DOCSLIB.ORG

Habitat-Specific Type I Polyketide Synthases in Soils and Street

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Habitat-Specific Type I Polyketide Synthases in Soils and Street J Ind Microbiol Biotechnol (2014) 41:41–48 DOI 10.1007/s10295-013-1364-5 BIOENERGY/BIOFUELS/BIOCHEMICALS Characterization of the sugar alcohol-producing yeast Pichia anomala Guoqiang Zhang · Yuping Lin · Peng He · Lin Li · Qinhong Wang · Yanhe Ma Downloaded from https://academic.oup.com/jimb/article/41/1/75/5995204 by guest on 23 September 2021 Received: 12 July 2013 / Accepted: 5 October 2013 / Published online: 30 October 2013 © Society for Industrial Microbiology and Biotechnology 2013 Abstract Sugar alcohols have been widely applied in production from glucose. Our study laid the foundation for the field of food and medicine for their unique properties. improving the production of sugar alcohols by metabolic Compared to chemical production, microbial production of and fermentation engineering strategies. sugar alcohol has become attractive for its environmental and sustainable pattern. In this study, a potential yeast iso- Keywords Pichia anomala · Sugar alcohol · lated from soil of Beijing suburbs was identified as Pichia Bioconversion · d-Arabitol dehydrogenase anomala TIB-x229, and its key enzyme of d-arabitol dehy- drogenase for microbial production of sugar alcohols was Abbreviations functionally characterized. This yeast could simultaneously A600 Absorbance at 600 nm produce d-arabitol, xylitol, and/or ribitol from a different A340 Absorbance at 340 nm ratio of sugar substrates at a high efficiency by biocon- ArDH d-Arabitol dehydrogenase version, and no glucose repression happened when mixed CGMCC China General Microorganism Culture sugars of xylose and glucose were used as the substrates Center during the bioconversion. This yeast could also efficiently HPLC High-performance liquid chromatography convert complicated feedstock such as xylose mother liq- IPTG Isopropyl β-d-1-thiogalactopyranoside uor to d-arabitol, xylitol, and ribitol with 55 % yields. To KDa Kilodalton elucidate the conversion relationship of the sugar alcohols, NAD+ Nicotinamide adenine dinucleotide especially d-arabitol and xylitol, the key d-arabitol dehy- SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel drogenase gene from P. anomala was cloned, expressed electrophoresis and purified for further in vitro characterization. The results QPS Qualified presumption of safety showed that this d-arabitol dehydrogenase could catalyze arabitol to xylulose further, which is significant for xylitol Introduction * G. Zhang · Y. Lin · L. Li · Q. Wang ( ) · Y. Ma Sugar alcohols, also known as polyols, are ingredients Key Laboratory of Systems Microbial Biotechnology, Tianjin Institute of Industrial Biotechnology, Chinese Academy used as sweeteners and bulking agents [1]. As a sugar sub- of Sciences, 32 XiQiDao, Tianjin Airport Economic Area, stitute, they provide fewer calories than regular sugar and Tianjin 300308, China require little or no insulin to be metabolized. This makes e-mail: [email protected] them popular among individuals with diabetes [23]. As P. He important five-carbon polyols, d-arabitol and xylitol have Center for Microbial Biotechnology, Institute of Microbiology, attracted much attention for their wide application as food Chinese Academy of Sciences, Beijing 100080, China sweeteners, dental caries reducer, and a sugar substitute for diabetics [7]. In addition, d-arabitol and xylitol have also L. Li Key Laboratory of Industrial Biotechnology, Ministry been used as raw materials for the chemical synthesis of of Education, Jangnan University, Wuxi 214122, China enantiopure compounds, immunosuppressive glycolipids, 1 3 42 J Ind Microbiol Biotechnol (2014) 41:41–48 herbicides, as well as anti-pathogenic disease medicines In this study, we reported that a recently isolated P. [29]. Hence, d-arabitol and xylitol had been selected as one anomala can produce important sugar alcohols as ribitol, of the top 12 types of value-added building-block chemi- d-arabitol, and/or xylitol from different