DOCSLIB.ORG

Suppression of Ku80 Correlates with Radiosensitivity and Telomere Shortening in the U2OS Telomerase-Negative Osteosarcoma Cell Line

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Suppression of Ku80 Correlates with Radiosensitivity and Telomere Shortening in the U2OS Telomerase-Negative Osteosarcoma Cell Line DOI:http://dx.doi.org/10.7314/APJCP.2013.14.2.795 Suppression of Ku80 Correlates with Radiosensitivity and Telomere Shortening in U2OS Osteosarcoma Cells RESEARCH ARTICLE Suppression of Ku80 Correlates with Radiosensitivity and Telomere Shortening in the U2OS Telomerase-negative Osteosarcoma Cell Line Liu Hu1&, Qin-Qin Wu1&, Wen-Bo Wang1, Huan-Gang Jiang1, Lei Yang1, Yu Liu1, Hai-Jun Yu1, Cong-Hua Xie1,2, Yun-Feng Zhou1,2, Fu-Xiang Zhou1,2* Abstract Ku70/80 heterodimer is a central element in the nonhomologous end joining (NHEJ) DNA repair pathway, Ku80 playing a key role in regulating the multiple functions of Ku proteins. It has been found that the Ku80 protein located at telomeres is a major contributor to radiosensitivity in some telomerase positive human cancer cells. However, in ALT human osteosarcoma cells, the precise function in radiosensitivity and telomere maintenance is still unknown. The aim of this study was to investigate the effects of Ku80 depletion in the U2OS ALT cell line cell line. Suppression of Ku80 expression was performed using a vector-based shRNA and stable Ku80 knockdown in cells was verified by Western blotting. U2OS cells treated with shRNA-Ku80 showed lower radiobiological parameters (D0, Dq and SF2) in clonogenic assays. Furthermore, shRNA-Ku80 vector transfected cells displayed shortening of the telomere length and showed less expression of TRF2 protein. These results demonstrated that down-regulation of Ku80 can sensitize ALT cells U2OS to radiation, and this radiosensitization is related to telomere length shortening. Keywords: Ku80 - telomerase negative osteosarcoma - U2OS cells - radiosensitivity - telomere length - TRF2 Asian Pacific J Cancer Prev, 14 (2), 795-799 Introduction enhanced the radiosensitivity in many cell lines (Yang et al., 2008). However, the cell lines selected in those studies Ku80 is one subunit of the Ku80/Ku70 heterodimer. were almost telomerase positive, the effect of Ku80 on The crucial role of Ku80 in DNA damage was well known, the telomere and radiosensitivity in telomerase negative especially the NHEJ pathway. When DNA is damaged, Ku cell lines are still unclear. The aim of this study was to heterodimer recruits DNA-PKcs to the DSB and activates investigate the relationship between radiosensitivity, its kinase function. And then, this process stimulates telomere length and Ku80 protein in telomerase negative DNA repair and the damage signal pathway, which may cancer cells. subsequently affect apoptosis and cell cycles. Besides its important role in DNA repair, many reports have suggested Materials and Methods that Ku80 is also involved in telomere maintenance. When DNA is damaged, the Ku heterodimer protects exposed Cell lines and culture conditions. DNA ends by end-to-end bridging at sites of DNA DSBs. The human osteosarcoma cell U2OS were obtained Unlike the DNA DSBR (double-strand DNA break repair) from the China center for type cultrue collection(CCTCC) pathway, end-to-end joining of DNA should be avoided in Wuhan University. The cells were cultured in RPMI during repair of exposed telomeric ends (Gullo et al., 1640 medium (Sigma chemical Co., St Louis, MO, USA) 2006). During telomere repair, Ku heterodimer bind to at 37℃ supplement with 10% fetal bovine serum and 1% telomeric sequences (Bianchi et al., 1999; Hsu et al., penicillin/streptomycin mixture. All cultures were grown 1999) and promote the