0.15

0.1

0.05

0 1 5 10 12

Days of treatment

Figure 7.3: APX enzyme activity for leaf (A) and root (B) of Cr-treated and control plants. Treatment means are the average of four replicates. Vertical bars are standard error bars values (p<0.05) for treatment comparisons at a given day of treatment.

Figure 7.4B Indicates that the differences in root GPX enzyme activities were increased linearly between Cr treated and control plants until 12 day of Cr treatment when GPX activity surged to 1265%. A different trend was noted in leaf GPX enzyme activity (Figure 7.4 A). No significant difference was detected between leaf GPX activity of Cr treated plants and control plants till fifth day of Cr treatment. A significant increase was 86 detected only from 10 to 12 days of Cr treatment with 299% and 276% level of GPX activity respectively. 87

0.4 Control Leave 0.35 Treated

0.3

0.25

0.2

0.15 * 0.1 *

0.05

0

protein) protein) 1 5 10 12

-1 250 Root Control * Treated 200 *

150

100 GPX activity (units mg GPX activity

50

0 1 5 10 12 Days of treatment

Figure 7.4: GPX enzyme activity for leaf (A) and root (B) of Cr-treated and control plants. Treatment means are the average of four replicates. Vertical bars are standard error bars values (p<0.05) for treatment comparisons at a given day of treatment.

Figure 7.5B shows that no significant differences in root CAT enzyme activities were detected on 1st day between Cr stressed and non-stressed plants. However, its activity declined significantly by 60% compared to control seedlings at 5 days of treatment. From 10 to 12 days of Cr treatment a reverse change was exhibited in CAT enzyme activity when Cr treated plants exceeded in CAT activities significantly by 1% 88 and 67% respectively. The CAT enzyme activity of leaf (Figure 7.5A) exhibited a significant increase of 15% and 19% of Cr treated plants at 5th and 12th day of treatment. Leaf CAT activity showed no significant response at 10th day of Cr treatment between treated and control plants.

1.8 Control * Leave 1.6 Treated * 1.4 * 1.2

1

0.8

0.6

0.4 protein)

-1 0.2

0 1 5 10 12 0.6 Root Control 0.5 Treated *

0.4 * CAT activity (units mg CAT activity 0.3

0.2

0.1

0 1 5 10 12 Days of treatment

Figure 7.5: CAT enzyme activity for leaf (A) and root (B) of Cr-treated and control plants. Treatment means are the average of four replicates. Vertical bars are standard error bars values (p<0.05) for treatment comparisons at a given day of treatment.

89

Figure 7.6 B shows that Cr stress has no effect on root SOD enzyme activity on the 1st day. However, at 5th day, there was a significant difference in SOD activity with 48% reduction in Cr treated plants than respective control plants. Similarly, from 10 to 12 days a reverse change in terms of SOD activity was observed. The Cr treated plants surpassed their respective control plants in SOD activity significantly by 176% on 12th day. A non- significant reduction of 8%, 17% and 5% in leaf SOD (Figure 7.6A) enzyme activities were detected between Cr stressed and control plants of crambe at 10 and 12 days of treatment. 90

30 Control Leaves Treated 25 *

20

15 *

10 protein)

-1 5

0 1 5 10 12 70 Roots Control * 60 Treated

50 SOD activity (units SOD activity mg 40

30 * 20

10

0 1 5 10 12 Days of treatment

Figure 7.6: Sod enzyme activity for leaf (A) and root (B) of Cr-treated and control plants. Treatment means are the average of four replicates. Vertical bars are standard error bars values (p<0.05) for treatment comparisons at a given day of treatment.

A statistically significant difference of 113% was detected in root MDA content between Cr treated and stressed plant on day 1 of Cr treatment (Figure 7.7 B). MDA content in Cr treated plants decreased to a significant level of 88% compared to control plant at 5th day of Cr treatment whereas no significant differences in MDA content were detected among treatments for 10 and 12 days of treatment. No significant difference in leaf MDA content (Figure 7.7A) was indicated by the very first day of Cr treatment. MDA 91 content of Cr treated plant increased significantly to 269%, 157%, and 249% than the respective control plants at 5, 10 and 15 days of Cr treatment respectively.

25 Control Leave Treated * 20 * 15 *

10

5

0 151012

5 Control Root 4.5 Treated * 4

3.5 MDA activity ( mmol per g-1 FW) ( mmol perMDA activity g-1 FW) 3

2.5

2 *

1.5

1

0.5

0 1 5 10 12 Days of treatment

Figure 7.7: Changes in the levels of lipid peroxidation, as measured using MDA content for Leaf (A) and root (B) of Cr-treated and control plants. Vertical bars are Sstandard error bars values (p 0.05) for treatment comparisons at a given day of treatment.

Chromium stress caused a significant reduction to 47% in electrolyte leakage (EL) of leaves by the very first day of Cr treatment compared to control plant at 60% (Figure 7.8 A). Later by 5 and 10 d of Cr treatment electrolyte leakage recovered to 13% and 60% 92 respectively compared to control plants although the marked differences were not observed. Again by the end of the treatment at 12 days a significant decline of 46 % was noted in EL of leaves than respective control plants. Cr stress had no effects on Leaf RWC (Figure 7.8 B) for any of the treatment. It was maintained at 62 % for all the 1, 5, 10, and 12 days of Cr treatments than the control plants. 93

40 Control A 35 Treated

30

25

20

15

10

5

0 151012

120 Control B Treated Percentage Percentage 100

80

60

40

20 1 5 10 12 Days of treatment

Figure 7.8: Changes in leaf electrolyte leakage (A) and RWC (B) in leaves of Crambe of Cr-treated and control plants. Treatment means are the average of four replicates. Vertical bars are standard error bars values (p<0.05) for treatment comparisons at a given day of treatment.

94

DISCUSSION The results of the photochemical efficiency of Cr-treated and control plants have been shown in Figure 7.2 A. The available literature reveals that the chlorophyll fluorescence parameter (Fv/Fm) has been used frequently for detecting stress in plants (Lbaraki and Murakami, 2006). This parameter primarily implies the effect of stress on the primary photochemical processes in PSII.These results demonstrated that Cr stress resulted in significant decline in photochemical efficiency (Fv/Fm) only in delayed Cr treatment. This observation also suggests that Cr metal stress caused an evident irreversible damage later by the end of treatment since during initial days Fv/Fm remained close to the optimal value of 80 % (Krzic and Gabersclk et al., 2005). Similarly Zheng et al., (2002) reported a decrease in photochemical efficiency (Fv/Fm) after prolonged exposure of Canna indica to Cd metal. While Subrahmanyam (2008) has reported contrasting result in Triticum aestivum in which Cr did not alter Fv/Fm ratio with increased duration of Cr exposure. Contrary to photochemical efficiency (Fv/Fm), the quantum yield of leaf (Fs/ Fms) shown in Figure 7.2 B exhibited a decline initially in the beginning of Cr-treatment. This readjusted to some extent with passage of time, and again exhibited a significant decline. The reduction became discernable again by 12th day of Cr treatment. The inhibition of the quantum yield of PSII by Cu has also been documented in maize in light adapted state. It may be attributed to either a decrease in the rate of consumption of reductants and ATP produced during noncyclic electron transport relative to the rate of excitation of open PSII reaction centers or to damage of PSII reaction centers (Doncheva et al., 2006). Initially, decline in physiological activities was accompanied by a general decrease in antioxidant enzyme activities and an increase in lipid peroxidation in leaves. This indicates that scavenging ability within plant cells declined under initial stages of Cr stress. During prolonged treatments of Cr stress, antioxidant enzyme activities are invariably enhanced. This increased antioxidant activities can be attributed to a greater resistance of crambe to Cr stress. The analyzed antioxidant enzymes exhibited differential effects in response to Cr (VI) exposure. SOD catalyzes the dismutation of superoxide into H2O2 and is one of the most effective antioxidant enzymes in limiting oxidative damage (Asada, 1999). In turn, CAT and APX break down H2O2 into H2O and O2. SOD activity remained low than control plants in leaf till the end of Cr treatment. While in root it remained initially low but later it increased in Cr treated plants compared to their 95 respective control plants. In contrast, significant differences in APX and GPX leaf activities were not detected by 5th day of treatment. The increase in APX and GPX at 10th day of treatments was 83% and 75% and on 12th day, were 84% and 61% respectively. Root APX and GPX also showed the same trend as that of leaf. Both enzymes showed a resistance to Cr stress in whole seedlings in contrast to results obtained by Subrahmanyam (2008) in wheat seedlings where decrease in APX showed sensitivity to Cr. The leaf CAT activity remained high throughout the experiment with significant increase of 19% and 16% increase than respective control plants on 5th and 12th day of treatment. While in roots, it increased to significant level only during the last two Cr treatments of 10 and 12 day. CAT has been considered indispensible for reactive oxygen species detoxification during stress when high levels of ROIs are produced (Willekens et al., 1997). This finding is contrary to a study undertaken by Subrahmanyam (2008) where a decrease in CAT activity resulted in response to Cr exposure in wheat seedlings. This indicated that not all antioxidant enzymes change their activities at the same time or with the same pattern as has been investigated in other stresses (Anderson et al., 1995). This finding further suggests that APX and GPX play a prominent role in controlling the level of AOS in crambe. The involvement of different antioxidant enzymes in AOS scavenging may vary with plant species and stress severity or duration (Decosta and Haung, 2007) and so far as SOD enzyme activity in root is concerned, it was detected in significant amounts at 5th and 12th day of Cr treatment. Increase in SOD activity is associated to oxidative stress tolerance (Scandalios, 2002). In response to various stresses, plants have developed an intricate antioxidant system that mitigates the harmful effects of the ROS (Panda, 2002). GPX in higher plants has also been reported to be implicated in different physiological processes including, chlorophyll degradation, senescence and H2O2 formation (Foyer et al., 1997). GPX showed the similar pattern as was noticed in the leaf with significant detectable level of 95% and 93% on 10th and 12th day of Cr treatment. Lipid peroxidation is identified as oxidative stress indicator in most metal accumulator plants. Thus, lipid peroxidation produced from TBA is measured in terms of MDA. Its production is linearly correlated with a linear increase in concentration and duration of Cr (VI) exposure (Panda, 2007). The increased levels of lipid peroxidation in leaf as indicated by MDA accumulation occurred throughout the experiment. By the end of treatment, Cr treated seedlings seemed to maintain a low level of MDA accumulation than previous Cr treatment. This may be related to higher antioxidant enzyme activities of APX, GPX and CAT under prolonged Cr stress. The maintenance of low levels of MDA 96 accumulation has also been associated with better resistance to environmental stress. An enhanced production of antioxidants and elevated activity level of antioxidative enzymes, represent a general and common approach in plants to curtail toxic peroxidation in plants (Schmidt and Kunert, 1986). In summary, Cr stress in crambe was associated with oxidative stress as exhibited by a general decline in antioxidant enzyme activities and subsequent increases in lipid peroxidation in earlier treatments. Crambe was better adapted to Cr stress during later stages as exhibited by decline in lipid peroxidation and elevated antioxidant enzyme activities. It can be concluded that improved resistance under Cr stress is associated with an elevated and prolonged maintenance of antioxidant enzymes activity. It can be further inferred that peroxidases and catalases could serve as important components of antioxidant defense mechanisms in crambe to combat metal induced oxidative injury. Morover, the results of this study also suggest that APX, GPX and CAT in crambe may also serve as a biochemical stress indicators for Cr pollution.

97

Discussion Molecular Study

The data presented here in the initial part provides a molecular insight into the Cr tolerance in the crambe. This data is novel as no molecular mechanism with particular reference to Cr tolerance is available until now. This study describes the first transcriptome analysis of Cr accumulation and identifies new genes that may contribute to the Cr tolerance and accumulation in crambe. Molecular identification of mechanisms governing Cr tolerance and accumulation could result in the development of useful markers, or of crops with reduced toxic metal content. A better understanding of plant metal handling might also lead to new insights into other fundamental aspects of Cr plant physiology.

The results obtained from this study clearly indicated that an intricate interplay of various metabolic pathways may be determinant in conferring Cr stress resistance and hyperaccumulation in plants. Stimulation of glutathione metabolism, amino acid synthesis, activation of numerous stress-related proteins might suggest an evidence for an attempt to counteract the toxicity of Cr.

This study also highlighted the parallels existing between different stresses, implying that genes which may be involved in hyperaccumulation and hypertolerance are not species-specific or novel. It is rather their different expression and regulation that is triggered upon various stresses as compared to less tolerant species (Verbruggen, 2009). The common factor among various biotic and abiotic stresses is the disruption of cellular oxidation-reduction homeostasis which ultimately leads to the oxidative stress (Asada, 1994). Most of the transcripts isolated in our study encoding various genes were induced also in other stresses. This finding is in consonance with the earlier reported findings underlying the role of ROS as messengers in signal transduction during different biotic and abiotic stress responses (Breusegem et al., 2008). This may be the shared feature in various stresses which evokes same sets of genes in different stresses. Previous studies indicated that types of responses evoked in plants under different stresses depend on various physiological, biochemical, and molecular mechanisms which relies either on the types of ROS or their subcellular production site (Gadjev et al., 2006). 98

A number of plant species have evolved metal tolerance and/or hyperaccumulation abilities and are thus able to thrive in metal-contaminated soil (Baker and Brooks, 1989; Ma et al., 2001). However, no plant with Cr hyperaccumulation ability has been identified. Additionally, Cr comes from the group of transition metals, which are recognized for inducing oxidative stress through a pathway termed as Fenton-type reaction (Luo et al., 1996), however, the basis of molecular mechanisms of Cr-induced oxidative stress and imparting tolerance in plants have not been fully explored yet. Ten day old crambe seedlings were exposed to varying concentrations of K2CrO4 ranging from 0 to 250 µM for seven days. .A moderate reduction in fresh weight of plants occurred at 100 and 150 µM K2CrO4 concentration with no toxicity (Figure 4.1). Higher concentration of 200 and 250 µM of K2CrO4 was highly toxic, caused significant reduction in biomass and caused chlorosis and visible necrosis on leaves. Low levels of K2CrO4 (50 µM) had no tangible effect both on fresh weight and plant morphology. Therefore, 150 µM K2CrO4 was selected to expose crambe for Cr stress.

Chromium levels were analyzed in crambe root and shoot tissues in plants exposed to 0, 150, and 250 µM K2CrO4. Crambe plants translocated high level, 180-200 ppm or mg kg-1) in aboveground shoot tissues (Figure 4.2 A) and also retained a very high levels (1800-2000 ppm or mg kg-1) in roots (Figure 4.2 B).Almost same results have been reported for uptake of As and Cd in crambe (Paulose et al., 2010; Artus, 2006), suggesting that this plant may contain an intrinsic tendency to accumulate high levels of toxic metals.