substrates. In order cals from biorefineries [31]. to characterize the metabolic pathway of the production of At present, sugar alcohols are still primarily produced sugar alcohols, d-arabitol dehydrogenase (ArDH) gene in by chemical reduction from monosaccharide. However, this P. anomala was cloned and expressed in Escherichia coli method has many drawbacks such as the requirements of firstly. Its enzymatic activity and in vitro reactions have highly purified substrates, high pressure and temperature, also been investigated with the purified recombinant pro- and expensive chemical catalyst of Raney-Nickel (a fine- tein to confirm its properties. grained solid composed mostly of nickel derived from a nickel-aluminium alloy, and often used for the reduction of sugar to produce sugar alcohol) in the process. At the same Materials and methods time, extensive separation steps have to be followed in Downloaded from https://academic.oup.com/jimb/article/41/1/75/5995204 by guest on 23 September 2021 order to remove the by-products, which are mainly derived Chemicals from the chemical reaction. However, sugar alcohol production using microorgan- Yeast extract and tryptone were procured from OXOID isms is eco-friendly and more cost-effective, as the process (Hampshire, UK). Agar powder was purchased from Solar- does not require pure sugar substrate and different bio- bio (Beijing, China). Glucose, xylose, d-arabitol, xylitol, mass materials can be used as substrates. In an attempt to d-xylulose and enzyme cofactors such as NADH and NAD+ increase product yields, bioconversion processes based on were purchased from Sigma (St. Louis, MO, USA). The other whole-cell enzyme biocatalysts had been investigated [1, chemicals were purchased from Sinopharm (Beijing, China). 9, 10, 13, 33]. Bioconversion, known as biotransformation, refers to the utilization of live microbial cells to carry out Organisms and growth conditions some multiple-enzyme-catalyzed reactions that are more costly or not feasible chemically. Compared to the tradi- The P. anomala TIB-x229 (CGMCC No. 5482) and Escher- tional production by fermentation, it is not necessary to ichia coli strains BL21 (DE3) used in this study were non- keep sterile strictly and add the nitrogen resource for the pathogenic strains. The plasmid pET30a( ) (Novagen, + bioconversion process, and this will reduce the cost for San Diego, CA, USA) was used for expressing protein in industrial applications. In addition, the products from bio- Escherichia coli BL21(DE3). conversion are usually much simpler for down-stream sepa- The yeast strain was maintained on YPD agar plates ration [34]. Hence, the production of bio-based chemicals with yeast extract 10 g/l, tryptone 20 g/l, agar 15 g/l, and via bioconversion has attracted much attention for its prac- glucose 20 g/l, incubated at 30 °C. The inoculums were tical application and become a promising technology [4]. prepared in YPD medium and the composition was 10 g/l The performance of strain plays an important role in the yeast extract, 20 g/l tryptone, and 20 g/l glucose. E. coli bioconversion process. Screening or engineering the suit- strain was cultivated in LB medium with yeast extract 5 g/l, able strains will greatly contribute to the success of biocon- tryptone 10 g/l, and NaCl 10 g/l. version for the production of bio-based chemicals. When exposed to osmotic stress, some microorganisms accumu- Identification and phylogenetic analysis of isolates late compatible solutes such as d-arabitol, glycerol, xylitol, and mannitol to balance the osmotic pressure across the cell The taxonomical studies of isolate was conducted by 18S membrane [12]. It is well known that many osmophilic yeast rDNA homologous analysis. The genomic DNA of P. species, such as Zygosaccharomyces [26], Debaryomyces anomala was extracted by Biomega Yeast gDNA Kit (Bei- [18], Metschnikowia [19], Candida [2], and Hansenula jing, China) following the manufacturer’s instruction. The [30] can produce different sugar alcohols. Of these species, 18S rDNA was amplified with universal primers 18s-FP P. anomala, belonging to the