telomerase-mediated synthesis of at 37℃ under a humidified atmosphere of 5% carbon the complimentary strand of DNA that prevents end-to- dioxide. end DNA fusion (Bailey et al., 1999; Samper et al., 2000). Previous studies demonstrated that mutation in Ku80 Ku80 shRNA vector constructs proteins prevent repair of telomere ends (Polotnianka et Plasmid pGenesil-1 expression vector (Wuhan genesil al., 1998) and these results reduced telomere lengthen and biotechnology Co, Ltd.) was used, which contained a human 1Department of Radiation and Medical Oncology, Zhongnan Hospital, Wuhan University, 2Hubei Key Laboratory of Tumor Biological Behaviors, Wuhan University, Wuhan, China &Equal contributors *For correspondence: [email protected] Asian Pacific Journal of Cancer Prevention, Vol 14, 2013 795 Liu Hu et al U6 promoter, a GFP reporter gene and a neomycin resistance whole cell was determined using a BCA protein assay kit gene to enable antibiotic selection in mammalian cells. We (Beyotime biotechnology). The protein extracts (50μg) designed two pairs of complementary oligonucleotide were incubated in loading buffer (60 mmol/L Tris-Hcl, sequences according to the cDNA sequences of Ku80 25% Glycerol, 2% SDS, 14.4 mmol/L Mercaptoethanol, (GenBank accession number: NM_021141). They 0.1% Bromophenol blue), and boiled for 5 min. These analyzed BLAST research to ensure that they didn’t samples were electrophoresed on a 10% SDS-PAGE. have significant sequence homology with other genes. After electrophoresis, proteins were transferred to a Target sequences of Ku80 for shRNA are showed below: PVDF membrane and processed for immunoblotting. For 5’-CACCGCCAGGTTCTCAACAGGCTGTTCAAGA the detection of Ku80 and β-actin, blots were incubated CGCAGCCTGTTGAGAACCTGG TTTTTTG-3’ 5’- AG with 1:300 dilution mouse monoclonal antibodies AGCTCAAAAAACCAGGTTCTCAACAGGCTGCGT (Santa cruze biotechnology) and further incubated with CTTGAACAGCCTGTTGAGAACCTGGC-3’. Horseradish peroxidase-conjugated secondary antibody diluted at 1:5000 and specific bands were visualized by shRNA vector stable transfection ECL (Beyotime biotechnology), Autoradiographs were One hundred thousand U2OS cells in a total volume recorded onto X-Omat AR film (Eastman kodak Co.) The of 2 ml RPMI 1640 medium were seeded in 6-well plates density of bands in the resulting film was quantified using and incubated for 24 h. The cells were rinsed with PBS the Image J analysis program. and then were treated with shRNA and scrambled control according to the manufacturer’s instructions. shRNA Real-time quantitative PCR plasmids and Oligofectamine 2000 (Invitrogen, USA) Genomic DNA was extracted from cells using were mixed separately with opti-MEM and incubated for TIANamp genomic DNA kit (TIANGEN biotech Co,. 5 min at room temperature. These reagents were combined Ltd. ) and stored at -70℃. Relative telomere length was and incubated for another 20 min before adding to the detected by using the approach described by Cawthon cells. The effectiveness of transfection was visualized by previously (Cawthon., 2002). This method measures fluorescence microscope 24 h after transfection. After 48 h the factor by which the ratio of telomere repeat copy incubation, 500 μg/ml of hygromycin (G418) was added to number to single-gene copy number differs between the the medium for selection individual colonies which were sample and the reference sample. PCR amplification was isolated after addition 2 weeks culture. The colonies which achieved using telomere (T) and single copy gene(S), contained GFP were selected by fluorescence microscope 36B4 (encodes acidic ribosomal phosphoprotein) primers and continue to culture for at least 10 passages. As a which serves as a quantative control. The mean