With an emergent genomic era in the present decade, the attributes of various plant species for resistance to heavy metal stress are being evaluated at the molecular level. Since crambe genome is not sequenced and thus using the current genomic applications such as microarray analysis is not a viable approach. A PCR- Select Suppression Subtraction Hybridization (Diatchenko et al., 1996) technique was employed to identify the differentially regulated d genes in crambe seedlings in response to K2CrO4 exposure. This technique is used to isolate differentially expressing transcripts between two populations of mRNA while simultaneously suppressing the common transcripts between the two populations. In the recent past, SSH has been used to study the differential expression of genes induced by toxic metals (Watt, 2003; Vanktatachalam et al., 2009; Paulose et al., 2010). Two parallel subtractions were performed by changing the driver/tester ratio and getting a total of 346 subtracted cDNA clones. The forward 99 suppression subtraction hybridization library blots displayed strong hybridization signals for many clones with the probe from Cr-treated plants (Figure 4.3A), whereas most clones did not hybridize to the cDNA probe from control (Figure 4.3B).So those clones were identified as differentially regulated cDNAs specific to Cr-treated plant. The differential screening for forward subtracted library identified 73 clones containing the differentially regulated mRNA transcripts (Figure 4.3). All 73 cDNA sequences were subjected to homology searches against the NCBI nucleotide database and found that they represented 43 transcripts encoding different genes (Table 1). These crambe cDNA sequences were highly homologous to that of Arabidopsis and Brassica; an expected finding given that all three species have the same lineage from Brassicaceae family.

The NCBI database search identified definitive or putative functions for 38 differentially expressed cDNA clones based on significant protein similarity to previously identified or putative proteins in other plant species. However, five transcripts encode proteins yet to be characterized and that could be implicated in novel metabolic pathways of Cr metabolism. Based on the sequence homology and functions in different metabolic pathways, we grouped the transcripts into different functional categories (Figure 4.4). These groups include genes involved in functions related to stress and defense response (17 genes), glutathione-S-transferases and sulfur assimilation (4 genes), cellular metabolism (8 genes), amino acid (AA) metabolism (2 genes), cell signaling (3 genes), ion transporters (2 genes), protein degradation (1 gene), photosynthesis (1 gene), and unknown novel proteins (5 genes).

Proteins involved in various stress and defense response were highly represented in the subtracted cDNA library. A total of 17 cDNA clones had homology to known genes participating in different types of biotic and abiotic stress response including heavy metal stress. Identified proteins include chitin binding protein/chitinase (CHB), early response to dehydration 15 (ERD15), ACC Oxidase 1 (ACCOx1), ThiJ like proteins (TJLP1), Glutamine amido-transferase-like superfamily protein (GAT), HSP90 (SHD), formate dehydrogenase/ NAD binding/ oxidoreductase (FDH), harpin-induced proteins (HRP), lipocalins (TIL1), 3-chloroallyl aldehyde dehydrogenase/oxidoreductase (ALDH7B4), virus resistant proteins (RP), peroxidases (POX1), β-1,3 glucanase (BG3), Rubisco activase (RCA), antifungal protein (Rafp1), defense related proteins (CJAS1), and disease resistant proteins (NDR1). 100

Higher representation of stress or defense related genes in our library suggests that these Cr induces genes are involved in protecting the cell from elemental toxicity. Many of these Cr-induced genes has previously been implicated in stress or defense responses in plants. Elevated expression of β-1,3 glucanase genes was observed in Hg-treated plants (Vankatachalam et al., 2009). Lipocalins (TIL1) constitute a diverse family of small extra- cellular proteins involved in lot of important functions. A recent report demonstrated the involvement of Arabidopsis temperature-induced-lipocalin (AtTIL) in modulating tolerance to oxidative stress (Charron et al, 2008). Transcripts encoding harpin-induced protein (HRP) and ThiJ like proteins 1 (TJLP1) were strongly upregulated in our library. Harpins are the bacterial elicitors known to induce hypersensitive response in many non- host species (Lindgren, 1997). The upregulation of harpin-induced defense related genes in the Cr-induced cDNA library may be due to involvement in signaling machinery under biotic and abiotic stresses. An extensive cross-talk between plant signaling pathways for defense against pathogens and those involved in abiotic stresses has been suggested (Fujita et al., 2006). ThiJ is an enzyme involved in the thiamine biosynthesis and ThiJ-like proteins (TJLP) are homologous to human DJ-1, a multiple functional protein involved in oxidative stress (Xu et al., 2005). A clone homologous to A. thaliana chloroallyl aldehyde dehydrogenase (ALDH7B4) was also found in our library. Aldehyde dehydrogenases (ALDHs) are reported to be involved in the detoxification of aldehydes produced in plants under abiotic stress. Two ALDHs from Arabidopsis, ALDH3I1 and ALDH7B4, were reported not only to function as aldehyde-detoxifying enzymes, but also as efficient AOS scavengers and lipid peroxidation-inhibiting enzymes (Kotchoni et al., 2006). Further, early responses to dehydration (ERD) proteins have been involved to play a role in abiotic stresses such as drought, salt, and toxic metals (Kariola et al., 2006).

Four genes involved in the glutathione-S-transeferases, and glutathione synthesis were represented in the subtracted cDNA library. Evidence for the role of sulfur metabolism in Cr tolerance and accumulation in Brassica juncea is supported by Schiavon et al. (2008). Glutathione (GSH), a sulfur containing tripeptide, is a major cellular antioxidant against ROS (Rouhier et al., 2008). Glutathione is not produced by means of usual process of protein synthesis. Instead of it is generated through the catalysis of two consecutive enzymes: γ-glutamylcysteine synthase (γ-ECS) and glutathione synthetase (GS). The differential expression of transcripts corresponding to both γ-ECS and GS in our cDNA library further implicate their involvement in metal tolerance and 101 detoxification. Increased production of GSH is suggested to provide protection against oxidative stress in various species of Thlaspi in response to Ni (Freeman et al., 2004) and Cd (van de Mortel et al., 2008). Two genes, GSTF6 and GSTU4, corresponding to the phi and tau subfamily, respectively, of glutathione-S-transferases (GSTs) specific to plants were present in our library. The upregulation of GSTs in response to various toxic metals and metalloids has been shown in several other studies (Abercombie et al., 2008; Ahsan et al., 2008; Paulose et al., 2010). GSTs are reported to be involved in detoxification of both the endogenous and xenobiotic compounds (Wagner et al., 2002). GSTs may be minimizing oxidative stress by other means as by ectopic expression of tomato GST significantly improving the tolerance of yeast to hydrogen peroxide induced oxidative stress (Kampranis et al., 2000). These findings suggest that glutathione metabolism may be a major component in alleviating Cr toxicity by regulating the cellular oxidative balance via GSH/ascorbate cycle (Schiavon et al., 2008). A recent study by Duby et al., (2010) is clearly indicative of the involvement of Glutathione pathway in the detoxification of Cr (VI) when roots of rice were exposed to 100µM potassium chromate for 24h and 7 days.

To cope with the deleterious effects of heavy metals, overproduction of various amino acids (histidine, methionine, proline and alanine) by eukaryotic cells has been reported (Monselise et al., 2003). Alanine accumulation in plants and animals in response to stress conditions has been reported (Monselise et al., 2003), although the precise role of alanine in stress tolerance is unknown. A clone (ALAAT1) encoding alanine amino- transferase appeared to be strongly induced in the present library. This enzyme is involved in the transamination of pyruvate to alanine. During a study of metabolite profiling of rice root in response to Cr (VI), it was demonstrated that a plant specific pathway of alanine production from glutamate, pyruvate and uracil was highly up regulated (Duby et al., 2010). Levine et al. (1996) have shown that amino acids vary in susceptibility to oxidative damage, with methionine residues being the most vulnerable, followed by cysteine and tyrosine (). A clone (CIMS) encoding cobalamin-independent methionine synthase showed strong upregulation in our subtracted cDNA library. Random oxidation phenomenon of methionine could widely act as a sink for reactive oxygen species contributing to scavenge the ROS and thus constituting a mechanism of detoxification (Stadtman et al., 2003). 102

Involvement of signal transduction pathways in stress responses caused by heavy metals in not well understood. A clone (RHA1) homologous to Arabidopsis RAB5 was a highly expressed Cr- responsive gene in our library. Little is known about the function of RHA1 in plant response to abiotic stress but the gene is known to play a critical role in vacuolar trafficking in plant cells (Lee et al., 2004). Another Cr-induced cDNA clone, Cucurlin, encodes a curculin-like (mannose-binding) lectin family protein, which has been implicated in signal transduction related to para-dormancy release in root buds of leafy spurge, Euphorbia esula (Horvath et al., 2005). The upregulation of glyceraldehyde-3- phosphate dehydrogenase (GAPDH) is also an indication of enhanced cellular metabolism. This gene has been reported to be involved in cellular oxidation-reduction regulation (Baek et al., 2008). Further, an alternative oxidase (AOX1A) present in our library has been implicated in reducing the formation of ROS in various stresses in plants (Maxwell et al., 1999). Based upon this evidence, it may be implied that upregulation of AOX1A clone may be instrumental in reduction of ROS in Cr-induced oxidative stress. Another alternative role may be presumed to stimulate the synthesis of AOX by ROS as a signaling element (Amor et al., 2000).

Evidence for a correlation of metal tolerance and organic acid content has been reported in various plants (Krotz et al., 1989). Upregulation of two cDNAs encoding malate dehydrogenase (MDH) and isocitrate dehydrogenase (ICDH) might suggest enhanced organic acid production for metal chelation. Zinc and nickel were reported to be associated with malate and citrate in shoots of Arabidopsis halleri (Sarret et al., 2001) and Thlaspi goesingense (Krämer et al., 2000), respectively. In our work, transcripts encoding ferridoxin NAD(+) oxidoreductase (FNR1) and format dehydrogenate/ NAD(+) oxidoreductase (FDH) upregulated by Cr exposure were presumed to be involved in cellular respiration during heavy metal oxidative stress (Fusco et al., 2005). Chromium is known to induce oxidative stress and commonly induced antioxidant genes such as ascorbate peroxidase, catalase, and superoxide dismutase were not present in our library. It is likely that these genes are either induced at early stages within 6 hr. of Cr treatment or respond at longer exposure time beyond 24 hr used in our study.

Two membrane transporters encoding plasma membrane aquaporin 1b (PAQ1b) and Yellow Stripe Like transporter 3 genes (YSL3) were found to be upregulated. Recently, an aquaporin (BjPIP1) from the heavy-metal accumulator Indian mustard (B. juncea) was reported to have a role in plant drought and heavy metal stress response 103

(Zhang et al., 2008). Although aquaporins are involved primarily in movement of water across biological membranes, compelling evidence also exists that aquaporins can transport other physiologically important molecules. The NIP subfamily of aquaporins actively transports arsenite and boron across membranes (Bienert et al., 2008). There are reports suggesting that mammalian aquaglyceroporin, AQP1, transports cations (Anthony et al., 2000) and that AQP7 and AQP9 transport metalloid such as arsenite (Liu et al., 2002). A cDNA clone with a strong homology to YSL3 family of genes in Arabidopsis thaliana was also identified. The YSL family members are shown to be implicated in the translocation of Nicotianamine-metal chelates and delivery of Fe in the seeds (Waters et al., 2006)

Upregulation of two ubiquitin-associated protein (UBA) identified in this study is presumed to be required for increase protein turnover in Cr-treated plants. It has previously been shown that the ubiquitination system is important for a broad range of plant developmental processes and responses to abiotic and biotic stresses (Zeng et al., 2006). A strong accumulation of ubiquitin-associated-protein in solanun lycopersicum was observed by exposure to Cd (Feussner et al., 1997). Differential expression of ubiquitin- associated proteins in response to Cr exposure (this study) and arsenic exposure (Paulose et al., 2010) strongly suggest the role of these proteins in ameliorating the proteotoxicity effect caused by heavy metals stresses.

Five subtracted cDNA sequences did not match any characterized proteins. However, they have distinct homologs in Arabidopsis and in other plants with a high sequence identity to proteins with no known function. Future characterization of these novel sequences seeks to elucidate their role in Cr metabolism by plants.

The upregulation of the subtracted cDNA clones in response to Cr exposure was confirmed by semi-quantitative RT-PCR. It was performed for the majority of genes identified in the subtracted cDNA library. RT-PCR analysis revealed that most of the subtracted cDNA clones showed induction of the corresponding mRNA transcripts upon Cr exposure. The time-dependent transcript upregulation of the Cr-responsive cDNAs are shown in Figure 4.5. The quantification of mRNA expression levels using ImageJ is shown in Figure 4.6. For most of the cDNA clones, transcript level started to increase at 6 hr and reached the highest level at 24 hr. RHA1, SHD, TIL1, UBA, POX1, GSTU4, and UNK2 were induced more than 8-fold at 12 and 24 hr. Several genes corresponding to subtracted cDNAs such as CHB, TJPL1, HRP, Rafp1, ICDH, UNK1, and UNK4 showed 104 more than 6-fold induction in Cr-exposed crambe tissues as compared to controls (Figure 5 and 6). The transcript levels start increasing as early as 6 hr and continued to increase up to 24 hr. Transcripts encoding ERD15, MDH, ACCOX1, FDH, YSL3, GSTF6, ALAAT1, MO1, ECS1, BG3, GS, CJAS1, UNK3, and UNK5 showed more than two-fold induction in response to Cr exposure. Transcripts corresponding to the cDNA clones encoding SHD, MDH, PAQ1, POX1, and BG3 exhibited strong upregulation only at 24hr. A transient expression was observed for RHA1, FDH, FNR1, TIL1, Rafp1, UNK1, UNK2, and UNK3 as their expression appeared to be induced at 6 or 12h, with variable response at 24 hr. Our results showed that the expression of most of the subtracted cDNAs was strongly induced in response to Cr exposure. The differential regulation of these subtracted cDNA transcripts highly indicate a role in Cr metabolism. The upregulation of most of these stress-related proteins has also been observed in response to other biotic or abiotic stresses, suggesting possible common metabolic responses to different stresses.

A reverse-subtracted cDNA libraryl was made with untreated plants serving as tester and Cr-treated plants as driver (Figure 4.7A/B). Cr-induced reverse subtracted cDNAs encoding proteins are mainly genes involved in photosynthetic and ribosomal proteins functional categories (Figure 4.8). Inhibition of photosynthesis by heavy metals is well documented (Joshi & Mohanty, 2004). Earlier studies demonstrated that heavy metal toxicity is associated generally with inhibition of chlorophyll biosynthesis and damage to the photosynthetic apparatus (Heidenreich, 2001). Almost all of the clones identified as down regulated belonged to the photosynthetic machinery reflecting the severity of Cr toxicity to plants. The present data clearly indicated that Cr had affected invariably light reactions and Calvin-Benson cycle alike. Transcripts encoding both the components of photosynthetic light reactions as well as the Calvin-Benson cycle (Table 4.2) were down regulated in our study. These results are in consonance with previous studies in Arabidopsis and tobacco, in which a short-term, S-deficiency stress resulted in down- regulation of several genes encoding chlorophyll a/b binding proteins and components of PSII as well as rubisco activase (Hirai et al., 2003; Wawrzyn´ska et al., 2005).