non-Saccharomyces yeasts, and 18s-RP (Table 1). The cloned 18S rDNA was aligned exhibits wide metabolic and physiological diversity for its in the GenBank database. capacity to grow under the environment of low pH, high osmotic pressure, and low oxygen tension [22]. In fact, P. Bioconversion of different sugar substrates by Pichia anomala is one of several yeast species that have been given anomala TIB-x229 QPS status, and it had been employed for biocontrol pur- poses in food and feed [27]. Therefore, it has widespread A single colony of P. anomala TIB-x229 was inoculated biotechnological significance ranging from therapeutic pro- into 20 ml of YPD medium in a 250-ml shake flask and tein production, biocontrol agents, and biofuels production. cultured at 30 °C/200 rpm. After incubation for 12 h, the 1 3 J Ind Microbiol Biotechnol (2014) 41:41–48 43 Table 1 Oligonucleotide primers in this study was then eluted with 20 ml of eluting buffer. Fractions were Primers Sequences (5′–3′) combined and passed through an ultra-filtration tube MWCO 3kD (Millipore, Billerica, MA, USA) for desalting. 18s-FP CCAACCTGGTTGATCCTGCCAGTA 18s-RP CCTTGTTACGACTTCACCTTCCTCT Enzyme assay and in vitro reaction ardh-1 aattcCATATGATGGAWTCCGCATAC ardh-2 aattCTCGAGCCARCAYTCGTAACCYCC The activity of recombinant enzyme ArDH was determined spectrophotometrically by monitoring the change of A340 whole cells were harvested by centrifugation at 3,000 g reflecting oxidation or reduction of NAD(H) or NADP(H) × for 3 min. After washing twice with distilled water, whole [28]. The oxidative reaction mixture for ArDH consisted cells were suspended in isometric substrate solution for fol- of 50 mM Tris–HCl (pH 7.5), 2 mM NAD+ or NADP+, lowing bioconversion. The condition of bioconversion was 50 mM d-arabitol/xylitol, and purified enzyme. For the 30 °C/250 rpm in a 250-ml shake flask. reductive reaction, the mixture contained 50 mM Tris–HCl Downloaded from https://academic.oup.com/jimb/article/41/1/75/5995204 by guest on 23 September 2021 (pH 7.5), 2 mM NADH or NADPH, 50 mM d-xylulose, Metabolite analysis and purified enzyme. All reactions were started by the addi- tion of enzyme to a final volume of 0.2 ml at 30 °C.
Load more

Recommended publications
  • GRAS Notice 789 for Erythritol
    GRAS Notice (GRN) No. 789 https://www.fda.gov/food/generally-recognized-safe-gras/gras-notice-inventory. Toi• Strategies ~~~~G~~[)) JUN 7 20'8 Innovative solutions Sound science OFFICE OF FOOD ADDITIVE SAFE1Y June 5, 2018 Dr. Dennis Keefe Director, Division of Biotechnology and GRAS Notice Review Office of Food Additive Safety (HFS-200) Center for Food Safety and Applied Nutrition Food and Drug Administration 5100 Paint Branch Parkway College Park, MD 20740-3835 Subject: GRAS Notification - Erythritol Dear Dr. Keefe: On behalf of Cargill, Incorporated, ToxStrategies, Inc. (its agent) is submitting, for FDA review, a copy of the GRAS notification as required. The enclosed document provides notice of a claim that the food ingredient, erythritol, described in the enclosed notification is exempt from the premarket approval requirement of the Federal Food, Drug, and Cosmetic Act because it has been determined to be generally recognized as safe (GRAS), based on scientific procedures, for addition to food. If you have any questions or require additional information, please do not hesitate to contact me at 630-352-0303, or [email protected]. Sincerely, (b) (6) Donald F. Schmitt, M.P.H. Senior Managing Scientist ToxStrategies, Inc., 931 W. 75th St. , Suite 137, PMB 263, Naperville, IL 60565 1 Office (630) 352-0303 • www.toxstrategies.com GRAS Determination of Erythritol for Use in Human Food JUNES,2018 Innovative solutions s ,..,.,',--.r-.r--.r--. OFFICE OF FOOD ADDITIVE SAFE1Y GRAS Determination of Erythritol for Use in Human Food SUBMITTED BY: Cargill, Incorporated 15407 McGinty Road West Wayzata, MN 55391 SUBMITTED TO: U.S. Food and Drug Administration Center for Food Safety and Applied Nutrition Office of Food Additive Safety HFS-200 5100 Paint Branch Parkway College Park MD 20740-3835 CONTACT FOR TECHNICAL OR OTIIER INFORMATION Donald F.