telomere control, a subset of U2OS cells was transfected with the repeat gene sequence to a reference single copy gene is control plasmid carrying scrambled sequence. represented as T/S ratio which calculated to determine the relative telomere length. Standard curves were generated Semi-quantitative reverse transcription-PCR (RT-PCR) for telomere lengths and the single gene copy amplification Total RNA was isolated using TRIzol reagent reactions from a reference DNA sample serially diluted (Invitrogen) according to the manufacture’s instructions. with Milli-Q water by 2-fold per dilution to produce four The first strand of cDNA was obtained using Revert concentrations of DNA ranging from 50 to 3.125 ng/μl. aidTM first strand cDNA synthesis kit (Fermentas). Duplicate PCR reactions using the TaKaRa realtime PCR For quantitative analysis of Ku80 mRNA, human kit (TaKaRa biotechnology Co, Ltd) according to the GAPDH gene was used as an internal control. DNA manufacture’s instructions. The primers for telomeres primer sequences were designed as follows: F: and the single copy gene 36B4 were added to final 5’-GGGGTACCATGGTGCGGTCGGGGAAT-3’, R: concentrations of 0.2 μM. The telomere and single copy 5’-GCTCTAGATCCCCATACATCCACGAC-3’for gene specific primers used for the experiment were given Ku80, F: 5’-ATCACTGCCACCCAGAAGAC-3’, R: as below: Tel 1: 5’- GGTTTTTGAGGGTGAGGGTGA 5’-AGCGTCAAAGGTGGAGGAGT-3’for GAPDH. GGGTGAGGGTGAGGGT -3’; Tel 2: 5’-TCCCGACTA Amplification cycles were 94℃ for 3 min; the 30 cycles TCCCTA TCCCTATCCCTATCCCTATCCCTA -3’; at 94℃ for 30 sec, 57℃ for 30 s, 72℃ for 1 min, 72℃ for 36B4u: 5’-CAGCAAGTGGGAAGGTGTAATCC-3’, 5 min. PCR products were identified using electrophoresis 36B4d: 5’-CCCATTCTATCATCAACGGGTACAA-3’. on 1.5% agarose gels containing 1% ethidium bromide The cycling conditions consisted of a preincubation for 5 (EB). Gel images were obtained using Bio-ID gel analysis sec at 95℃ and followed by 35 cycles of 15 sec at 95℃, 2 software (Vilber lourmat, France). All experiments were min at 54℃. All experiments were repeated at least three repeated at least three times. times. Thermal amplification was carried out on Mx3000P (Stratagene) and the result was analyzed using the MXP Western blot analysis 3000 analysis program. Cultured cells were rinsed twice with phosphate buffered saline (PBS) and mixed with 200 μl of lysis Grouping and Irradiation buffer (Beyotime
Load more

Recommended publications
  • Ku80 Antibody A
    Revision 1 C 0 2 - t Ku80 Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] Support: 877-678-TECH (8324) 3 5 Web: [email protected] 7 www.cellsignal.com 2 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB, IP, IHC-P, IF-IC, F H Mk Endogenous 86 Rabbit P13010 7520 Product Usage Information cell cycle regulation, DNA replication and repair, telomere maintenance, recombination, and transcriptional activation. Application Dilution 1. Tuteja, R. and Tuteja, N. (2000) Crit. Rev. Biochem. Mol. Biol. 35, 1-33. 2. Blier, P.R. et al. (1993) J. Biol. Chem. 268, 7594-7601. Western Blotting 1:1000 3. Jin, S. and Weaver, D.T. (1997) EMBO J. 16, 6874-6885. Immunoprecipitation 1:25 4. Boulton, S.J. and Jackson, S.P. (1998) EMBO J. 17, 1819-1828. 5. Gravel, S. et al. (1998) Science 280, 741-744. Immunohistochemistry (Paraffin) 1:150 - 1:600 6. Cao, Q.P. et al. (1994) Biochemistry 33, 8548-8557. Immunofluorescence (Immunocytochemistry) 1:100 - 1:400 7. Lees-Miller, S.P. et al. (1990) Mol. Cell Biol. 10, 6472-6481. Flow Cytometry 1:50 - 1:100 8. Collis, S.J. et al. (2005) Oncogene 24, 949-961. Storage Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% glycerol. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity Ku80 antibody detects endogenous levels of total Ku80 protein.