Characterization of particular genes is usually carried out by expressing those genes in bacteria and plants. For this purpose the next step consists of cloning of genes to decipher the role of those encoded genes. Keeping this in view three genes named AtHrp, AtTIL1and Tjip1 were cloned in specific plasmid vectors for their expression in plants and bacteria. Various molecular approaches can characterize these genes including bacterial 105 complementation studies. No conclusive results regarding the roles of these selected genes in Cr metabolism were noted in bacteria. However these genes were cloned successfully for plant expression which may be useful for further studies in future. In short it can be concluded that results were not consistent in all three complementation studies and their implication cannot be justified in Cr metabolism based upon these findings.

Physiological Study

Heavy metal phytotoxicity may result from alterations of numerous physiological processes. By going through the Table 4.2 it can be easily assessed that most of the down- regulated genes fall in the category of photosynthetic machinery. It has been well demonstrated by many workers that Cr stress is directly affecting the efficiency of PSII and results in its direct inactivation of reaction center (Prasad et al., 1991). Recently the technique of chlorophyll fluorescence has been widely used in assessing plant stresses in plant ecophysiological studies. All photosynthetic active organisms exhibit fluorescence emission phenomenon that has its roots in chlorophyll a molecules of PS II. The available literature reveals that the chlorophyll fluorescence parameter (Fv/Fm) has been used frequently for detecting stress in plants (Lbaraki and Murakami, 2006). These results clearly demonstrated that Cr stress resulted in significant decline in photochemical efficiency (Fv/Fm), though in delayed Cr treatment. This observation also suggested that Cr metal stress caused an evident irreversible damage later by the end of treatment since during initial days Fv/Fm remained close to the optimal value of 80% (Krzic and Gabersclk et al., 2005). Supporting these results Zheng et al., (2002) reported a decrease in photochemical efficiency (Fv/Fm) after prolonged exposure of Canna indica to Cd metal. Contrary to photochemical efficiency (Fv/Fm), the quantum yield of leaf (Fs/Fms) shown in Figure 7.2B exhibited a decline initially at the beginning of Cr-treatment, readjusted to some extent with the passage of time and again exhibited a significant decline again. Such type of changes in the quantum yield was among the earliest reported biochemical responses of leaf photosynthesis to water stress (Sharp and Boyer, 1986).

The electrolyte leakage (EL) results of this study do not agree with Gonzalez- Mendoza (2009), who reported that EL of leaf discs in Avicennia germinans increased rapidly only after 24 h exposure to Cu and Cd. In this case Cr stress had no effects on electrolyte leakage in leaves on the first and fifth day of treatment. On tenth day of treatment electrolyte leakage of treated plants increased significantly than the control 106 plants. Haldimann and Feller (2005) reported that a functional photosynthetic apparatus is a result of an improved thermal stability of thylakoid membranes at high temperature and significantly reduced the effect of heat stress in Pisum sativum L. leaves. These results suggest that Cr stress had no effects on electrolyte leakage in leaves for first five days. On tenth day of treatment electrolyte leakage of control leaves was low than the respective treated plants. On the 12 day of treatment an erroneous result was observed which could not be explained because more electrolyte leakage was observed in control compared with their respective treated plants.Leaf RWC was not affected significantly for any of the treatments. The results of this finding do not agree with that of a study undertaken by Malik (2009) on Brassica juncea where metal stressed seedlings retained less water content and exhibited greater damage to membranes when exposed to Cd, Hg, and Pb.

It is well documented phenomenon that various abiotic stresses become a cause of overwhelming erproduction of ROS in plants generating highly reactive and toxic ROS, and ultimately causing oxidative stress (Mittler, 2002). It affects cell membrane properties and causes oxidative damage to cellular machinery, rendering them inactivated and nonfunctional. Interestingly he cells are armed with an excellent antioxidant defense arsenal to detoxify the deleterious effects of ROS. These reactive oxygen species are actively chelated either by non- enzymatic detoxification mechanisms or antioxidant enzymes such as superoxide dismutase, catalase, ascorbate peroxidase and peroxidase (Gong et al., 1997). An extensive research has established that the induction of the cellular antioxidant machinery is prerequisite for protection against ROS. Plant stress tolerance can be enhanced by the increased production of antioxidant enzymes in vivo. It is now known that tolerance potential of plants to oxidative stress under various biotic and abiotic stresses depend upon either upon their induction or activating the oxidant levels in plants (Cheeseman, 2007).

Higher plants possess an arsenal of peroxidases. Several isoforms of thses enzymes are found in plants and their expression is tissue specific and developmentally regulated. They are thought to participate in various physiological processes. These include detoxification of H2O2, cell elongation and the stress adapted responses. Peroxidases (Poxs) were highly upregulated in the cDNA-subtracted library and this finding very well correlated with the peroxidases highly active in the response of plants towards Cr stress. At molecular level, the upregulation was pronounced even after 24-hour exposure but the activity of both APX and GPX was initially not significant. They only became significant 107 only after exposure to Cr for either 10 or 12 days. This finding suggests that APX and GPX play a prominent role in controlling the level of AOS in crambe. GPX in higher plants has also been reported to be involved in various physiological processes including lignification, chlorophyll degradation, senescence and H2O2 formation (Foyer et al., 1997). A clone homologous to A. thaliana chloroallyl aldehyde dehydrogenase (ALDH7B4) was also found in the obtained library.

Ascorbate peroxidases (APXs) are enzymes that detoxify peroxides such as hydrogen peroxide using ascorbate as a substrate. They are responsible for hydrogen peroxide removal in the chloroplasts and cytosol of higher plants. A study conducted on proteomic and metabolic analysis of Arabidopsis thaliana plants subjected to joined drought and heat stress identified proteins that were involved in reactive oxygen detoxification and malate metabolism. Protein and mRNA of Cytosolic ascorbate peroxidase I accumulated during this treatment (Koussevitzky et al., 2008). Over expression of rice APX1 and APX2 in Arabidopsis reduced the accumulation of hydrogen peroxide, limits chlorophyll degradation, and increases survival under salinity stress (Lu et al., 2007).

No significant differences in root CAT enzyme activities were detected in initial days of treatment day between Cr stressed and non-stressed plants (Figure 7.5B). From 10 to 12 days of Cr treatment CAT activities exceeded manifold. The CAT enzyme activity of leaf (Figure 7.5A) exhibited a significant increase of 15% and 19% of Cr treated plants at 5th and 12th day of treatment. Leaf CAT activity showed no significant response at 10th day of Cr treatment between treated and control plants. In our experiment, catalase enzyme activity was increased under metal stress condition reflecting the peroxidase activity as sensitive indicator of heavy metal stress and can be used to anticipate events on the organism level (Wu et al., 2003).

Guaiacol peroxidases (GPXs) are involved in many physiological processes in plants. The expression is tissue specific and developmentally controlled. In this presented study conditions the activity of guaiacol peroxidase (GPX) ascorbate peroxidase (APX) and catalase (CAT) increased in Crambe plants exposed to Cr, but having no effect on the SOD. Mohan et al. (1997) suggested that the increase of peroxidase activity may cause an increased senescence, enhanced generation of hydrogen peroxide (H2O2) and phenolic compounds. Our results suggest that, of the antioxidative enzymes we analyzed in crambe test plants, APX, GPX and CAT may serve as stress indicator of biochemical stress for Cr 108 pollution, especially peroxidases as they were highly upregulated in Cr subtracted cDNA library (Table 2).

The potential of plants to cope oxidative stress partly hinges upon the efficiency of them as inducers and activator of SOD and leading to a subsequent upregulation of other downstream antioxidant enzymes. The dismutation of superoxide into H2O2 is catalyzed by SOD, which is one of the most effective antioxidant enzymes in limiting oxidative damage (Asada, 1999). Subsequently, CAT and APX break down H2O2 into H2O and O2. An increase in SOD activity was observed in later stages of Cr exposure in root while it remained constantly lower than control plants in leaves for the whole duration of experiment. Plants employ the common but powerful adaptive strategy of the induction of antioxidant enzyme activities which renders plants resistance to overcome oxidative stress (Foyer and Noctor, 2003). These results suggest that tolerance to Cr exposure results due to the removal of H2O2 and not related to dismutation of superoxide radicle and leading towards the suppression of the injury from oxidative stress (Scandalios, 1993). Of the five SOD genes characterized in rice, mitochondrial SodA1 (mitoochondrial Mn-SOD) and SodB (Fe-SOD) are significantly induced by osmotic stress and hypoxic conditions respectively (Magneschi and Perata, 2009). In another study SodA1 mRNA was elevated by oxidative stress in rice (Fukao et al., 2011)

Malonydialdehyde results from the peroxidation of unsaturated fatty acids of phospholipids, and lipid peroxidation is responsible for inducing injury to cell membrane. Cr stress induces and causes an increased MDA production (Fu & Huang, 2003). Lipid peroxidation is considered an indicator of oxidative stress in most metal accumulator plants. This lipid peroxidation measured in terms of MDA produced from Thiobarbituric Acid (TBA) reactions showed a gradual increase with increased in dose dependent manner and duration of Cr (VI) treatment (Panda, 2007). The increased level of lipid peroxidation in leaf as indicated by MDA accumulation occurred throughout the experiment. By the end of treatment, Cr treated seedlings seemed to maintain a low level of MDA accumulation than previous Cr treatment. This may be related to higher antioxidant enzyme activities of APX, GPX and CAT under prolonged Cr stress. A better resistance to environmental stress has been associated with maintainance of low levels of MDA accumulation. Increased production of antioxidants and elevated activity of antioxidative enzymes seem to be a general strategy to limit toxic peroxidation in plants (Schmidt and Kunert, 1986). 109

Chromium accumulation in roots and shoots increased with increasing concentration of Cr (VI). An anomalous result in root at 10th day of Cr treatment was obtained where Cr content was low as compared to 12th day of Cr treatment. The chromium accumulation was higher in roots as compared to shoot with increasing exposure to Cr. These results are in consonance with a recent study undertaken by Dubey et al. (2010).

Based upon these results it can be concluded that crambe is an ideal candidate for phytoremediation of Cr and other toxic metals. In addition, crambe can be readily genetically modified to further improve its tolerance to various toxic metals.

110

References

1. Abercrombie, J., Halfhill, M., Ranjan, P., Rao, M., Saxton, A., Yuan, J., Stewart, C.N., 2008. Transcriptional responses of Arabidopsis thaliana plants to As (V) stress. BMC. Plant Biol. 8, 87. 2. Ahsan, N., Lee, D., Alam, I., Kim, P.J., Lee, J.J., Ahn, Y., Kwak, S., Lee, I., Bahk, J.D., Kang, K.Y., Renaut, J., Komatsu, S., Lee, B., 2008. Comparative proteomic study of arsenic‐induced differentially expressed proteins in rice roots reveals glutathione plays a central role during As stress. Proteomics. 8, 3561‐3576. 3. Alkorta, J.M., Amezaga , I., Albizu, I., Garbisu, C., 2004. Recent Findings on the Phytoremediation of Soils Contaminated with Environmentally Toxic Heavy Metals and Metalloids Such as Zinc, Cadmium, Lead, and Arsenic. Annu. Rev. Environ. Sci. Biotechnol. 3,71-90 4. Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST, a new generation of protein database search programs. Nucleic Acids Res. 25, 3389-3402. 5. Amor, Y., Chevion, M., Levine, A., 2000. Anoxia pretreatment protects soybean cells against H2O2-induced cell death: possible involvement of peroxidases and of alternative oxidase. FEBS Lett. 477, 175-180. 6. Anderson, M.D., Prasad, T.K., Stewart, C.R., 1995. Changes in isozyme profiles of catalase, peroxidase, and glutathione reductase during acclimation to chilling in mesocotyls of maize seedlings. Plant Physiol. 109, 1247-1257. 7. Anderson, R.A., 1989. Essentiality of Cr in humans. Sci. Total Environ. 86, 75–81. 8. Anon, 1993. Crambe production and utilization. BioOptions, Newsletter of the Centre for Alternative Plant and Animal Products, University of Minnesota, 1-3. 9. Anthony, T.L., Brooks, H.L., Boassa, D., Leonov, S., Yanochko, G.M., Regan, J.W., Yool, A.J., 2000. Cloned human aquaporin-1 is a cyclic GMP-gated ion channel. Mol. Pharmacol. 57, 576-588. 10. Appenroth, K.J., 2010. Sherameti and A. Varma (eds.), Soil Heavy Metals, Soil Biology, Vol 19, DOI 10.1007/978-3-642-02436-8_2, © Springer-Verlag Berlin Heidelberg 2010 11. Aravind, P., Prasad., 2005. Cadmium zinc interactions in a hydroponic system using ceratophyllum demersum L., adaptive ecophysiology, biochemistry and molecular toxicology. Braz. J. Plant Physiol. 17, 3-20 12. Artus, N.N., 2006. Arsenic and cadmium phytoextraction potential of Crambe compared with Indian mustard. J. Plant Nut. 29, 667-679. 13. Asada K (1994) Production and action of active oxygen species in photosynthetic tissues. In CH Foyer, PM Mullineaux, eds, Causes of Photooxidative Stress and Amelioration of Defence Systems in Plants. CRC Press, Boca Raton, FL, pp 77- 104 14. Asada, K., 1999 . Plant responses to abiotic stresses: heavy metal‐induced oxidative stress and protection by mycorrhization. J. Exp. Bot. 53, 1351-1365. 15. Asada, K., 1999. The water-water cycle in Chloroplasts: scavenging of active oxygen and dissipation of excess photons. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 601-639. 16. Avery, S.V., 2001. Metal toxicity in yeasts and the role of oxidative stress. Adv Appl Microbiol. 49, 111–142 111