    [Show full text]
  • Analysis of Sugars and Sugar Alcohols in Energy Drink by Prominence-I with Differential Refreactive Index Detector
    LAAN-A-LC-E258 Application High Performance Liquid Chromatography News Analysis of Sugars and Sugar Alcohols in Energy Drink by Prominence-i with Differential Refractive Index Detector No.L481 Sugars and sugar alcohols display almost no ultraviolet absorption, and are therefore typically detected using a differential refractive index detector or evaporative light uRI scattering detector. By using a ligand exchange column for 80 ■ Peaks sugar analysis, it is possible to distinguish among the different 1. maltose 70 2. glucose isomers based on the position of the hydroxyl group in the 1 4 3. fructose chair conformation of glucose and fructose for example. In 4. erythritol 60 5 other words, the hydroxyl group of the sugar and the metal 5. mannitol ion of the stationary phase form a complex, making it 2 3 6. sorbitol possible to achieve separation due to the difference in the 50 6 strength of the complex formation. Also, maintaining a 40 column temperature of 80 °C suppresses sugar anomer separation and peak dispersion, thereby achieving good 30 separation of adjacent peaks. The new Prominence-i integrated high-performance liquid 20 chromatograph can be connected to the RID-20A differential refractive index detector. The column oven, which can 10 accommodate a 30 cm column and maintain temperature 0 control up to 85 °C, therefore supports applications that require a long column. In Application News No. 467, we introduced an example of 0 5 10 15 20 25 min analysis of sugars in juice, in which the Prominence-i was connected to a differential refractive index detector. Here, we introduce an example of simultaneous analysis of sugars and Fig.
    [Show full text]
  • Low Molecular Weight Organic Composition of Ethanol Stillage from Sugarcane Molasses, Citrus Waste, and Sweet Whey Michael K
    Chemical and Biological Engineering Publications Chemical and Biological Engineering 2-1994 Low Molecular Weight Organic Composition of Ethanol Stillage from Sugarcane Molasses, Citrus Waste, and Sweet Whey Michael K. Dowd Iowa State University Steven L. Johansen Iowa State University Laura Cantarella Iowa State University See next page for additional authors Follow this and additional works at: http://lib.dr.iastate.edu/cbe_pubs Part of the Biochemical and Biomolecular Engineering Commons, and the Biological Engineering Commons The ompc lete bibliographic information for this item can be found at http://lib.dr.iastate.edu/ cbe_pubs/12. For information on how to cite this item, please visit http://lib.dr.iastate.edu/ howtocite.html. This Article is brought to you for free and open access by the Chemical and Biological Engineering at Iowa State University Digital Repository. It has been accepted for inclusion in Chemical and Biological Engineering Publications by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Low Molecular Weight Organic Composition of Ethanol Stillage from Sugarcane Molasses, Citrus Waste, and Sweet Whey Abstract Filtered stillage from the distillation of ethanol made by yeast fermentation of sugarcane molasses, citrus waste, and sweet whey was analyzed by gas chromatography/mass spectroscopy and by high-performance liquid chromatography. Nearly all of the major peaks representing low molecular weight organic components were identified. The am jor components in cane stillage were, in decreasing order of concentration, lactic acid, glycerol, ethanol, and acetic acid. In citrus stillage they were lactic acid, glycerol, myo-inositol, acetic acid, chiro-inositol, and proline.