    [Show full text]
  • A Werner Syndrome Protein Homolog Affects C. Elegans Development
    Research article 2565 A Werner syndrome protein homolog affects C. elegans development, growth rate, life span and sensitivity to DNA damage by acting at a DNA damage checkpoint Se-Jin Lee, Jong-Sung Yook, Sung Min Han and Hyeon-Sook Koo* Department of Biochemistry, College of Science, Yonsei University, Seoul 120-749, Korea *Author for correspondence (e-mail: [email protected]) Accepted 18 February 2004 Development 131, 2565-2575 Published by The Company of Biologists 2004 doi:10.1242/dev.01136 Summary A Werner syndrome protein homolog in C. elegans (WRN- irrespective of γ-irradiation, and pre-meiotic germ cells had 1) was immunolocalized to the nuclei of germ cells, an abnormal checkpoint response to DNA replication embryonic cells, and many other cells of larval and adult blockage. These observations suggest that WRN-1 acts as worms. When wrn-1 expression was inhibited by RNA a checkpoint protein for DNA damage and replication interference (RNAi), a slight reduction in C. elegans life blockage. This idea is also supported by an accelerated S span was observed, with accompanying signs of premature phase in wrn-1(RNAi) embryonic cells. wrn-1(RNAi) aging, such as earlier accumulation of lipofuscin and phenotypes similar to those of Werner syndrome, such as tissue deterioration in the head. In addition, various premature aging and short stature, suggest wrn-1-deficient developmental defects, including small, dumpy, ruptured, C. elegans as a useful model organism for Werner transparent body, growth arrest and bag of worms, were syndrome. induced by RNAi. The frequency of these defects was accentuated by γ-irradiation, implying that they were derived from spontaneous or induced DNA damage.
    [Show full text]
  • DNA Repair with Its Consequences (E.G
    Cell Science at a Glance 515 DNA repair with its consequences (e.g. tolerance and pathways each require a number of apoptosis) as well as direct correction of proteins. By contrast, O-alkylated bases, Oliver Fleck* and Olaf Nielsen* the damage by DNA repair mechanisms, such as O6-methylguanine can be Department of Genetics, Institute of Molecular which may require activation of repaired by the action of a single protein, Biology, University of Copenhagen, Øster checkpoint pathways. There are various O6-methylguanine-DNA Farimagsgade 2A, DK-1353 Copenhagen K, Denmark forms of DNA damage, such as base methyltransferase (MGMT). MGMT *Authors for correspondence (e-mail: modifications, strand breaks, crosslinks removes the alkyl group in a suicide fl[email protected]; [email protected]) and mismatches. There are also reaction by transfer to one of its cysteine numerous DNA repair pathways. Each residues. Photolyases are able to split Journal of Cell Science 117, 515-517 repair pathway is directed to specific Published by The Company of Biologists 2004 covalent bonds of pyrimidine dimers doi:10.1242/jcs.00952 types of damage, and a given type of produced by UV radiation. They bind to damage can be targeted by several a UV lesion in a light-independent Organisms are permanently exposed to pathways. Major DNA repair pathways process, but require light (350-450 nm) endogenous and exogenous agents that are mismatch repair (MMR), nucleotide as an energy source for repair. Another damage DNA. If not repaired, such excision repair (NER), base excision NER-independent pathway that can damage can result in mutations, diseases repair (BER), homologous recombi- remove UV-induced damage, UVER, is and cell death.