17. Baek, D., Jin, Y., Jeong, J.C., Lee, H., Moon, H., Lee, J., Shin, D., Kang, C.H., Kim, D.H., Nam, J., Lee, S.Y., Yun, D., 2008. Suppression of reactive oxygen species by glyceraldehyde-3-phosphate dehydrogenase. Phytochem. 69, 333-338. 18. Baker, A.J.M., Brooks, R.R., 1989. Terrestrial higher plants which hyperaccumulate metallic elements – A review of their distribution, ecology and phytochemistry. Biorecovery 1, 81– 126 19. Baker, A.J.M., McGrath, S.P., Reeves, R.D. Smith, J.A.C., 2000. Metal hyper accumulator plants: a review of the ecology and physiology of a biochemical resource for phyto remediation of metal polluted soils. In, N. Terry and G. Banuelos (Eds.) Phytoremediation of contaminated Soil and Water. Lewis Publishers, Boca Raton, FL, pp 85-107. 20. Bañuelos, G., Terry, N., Danika, L., Leduc, Elizabeth, A.H., Smits, P., Macke, B., 2005. Field Trial of Transgenic Indian Mustard Plants Shows Enhanced Phytoremediation of Selenium-Contaminated Sediment. Environ. Sci. Technol. 39, 1771–1777. 21. Barceló, J., Porchenrieder, C.H., Gunse., B., 1986. Water relations of chromium VI treated bush bean plants (Phaseolus vulgaris L. cv Contender) under both normal and water stress conditions. J. Exp. Bot. 37,178–187. 22. Barceló, J. and Poschenrieder, C., 1997. Chromium in plants. In: Canali, S., Tittarelli, F. and Sequi, P., Chromium Environmental Issues, Franco Angeli, Milano, pp. 101–129. 23. Becher, M., Talke, I.N., Krall, L., Kramer, U., 2004. Cross-species microarray transcript profiling reveals high constitutive expression of metal homeostasis genes in shoots of the zinc hyperaccumulator. Arabidopsis halleri. The Plant J. 37, 251- 268. 24. Bienert, G.P., Thorsen, M., Schüssler, M.D., Nilsson, H.R., Wagner, A., Tamás, M.J., Jahn, T.P., 2008. A subgroup of plant aquaporins facilitate the bi-directional diffusion of As (OH) 3 and Sb(OH)3 across membranes. BMC Biol. 6, 26. 25. Bondioli, P., Folegatti, L., Lazzeri, L., Palmieri, S., 1998. Native crambe abyssinica and its derivative as renewable lubricants, an approach to improve its quality by chemical and biotechnological processes. Ind. Crop. Prod. 7, 231-238. 26. Bonet, A., Poschenrieder, C., Barcelo, J., 1991. Chromium III-ion interaction in Fe-deficient and Fe-sufficient bean plants I. Growth and nutrient content. J. Plant Nutr. 14, 403–414. 27. Boyd, R.S., 2007. The defense hypothesis of elemental hyperaccumulation: status, challenges and new directions. Plant Soil. 293, 153–176. 28. Breusegem, F.V., Serres, J.B., Mittler, R., 2008. Unraveling the Tapestry of Networks Involving Reactive Oxygen Species in Plants. American Society of Plant Biologists. Plant Physiol. 147,978-984. 29. Brooks, R. R., Lee, J., Reeves, R. D., Jaffrè, T., 1977. Detection of nickeliferous rocks by analysis of herbarium specimens of indicator plants. J. Geochem. Explor. 7, 49–57. 30. Brooks, R.R., Chambers, M.F., Nicks, L.J., Robinson, B.H., 1998. Phytomining. Trends Plant Sci. 3, 359. 31. Cary, E.E., Allaway, W.H., Olsen, O.E., 1977. Control of chromium concentrations in food plants. 1. Absorption and translocation of chromium by plants. J. Agric. Food Chem. 25,300-304. 32. Chance, B., Maehly, A.C., 1955. Assay of catalases and peroxidases. Methods Enzymol. 2, 764-817. 112

33. Chanda, S.V., Parmar, N.G., 2003. Effects of chromium on hypocotyl elongation, wall components, and peroxidase activity of Phaseolus vulgaris seedlings. New Zeal. J. Crop Hort. 31, 115. 34. Chandra, P., Sinha, S., Rai, U.N., 1997. Bioremediation of Cr from water and soil by vascular aquatic plants. In: Kruger, E.L., Anderson, T.A., Coats, J.R., (Eds.), Phytoremediation of Soil and Water Contaminants. ACS Symposium Series, vol. 664. Washington, DC, American Chemical Society pp. 274-282. 35. Chaney, I.R., Malik, M., Li, Y.M., Brown, S.L., Brewer, E.P., Angle, J.S., Baker, A.J.M., 1997. Phytoremediation of soil metals. Curr. Opin. Biotechnol. 8, 279–284. 36. Charron, J., Ouellet, F., Houde, M., Sarhan, F., 2008. The plant apolipoprotein D ortholog protects Arabidopsis against oxidative stress. BMC Plant Biol. 8, 86. 37. Cheeseman, J., 2007 Hydrogen Peroxide and Plant Stress: A Challenging Relationship. Plant stress, 1, 4-15. 38. Choudhury S., Panda, S.K., 2004. Role of salicylic acid in regulating cadmium induced oxidative stress in Oryza sativa L. roots. Bulg. J. Plant Physiol., 30, 95– 110. 39. Chromium alters uptake and translocation of certain nutrients in citrullus. Chemosphere 53, 1147–1153 40. Clemens, S., 2001. Molecular mechanisms of plant metal homeostasis and tolerance. Planta. 212, 475–486. 41. Clemens, S., 2006a. Toxic metal accumulation, responses to exposure and mechanismsof tolerance in plants. Biochimie. 88, 1707-19. 42. Clemens, S., 2006b. Evolution and function of phytochelatin synthases. Plant J. 49, 740–749. 43. Clemens, S., Palmgren, G.M., Krämer, U., 2002. A long way ahead: understanding and engineering plant metal accumulation. Trends Plant Sci. 7, 309-315 44. Clough, S.J., Bent, A. F., 1998. Floral dip: a simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant J. 16, 735-743 45. Cobbett, C., Goldsbrough, P., 2002. Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis. Annu. Rev. Plant Biol. 53, 159–182 46. Craciun, A.R., Courbot, M., Bourgis, F., Salis, P., Saumitou-Laprade, P., Verbruggen, N., 2006. Comparative cDNA-AFLP analysis of Cd-tolerant and - sensitive genotypes derived from crosses between the Cd hyperaccumulator Arabidopsis halleri and Arabidopsis lyrata spp. Petraea. J. Exp. Bot. 57, 2967- 2983. 47. Dacosta, M., Huang, B., 2007. Changes in antioxidant enzyme activities and lipid peroxidation for bentgrass species in response to drought stress. J. Am. Soc. Hort. Sci. 132,319-326. 48. Dacosta, M., Huang, B., 2007. Drought survival and recuperative ability of bentgrass species associated with changes in abscisic acid and cytokinin production. J. Am. Soc. Hortic. Sci. 49. David, E., Salt, 2006. From Meals to Metals and Back. In Plant Phsiol. 50. Dhanker, O.P., Li, Y., Rosen, B.P., Shi, J., Salt, D., Senecoff, J.F., Sashti, N.A., Meagher, R,B., 2002.Engineering tolerance and hyperaccumulation of arsenic in plants by combining arsenate reductase and y-glutamylcysteine synthetase expression. Nat. Biotechnol. 20, 1140-114. 51. Dhindsa, R.S., Plumb, Dhindsa, P., Thorpe, T.A., 1981. Leaf senescence: 113

correlated with increased levels of membrane permeability and lipid per oxidation, and decreased levels of superoxide dismutase and catalase. J. Exp. Bot. 32, 93– 101. 52. Diatchenko, L., Lukyanov, S., Lau, Y.F., Siebert, P.D., 1999. Suppression subtractive hybridization: a versatile method for identifying differentially expressed genes. Methods Enzymol. 303, 349-380. 53. Diatchenko, L., Lau, Y.F., Campbell, A.P., Chenchick, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E.D., Siebert, P.D.,1996. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries, Proc. Natl. Acad. Sci. U.S.A. 93, 6025–6030. 54. Dixit, V., Pandey, V., Shyam, R., 2002. Chromium ions inactivate electron transport and enhance superoxide generation in vivo in pea (Pisum sativum L. cv. Azad) root mitochondria. Plant, Cell Environ. 25, 687-693. 55. Doncheva, S., Amenós, M., Poschenrieder, C., Barceló, J., 2005. Root cell patterning, a primary target for aluminium toxicity in maize. J. Exp Bot., 56, 1213- 1220. 56. Doty, S.L., 2008. Enhancing phytoremediation through the use of transgenics and endophytes. New Phytol. 179, 318-333. 57. Dube, B.K., Kamlesh, T., Chatterjee, J., Chatterjee, C., 2003. Chromium alters uptake and translocation of certain nutrients in citrullus. Chemosphere 53, 1147– 1153. 58. Dubey, S., Misra, P., Diwedi, S., Chatterjee, S.,Bag, S.K., Mantri, S., Asif, M.H., Rai, A., Kumar, S., Shri, M., Tripathi, P., Tripathi, R.D., Trivedi, P.K., Chakrabarty, D., Tuli, R., 2010. Transcriptomic and metabolomic shifts in rice roots in response to Cr(VI) stress. Genomics, 11,648. 59. Ebbs, S., Lau, I., Ahner, B., Kochian, L., 2002. Phytochelatin synthesis is not responsible for Cd tolerance in the Zn/Cd hyperaccumulator Thlaspi caerulescens (J. & C. Presl). Planta . 214, 635–640. 60. Ebbs, S.D., Lasat, M.M., Brady, D.J., Cornish, Gordon, R., Kochian, L.V., 1997. Phytoextraction of Cadmium and Zinc from a Contaminated Soil. J. Environ. Quality. 26,1424-1430. 61. Ellis, D.R., Salt, D.E., 2003. Plants, selenium and human health. Curr. Opin Plant Biol. 6, 273-279. 62. Feussner, I., 1997. Do specific linoleate 13-lipoxygenases initiate β-oxidation? FEBS Lett. 406, 1–5. 63. Feussner, K., Feussner, I., Leopold, I., Wasternack, C., 1997. Isolation of a cDNA coding for an ubiquitin-conjugating enzyme UBC1 of tomato-the first stress- induced UBC of higher plants. FEBS Lett. 409, 211-215. 64. Filatov, V., Dowdle, J., Smirnoff, N., Ford-Lloyd, B., Newbury, H.J., Macnair, M.R., 2006. Comparison of gene expression in segregating families identifies genes and genomic regions involved in a novel adaptation, zinc hyperaccumulation. Mol. Ecol. 15, 3045-3059. 65. Fowler, J.L., 1991. Interaction of salinity and temperature on the germination of Crambe. Agron. J. 83, 169-172. 66. Foyer, C.H., Lopez-Delgado, H., Dat, J.F., Scott, I.M., 1997. Hydrogen peroxide and glutathione–associated mechanisms of acclamatory stress tolerance and signalling. Plant Physiol. 100, 241–254. 67. Freeman, J.L., Persans, M.W., Nieman, K., Albrecht, C., Peer, W.A., Pickering, I.J., Salt, D.E., 2004. Increased glutathione biosynthesis plays a role in nickel 114

tolerance in Thlaspi nickel hyperaccumulators. Plant Cell, 16, 2176-2191. 68. Fu, J., Huang, B., 2003. Effects of foliar application of nutrients on heat tolerance of creeping bent grass. J. Plant Nut. 26, 81-96. 69. Fujita, M., Fujita, Y., Noutoshi, Y., Takahashi, F., Narusaka, Y., Yamaguchi- Shinozaki, K., Shinozaki, K., 2006. Crosstalk between abiotic and biotic stress responses: A current view from the points of convergence in the stress signaling networks. Curr. Opin. Plant Biol. 9, 436-442. 70. Fukao, T., Yeung, E., Bailey-Serres1, J., 2011. The Submergence Tolerance Regulator SUB1A Mediates Crosstalk between Submergence and Drought Tolerance in Rice Takeshi fukao. Plant Cell, 23,412-427. 71. Fusco, N., Micheletto, L., Dal-Corso, G., Borgato, L., Furini, A., 2005. Identification of cadmium-regulated genes by cDNA-AFLP in the heavy metal accumulator Brassica juncea L. J. Exp. Bot. 56, 3017-3027. 72. Gaberscik, A., Mazej, Z., 1995. Photosynthetic performance and photoinhibition in two species of Potamogeton from lake Bohinj (Slovenia). Acta bot. Gallica 142 , 667-672. 73. Gaberščik, A., Urbanc-Berčič, O., Kržič, N., Kosi, G., Brancelj, A., 2003. The intermittent lake Cerknica. Various faces of the same ecosystem. Lake Reserv. Manage. 8, 159-168. 74. Gadjev, I., Vanderauwer, S., Gechev, T.S., Laloi, C., Minkov, I.N, Shulaev, V., Apel, K., Inze, D., Mittler, R., Van Breusegem, F., 2006. Transcriptomic footprints disclose specificity of reactive oxygen species signaling in Arabidopsis. Plant Physiol. 141, 436–445 75. Gaetke, L.M., Chow, C.K., 2003. Copper toxicity, oxidative stress and antioxidant nutriens. Toxicol. 189,147-63. 76. Galeas, M.L., Zhang, L.H,. Freeman, J.L., Wegner, M., Pilon-Smits, E.A.H., 2007. Seasonal fluctuations of selenium and sulfur accumulation in selenium hyperaccumulators and related non-accumulators. New Phytol. 173, 517–525 77. Garbisu, C., Herna´ ndez-Allica, J., Barrutia, O., Alkorta, I., Becerril, J.M., 2002. Phytoremediation: A technology using green plants to remove contaminants from polluted areas. Rev. Environ. Health. 17, 75–90. 78. Gardea-Torresdey, J.L., De la Rosa, G., Peralta-Videa, J.R., Montes, M., Cruz- Jimenez, G., Cano-Aguilera, I., 2005. Differential uptake and transport of trivalent and hexavalent chromium by Tumbleweed (Salsola kali). Arch. Environ. Contam. Toxicol. 48, 225–232. 79. Giannopolitis, C.N., Ries, S.K., 1977. Superoxide, mutase I. Occurrence in higher plants. Plant Physiol. 59, 309 – 314. 80. Gong, L., Li, B., Millas, S., Yeh, E.T.H., 1999. Molecular cloning and characterization of human AOS1 and UBA2, components of the sentrin-activating enzyme complex. FEBS Lett. 448, 185–189 81. González-Mendoz, D., Morales, A., Brito-Vera, H., 2009. A rapid and efficient method for isolation of total RNA from Euglena gracilis (Euglenoidea). Genet. Mol. Res. 8, 482-486. 82. Goyer, R.A., 1997.Toxic and essential metal interactions. Annu. Rev. Nutr.17, 37- 50. 83. Guerinot, M.L., Salt, D.E., 2001. Fortified foods and phytoremediation. Two sides of the same coin. Plant Physiol. 125, 164–167 84. Gutteridge, J.M.C., 1995. Lipid peroxidation and antioxidants as biomarkers of tissue damage. Clin. Chem. 41, 1819–28. 115

