J Ind Microbiol Biotechnol (2014) 41:41–48 DOI 10.1007/s10295-013-1364-5 BIOENERGY/BIOFUELS/BIOCHEMICALS Characterization of the sugar alcohol-producing yeast Pichia anomala Guoqiang Zhang · Yuping Lin · Peng He · Lin Li · Qinhong Wang · Yanhe Ma Downloaded from https://academic.oup.com/jimb/article/41/1/75/5995204 by guest on 23 September 2021 Received: 12 July 2013 / Accepted: 5 October 2013 / Published online: 30 October 2013 © Society for Industrial Microbiology and Biotechnology 2013 Abstract Sugar alcohols have been widely applied in production from glucose. Our study laid the foundation for the field of food and medicine for their unique properties. improving the production of sugar alcohols by metabolic Compared to chemical production, microbial production of and fermentation engineering strategies. sugar alcohol has become attractive for its environmental and sustainable pattern. In this study, a potential yeast iso- Keywords Pichia anomala · Sugar alcohol · lated from soil of Beijing suburbs was identified as Pichia Bioconversion · d-Arabitol dehydrogenase anomala TIB-x229, and its key enzyme of d-arabitol dehy- drogenase for microbial production of sugar alcohols was Abbreviations functionally characterized. This yeast could simultaneously A600 Absorbance at 600 nm produce d-arabitol, xylitol, and/or ribitol from a different A340 Absorbance at 340 nm ratio of sugar substrates at a high efficiency by biocon- ArDH d-Arabitol dehydrogenase version, and no glucose repression happened when mixed CGMCC China General Microorganism Culture sugars of xylose and glucose were used as the substrates Center during the bioconversion. This yeast could also efficiently HPLC High-performance liquid chromatography convert complicated feedstock such as xylose mother liq- IPTG Isopropyl β-d-1-thiogalactopyranoside uor to d-arabitol, xylitol, and ribitol with 55 % yields. To KDa Kilodalton elucidate the conversion relationship of the sugar alcohols, NAD+ Nicotinamide adenine dinucleotide especially d-arabitol and xylitol, the key d-arabitol dehy- SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel drogenase gene from P. anomala was cloned, expressed electrophoresis and purified for further in vitro characterization. The results QPS Qualified presumption of safety showed that this d-arabitol dehydrogenase could catalyze arabitol to xylulose further, which is significant for xylitol Introduction * G. Zhang · Y. Lin · L. Li · Q. Wang ( ) · Y. Ma Sugar alcohols, also known as polyols, are ingredients Key Laboratory of Systems Microbial Biotechnology, Tianjin Institute of Industrial Biotechnology, Chinese Academy used as sweeteners and bulking agents [1]. As a sugar sub- of Sciences, 32 XiQiDao, Tianjin Airport Economic Area, stitute, they provide fewer calories than regular sugar and Tianjin 300308, China require little or no insulin to be metabolized. This makes e-mail: [email protected] them popular among individuals with diabetes [23]. As P. He important five-carbon polyols, d-arabitol and xylitol have Center for Microbial Biotechnology, Institute of Microbiology, attracted much attention for their wide application as food Chinese Academy of Sciences, Beijing 100080, China sweeteners, dental caries reducer, and a sugar substitute for diabetics [7]. In addition, d-arabitol and xylitol have also L. Li Key Laboratory of Industrial Biotechnology, Ministry been used as raw materials for the chemical synthesis of of Education, Jangnan University, Wuxi 214122, China enantiopure compounds, immunosuppressive glycolipids, 1 3 42 J Ind Microbiol Biotechnol (2014) 41:41–48 herbicides, as well as anti-pathogenic disease medicines In this study, we reported that a recently isolated P. [29]. Hence, d-arabitol and xylitol had been selected as one anomala can produce important sugar alcohols as ribitol, of the top 12 types of value-added building-block chemi- d-arabitol, and/or xylitol from different substrates. In order cals from biorefineries [31]. to characterize the metabolic pathway of the production of At present, sugar alcohols are still primarily produced sugar alcohols, d-arabitol dehydrogenase (ArDH) gene in by chemical reduction from monosaccharide. However, this P. anomala was cloned and expressed in Escherichia coli method has many drawbacks such as the requirements of firstly. Its enzymatic activity and in vitro reactions have highly purified substrates, high pressure and temperature, also been investigated with the purified recombinant pro- and expensive chemical catalyst of Raney-Nickel (a fine- tein to confirm its properties. grained solid composed mostly of nickel derived from a nickel-aluminium alloy, and often used for the reduction of sugar to produce sugar alcohol) in the process. At the same Materials and methods time, extensive separation steps have to be followed in Downloaded from https://academic.oup.com/jimb/article/41/1/75/5995204 by guest on 23 September 2021 order to remove the by-products, which are mainly derived Chemicals from the chemical reaction. However, sugar alcohol production using microorgan- Yeast extract and tryptone were procured from OXOID isms is eco-friendly and more cost-effective, as the process (Hampshire, UK). Agar powder was purchased from Solar- does not require pure sugar substrate and different bio- bio (Beijing, China). Glucose, xylose, d-arabitol, xylitol, mass materials can be used as substrates. In an attempt to d-xylulose and enzyme cofactors such as NADH and NAD+ increase product yields, bioconversion processes based on were purchased from Sigma (St. Louis, MO, USA). The other whole-cell enzyme biocatalysts had been investigated [1, chemicals were purchased from Sinopharm (Beijing, China). 