    [Show full text]
  • Biochemical Characterization of the Werner – Like Exonuclease From
    Biochemical characterization of the Werner – like exonuclease from Arabidopsis thaliana Zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften an der Fakultät für Chemie und Biowissenschaften der Universität Karlsruhe (TH) genehmigte DISSERTATION von Diplom-Biochemikerin Helena Plchova aus Prag, Tschechische Republik Dekan: Prof. Dr. Manfred Metzler 1. Gutachter: Prof. Dr. Holger Puchta 2. Gutachter: Prof. Dr. Andrea Hartwig Tag der mündlichen Prüfung: 04.12.03 Acknowledgements This work was carried out during the period from September 1999 to June 2003 at the Institut for Plant Genetics and Crop Plant Research (IPK), Gatersleben, Germany. I would like to express my sincere gratitude to my supervisor, Prof. Dr. H. Puchta, for giving me the opportunity to work in his research group “DNA-Recombination”, for his expertise, understanding, stimulating discussions and valuable suggestions during the practical work and writing of the manuscript. I appreciate his vast knowledge and skill in many areas and his assistance during the course of the work. I would like to thank also Dr. Manfred Focke for reading the manuscript and helpful discussions. My sincere gratitude is to all the collaborators of the Institute for Plant Genetics and Crop Plant Research (IPK) in Gatersleben, especially from the “DNA-Recombination” group for the stimulating environment and very friendly atmosphere during this work. Finally, I also thank all my friends that supported me in my Ph.D. study and were always around at any time. Table of contents Page 1. Introduction 1 1.1. Werner syndrome (WS) 1 1.2. Product of Werner syndrome gene 2 1.2.1. RecQ DNA helicases 3 1.2.2 Mutations in Werner syndrome gene 6 1.3.
    [Show full text]
  • Epigenetic Regulation of DNA Repair Genes and Implications for Tumor Therapy ⁎ ⁎ Markus Christmann , Bernd Kaina
    Mutation Research-Reviews in Mutation Research xxx (xxxx) xxx–xxx Contents lists available at ScienceDirect Mutation Research-Reviews in Mutation Research journal homepage: www.elsevier.com/locate/mutrev Review Epigenetic regulation of DNA repair genes and implications for tumor therapy ⁎ ⁎ Markus Christmann , Bernd Kaina Department of Toxicology, University of Mainz, Obere Zahlbacher Str. 67, D-55131 Mainz, Germany ARTICLE INFO ABSTRACT Keywords: DNA repair represents the first barrier against genotoxic stress causing metabolic changes, inflammation and DNA repair cancer. Besides its role in preventing cancer, DNA repair needs also to be considered during cancer treatment Genotoxic stress with radiation and DNA damaging drugs as it impacts therapy outcome. The DNA repair capacity is mainly Epigenetic silencing governed by the expression level of repair genes. Alterations in the expression of repair genes can occur due to tumor formation mutations in their coding or promoter region, changes in the expression of transcription factors activating or Cancer therapy repressing these genes, and/or epigenetic factors changing histone modifications and CpG promoter methylation MGMT Promoter methylation or demethylation levels. In this review we provide an overview on the epigenetic regulation of DNA repair genes. GADD45 We summarize the mechanisms underlying CpG methylation and demethylation, with de novo methyl- TET transferases and DNA repair involved in gain and loss of CpG methylation, respectively. We discuss the role of p53 components of the DNA damage response, p53, PARP-1 and GADD45a on the regulation of the DNA (cytosine-5)- methyltransferase DNMT1, the key enzyme responsible for gene silencing. We stress the relevance of epigenetic silencing of DNA repair genes for tumor formation and tumor therapy.
    [Show full text]
  • An Overview of DNA Repair Mechanisms in Plants Compared to Mammals
    Cell. Mol. Life Sci. (2017) 74:1693–1709 DOI 10.1007/s00018-016-2436-2 Cellular and Molecular Life Sciences REVIEW Protecting DNA from errors and damage: an overview of DNA repair mechanisms in plants compared to mammals Claudia P. Spampinato1 Received: 8 August 2016 / Revised: 1 December 2016 / Accepted: 5 December 2016 / Published online: 20 December 2016 Ó Springer International Publishing 2016 Abstract The genome integrity of all organisms is con- methods and reporter systems for gene expression and stantly threatened by replication errors and DNA damage function studies. Here, I provide a current understanding of arising from endogenous and exogenous sources. Such base DNA repair genes in plants, with a special focus on A. pair anomalies must be accurately repaired to prevent thaliana. It is expected that this review will be a valuable mutagenesis and/or lethality. Thus, it is not surprising that resource for future functional studies in the DNA repair cells have evolved multiple and partially overlapping DNA field, both in plants and animals. repair pathways to correct specific types of DNA errors and lesions. Great progress in unraveling these repair mecha- Keywords DNA repair Á Photolyases Á BER Á NER Á nisms at the molecular level has been made by several MMR Á HR Á NHEJ talented researchers, among them Tomas Lindahl, Aziz Sancar, and Paul Modrich, all three Nobel laureates in Chemistry for 2015. Much of this knowledge comes from Introduction studies performed in bacteria, yeast, and mammals and has impacted research in plant systems. Two plant features All organisms are constantly exposed to environmental should be mentioned.