85. Hagemeier, J., 2004. Ecophysiology of plant growth under heavy metal stress. In M.N.V. Prasad (ed.) Heavy metal stress in plants: From biomolecules to ecosystems. Springer-Verlag, Berlin, Germany. pp. 201–222. 86. Haldimann, P., Feller, U., 2005. Growth at moderately elevated temperature alters the physiological response of the photosynthetic apparatus to heat stress in pea (Pisum sativum L.) leaves. Plant Cell, Environ. 28, 302-317. 87. Hamid, S.S., 1987. A rich sources of erucic acid, its oil percentage, fatty acid composition and agriculture data. Pak. J. Sci. Ind. Res. 30, 33–35. 88. Hammond-Kosack, K. E., Jones, J. D. G., 1996. Inducible plant defence mechanisms and resistance gene function. Plant Cell, 8, 1773-1791. 89. He, Y., Lie, Y., Chen, Q., Bian, A., Chen, W., 2001. Comparison of the optimal pH for four antioxidant enzymes in the seedlings of tall fescue (Festuca arundinacea Schreb) and Kentucky bluegrass (Poa pratensis L.). J Nanjing Agr.Univ. 24, 1-4. 90. Heath, R.L., Packer, L., 1968. Photoperoxidation in isolated chloroplasts. I. Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem Biophys.125, 189–198. 91. Heidenreich, B., Mayer, K., Sandermann, H., Ernast, H., 2001. Mercury induced genes in arabidopsis thaliana: Identification of induced genes upon long-term mercuric ion exposure. Plant Cell, Environ. 24, 1227-1234. 92. Hinderhofer, K., Zentgraf, U., 2001. Identification of a transcription factor spec expressed at the onset of leaf senescence. Planta. 213, 469-473. 93. Hirai, M.Y., Fujiwara, T., Awazuhara, M., Kimura, T., Noji, M., Saito, K., 2003. Global expression profiling of sulfur-starved Arabidopsis by DNA macroarray reveals the role of O-acetyl-L-serine as a general regulator of gene expression in response to sulfur nutrition. Plant J. 33, 651–663. 94. Hoagland, D.R., D.I. Arnon. 1950. The water-culture for growing plants without soil. Calif. Agric. Exp. Stn. Circ. 347 (Rev.). 95. Horvath, D.P., Soto-Suárez, M., Chao, W.S., Jia, Y., Anderson, J.V., 2005. Transcriptome analysis of paradormancy release in root buds of leafy spurge (Euphorbia esula). Weed Sci. 53, 795-801. 96. Jacobsen, S., Hauschild, M.Z., Rasmussen., U., 1992. Induction by chromium of chitinases and polyamines in barely (Hordeum vulgare L.) and rape (Brassica napus L.ssp oleifera). Plant Sci. 84,119–128. 97. James, B.R., Bartlett, R.J., 1983. Behavior of Chromiumin Soils V1 Interactions Between Oxidation-Reduction and Organic Complexation. J. Environ. Qual. 12, 173-176. 98. John, L., Freeman, Salt, D.E., 2006. The Metal Tolerance Profile of Thlaspi goesingense is Mimicked in Arabidopsis thaliana Ectopically Expressing Serine Acetyl-transferase. New Phytol. In Preparation. 99. Johnson, B.L., McKay, K.R., Schneiter, A.A., Hanson, B.K., Schatz, B.G., 1995. Influence of planting date on Canola and crambe production. J. Prod. Agric. 8, 594-599. 100. Jonak, C., Nakagami, H., Hirt, H., 2004. Heavy Metal Stress: Activation of Distinct Mitogen-Activated Protein Kinase Pathways by Copper and Cadmium .Plant Physiol. 136, 3276-3283. 101. Joshi, M.K., Mohanty, P., 2004. Chlorophyll a fluorescence as a probe of heavy metal ion toxicity in plants. in: Papageorgiou GC, govindjee, eds. chlorophyll a fluorescence: A signature of photosynthesis. Dordrecht, the Netherlands. Springer, 637–661. 116

102. Kampranis, S.C., Damianova, R., Atallah, M., Toby, G., Kondi, G., Tsichlis, P.N., Makris, A.M., 2000. A novel plant glutathione S-transferase/peroxidase suppresses bax Lethality in yeast. J. Biol. Chem. 275, 29207-29216. 103. Kariola, T., Brader, G., Helenius, E., Li, J., Heino, P., Palva, E.T., 2006. Early responsive to dehydration 15, a negative regulator of abscisic acid responses in Arabidopsis. Plant Physiol. 142, 1559-1573. 104. Kawauchi, D., Taniguchi, H., Watanabe, H., Saito, T., Murakami, H., 2006. Direct visualization of nucleogenesis by precerebellar neurons: involvement of ventricle- directed, radial fibre-associated migration. Development. 133, 1113-1123. 105. Kerkeb, L., Kramer, U., 2003. The role of free histidine in xylem loading of nickel in Alyssum lesbiacum and Brassica juncea. Plant Physiol. 131, 716-724. 106. Khan, A.G., 2001. Relationships between chromium biomagnification ratio, accumulation factor, and mycorrhizae in plants growing on tannery effluent- polluted soil. Environ Int. (5-6), 417-23. 107. Kim, Y.S., Nosaka, K., Downs, D.M., Kwak, J.M., Park, D., Chung, I.K., Nam, H.G., 1998. A Brassica cDNA clone encoding a bifunctional hydroxymethylpyrimidine kinase/thiamin-phosphate pyrophosphorylase involved in thiamine biosynthesis. Plant Mol. Biol. 37, 955–966. 108. Kisku, G.C., Barman, S.C., Bhargava, S.K., 2000. Contamination of soil and plants with potentially toxic elements irrigated with mixed industrial effluent and its impact on the environment. Water, Air, Soil Poll. 120, 21-137. 109. Kotas, J., Stasicka, Z., 2000. Chromium occurance in the environment and methods of its speciation. Environ. Poll. 107, 263-283. 110. Kotchoni, S.O., Kuhns, C., Ditzer, A., Kirch, H., Bartels, D., 2006. Over- expression of different aldehyde dehydrogenase genes in Arabidopsis thaliana confers tolerance to abiotic stress and protects plants against lipid peroxidation and oxidative stress. Plant, Cell, Environ. 29, 1033-1048. 111. Koussevitzky, S., Nott, A., Mockler, T.C., Hong, F., Sachetto-Martins, G., Surpin, M., 112. Kramer, U., 2005. Phytoremediation: Novel approaches to clean up polluted soils. Curr. Opin. Biotech. 16, 133-14l 113. Kramer, U., 2010. Metal hyper accumulation in plants. Annu.Rev.Plant Biol. 61, 517-534. 114. Krämer, U., Pickering, I.J., Prince, R.C., Raskin, I., Salt, D.E., 2000. Subcellular localization and speciation of nickel in hyperaccumulator and non-accumulator Thlaspi species. Plant Physiol. 122, 1343-1354. 115. Kreps, A.J., Wu, Y., Chang, H.S., Zhu, T., Wang, X., Harper, J.F., 2002. Transcriptomic changes for Arabidopsis in response to salt, osmotic, and cold stress. Plant Physiol. 130, 2129-2141. 116. Krotz, R.M., Evangelou, B.P., Wagner, G.J., 1989. Relationships between cadmium, zinc, Cd-peptide, and organic acid in tobacco suspension cells. Plant Physiol. 91, 780-787. 117. Lazzeri, L., Leoni, O., Conte, L.S., Palmieri, S., 1994. , Some technological characteristics and potential uses of Crambe abyssinica products. Ind. Crops Prod. 3,103–112. 118. Ledue, D.L., Terry, N., 2005. Phytoremediation of toxic trace elements in soil and water. J. Ind Microbiol. Biotechnol. 32, 514-520. 119. Lee, G., Sohn, E.J., Lee, M.H., Hwang, I., 2004. The Arabidopsis Rab5 homologs Rha1 and Ara7 localize to the prevacuolar compartment. Plant Cell Physiol. 45, 1211-1220. 117

120. Levine, R., Mosoni, L., Berlett, B., Stadtman, E., 1996. Methionine residues as endogenous antioxidants in proteins. Proceedings Natl Acad. Sci. USA, 93, 15036-15040. 121. Li, W., Zhang, J., Mou, Y., Geng, J., McVetty, P. B., Hu, S., Li, G., 2011. Integration of Solexa sequences on an ultradense genetic map in Brassica rapa L. BMC Genomics. 12-249. 122. Lim, J., Mittler, R., Chory, J., 2007. Signals from Chloroplasts Converge to Regulate Nuclear Gene Expression. Science 316, 715-719. 123. Lindgren, P.B., 1997. The role of hrp genes during plant-bacterial interactions. Annu. Rev. Phytopathol. 35, 129-152. 124. Liu, Z., Shen, J., Carbrey, J.M., Mukhopadhyay, R., Agre, P., Rosen, B.P., 2002. Arsenite transport by mammalian aquaglyceroporins AQP7 and AQP9. Proceedings Natl Acad. Sci. USA, 99, 6053-6058. 125. Louie, M., Kondor, N., DeWitt, J.G., 2003. Gene expression in cadmium tolerant Datura innoxia, detection and characterization of cDNAs induced in response to Cd2+. Plant Mol. Biol. 52, 81–89. 126. Lu, Z., Liu, D., Liu, S., 2007. Two rice cytosolic ascorbate peroxidises differentially improve salt tolerance in transgenic Arabidopsis. Plant Cell Rep. 26, 1909-1917. 127. Luo, H., Lu, Y., Mao, Y., Shi, X., Dalal, N.S., 1996. Role of chromium (IV) in the chromium (VI)-related free radical formation, dG hydroxylation, and DNA damage. J. Inorg. Biochem. 64, 25-35. 128. Lyon, G.L., Brooks, R.R., Peterson, P.J., Butler, G.W., 1969. Some trace elements in plants for Serpentine soils. N. Z. J. Sci. 13, 133–139. 129. Ma, L.Q., Komar, K.M., Tu, C., Zhang, W., Cai, Y., Kennelley, E.D., 2001. A fern that hyperaccumulates arsenic: A hardy versatile fast-growing plant helps to remove arsenic from contaminated soils. Nature 409, 579-579. 130. Mahalingam, R., Gomez-Buitrago, A., Eckardt, N., Shah, N., Guevara-Garcia, A., Philip Day, R.R., Fedoroff, N.V., 2003. Characterizing the stress/defense transcriptome of Arabidopsis. Genome Biol. 4, 1-14. 131. Malik, C.P., Bharti, J., Chaturvedi, V., 2009. Evaluation of comparative effects of heavy metals (cadmium, mercury and lead) on growth and stress injury in Brassica juncea L. Czern and Coss. J. Plant Sci. 25, 69-78. 132. Maniatis, T., Fritsch, E.F., Sambrook, J., 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor, Cold Spring Harbor Laboratory Press. 133. Marschner, H., 1995. Mineral Nutrition of Higher Plants , London Academic Press. 134. Maxwell, D.P., Wang, Y., McIntosh, L., 1999. The alternative oxidase lowers mitochondrial reactive oxygen production in plant cells. Proc. Natl. Acad. Sci. USA. 96, 8271-8276. 135. Maxwell, K., Johnson, G.N., 2000. Chlorophyll fluorescence - a practical guide. J. Exp. Bot. 51, 659-668. 136. May, M.J., Leaver, C.J., 1994. Arabidopsis thaliana γ-glutamylcysteine synthetase is structurally unrelated to mammalian, yeast and E. coli homologs. Proc. Natl Acad. Sci. USA, 91, 10059–10063. 137. McGrath, S.P., 1982. The uptake and translocation of tri- and hexavalent chromium and effects on the growth of oat in flowing nutrient solution and in soil. New Phytol. 92, 381–390. 138. McGrath, S.P., Zhao, F.J., Lombi, E., 2001. Plant and rhizosphere processes involved in phytoremediation of metal contaminated soils. Plant Soil. 232, 207– 214. 118

139. Meagher, R.B., 2000. Phytoremediation of toxic elemental and organic pollutants. Curr. Opin. Plant Biol. 3, 153–162. 140. Mehlmer N., 2009. Functional complementation of yeast mutants to study plant signalling pathways. Methods Mol. Biol. 479,1-11. 141. Mengel, K., Kirkby, E.A., 1982. Principles of plant nutrition. Bern, Switzerland: International Potash Institute. 142. Milner, M.J., Kochian, L.V., 2008. Investigating heavy metal hyperaccumulation using Thlaspi caerulescence as a model. Ann. Bot. 102, 3 -13. 143. Mishra, S., Shanker, K., Srivastava, M., S. Srivastava, S., Shrivastav, R., Dass, S., Satya Prakash, S., 1997. A study on the uptake of trivalent and hexavalent chromium by paddy (Oryza sativa): possible chemical modifications in rhizosphere. Agr. Eco. Environ. 62, 53-58. 144. Mittler, R., 2002. Oxidative stress, antioxidants and stress tolerance. Trends plant Sci. 7, 410-415. 145. Mohan, M., Nair, S., Bhagwat, A., Krishna, T.G., Yano, M., Bhatia, C.R., Sasaki, T., 1997. Genome mapping, molecular markers and marker-assisted selection in crop plants. Mol. Breed. 3, 87–103. 146. Monselise, E.B.I., Parola, A.H., Kost, D., 2003. Low-frequency electromagnetic fields induce a stress effect upon higher plants, as evident by the universal stress signal, alanine. Biochem. Biophys. Res. Commun. 302, 427-434. 147. Mudgal.V., Madaan N., Mudgal, A., 2010. Heavy metals in plants: phytoremediation: Plants used to remediate heavy metal pollution. Agric Biol. J. North America. ISSN Print: 2151-7517 148. Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plantarum. 15, 472-497. 149. Nakano, Y., Asada, K.,1981. Hydrogen Peroxide is scavenged by Ascorbate- specific Peroxidase in Spinach Chloroplasts. Plant Cell Physiol. 22, 867-880. 150. Newman. L., Reynolds, C.M., 2005. Bacteria and phytoremediation. New uses for endophytic bacteria in plants. Trends. Biotechnol. 23, 6-8. 151. Noret, N., Meerts, P., Vanhaelen, M., Dos santos, A., Escarre, J., 2007. Do metal- rich plants deter herbivores? A field test of the defence hypothesis. Oecologia 152(1), 92-100. 152. of soybeans. Soil Sci. Soc. Am. Proc. 35, 755– 8. 153. Ouellet, F., Charron, J.B., Houde, M., Sarhan, F., 2008.The plant Apolipoprotein D ortholog protects Arabidopsis against oxidative stress. BMC Plant Biol. 8-86. 154. Padmanabhan, P., Sahi, S.V., 2011. Suppression subtractive hybridization reveals differential gene expression in sunflower grown in high P. Plant Physiol. Biochem. 49,584-591 155. Palmer, E. F., Warwick, F., Keller, W., 2001. Brassicaceae (Cruciferae) family, plant biotechnology and phytoremediation. Int. J. Phytoremediat. 3, 245-287. 156. Panda, S. K., Choudhury, S., 2005. Chromium stress in plants. Braz. J. Plant Physiol.17, 131-136. 157. Panda, S.K, 2007. Chromium-mediated oxidative stress and ultrastructural changes in root cells of developing rice seedlings. J. Plant Physiol. 11, 1419-1428. 158. Panda, S.K., 2007. Chromium-mediated oxidative stress and ultrastructural changes in root cells of developing rice seedlings. J. of Plant Physiol.164, 1419- 1428. 159. Pandey, V., Dixit, V., Shyram, R., 2005. Antioxidative responses in relation to growth of mustard (Brassica juncea cv. Pusa Jaikisan) plants exposed to hexavalent chromium. Chemosphere. 61, 40–47. 119