    [Show full text]
  • New Yeasts Capable of Assimilating Methanol*
    J. Gen. Appl. Microbiol., 18, 295-305 (1972) NEW YEASTS CAPABLE OF ASSIMILATING METHANOL* TOSHIKAZU OKI, KAGEAKI KOUNO, ATSUO KITAI, ANDASAICHIRO OZAKI Central Research Laboratories of Sanraku- Ocean Co., Ltd., Fujisawa, Japan (Received May 10, 1972) Twenty strains of methanol strongly assimilating yeasts were isolated from rotten tomato and a flower of azalea through investigations on the single- cell protein production and on the microbial utilization of Cl compound. Taxonomic studies indicated that these yeasts were limited to certain species of Candida and Torulopsis, including two new species; C. methanolica OKi et KouNo sp. nov. and T. methanolovescens OKi et KouNo sp. nov. One hundred and ninety-one strains of yeasts obtained from type culture collections did not exhibit methanol assimilability at all. The possibility of producing a single-cell protein from methanol by micro- organisms was suggested by the extensive studies concerning methane- or methanol-assimilating bacteria, Pseudomonas sp. PRL-W4 (1), Pseudomonas methanica (2, 3, 4), Methanomonas methanooxidans (5, 6), Pseudomonas AM 1(7 ), Pseudomonas sp. M27 (8), and Vibrio extorquens (9). Moreover, it is of considerable interest that OGATA et al. first reported the assimila- tion of methanol by yeast, Kloeckera sp. No. 2201 (10, 11, 12). More recently, ASTHANA et al. (13) isolated one species of yeast capable of uti- lizing methanol as a primary carbon source and identified it tentatively as Torulopsis glabrata. However, its taxonomical characteristics have not been reported yet. In the course of investigations on yeast production and microbial utiliza- tion of Ci compounds, two new species of yeasts assimilating methanol as a carbon and energy source were isolated from natural sources.
    [Show full text]
  • United States Patent Office
    United States Patentaw Office ... ber of ether groupings on each molecule. These mix tures, however, if they analyze as containing an average 2,978,421. number of ether groups per molecule greater than one, NITRILE COPOLYMERS AND METHOD OF are capable of producing the insoluble nitrile polymers PREPARING SAME of this invention. Since the efficiency of the polyether cross-linking agent increases with the number of poten John A. Holloway, Cleveland, Ohio, assignor to The tially polymerizable groups on the molecule, it is much B. F. Goodrich Company, New York, N.Y., a corpo preferred to utilize polyethers containing an average of ration of New York - two or more alkenyl ether groupings per molecule. The No Drawing. Filed June 9, 1958, Ser. No. 740,566. 10 polyvinyl polyethers of the polyhydric alcohols within the above broad class are produced by reacting acetylene 9 Claims. (C. 260-17.4) with the polyhydric alcohol (or an alcoholate thereof) in a Reppe-type vinylation synthesis. The polycrotyl ethers of the polyhydric alcohols are also useful although they This invention relates to cross-linked alpha-beta ole 15 do not contain a terminal CHCC group. - finically unsaturated nitrile polymers and more particu Illustrative polyhydric alcohols of the above-described larly pertains to copolymers of alpha-beta olefinically class that may be utilized in the preparation of the poly. unsaturated nitriles and polyalkenyl polyethers of poly alkenyl polyether, cross-linking agent include the butane hydric alcohols and methods for their preparation. triols such as 1,2,3-butane triol, 2,3,4-trihydroxybutyric An object of this invention is the provision of insoluble, 20 acid, the aldotetroses such as erythrose and threose, keto cross-linked polynitriles which are capable of thickening tetroses such as erythrulose; the aldopentoses such as certain non-aqueous polar solvents.