    [Show full text]
  • DNA Mismatch Repair Proteins MLH1 and PMS2 Can Be Imported to the Nucleus by a Classical Nuclear Import Pathway
    Accepted Manuscript DNA mismatch repair proteins MLH1 and PMS2 can be imported to the nucleus by a classical nuclear import pathway Andrea C. de Barros, Agnes A.S. Takeda, Thiago R. Dreyer, Adrian Velazquez- Campoy, Boštjan Kobe, Marcos R.M. Fontes PII: S0300-9084(17)30308-5 DOI: 10.1016/j.biochi.2017.11.013 Reference: BIOCHI 5321 To appear in: Biochimie Received Date: 25 May 2017 Accepted Date: 22 November 2017 Please cite this article as: Keplinger M, Marhofer P, Moriggl B, Zeitlinger M, Muehleder-Matterey S, Marhofer D, Cutaneous innervation of the hand: clinical testing in volunteers shows that variability is far greater than claimed in textbooks, British Journal of Anaesthesia (2017), doi: 10.1016/j.bja.2017.09.008. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. ACCEPTED MANUSCRIPT ABSTRACT MLH1 and PMS2 proteins form the MutL α heterodimer, which plays a major role in DNA mismatch repair (MMR) in humans. Mutations in MMR-related proteins are associated with cancer, especially with colon cancer. The N-terminal region of MutL α comprises the N-termini of PMS2 and MLH1 and, similarly, the C-terminal region of MutL α is composed by the C-termini of PMS2 and MLH1, and the two are connected by linker region.
    [Show full text]
  • Chromatin Association of XRCC5/6 in the Absence of DNA Damage Depends on the XPE Gene Product DDB2
    M BoC | ARTICLE Chromatin association of XRCC5/6 in the absence of DNA damage depends on the XPE gene product DDB2 Damiano Fantinia,†, Shuo Huanga, John M. Asarab, Srilata Bagchic, and Pradip Raychaudhuria,d,* aDepartment of Biochemistry and Molecular Genetics, College of Medicine, University of Illinois, Chicago, IL 60607; bDivision of Signal Transduction, Beth Israel Deaconess Medical Center, and Department of Medicine, Harvard Medical School, Boston, MA 02115; cDepartment of Oral Biology, College of Dentistry, University of Illinois, Chicago, IL 60612; dJesse Brown VA Medical Center, Chicago, IL 60612 ABSTRACT Damaged DNA-binding protein 2 (DDB2), a nuclear protein, participates in both Monitoring Editor nucleotide excision repair and mRNA transcription. The transcriptional regulatory function of William P. Tansey DDB2 is significant in colon cancer, as it regulates metastasis. To characterize the mechanism Vanderbilt University by which DDB2 participates in transcription, we investigated the protein partners in colon Received: Aug 9, 2016 cancer cells. Here we show that DDB2 abundantly associates with XRCC5/6, not involving Revised: Oct 24, 2016 CUL4 and DNA-PKcs. A DNA-damaging agent that induces DNA double-stranded breaks Accepted: Nov 2, 2016 (DSBs) does not affect the interaction between DDB2 and XRCC5. In addition, DSB-induced nuclear enrichment or chromatin association of XRCC5 does not involve DDB2, suggesting that the DDB2/XRCC5/6 complex represents a distinct pool of XRCC5/6 that is not directly involved in DNA break repair (NHEJ). In the absence of DNA damage, on the other hand, chromatin association of XRCC5 requires DDB2. We show that DDB2 recruits XRCC5 onto the promoter of SEMA3A, a DDB2-stimulated gene.