160. Paulose, B., Kandasamy, S., Dhankher, O.P., 2010. Expression profiling of Crambe abyssinica under arsenate stress identifies genes and gene networks involved in arsenic metabolism and detoxification. BMC Plant Biol. 10, 108. 161. Peer, W.A., Baxter, I.R., Richards, E.L., Freeman, J.L., Murphy, A.S., 2005. Phytoremediation and hyperaccumulator plants. In: “Molecular biology of metal homeostasis and detoxification, topics in current genetics” (Tamas M, Martinoia E eds). Vol. 14, Springer, Berlin, Germany, pp. 299-340. 162. Peer, W.A., Mahmoudian, M., Freeman, J.L., Lahner, B., Richards, E.L, Reeves, R.D., 2006. Assessment of plants from the Brassicaceae family as genetic models for the study of nickel and zinc hyperaccumulation. New Phytol. 172, 248-260. 163. Pence, N.S., Larsen, P.B., Ebbs, S.D., Letham, D.L.D., Lasat, M.M., Garvin, D.F., Eide, D., Kochian, L.V., 2000. The molecular physiology of heavy metals. Plant Physiol. 163, 319–332. 164. Pence, N.S., Larsen, P.B., Ebbs, S.D., Letham, D.L.D., Lasat, M.M., Garvin, D.F., Eide, D., Kochian, L.V., 2000.The molecular physiology of heavy metal transport in the Zn/Cd hyperaccumulator Thlaspi caerulescens. Proc. Natl. Acad. Sci. USA. 4956–4960. 165. Pietrini, F., Iannelli, M.A., Pasqualini, S., Massacci, A., 2003. Interaction of cadmium with glutathione and photosynthesis in developing leaves and chloroplasts of Phragmites. Plant Physiol. 133, 829-837. 166. Pilon-Smits, E.A.H., 2005. Phytoremediation. Annu. Rev. Plant Biol. 56, 15-39. 167. Pilon-Smits, E.A.H., Freeman J. L., 2006. Envirnmental cleaning using plants: Biotechnology advances and ecological considerations. Front. Ecol. Environ. 4, 203-210. 168. Pollard, A.J., Powell, K.D., Harper, F.A., Smith, J.A.C., 2002. The genetic basis of metal hyperaccumulation in plants. Crit. Rev. Plant Sci. 21, 539-566. 169. Polle, A., Schützendübel, A., 2003. Heavy metal signalling in plants: Linking cellular and organismic reesponses. In: Hirt H, Shinozaki K. (eds), Plant Stress Resp. pp.1-29. Springer-Verlag, Berlin Heidelberg, Germany. 170. Radic, S., Radic-Stojkovic, M., Pevalek-Kozlina, B., 2006. Influence of NaCl and mannitol on peroxidase activity and lipid peroxidation in Centaurea ragusina L. roots and shoots. J. Plant. Physiol. 163, 184-1292. 171. Rakwal, R., Agrawal, G.K., Tamogami, S., Yonekura, M., Agrawal, V.P. Iwahashi, H., 2003. Novel insight into kinetin-inducible stress responses in rice seedlings. Plant Physiol. Biochem. 41,453–457. 172. Reeves, R.D., 1992. Hyperaccumulation of nickel by serpentine plants. In: Proctor J., (Editor.). The vegetative of ultramafic (serpentine) soils. J. Intercept. Andover. Hants. UK. 253–77. 173. Reeves, R.D., Baker, A.J.H., 2000. Metal accumulating plants. In: Raskin, I., Ensley, E.D., editors. Phytoremediation of toxic metals: using plants to clean up the environment. New York7 Wiley. pp, 93– 229. 174. Rensing, C., Ghosh, M., Rosen, B.P., 1999. Families of soft metal ion transporting ATPases. J. Bacteriol. 181, 5891–5897. 175. Rensing, C., Mitra, B., Rosen, B.P., 1997. The zntA gene of Escherichia coli encodes a Zn (II)- translocating P-type ATPase. Proc. Natl. Acad. Sci. USA 94, 14326-14331. 176. Rouhier, N., Lemaire, S.D., Jacquot, J., 2008. The role of glutathione in photosynthetic organisms: emerging functions for glutaredoxins and glutathionylation. Ann. Rev. Plant Biol. 59, 143-166. 177. Rugh, C.L., 2004. Mercury detoxification with transgenic plants and other 120

Biotechnological breakthroughs for phytoremediation. In Vitro Cell. Dev. Biol. Plant. 37, 321-325. 178. Rugh, C.L., Gragson, G.M., Meagher, R.B., Merkle, S.A., 1998. Toxic mercury reduction and remediation using transgenic plants with a modified bacterial gene. Hort. Sci. 33, 618-621. 179. Rugh, C.L., SenecoÄ, J.F., Meagher, R.B., Merkle, S.A., 1998. Development of transgenic yellow poplar for mercury phytoremediation. Nat. Biotechnol. 16, 925- 928. 180. Ryan Fink, C., Scandalio, S.J.G., 2002. Molecular evolution and structure–function relationships of the superoxide dismutase gene families in angiosperms and their relationship to other eukaryotic and prokaryotic superoxide dismutases. Arch. Biochem. Biophys. 399, 19–36. 181. Sahr, T., Voigt, G., Paretzke, H.G., Schramel, P., Ernst, D., 2004. Caesium- Affected gene expression in Arabidopsis thaliana. New Phytol. 165, 747–754. 182. Salt, D.E., 2006. From Meals to Metals and Back. In: Plant Physiology. Sinuer Associates Inc. sunders land, Massachusetts. 183. Salt, D.E., Rauser, W.E., 1995. MgATP-dependent transport of phytochelatins across the tonoplast of oat roots. Plant Physiol. 107, 1293–1301. 184. Salt, D.E., Smith, R.D., Raskin, I., 1998. Phytoremediation. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49, 643–668. 185. Sarret, G., Vangronsveld, J., Manceau, A., Musso, M., D'Haen, J., Menthonnex, J., Hazemann, J., 2001. Accumulation forms of Zn and Pb in Phaseolus vulgaris in the presence and absence of EDTA. Environ. Sci. and Technol. 35, 2854-2859. 186. Scandalios, J.G., 2002. Oxidative stress: molecular perception and transduction of signals triggering antioxidant gene defences. Braz. J. Med. Biol. Res. 38, 995-1014. 187. Schat, H., Llugany, M., Vooijs, R., Hartley-Whitaker, J., Bleeker, P.M., 2002. The role of phytochelatins in constitutive and adaptive heavy metal tolerances in hyperaccumulator and non-hyperaccumulator metallophytes. J. Exp. Bot. 53, 1-12. 188. Schiavon, M., Pilon-Smits, E., Wirtz, M., Hell, R., Malagoli, M., 2008. Interactions between chromium and sulfur metabolism in Brassica juncea. J. Environ. Qual. 37, 1536-1545. 189. Schmidt, A., Kunert, K.J., 1986. Lipid Peroxidation in Higher Plants: The Role of Glutathione Reductase. Plant physiol. 700-702. 190. Scholz, W., Lucas, M., 2003. Techno-economic evaluation of membrane filtration for the recovery and re-use of tanning chemicals. Water Res. 37, 1859-1867. 191. Shanker, A.K., Cervantes, C., Loza-Tavera, H., Avudainayagam, S., 2005. Chromium toxicity in plants. Environ. Int. 31, 739-753. 192. Sharma, D.C., Chatterjee, C., Sharma, C.P., 1995. Chromium accumulation and its effects on wheat (Triticum aestivum L. cv HD 2204) metabolism. Plant Sci. 111, 145–151. 193. Sharp, R.E., Boyer, J.S., 1986. Photosynthesis at low water potentials in sunflower: lack of photoinhibitory effects. Plant Physiol. 82, 90–95. 194. Shewry, P.R., Peterson, J.P., 1974. The uptake of chromium by barley seedlings (Hordeum vulgare L). J Exp. Bot. 25, 785–97. 195. Shewry, P.R., Peterson, P.J., 1976. Distribution of chromium and nickel in plants and soil from serpentine and other sites. J. Ecol. 64,192-212. 196. Siddiqi, A.H., 1968. Chromite mining in Pakistan. The Professional Geographer, 20, 342–345. 121

197. Sinam, G., Sinha, S., Mullica, S., 2011. Effect of chromium on accumulation and antioxidants in Cucumis utillissimus L., response under enhanced bioavailability condition J. Environ Sci. 23, 506-512. 198. Skeffington, R.A., Shewry, P.R., and P. J. Peterson, P.J., 1976. Chromium uptake and transport in barley seedlings (Hordeum vulgare L.). Planta. 132, 209-214 199. Sraj Krizic, N., Pongrac, P., Regvar, M., Gaberscik, A., 2009. Photon harvesting efficiency and arbuscular mycorriza in amphibious plants. Photosynthet. 47, 61-67. 200. Stadtman, E.R., Moskovitz, J., Levine, R.L., 2003. Oxidation of methionine residues in proteins: biological consequences, Antioxid. Redox. Signaling. 5, 577- 582. 201. Stohs, S.J., Bagchi, D., 1995. Oxidative mechanisms in the toxicity of metal ions. Free Radic. Biol. Med. 18,321–336. 202. Subrahmanyam, D., 2008. Effects of chromium toxicity on leaf photosynthetic characteristics and oxidative changes in wheat (Triticum aestivum). Photosynthet. 46, 339-346. 203. Talke, I.N., Hanikenne, M., Krämer, U., 2006. Zinc-dependent global transcriptional control, transcriptional deregulation, and higher gene copy number for genes in metal homeostasis of the hyperaccumulator Arabidopsis halleri. Plant Physiol. 142, 148-167. 204. Tariq, S. R., Shah, M.H., Shaheen, N., Khalique, A., Manzoor, S., Jaffar, M., 2005. Multivariate analysis of selected metals in tannery effluents and related soil. J. Hazard. Mater. 122, 17–22. 205. Tiffin, L, O., 1966. Iron translocation. I. Plant culture, exudate sampling, iron- citrate analysis. Plant Physiol. 41: 510-514. 206. Turner, M.A., Rust, R.H., 1971. Effects of chromium on growth and mineral nutrition 207. Ueno, D., Ma, J.F., Iwashita, T., Zhao, F.J, McGrath, S.P., 2005. Identification of the form of Cd in the leaves of a superior Cd-accumulating ecotype of Thlaspi caerulescens using 113Cd-NMR. Planta. 221, 928-936. Environmental Pollution xxx (2011) 1e6

Contents lists available at ScienceDirect

Environmental Pollution

journal homepage: www.elsevier.com/locate/envpol

Short Communication Identifying genes and gene networks involved in chromium metabolism and detoxification in Crambe abyssinica

Asma Zulfiqar 1,2, Bibin Paulose 1, Sudesh Chhikara, Om Parkash Dhankher*

Department of Plant, Soil, and Insect Sciences, 270 Stockbridge Road, University of Massachusetts Amherst, MA 01003, USA article info abstract

Article history: Chromium pollution is a serious environmental problem with few cost-effective remediation strategies Received 4 March 2011 available. Crambe abyssinica (a member of Brassicaseae), a non-food, fast growing high biomass crop, is Received in revised form an ideal candidate for phytoremediation of heavy metals contaminated soils. The present study used 25 May 2011 a PCR-Select Suppression Subtraction Hybridization approach in C. abyssinica to isolate differentially Accepted 24 June 2011 expressed genes in response to Cr exposure. A total of 72 differentially expressed subtracted cDNAs were sequenced and found to represent 43 genes. The subtracted cDNAs suggest that Cr stress significantly Keywords: affects pathways related to stress/defense, ion transporters, sulfur assimilation, cell signaling, protein Chromium Crambe abyssinica degradation, photosynthesis and cell metabolism. The regulation of these genes in response to Cr fi Phytoremediation exposure was further con rmed by semi-quantitative RT-PCR. Characterization of these differentially Differential gene expression expressed genes may enable the engineering of non-food, high-biomass plants, including C. abyssinica, Suppression subtraction hybridization for phytoremediation of Cr-contaminated soils and sediments. Published by Elsevier Ltd.

1. Introduction causes cellular and DNA damage. Conversely, Cr(III) is less soluble and less toxic but at higher concentrations, will inhibit enzymatic In recent years, chromium (Cr) contamination has become activities such as root-associated Fe(III) reductases (Barceló and a major environmental concern, primarily due to the toxic Cr burden Poschenrieder, 1997). High levels of Cr are also toxic to plants and in soil and water resulting from various industrial and agricultural may significantly limit biomass and yield. Impaired uptake of activities (Chanda and Parmar, 2003; Schiavon et al., 2008). In India various mineral nutrients and oxidative stress due to the formation alone, approximately 2000e3200 tonnes of Cr is released into the of reactive oxygen species (ROS) has also been observed in response environment annually from the tanning industries. Effluent total Cr to Cr exposure (Gardea-Torresdey et al., 2005; Milner and Kochian, concentrations ranging between 2000 and 5000 mg Cr l 1 have 2008; Pandey et al., 2005). The molecular mechanisms of been detected (Chandra et al.,1997); a rate dramatically higher than Cr-induced oxidative damage and tolerance in plants have not been the recommended limit of 2 mg l 1 for industrial effluents in India fully understood. (http://www.ismenvis.nic.in/standard9.html, February 13, 2011), or Phytoremediation, a plant-based and cost-effective strategy for in drinking water (100 mgl 1)(US EPA, 2010). the remediation of heavy metal contaminated soils, has garnered Chromium poses a significant potential risk to human health increasing attention in the last decade (Pilon-Smits, 2005). Plant- because of its mutagenic and carcinogenic properties (Chaney et al., based remedial strategies utilized the natural abilities of plants to 1997; US EPA, 2000). Chromium exists in trivalent (III) and hex- decontaminate polluted soil (Doty, 2008). Crambe abyssinica, avalent (VI) oxidation states in nature (Zayed et al., 1998). Chro- a member of Brassicaseae and referred to here as crambe, is an mium (VI) is more soluble, mobile and bioavailable than Cr(III). Due annual herb, native of the Mediterranean area, and cultivated for to its powerful oxidizing properties, Cr(VI) is highly toxic and primarily industrial oil (Wang et al.,1999). Crambe is a fast growing, high biomass non-food crop with significant potential for the phy- toremediation of toxic metals. Preliminary studies have shown that * Corresponding author. crambe is not only highly tolerant to As and other heavy metals, but E-mail addresses: asmazulfi[email protected] (A. Zulfiqar), bpaulose@psis. also accumulates significantly higher levels of As and Cd than other umass.edu (B. Paulose), [email protected] (S. Chhikara), [email protected]. Brassica species (Artus, 2006; Paulose et al., 2010). Crambe can be edu (O. P. Dhankher). grown wherever oilseed rape is grown and does not out-cross with 1 Authors contributed equally. 2 Department of Botany, Quaid-i-Azam Campus, Postal code 54590, University of canola or other agriculture crops (Anon, 1993; European Union the Punjab, Lahore, Pakistan. Strategic Research Agenda, 2005), thereby minimizing the risk of

0269-7491/$ e see front matter Published by Elsevier Ltd. doi:10.1016/j.envpol.2011.06.027