    [Show full text]
  • LIQUID-VAPOR EQUILIBRIUM THERMODYNAMICS of the FUSEL OIL: a CASE STUDY Jéssyka Jennifer Miranda Corrêa¹, Edilailsa Januário
    LIQUID-VAPOR EQUILIBRIUM THERMODYNAMICS OF THE FUSEL OIL: A CASE STUDY Jéssyka Jennifer Miranda Corrêa¹, Edilailsa Januário de Melo², José Izaquiel Santos da Silva³ ¹Graduating in Chemical Engineering from the Federal University of the Jequitinhonha and Mucuri Valleys, Diamantina - MG, Brazil. ²PhD student in Chemical Engineering, College of Chemical Engineering - State University of Campinas - SP, Brazill. ³Professor at the Federal University of the Jequitinhonha and Mucuri Valleys, Diamantina - MG, Brazil. E-mail for contact: [email protected] Recebido em: 06/04/2019 – Aprovado em: 10/06/2019 – Publicado em: 30/06/2019 DOI: 10.18677/EnciBio_2019A183 ABSTRACT Fusel oil is a by-product of the process of recovering hydrated ethanol, consisting of a mixture of superior alcohols, ethanol, water, among other components. Its commercial interest is mainly due to the presence of isoamyl alcohol, one of the raw materials used in the synthesis of esters, which compounds are relevant for the chemical industry. The recovery of this superior alcohol involves unit operations based on phase equilibrium, which for multicomponent systems can be studied in software that simulates the operation of equipment, in order to present predictions of interactions between its components, reducing errors, time and costs of design. In the industrial, academic and scientific fields, there are numerous challenges regarding the design of separation processes and the monitoring of mixing effects in typical operations, and the Aspen Plus process simulation and optimization platform excels in solving these issues. The current study aims to predict the Liquid-Vapor Equilibrium of the fusel oil, which was considered as a mixture of five components, from the behavioral analysis of each of the binaries that compose it.
    [Show full text]
  • Green Synthesis of 1,5‑Dideoxy‑1,5‑Imino‑Ribitol and 1 ,5
    www.nature.com/scientificreports OPEN Green synthesis of 1,5‑dideoxy‑1,5‑imino‑ribitol and 1,5‑ dideox y‑1 ,5‑ imino‑ dl ‑a rabinitol from natural d‑sugars 2− over Au/Al2O3 and ­SO4 /Al2O3 catalysts Hongjian Gao & Ao Fan* A green synthetic route for the synthesis of some potential enzyme active hydroxypiperidine iminosugars including 1,5‑dideoxy‑1,5‑imino‑ribitol and 1,5‑dideoxy‑1,5‑imino‑dl‑arabinitol, starting from commercially available d‑ribose and d‑lyxose was tested out. Heterogeneous catalysts including 2− Au/Al2O3, SO4 /Al2O3 as well as environmentally friendly reagents were employed into several critical reaction of the route. The synthetic route resulted in good overall yields of 1,5‑dideoxy‑1,5‑imino‑ ribitol of 54%, 1,5‑dideoxy‑1,5‑imino‑d‑arabinitol of 48% and 1,5‑dideoxy‑1,5‑imino‑l‑arabinitol of 46%. The Au/Al2O3 catalyst can be easily recovered from the reaction mixture and reused with no loss of activity. Iminosugars are analogues of carbohydrates, chemically named as polyhydroxylated secondary and tertiary amines and found to be widespread in plants and microorganisms. Tanks to their structural similarity to sugar molecules and excellent metabolic stability, iminosugars are endowed with a high pharmacological potential for a wide range of diseases such as viral infections, tumor metastasis, AIDS, diabetes and lysosomal storage disorders1–11. Iminosugars are generally classifed into fve structural classes: pyrrolidines, piperidines, indolizidines, pyrrolizidines and nortropanes12. Hydroxypiperidines are structurally six-membered iminosugars. Some of the hydroxypiperidines such as 1,5-dideoxy-1,5-iminohexitol derivatives have now been commercialized as drugs to treat type II diabetes mellitus, type I Gaucher disease, Niemann-Pick disease type C (NP-C) and Fabry disease13–18.