9, 10, 13, 33]. Bioconversion, known as biotransformation, refers to the utilization of live microbial cells to carry out Organisms and growth conditions some multiple-enzyme-catalyzed reactions that are more costly or not feasible chemically. Compared to the tradi- The P. anomala TIB-x229 (CGMCC No. 5482) and Escher- tional production by fermentation, it is not necessary to ichia coli strains BL21 (DE3) used in this study were non- keep sterile strictly and add the nitrogen resource for the pathogenic strains. The plasmid pET30a( ) (Novagen, + bioconversion process, and this will reduce the cost for San Diego, CA, USA) was used for expressing protein in industrial applications. In addition, the products from bio- Escherichia coli BL21(DE3). conversion are usually much simpler for down-stream sepa- The yeast strain was maintained on YPD agar plates ration [34]. Hence, the production of bio-based chemicals with yeast extract 10 g/l, tryptone 20 g/l, agar 15 g/l, and via bioconversion has attracted much attention for its prac- glucose 20 g/l, incubated at 30 °C. The inoculums were tical application and become a promising technology [4]. prepared in YPD medium and the composition was 10 g/l The performance of strain plays an important role in the yeast extract, 20 g/l tryptone, and 20 g/l glucose. E. coli bioconversion process. Screening or engineering the suit- strain was cultivated in LB medium with yeast extract 5 g/l, able strains will greatly contribute to the success of biocon- tryptone 10 g/l, and NaCl 10 g/l. version for the production of bio-based chemicals. When exposed to osmotic stress, some microorganisms accumu- Identification and phylogenetic analysis of isolates late compatible solutes such as d-arabitol, glycerol, xylitol, and mannitol to balance the osmotic pressure across the cell The taxonomical studies of isolate was conducted by 18S membrane [12]. It is well known that many osmophilic yeast rDNA homologous analysis. The genomic DNA of P. species, such as Zygosaccharomyces [26], Debaryomyces anomala was extracted by Biomega Yeast gDNA Kit (Bei- [18], Metschnikowia [19], Candida [2], and Hansenula jing, China) following the manufacturer’s instruction. The [30] can produce different sugar alcohols. Of these species, 18S rDNA was amplified with universal primers 18s-FP P. anomala, belonging to the non-Saccharomyces yeasts, and 18s-RP (Table 1). The cloned 18S rDNA was aligned exhibits wide metabolic and physiological diversity for its in the GenBank database. capacity to grow under the environment of low pH, high osmotic pressure, and low oxygen tension [22]. In fact, P. Bioconversion of different sugar substrates by Pichia anomala is one of several yeast species that have been given anomala TIB-x229 QPS status, and it had been employed for biocontrol pur- poses in food and feed [27]. Therefore, it has widespread A single colony of P. anomala TIB-x229 was inoculated biotechnological significance ranging from therapeutic pro- into 20 ml of YPD medium in a 250-ml shake flask and tein production, biocontrol agents, and biofuels production. cultured at 30 °C/200 rpm. After incubation for 12 h, the 1 3 J Ind Microbiol Biotechnol (2014) 41:41–48 43 Table 1 Oligonucleotide primers in this study was then eluted with 20 ml of eluting buffer. Fractions were Primers Sequences (5′–3′) combined and passed through an ultra-filtration tube MWCO 3kD (Millipore, Billerica, MA, USA) for desalting. 18s-FP CCAACCTGGTTGATCCTGCCAGTA 18s-RP CCTTGTTACGACTTCACCTTCCTCT Enzyme assay and in vitro reaction ardh-1 aattcCATATGATGGAWTCCGCATAC ardh-2 aattCTCGAGCCARCAYTCGTAACCYCC The activity of recombinant enzyme ArDH was determined spectrophotometrically by monitoring the change of A340 whole cells were harvested by centrifugation at 3,000 g reflecting oxidation or reduction of NAD(H) or NADP(H) × for 3 min. After washing twice with distilled water, whole [28]. The oxidative reaction mixture for ArDH consisted cells were suspended in isometric substrate solution for fol- of 50 mM Tris–HCl (pH 7.5), 2 mM NAD+ or NADP+, lowing bioconversion. The condition of bioconversion was 50 mM d-arabitol/xylitol, and purified enzyme. For the 30 °C/250 rpm in a 250-ml shake flask. reductive reaction, the mixture contained 50 mM Tris–HCl Downloaded from https://academic.oup.com/jimb/article/41/1/75/5995204 by guest on 23 September 2021 (pH 7.5), 2 mM NADH or NADPH, 50 mM d-xylulose, Metabolite analysis and purified enzyme. All reactions were started by the addi- tion of enzyme to a final volume of 0.2 ml at 30 °C.