Please cite this article in press as: Zulfiqar, A., et al., Identifying genes and gene networks involved in chromium metabolism and detoxification in Crambe abyssinica, Environmental Pollution (2011), doi:10.1016/j.envpol.2011.06.027 2 A. Zulfiqar et al. / Environmental Pollution xxx (2011) 1e6 gene flow from genetically modified crambe to other members no symptoms of severe cellular damage (Supplementary Fig. S1). of Brassicaseae. A better understanding of the molecular and However at higher concentration (200 and 250 mM), plant showed biochemical mechanism of Cr uptake and detoxification in crambe chlorosis and visible necrosis on leaves. Therefore, 150 mMK2CrO4 will facilitate the development of cost-effective strategies for phy- was selected to treat crambe seedlings to induce Cr stress. toremediation as well as for engineering of Cr resistant food crops with reduced Cr accumulation. 3.2. Isolation of differentially expressed crambe transcripts In this study, we studied the molecular mechanism of Cr accu- in response to chromium stress mulation and detoxification in crambe and used a PCR-Select Suppression Subtraction Hybridization (SSH) approach to identify Since crambe genome is not sequenced and thus using the genes that are differentially regulated upon Cr exposure. We report current genomic applications such as microarray analysis is not here many uncharacterized novel transcripts as well as those a viable approach. To isolate the differentially expressed genes in participating in known biochemical pathways that are differentially crambe seedlings in response to K2CrO4 exposure, a PCR-Select SSH expressed in response to Cr exposure. (Diatchenko et al., 1996) approach was employed. This technique is used to isolate differentially expressing transcripts between two 2. Material and methods populations of mRNA while simultaneously suppressing the common transcripts between the two populations. In the recent 2.1. Plant growth and chromium treatments past, SSH has been used to study the differential expression of C. abyssinica (cv. BelAnn) seeds were obtained from the North Dakota State genes induced by toxic metals (Watt, 2003; Venkatachalam et al., University’s Agriculture Experimental Station, Fargo, ND. The surface disinfected 2009; Paulose et al., 2010). As the ratio of driver to tester affects crambe seeds as describe in Paulose et al. (2010) were germinated on 0.5 MS the stringency of the subtraction, two parallel subtractions were (Murashige and Skoog) agar media. Germinated seeds were aseptically transferred to 0.5 MS liquid media in 250 ml flasks and grown under controlled conditions performed varying the driver/tester ratio and thus a total of 346 (16/8 h light/dark periods at 22 C) with constant shaking. To determine the subtracted cDNA clones were obtained. The differential screening optimum concentration for Cr treatment, at 10 days K2CrO4 at various concentra- for forward subtracted library eliminating a large number of false tions (0, 50, 100, 150, 200, and 250 mM) was added to the medium, plants were positives as visible on the blots (Supplementary Fig. S2) and iden- grown for an additional seven days and fresh weight of seedlings was measured. tified 73 clones containing the differentially expressed mRNA A concentration of 150 mMK2CrO4 resulted in significant biomass reductions without exhibiting severe toxicity (visible injury) symptoms, and was thus used for sequences. All 73 cDNA sequences were subjected to homology treating plants for cDNA subtraction experiments. Ten days old seedlings were searches against the NCBI nucleotide database and found that they exposed to K2CrO4 for 24 h and the Cr-treated seedlings were frozen in liquid represented 43 different coding transcripts (Table 1). These crambe nitrogen, ground in to powder and stored at 80 C. cDNA sequences are similar to those of Arabidopsis thaliana and some Brassica species. 2.2. RNA isolation, cDNA synthesis and PCR-select subtraction The NCBI database search identified definitive or putative func- fi Total RNA was extracted from control and K2CrO4 treated samples using RNeasy tions for 38 differentially expressed cDNA clones based on signi - Plant Mini kit (Qiagen) followed by the mRNA isolation using NucleoTrap mRNA cant protein homology to previously identified or putative proteins isolation kit. Double stranded cDNA synthesis and cDNA subtractions (Diatchenko in other plant species (Table 1). However, five transcripts encode et al., 1996) were performed using the PCR select cDNA subtraction kit (Clontech, CA). For the forward subtraction library, cDNAs from Cr-treated and untreated plants uncharacterized proteins that could be involved in novel pathways were used as ‘tester’ and ‘driver’, respectively. A reverse-subtraction was performed of Cr metabolism. Based on the sequence identity and roles in with untreated plants serving as ‘tester’ and Cr-treated plants as ‘driver’. The cDNA various metabolic pathways, we clustered the transcripts into synthesis, digestion, adaptor ligation, subtractive hybridizations, and PCR amplifi- different functional groups (Fig. 1). These groups include genes ’ cation was carried out according to manufacturer s protocol and as described in involved in functions related to stress and defense response Paulose et al. (2010). (17 genes), glutathione-S-transferases and sulfur assimilation 2.3. Differential screening (4 genes), cellular metabolism (8 genes), amino acid (AA) metabo- lism (2 genes), cell signaling (3 genes), ion transporters (2 genes), A differential screening procedure using a differential screening kit (Clontech) protein degradation (1 gene), photosynthesis (1 gene), and was used to eliminate false positives in the subtracted cDNA library. In this proce- unknown novel proteins (5 genes). dure, the subtracted cDNAs blotted onto the nylon membranes were hybridized with forward and reverse subtracted probes and the signals were compared for each Proteins involved in various stress and defense response were clone. The differential screening procedure was followed exactly as described in highly represented in the subtracted cDNA library. A total of 17 Paulose et al. (2010). Differentially expressed cDNA clones were sequenced. The DNA cDNA clones had homology to known genes involved in biotic and sequences of these subtracted cDNA clones were used in BLAST search against both abiotic stress response including heavy metal stress. Higher DNA and protein sequences on the database and their homologous gene sequences were identified both from Prokaryotes and Eukaryotes. representation of stress or defense-related genes in our library suggests that these Cr induces genes are involved in protecting the 2.4. Semi-quantitative RT-PCR cell from elemental toxicity. Many of these Cr-induced genes have previously been implicated in stress or defense responses in plants. For RT-PCR, 10 days old crambe seedlings were treated with 150 mMK2CrO4 and Elevated expression of b-1,3 glucanase genes was observed in Hg- the samples were harvested after 6, 12 or 24 h treatment. The cDNA was synthesized from total RNA using a Thermoscript RT-PCR kit (Invitrogen). Primers for each treated plants (Venkatachalam et al., 2009). Lipocalins (TIL1) subtracted cDNA were designed using Primer3 (http://frodo.wi.mit.edu/primer3/). constitute a diverse family of small, mostly extra-cellular proteins The RT-PCR conditions were optimized as described in Paulose et al. (2010). implicated in many important functions. A recent report demon- strated the involvement of Arabidopsis temperature-induced lip- 3. Results and discussion ocalin (AtTIL) in modulating tolerance to oxidative stress (Charron et al., 2008). Transcripts encoding harpin-induced protein (HRP) 3.1. Growth characteristics and Cr tolerance in crambe and ThiJ-like proteins 1 (TJLP1) were strongly upregulated in our library. Harpins are the bacterial elicitors known to induce hyper- Ten days old crambe seedlings were exposed to varying sensitive response in many non-host species (Lindgren, 1997). The concentrations of K2CrO4 (0e250 mM) for seven days. The fresh upregulation of harpin-induced defense-related genes in the Cr- weight of plants decreased moderately at 100 mMK2CrO4, whereas induced cDNA library may be due to involvement in signaling at 150 mMK2CrO4, there was a significant reduction in biomass with machinery under biotic and abiotic stresses. ThiJ is an enzyme

Please cite this article in press as: Zulfiqar, A., et al., Identifying genes and gene networks involved in chromium metabolism and detoxification in Crambe abyssinica, Environmental Pollution (2011), doi:10.1016/j.envpol.2011.06.027 A. Zulfiqar et al. / Environmental Pollution xxx (2011) 1e6 3

Table 1 Relative frequency, identity and description of differentially expressed subtracted cDNA transcripts from C. abyssinica after 24 h exposure to potassium chromate. E-Value refers the blasting of DNA sequences of subtracted clones against both DNA and protein sequences.

Transcripts Description E-value Max Genbank Functions relative identity (%) accession no. frequency (%) 5 Chitin binding/chitinase (CHB) 9e-41 96% NM_129921 Stress/defense 4 Brassica rapa ThiJ-like protein (TJLP1) 1e-87 92% AY335489 Stress 4 Glutamine amidotransferase-like superfamily protein (GAT) 6e-106 89% NM_001035621 Cd stress 4 Sinapis alba cytosolic glyceraldehyde-3-phosphate 4e-81 92% X04301 Cell metabolism dehydrogenase (GAPDH) 4 A. thaliana glutathione-S-transferase tau 4 (ATGSTU4) 4e-129 85% NM_128500 Stress 3 B. juncea mRNA gamma-glutamylcysteine synthetase 1 (ECS1) 0 97% NM_001036624 Stress 2 B. juncea glutathione synthetase (GS) 0 99% Y10984 Stress 2 Brassica carinata defense-related protein (CJAS1) 1e-139 100 AY030296 Defense 2 Brassica oleracea ACC oxidase 1 (ACCOx1) 3e-62 95% X81628 Stress 2 Harpins-induced protein/harpin responsive protein (HRP) 1e-55 76% NP_196250.1 Defense 2 A. thaliana NHL3 [Non-race specific disease resistance gene (NDR1)] 3e-110 90% NM_120715 Defense 2 A. thaliana cobalamin-independent methionine synthase (CIMS) 0 94% AJ608673 AA metabolism 2 A. thaliana elongation factor 1-alpha (EF-1a) 5e-129 100% NM_100666 Cell metabolism 2 A. thaliana putative fructose-bisphosphate aldolase (FBA) 5e-19 100 NM_120057 Cell metabolism 2 A. thaliana curculin-like (mannose-binding) lectin family 1e-45 90% NM_106534 Cell signaling protein (Curculin) 2 A. thaliana RAB homolog 1 (RHA1) 3e-124 94% NM_123881 Cell Signaling 2 Raphanus sativus mRNA for plasma membrane aquaporin 1b (PAQ1b) 0 95% AB030695 Ion transport 2 A. thaliana ubiquitin-associated/TS-N domain-containing protein (UBA) 3e-85 82% NM_118602 Protein degradation 1 Early responsive to dehydration 15 (ERD15) 7e-52 77% NM_180019 Stress 1 Malate dehydrogenase like protein (MDH) 2e-51 96% FJ208590 Cell metabolism 1 A. thaliana SHEPHERD (SHD); contain HSP90/ATP binding domain 0 89% NM_118552 Stress 1 A. thaliana formate dehydrogenase (FDH); NAD binding/oxidoreductase 2e-161 88 NM_121482 Cd stress 1 B. juncea glutathione-S-transferase 6 (GSTF6) 9e-94 92% AY299481 Stress 1 A. thaliana temperature-induced lipocalin (TIL1) 7e-151 96% NM_125192 Stress 1 A. thaliana 3-chloroallyl aldehyde dehydrogenase/ 0 90% NM_179476 Stress oxidoreductase (ALDH7B4) 1 A. thaliana rubisco activase (RCA) 6e-04 86% NM_1799890 Stress 1 B. napus peroxidase 1 (POX1) 0 92% DQ0787541 Stress 1 Brassica juncea b-1,3 glucanase3(BG3) 0 93% NM_115584 Defense 1 Raphanus sativus antifungal rafp1 gene (Rafp1) 2e-132 89% ABJ09663 Defense 1 B. juncea virus resistant protein (RT) 4e-92 92% DQ789595 Defense 1 A. thaliana phosphoric ester hydrolase (SBPASE) 3e-155 92% NM_115438 Cell metabolism/stress 1 A. thaliana ferredoxin-NADP(þ)-oxidoreductase 1 (FNR1) 0 91% NM_126017 Cell metabolism 1 A. thaliana alternative oxidase 1A (AOX1A) 0 90% NM_113135 Cell metabolism 1 Thalaspi caerulescens yellow stripe like transporter 3 gene (YSL3) 0 90% DQ366110 Ion transport 1 A. thaliana monooxigenase 1/oxidoreductase 2e-40 86% NM_117667 Cell signaling 1 A. thaliana alanine aminotransferase/alanine transaminase (ALAAT1) 9e-76 89% NM_101591 AA metabolism 1 A. thaliana PSBO2; oxygen evolving mRNA 0 93% NP_190651.1 Photosynthesis 1 A. thaliana putative/NADPþ isocitrate dehydrogenase (ICDH) 5e-124 94% NM_105265 Cell metabolism 1 A. thaliana mago nashi protein with unknown function (UNK1) 1e-143 91% At1g02140 Unknown 1 A. thaliana with ubiquitin-associated domain, unknown function (UNK2) 0 97% At4g24690 Unknown/Protein degradation 1 A. thaliana arginosuccinate synthase family/unknown function (UNK3) 1e-33 90% NP_194214.2 Unknown/AA metabolism 1 A. thaliana arginosuccinate synthetase/unknown function (UNK4) 2e-12 92% NP_001119047 Unknown/AA metabolism 1 A. thaliana Rab GTPase/unknown protein (UNK5) 6e-39 87% U89959.1 Unknown

involved in the thiamine biosynthesis and ThiJ-like proteins (TJLP) shown in several other studies (Paulose et al., 2010; Ahsan et al., share similarity with human DJ-1, a multiple functional protein 2008; Abercrombie et al., 2008). These findings suggest that implicated in oxidative stress (Xu et al., 2005). glutathione metabolism may be a major component in alleviating Four genes belonging to the glutathione-S-transferases (GSTs), Cr toxicity by regulating the cellular oxidative balance via GSH/ and glutathione synthesis were present in the subtracted cDNA ascorbate cycle (Schiavon et al., 2008). library. Evidence for the role of sulfur metabolism in Cr tolerance Involvement of signal transduction pathways in stress and accumulation in Brassica juncea is supported by Schiavon et al. responses caused by heavy metals in not well understood. A clone (2008). Glutathione is produced through the operation of two (RHA1) homologous to Arabidopsis RAB5 was a highly expressed successive enzymes: g-glutamylcysteine synthase (g-ECS) and Cr-responsive gene in our library. Little is known about the glutathione synthetase (GS). The differential expression of tran- function of RHA1 in plant response to abiotic stress but the gene scripts corresponding to both g-ECS and GS in our cDNA library is known to play a critical role in vacuolar trafficking in plant cells further implicates their involvement in metal tolerance and (Lee et al., 2004). Another Cr-induced cDNA clone, Cucurlin, detoxification. Increased production of GSH is suggested to provide encodes a curculin-like (mannose-binding) lectin family protein, protection against oxidative stress in various species of Thlaspi in which has been implicated in signal transduction related to para- response to Ni (Freeman et al., 2004) and Cd (Van de Mortel et al., dormancy release in root buds of leafy spurge, Euphorbia esula 2008). Two genes, GSTF6 and GSTU4, corresponding to the phi and (Horvath et al., 2005). Further, an alternative oxidase (AOX1A) tau subfamily, respectively, of glutathione-S-transferases (GSTs) present in our library has been implicated in reducing the specific to plants were present in our library. The upregulation of formation of ROS in various stresses in plants (Maxwell et al., GSTs in response to various toxic metals and metalloids has been 1999). Based upon this evidence, it may be implied that