    [Show full text]
  • Targeting RNF8 Effectively Reverse Cisplatin and Doxorubicin Resistance in Endometrial Cancer
    Targeting RNF8 Effectively Reverse Cisplatin and Doxorubicin Resistance in Endometrial Cancer Ben Yang China-Japan Union Hospital of Jilin University Wang Ke China-Japan Union Hospital of Jilin University Yingchun Wan China-Japan Union Hospital of Jilin University Tao Li ( [email protected] ) China-Japan Union Hospital of Jilin University https://orcid.org/0000-0002-6981-2977 Primary research Keywords: Endometrial cancer, RNF8, cisplatin, doxorubicin, resistance Posted Date: September 2nd, 2020 DOI: https://doi.org/10.21203/rs.3.rs-57263/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at Biochemical and Biophysical Research Communications on March 1st, 2021. See the published version at https://doi.org/10.1016/j.bbrc.2021.01.046. Page 1/19 Abstract Background Endometrial cancer (EC) is one of the most frequent gynecological malignancy worldwide. However, resistance to chemotherapy remains one of the major diculties in the treatment of EC. Thus, there is an urgent requirement to understand mechanisms of chemoresistance and identify novel regimens for patients with EC. Methods Cisplatin and doxorubicin resistant cell lines were acquired by continuous exposing parental EC cells to cisplatin or doxorubicin for 3 months. Cell viability was determined by using MTT assay. Protein Expression levels of protein were examined by western blotting assay. mRNA levels were measured by quantitative polymerase chain reaction (qPCR) assay. Ring nger protein 8 (RNF8) knockout cell lines were generated by clustered regularly interspaced short palindromic repeats (CRISPR)–Cas9 gene editing assay.
    [Show full text]
  • Akt Promotes Post-Irradiation Survival of Human Tumor Cells Through Initiation, Progression, and Termination of DNA-Pkcs–Dependent DNA Double-Strand Break Repair
    Published OnlineFirst May 17, 2012; DOI: 10.1158/1541-7786.MCR-11-0592 Molecular Cancer DNA Damage and Cellular Stress Responses Research Akt Promotes Post-Irradiation Survival of Human Tumor Cells through Initiation, Progression, and Termination of DNA-PKcs–Dependent DNA Double-Strand Break Repair Mahmoud Toulany1, Kyung-Jong Lee3, Kazi R. Fattah3, Yu-Fen Lin3, Brigit Fehrenbacher2, Martin Schaller2, Benjamin P. Chen3, David J. Chen3, and H. Peter Rodemann1 Abstract Akt phosphorylation has previously been described to be involved in mediating DNA damage repair through the nonhomologous end-joining (NHEJ) repair pathway. Yet the mechanism how Akt stimulates DNA-protein kinase catalytic subunit (DNA-PKcs)-dependent DNA double-strand break (DNA-DSB) repair has not been described so far. In the present study, we investigated the mechanism by which Akt can interact with DNA-PKcs and promote its function during the NHEJ repair process. The results obtained indicate a prominent role of Akt, especially Akt1 in the regulation of NHEJ mechanism for DNA-DSB repair. As shown by pull-down assay of DNA-PKcs, Akt1 through its C-terminal domain interacts with DNA-PKcs. After exposure of cells to ionizing radiation (IR), Akt1 and DNA-PKcs form a functional complex in a first initiating step of DNA-DSB repair. Thereafter, Akt plays a pivotal role in the recruitment of AKT1/DNA-PKcs complex to DNA duplex ends marked by Ku dimers. Moreover, in the formed complex, Akt1 promotes DNA-PKcs kinase activity, which is the necessary step for progression of DNA-DSB repair. Akt1-dependent DNA-PKcs kinase activity stimulates autophosphorylation of DNA-PKcs at S2056 that is needed for efficient DNA-DSB repair and the release of DNA-PKcs from the damage site.