    [Show full text]
  • IPOLYHYDRIC ALCOHOLS from WOOD July 1954
    IPOLYHYDRIC ALCOHOLS FROM WOOD July 1954 DEC 221954 No. 1984 UNITED STATES DEPARTMENT OF AGRICULTURE --,LFOREST. SERVICE 40REST PRODUCTS LABORATORY÷Q-.---,Y) Madison 5,Wisconsin In Cooperation with the University of Wisconsin 1 POLYHYDRIC ALCOHOLS FROM WOOD-2 2— By J. A. HALL, Director Forest Products Laboratory, 3 Forest Service U. S. Department of Agriculture Wood-sugar solutions produced in the laboratory-scale pilot plant at the U. S. Forest Products Laboratory have been proven to be satis- factory for the production of industrial alcohol, feeding yeast, and wood 4 molasses for stock feed (14, 15, 16, P 17). ± As a continuation of the pro- gram of the Laboratory for developing chemical utilization processes for the wood residues resulting from normal logging operations, and lumber, veneer, and the other forest products manufacture, investiga- tions are in progress to convert wood sugar into merchantable products. Because of the versatility and greatly increased demand for polytlydric alcohols, a study of the production of these materials has been chosen. The alkyd resin industry in the United States has increased tenfold in the past few years and no evidence of decline has been noted. Recently sorbitol has been made available commercially by the catalytic hydro- genation of corn sugar (2). The annual capacity now is 75 million pounds. Sorbitol is widely used as a humectant and conditioner in tobacco, cello- phane, and other products (3). However, one of its fast growing uses is for alkyd resins, where it may replace up to 50 percent glycerine and 25 percent pentaerythritol. This is fortunate since the production of glycerine in the United States as a byproduct of the soap manufacturing 1Presented before the Food and Agriculture Organization of the United Nations, Expert Panel on the Chemistry of Wood, meeting in Stockholm, Sweden, July 27-28, 1953.
    [Show full text]
  • Application of Chiral Sulfoxides in Asymmetric Synthesis
    MOJ Bioorganic & Organic Chemistry Review Article Open Access Application of chiral sulfoxides in asymmetric synthesis Abstract Volume 2 Issue 2 - 2018 Chiral sulfoxides are used as a toolbox for the synthesis of enantiomeric/diastereomeric compounds, which are used as precursors for the pharmaceutically/chemically Ganapathy Subramanian Sankaran,1 important molecules. The current review focuses on applying these chiral sulfoxides Srinivasan Arumugan,2 Sivaraman towards the synthesis of the compounds having stereogenic center. In general, the 3 stereogenic center induced by the sulfoxide is able to direct the stereochemistry of Balasubramaniam 1University of Massachusetts Medical School, USA further transformation necessary to complete the total synthesis of bioactive molecules. 2Department of Science and Humanity (Chemistry), Karunya The nature of the reactive conformation of the sulfoxide is strongly dependent on the Institute of Technology and Sciences, India nature of the substituents at C-α and/or C-β. 3Indian Institute of Technology Madras, Chennai, India Correspondence: Sivaraman Balasubramaniam, Senior Research Scientist, Indian Institute of Technology Madras, Chennai, India, Tel +9177 1880 5113, Email [email protected] Received: March 07, 2018 | Published: March 29, 2018 Introduction occurred in a further oxidation step of one of the sulfinyl enantiomer to sulfone.13 The titanium-binaphthol complex catalyzes not only the Over the last three decades, the sulfinyl group has received asymmetric oxidation but also the kinetic
    [Show full text]
  • Sugar Alcohols a Sugar Alcohol Is a Kind of Alcohol Prepared from Sugars
    Sweeteners, Good, Bad, or Something even Worse. (Part 8) These are Low calorie sweeteners - not non-calorie sweeteners Sugar Alcohols A sugar alcohol is a kind of alcohol prepared from sugars. These organic compounds are a class of polyols, also called polyhydric alcohol, polyalcohol, or glycitol. They are white, water-soluble solids that occur naturally and are used widely in the food industry as thickeners and sweeteners. In commercial foodstuffs, sugar alcohols are commonly used in place of table sugar (sucrose), often in combination with high intensity artificial sweeteners to counter the low sweetness of the sugar alcohols. Unlike sugars, sugar alcohols do not contribute to the formation of tooth cavities. Common Sugar Alcohols Arabitol, Erythritol, Ethylene glycol, Fucitol, Galactitol, Glycerol, Hydrogenated Starch – Hydrolysate (HSH), Iditol, Inositol, Isomalt, Lactitol, Maltitol, Maltotetraitol, Maltotriitol, Mannitol, Methanol, Polyglycitol, Polydextrose, Ribitol, Sorbitol, Threitol, Volemitol, Xylitol, Of these, xylitol is perhaps the most popular due to its similarity to sucrose in visual appearance and sweetness. Sugar alcohols do not contribute to tooth decay. However, consumption of sugar alcohols does affect blood sugar levels, although less than that of "regular" sugar (sucrose). Sugar alcohols may also cause bloating and diarrhea when consumed in excessive amounts. Erythritol Also labeled as: Sugar alcohol Zerose ZSweet Erythritol is a sugar alcohol (or polyol) that has been approved for use as a food additive in the United States and throughout much of the world. It was discovered in 1848 by British chemist John Stenhouse. It occurs naturally in some fruits and fermented foods. At the industrial level, it is produced from glucose by fermentation with a yeast, Moniliella pollinis.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2006/0165623 A1 Workman Et Al
    US 2006O165623A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2006/0165623 A1 Workman et al. (43) Pub. Date: Jul. 27, 2006 (54) NATURAL IDEODORANT COMPOSITION (57) ABSTRACT (75) Inventors: Tanya Workman, Mansonville (CA); Svetlana Ratnikova, Toronto (CA) The present invention relates to a natural deodorant system and a natural system for topical and systemic delivery of Correspondence Address: active ingredients, both systems being primarily free of Louis C. Paul, Esq. preferably substantially free of more preferably essentially CTSW free of, and most preferably completely free of ethoxylates Suite 2400 or other petrochemical derivatives, and comprising: (a) at least one of (1) glycerine (preferably of plant origin), (2) a 420 Lexington Avenue polyol selected from the group consisting of galactitol, New York, NY 10170 (US) erythritol, inositol, ribitol, dithioerythritol, dithiothreitol, (3) a Sugar alcohol, selected from the group consisting of (73) Assignee: Terra Firma Natuals, Inc. mannitol, Sorbitol. Xylitol and maltitol, (4) a hydrogenated starch hydrosylates of at least one of berries, apples or (21) Appl. No.: 11/042,569 plums, and (5) mixtures thereof; (b) water or a lower monohydric alcohol, selected from the group of methanol, (22) Filed: Jan. 24, 2005 ethanol, propanol and isoproponal, or mixtures thereof, present at a combined concentration of at least 20%; (c) one Publication Classification or more carrageenans (preferably of plant origin) or algi nates, or mixtures thereof, present in combined concentra (51) Int. C. tions of less than about 2%; and (d) optionally, one or more A6 IK 8/73 (2006.01) thickeners or gums selected from the group consisting of tara, guar, Xanthan, Arabic, tragacanth, agar, locust bean (52) U.S.
    [Show full text]
  • Sugar Alcohols—Their Role in the Modern World of Sweeteners: a Review
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Springer - Publisher Connector Eur Food Res Technol (2015) 241:1–14 DOI 10.1007/s00217-015-2437-7 REVIEW PAPER Sugar alcohols—their role in the modern world of sweeteners: a review Małgorzata Grembecka Received: 31 August 2014 / Revised: 16 December 2014 / Accepted: 13 February 2015 / Published online: 28 February 2015 © The Author(s) 2015. This article is published with open access at Springerlink.com Abstract Epidemic obesity and diabetes encouraged the observed. It was mainly due to the developments in bio- changes in population lifestyle and consumers’ food prod- logical studies, the change of a population lifestyle and the ucts awareness. Food industry has responded people’s increase in the consumer awareness concerning food prod- demand by producing a number of energy-reduced prod- ucts. The health quality of food depends mainly on nutri- ucts with sugar alcohols as sweeteners. These compounds ents, but also on foreign substances such as food additives. are usually produced by a catalytic hydrogenation of carbo- The presence of foreign substances in the food can be justi- hydrates, but they can be also found in nature in fruits, veg- fied, allowed or tolerated only when they are harmless to etables or mushrooms as well as in human organism. Due our health. Epidemic obesity and diabetes encouraged the to their properties, sugar alcohols are widely used in food, growth of the artificial sweetener industry. There are more beverage, confectionery and pharmaceutical industries and more people who are trying to lose weight or keeping throughout the world.
    [Show full text]