Please cite this article in press as: Zulfiqar, A., et al., Identifying genes and gene networks involved in chromium metabolism and detoxification in Crambe abyssinica, Environmental Pollution (2011), doi:10.1016/j.envpol.2011.06.027 4 A. Zulfiqar et al. / Environmental Pollution xxx (2011) 1e6

reported to be associated with malate and citrate in shoots of Unknown Arabidopsis halleri (Sarret et al., 2002) and Thlaspi goesingense Photosynthesis (Krämer et al., 2000), respectively. Two membrane transporters encoding plasma membrane aquaporin 1b (PAQ1b) and Yellow Protein Degradation Stripe Like transporter 3 gene (YSL3) were also found to be upre- Transport gulated. Recently, an aquaporin (BjPIP1) from the heavy metal accumulator Indian mustard (B. juncea) was reported to have a role Signaling in plant drought and heavy metal stress response (Zhang et al., AA metabolism 2008). A cDNA clone with a strong homology to YSL3 family of genes in A. thaliana was also identified. The YSL family members are GSTs and Sulfur metabolism shown to be implicated in the translocation of Nicotianamine- Cell metabolism metal chelates and delivery of Fe in the seeds (Waters et al., 2006). There were five subtracted cDNA sequences that did not Stress/ Defense match any characterized proteins. Ongoing characterization of these unknown novel sequences seeks to elucidate their role in Cr 0 5 10 15 20 25 metabolism by plants. Number of upregulated genes 3.3. Confirmation of differential expression of subtracted Fig. 1. Cr-induced subtracted cDNAs encoding proteins involved in various functional categories. cDNA transcripts by semi-quantitative RT-PCR

RT-PCR analysis confirmed that most of the subtracted cDNA upregulation of AOX1A clone may be instrumental in reduction of clones showed induction of the corresponding mRNA transcripts ROS in Cr-induced oxidative stress. upon Cr exposure (Fig. 2). The quantification of mRNA expression Evidence for a correlation of metal tolerance and organic acid levels using ImageJ is shown in Supplementary Fig. S3. For most of content has been reported in various plants (Krotz et al., 1989). the cDNA clones, transcript level started to increase at 6 h and Upregulation of two cDNAs encoding malate dehydrogenase (MDH) reached the highest level at 24 h. RHA1, SHD, TIL1, UBA, POX1, and isocitrate dehydrogenase (ICDH) might suggest enhanced GSTU4, and UNK2 were induced more than 8-fold at 12 and 24 h. organic acid production for metal chelation. Zinc and nickel were Several genes corresponding to subtracted cDNAs such as CHB,

Fig. 2. Semi-quantitative RT-PCR analysis of the C. abyssinica transcripts corresponding to the subtracted cDNAs after 0, 6, 12 and 24 h of potassium chromate treatments. The details about the subtracted cDNA sequences identified by their serial numbers are given in Table 1. The number of optimized PCR cycles used for amplification for each cDNA clone is written on the right hand side of the panel. Actin2 gene, ACT2, was used as an internal control for equal loading of cDNA template of each clone.

Please cite this article in press as: Zulfiqar, A., et al., Identifying genes and gene networks involved in chromium metabolism and detoxification in Crambe abyssinica, Environmental Pollution (2011), doi:10.1016/j.envpol.2011.06.027 A. Zulfiqar et al. / Environmental Pollution xxx (2011) 1e6 5

TJPL1, HRP, Rafp1, ICDH, UNK1, and UNK4 showed more than 6-fold Artus, N.N., 2006. Arsenic and cadmium phytoextraction potential of crambe e induction in Cr-exposed crambe tissues as compared to controls compared with Indian mustard. Journal of Plant Nutrition 29, 667 679. Barceló, J., Poschenrieder, C., 1997. Chromium in plants. In: Canali, S., Tittarelli, F., (Fig. 2 and Supplementary Fig. S3). Transcripts encoding ERD15, Sequi, P. (Eds.), Chromium Environmental Issues. Franco Angeli, Milano, MDH, ACCOX1, FDH, YSL3, GSTF6, ALAAT1, MO1, ECS1, BG3, GS, pp. 101e129. 1997. CJAS1, UNK3, and UNK5 showed more than two-fold induction in Chanda, S.V., Parmar, N.G., 2003. Effects of chromium on hypocotyl elongation, wall components, and peroxidase activity of Phaseolus vulgaris seedlings. New response to Cr exposure. Transcripts corresponding to the cDNA Zealand Journal of Crop and Horticultural Sciences 31, 115. clones encoding SHD, MDH, PAQ1, POX1, and BG3 exhibited strong Chandra, P., Sinha, S., Rai, U.N., 1997. Bioremediation of Cr from water and soil by upregulation only at 24hr. The differential regulation of most of vascular aquatic plants. In: Kruger, E.L., Anderson, T.A., Coats, J.R. (Eds.), Phy- toremediation of Soil and Water Contaminants. ACS Symposium Series, vol. these subtracted cDNA strongly suggests a role in Cr metabolism 664. American Chemical Society, Washington, DC, pp. 274e282. and detoxification processes. Chaney, R.L., Malik, M., Li, Y.M., Brown, S.L., Brewer, E.P., Angle, J.S., Baker, A.J., 1997. Phytoremediation of soil metals. Current Opinion in Biotechnology 8, 279e284. 4. Conclusions Charron, J., Ouellet, F., Houde, M., Sarhan, F., 2008. The plant Apolipoprotein D ortholog protects Arabidopsis against oxidative stress. BMC Plant Biology 8, 86. Crambe, being a non-food high biomass crop, is an ideal Diatchenko, L., Lau, Y.F., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E.D., Siebert, P.D., 1996. candidate for phytoremediation of Cr and other toxic metals. In Suppression subtractive hybridization: a method for generating differentially addition, crambe can be readily genetically modified to further regulated or tissue-specific cDNA probes and libraries. Proceedings of the improve its tolerance to various toxic metals. The present study is National Academy of Sciences of the United States of America 93, 6025e6030. fi fi Doty, S.L., 2008. Enhancing phytoremediation through the use of transgenics and the rst transcriptomic analysis that identi es the genes/gene endophytes. New Phytologist 179, 318e333. networks differentially regulated in response to Cr stress a heavy European Union Strategic Research Agenda, 2005. European Union Strategic metal tolerant crop with phytoremediation potential. The results Research Agenda, Part II: Plant for the Future. Stakeholder proposal for a stra- obtained from this study clearly indicate that an intricate interplay tegic research agenda 2005 including Draft Action Plan 2010. Freeman, J.L., Persans, M.W., Nieman, K., Albrecht, C., Peer, W., Pickering, I.J., of various metabolic pathways may be involved in the determinant Salt, D.E., 2004. Increased glutathione biosynthesis plays a role in nickel in conferring tolerance to and hyperaccumulation of Cr. Stimulation tolerance in Thlaspi nickel hyperaccumulators. The Plant Cell 16, 2176e2191. of glutathione metabolism, amino acid synthesis, activation of Gardea-Torresdey, J.L., de la Rosa, G., Peralta-Videa, J.R., Montes, M., Cruz- Jimenez, G., Cano-Aguilera, I., 2005. Differential uptake and transport of triva- numerous stress or defense-related proteins is evidence for lent and hexavalent chromium by tumbleweed (Salsola kali). Archives of a significant metabolic response to counteract the toxicity of Cr. Environmental Contamination and Toxicology 48, 225e232. Further characterization of these differentially expressed genes will Horvath, D.P., Soto-Suárez, M., Chao, W.S., Jia, Y., Anderson, J.V., 2005. Transcriptome fi analysis of paradormancy release in root buds of leafy spurge (Euphorbia esula). enable us to develop strategies for ef cient phytoremediation of Cr Weed Science 53, 795e801. in non-food high biomass crops as well as to engineer food crops for Krämer, U., Pickering, I.J., Prince, R.C., Raskin, I., Salt, D.E., 2000. Subcellular locali- reduced Cr uptake in the edible parts. zation and speciation of nickel in hyperaccumulator and non-accumulator Thlaspi species. Plant Physiology 122, 1343e1354. Krotz, R.M., Evangelou, B.P., Wagner, G.J., 1989. Relationships between cadmium, Role of funding source zinc, Cd-peptide, and organic acid in tobacco suspension cells. Plant Physiology 91, 780e787. Lee, G., Sohn, E.J., Lee, M.H., Hwang, I., 2004. The Arabidopsis Rab5 homologs Rha1 The Higher Education Commission (HEC), Government of and Ara7 localize to the prevacuolar compartment. Plant and Cell Physiology 45, Pakistan, Islamabad, provided funding to carry out this work. 1211e1220. Sponsor did not participated in experimental design, in the Lindgren, P.B., 1997. The role of hrp genes during plant-bacterial interactions. Annual Reveiw of Phytopathology 35, 129e152. collection, analysis, interpretation of data, and in the writing of the Maxwell, D.P., Wang, Y., McIntosh, L., 1999. The alternative oxidase lowers mito- report. chondrial reactive oxygen production in plant cells. Proceedings of the National Academy of Sciences of the United States of America 96, 8271e8276. Milner, M., Kochian, L.V., 2008. Investigating heavy-metal hyperaccumulation using Acknowledgments Thlaspi caerulescens as a model system. Annals of Botany 102, 3e13. Pandey, V., Dixit, V., Shyam, R., 2005. Antioxidative responses in relation to growth Authors are grateful to Drs Gail Fleischaker and Firdaus Bareen of mustard (Brassica juncea cv. Pusa Jaikisan) plants exposed to hexavalent chromium. Chemosphere 61, 40e47. for critical reading and editing of the manuscript and their valuable Paulose, B., Kandasamy, S., Dhankher, O.P., 2010. Expression profiling of Crambe suggestions. Financial assistance via a grant (DD-2006-04/06HEC) abyssinica under arsenate stress identifies genes and gene networks involved in to OPD from the Higher Education Commission (HEC), Government arsenic metabolism and detoxification. BMC Plant Biology 10, 108. e of Pakistan, Islamabad, under a split Ph.D. program for to carry out Pilon-Smits, E., 2005. Phytoremediation. Annual Review of Plant Biology 56, 15 39. Sarret, G., Saumitou-Laprade, P., Bert, V., Proux, O., Hazemann, J.L., Traverse, A., this research work is highly acknowledged. Authors are also Marcus, M.A., Manceau, A., 2002. Forms of zinc accumulated in the hyper- thankful to Dr. Klaus Nüsslein (Department of Microbiology) for the accumulator Arabidopsis halleri. Plant Physiology 130, 1815e1826. use of his radiation lab. Schiavon, M., Pilon-Smits, E., Wirtz, M., Hell, R., Malagoli, M., 2008. Interactions between chromium and sulfur metabolism in Brassica juncea. Journal of Envi- ronmental Quality 37, 1536e1545. Appendix. Supplementary material United States Environmental Protection Agency, 2000. In Situ Treatment of Soil and Groundwater Contaminated with Chromium. EPA-625-R-00e005, Office of Research and Development, October, 2000. Supplementary material associated with this article can be United States Environmental Protection Agency, 2010. Chromium-6 in Drinking found, in the online version, at doi:10.1016/j.envpol.2011.06.027. Water. EPA 815-F-10e005, Office of Water, December, 2010. Van de Mortel, J.E., Schat, H., Moerland, P.D., Van Themaat, E.V.L., Van Der Ent, S., Blankestijn, H., Ghandilyan, A., Tsiatsiani, S., Aarts, M.G.M., 2008. References Expression differences for genes involved in lignin, glutathione and sulphate metabolism in response to cadmium in Arabidopsis thaliana and the related Abercrombie, J., Halfhill, M., Ranjan, P., Rao, M., Saxton, A., Yuan, J., Stewart, C.N., Zn/Cd-hyperaccumulator Thlaspi caerulescens. Plant, Cell and Environment 2008. Transcriptional responses of Arabidopsis thaliana plants to As (V) stress. 31, 301e324. BMC Plant Biology 8, 87. Venkatachalam, P., Jain, A., Sahi, S., Raghothama, K., 2009. Molecular cloning and Ahsan, N., Lee, D., Alam, I., Kim, P.J., Lee, J.J., Ahn, Y., Kwak, S., Lee, I., Bahk, J.D., characterization of phosphate (Pi) responsive genes in Gulf ryegrass (Lolium Kang, K.Y., Renaut, J., Komatsu, S., Lee, B., 2008. Comparative proteomic study of multiflorum L.): a Pi hyperaccumulator. Plant Molecular Biology 69, 1e21. 60 arsenic-induced differentially expressed proteins in rice roots reveals gluta- Wang, Y.P., Xu, X.X., Luo, P., 1999. Effects of EMS and Co on seed germination of thione plays a central role during As stress. Proteomics 8, 3561e3576. Crambe abyssinica and its agronomic characters of M1 generation. Bulletin of Anon, 1993. Crambe Production and Utilization. BioOptions, Newsletter of the Botanical Research 19, 64e67. Centre for Alternative Plant and Animal Products, University of Minnesota, pp. Waters, B.M., Chu, H., DiDonato, R.J., Roberts, L.A., Eisley, R.B., Lahner, B., Salt, D.E., 1e3. Walker, E.L., 2006. Mutations in Arabidopsis yellow stripe-like1 and yellow

Please cite this article in press as: Zulfiqar, A., et al., Identifying genes and gene networks involved in chromium metabolism and detoxification in Crambe abyssinica, Environmental Pollution (2011), doi:10.1016/j.envpol.2011.06.027 6 A. Zulfiqar et al. / Environmental Pollution xxx (2011) 1e6

stripe-like3 reveal their roles in metal ion homeostasis and loading of metal a transcriptional co-activator that protects against neuronal apoptosis. Human ions in seeds. Plant Physiology 141, 1446e1458. Molecular Genetics 14, 1231e1241. Watt, D.A., 2003. Aluminium responsive genes in sugarcane: identification and Zayed, A., Lytle, C.M., Qian, J., Terry, N., 1998. Chromium accumulation, translocation analysis of expression under oxidative stress. Journal of Experimental Botany and chemical speciation in vegetable crops. Planta 206, 293e299. 54, 1163e1174. Zhang, Y., Wang, Z., Chai, T., Wen, Z., Zhang, H., 2008. Indian Mustard aquaporin Xu, J., Zhong, N., Wang, H., Elias, J.E., Kim, C.Y., Woldman, I., Pifl, C., Gygi, S.P., improves drought and heavy-metal resistance in Tobacco. Molecular Biotech- Geula, C., Yankner, B.A., 2005. The Parkinson’s disease-associated DJ-1 protein is nology 40, 280e292.

Please cite this article in press as: Zulfiqar, A., et al., Identifying genes and gene networks involved in chromium metabolism and detoxification in Crambe abyssinica, Environmental Pollution (2011), doi:10.1016/j.envpol.2011.06.027