    [Show full text]
  • DNA Repair: How Ku Makes Ends Meet Aidan J
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector R920 Dispatch DNA repair: How Ku makes ends meet Aidan J. Doherty* and Stephen P. Jackson† The recently determined crystal structure of the Ku of NHEJ, structural and functional homologues of Ku70, heterodimer, in both DNA-bound and unbound forms, Ku80, ligase IV and XRCC4 exist in lower eukaryotes, has shed new light on the mechanism by which this including yeast. DNA-PKcs, however, seems to be restricted protein fulfills its key role in the repair of DNA to vertebrates. double-strand breaks. Biochemical studies have yielded some major insights into Address: *Cambridge Institute for Medical Research, Department of Haematology, University of Cambridge, Hills Road, the mechanisms of NHEJ. Most notably perhaps, the Cambridge CB2 2XY, UK. †Wellcome Trust and Cancer Research observation that Ku binds tightly and specifically to a Campaign Institute of Cancer and Developmental Biology and variety of DNA end-structures, including blunt ends, 5′ or Department of Zoology, University of Cambridge, Tennis Court Road, 3′ overhangs and DNA hairpins, suggests that it acts as the Cambridge CB2 1QR, UK. primary sensor of broken chromosomal DNA [3,5]. Once E-mail: *[email protected]; †[email protected] bound to a DNA double-strand break, Ku presumably Current Biology 2001, 11:R920–R924 then recruits DNA-PKcs, whose protein kinase function — which in vitro preferentially targets proteins bound in 0960-9822/01/$ – see front matter © 2001 Elsevier Science Ltd. All rights reserved. cis on the same DNA molecule — could trigger changes in chromatin structure at the site of the DNA double-strand DNA double-strand breaks are generated by ionising breaks and/or regulate the activities of other repair factors radiation and radio-mimetic chemicals.
    [Show full text]
  • ERCC6L2 Promotes DNA Orientation-Specific
    www.nature.com/cr www.cell-research.com ARTICLE ERCC6L2 promotes DNA orientation-specific recombination in mammalian cells Xiaojing Liu1,2, Tingting Liu1,2, Yafang Shang1,2, Pengfei Dai1,2, Wubing Zhang3, Brian J. Lee 4, Min Huang1,2, Dingpeng Yang 1,2, Qiu Wu 3, Liu Daisy Liu1,2, Xiaoqi Zheng5, Bo O. Zhou 1,2, Junchao Dong6, Leng-Siew Yeap7, Jiazhi Hu 8, Tengfei Xiao9, Shan Zha4, Rafael Casellas10, X. Shirley Liu11 and Fei-Long Meng 1,2 Programmed DNA recombination in mammalian cells occurs predominantly in a directional manner. While random DNA breaks are typically repaired both by deletion and by inversion at approximately equal proportions, V(D)J and class switch recombination (CSR) of immunoglobulin heavy chain gene overwhelmingly delete intervening sequences to yield productive rearrangement. What factors channel chromatin breaks to deletional CSR in lymphocytes is unknown. Integrating CRISPR knockout and chemical perturbation screening we here identify the Snf2-family helicase-like ERCC6L2 as one such factor. We show that ERCC6L2 promotes double-strand break end-joining and facilitates optimal CSR in mice. At the cellular levels, ERCC6L2 rapidly engages in DNA repair through its C-terminal domains. Mechanistically, ERCC6L2 interacts with other end-joining factors and plays a functionally redundant role with the XLF end-joining factor in V(D)J recombination. Strikingly, ERCC6L2 controls orientation-specific joining of broken ends during CSR, which relies on its helicase activity. Thus, ERCC6L2 facilitates programmed recombination through directional repair of distant breaks. Cell Research (2020) 30:732–744; https://doi.org/10.1038/s41422-020-0328-3 1234567890();,: INTRODUCTION specific joining of V(D)J breaks.2,6 How CSR ends are processed Programmed DNA recombination processes, including V(D)J and mostly by deletion is less understood.
    [Show full text]