A Network-Guided Association Mapping Approach from DNA
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis. -
Anti-Rab11 Antibody (ARG41900)
Product datasheet [email protected] ARG41900 Package: 100 μg anti-Rab11 antibody Store at: -20°C Summary Product Description Goat Polyclonal antibody recognizes Rab11 Tested Reactivity Hu, Ms, Rat, Dog, Mk Tested Application IHC-Fr, IHC-P, WB Host Goat Clonality Polyclonal Isotype IgG Target Name Rab11 Antigen Species Mouse Immunogen Purified recombinant peptides within aa. 110 to the C-terminus of Mouse Rab11a, Rab11b and Rab11c (Rab25). Conjugation Un-conjugated Alternate Names RAB11A: Rab-11; Ras-related protein Rab-11A; YL8 RAB11B: GTP-binding protein YPT3; H-YPT3; Ras-related protein Rab-11B RAB25: RAB11C; CATX-8; Ras-related protein Rab-25 Application Instructions Application table Application Dilution IHC-Fr 1:100 - 1:400 IHC-P 1:100 - 1:400 WB 1:250 - 1:2000 Application Note IHC-P: Antigen Retrieval: Heat mediation was recommended. * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Hepa cell lysate Calculated Mw 24 kDa Observed Size ~ 26 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer PBS, 0.05% Sodium azide and 20% Glycerol. Preservative 0.05% Sodium azide www.arigobio.com 1/3 Stabilizer 20% Glycerol Concentration 3 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. -
A Ph-Eqtl Interaction at the RIT2-SYT4 Parkinson's Disease Risk
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423140; this version posted June 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. A pH-eQTL interaction at the RIT2-SYT4 Parkinson’s disease risk locus in the substantia nigra Authors and affiliations: Sejal Patel1*, Derek Howard1, Leon French1,2,3,4* 1. Krembil Centre for Neuroinformatics, Centre for Addiction and Mental Health, Toronto, ON, Canada 2. Campbell Family Mental Health Research Institute, Centre for Addiction and Mental Health, Toronto, Canada 3. Department of Psychiatry, University of Toronto, Toronto 4. Institute for Medical Science, University of Toronto, Toronto, Canada Abstract Parkinson's disease (PD) causes severe motor and cognitive disabilities that result from the progressive loss of dopamine neurons in the substantia nigra. The rs12456492 variant in the RIT2 gene has been repeatedly associated with increased risk for Parkinson's disease. From a transcriptomic perspective, a meta-analysis found that RIT2 gene expression is correlated with pH in the human brain. To assess these pH associations in relation to PD risk, we examined the two datasets that assayed rs12456492, gene expression, and pH in the postmortem human brain. Using the BrainEAC dataset, we replicate the positive correlation between RIT2 gene expression and pH in the human brain (n=100). Furthermore, we found that the relationship between expression and pH is influenced by rs12456492. -
By Submitted in Partial Satisfaction of the Requirements for Degree of in In
Developments of Two Imaging based Technologies for Cell Biology Researches by Xiaowei Yan DISSERTATION Submitted in partial satisfaction of the requirements for degree of DOCTOR OF PHILOSOPHY in Biochemistry and Molecular Biology in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________Ronald Vale Chair ______________________________________________________________________________Jonathan Weissman ______________________________________________________________________________Orion Weiner ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2021 By Xiaowei Yan ii DEDICATION Everything happens for the best. To my family, who supported me with all their love. iii ACKNOWLEDGEMENTS The greatest joy of my PhD has been joining UCSF, working and learning with such a fantastic group of scientists. I am extremely grateful for all the support and mentorship I received and would like to thank: My mentor, Ron Vale, who is such a great and generous person. Thank you for showing me that science is so much fun and thank you for always giving me the freedom in pursuing my interest. I am grateful for all the guidance from you and thank you for always supporting me whenever I needed. You are a person full of wisdom, and I have been learning so much from you and your attitude to science, science community and even life will continue inspire me. Thank you for being my mentor and thank you for being such a great mentor. Everyone else in Vale lab, past and present, for making our lab a sweet home. I would like to give my special thank to Marvin (Marvin Tanenbaum) and Nico (Nico Stuurman), two other mentors for me in the lab. I would like to thank them for helping me adapt to our lab, for all the valuable advice and for all the happiness during the time that we work together. -
Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes
[CANCER RESEARCH 64, 6453–6460, September 15, 2004] Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes Be´atrice Orsetti,1 Me´lanie Nugoli,1 Nathalie Cervera,1 Laurence Lasorsa,1 Paul Chuchana,1 Lisa Ursule,1 Catherine Nguyen,2 Richard Redon,3 Stanislas du Manoir,3 Carmen Rodriguez,1 and Charles Theillet1 1Ge´notypes et Phe´notypes Tumoraux, EMI229 INSERM/Universite´ Montpellier I, Montpellier, France; 2ERM 206 INSERM/Universite´ Aix-Marseille 2, Parc Scientifique de Luminy, Marseille cedex, France; and 3IGBMC, U596 INSERM/Universite´Louis Pasteur, Parc d’Innovation, Illkirch cedex, France ABSTRACT 17q12-q21 corresponding to the amplification of ERBB2 and collinear genes, and a large region at 17q23 (5, 6). A number of new candidate Chromosome 17 is severely rearranged in breast cancer. Whereas the oncogenes have been identified, among which GRB7 and TOP2A at short arm undergoes frequent losses, the long arm harbors complex 17q21 or RP6SKB1, TBX2, PPM1D, and MUL at 17q23 have drawn combinations of gains and losses. In this work we present a comprehensive study of quantitative anomalies at chromosome 17 by genomic array- most attention (6–10). Furthermore, DNA microarray studies have comparative genomic hybridization and of associated RNA expression revealed additional candidates, with some located outside current changes by cDNA arrays. We built a genomic array covering the entire regions of gains, thus suggesting the existence of additional amplicons chromosome at an average density of 1 clone per 0.5 Mb, and patterns of on 17q (8, 9). gains and losses were characterized in 30 breast cancer cell lines and 22 Our previous loss of heterozygosity mapping data pointed to the primary tumors. -
Zbtb16 Regulates Social Cognitive Behaviors and Neocortical
Usui et al. Translational Psychiatry (2021) 11:242 https://doi.org/10.1038/s41398-021-01358-y Translational Psychiatry ARTICLE Open Access Zbtb16 regulates social cognitive behaviors and neocortical development Noriyoshi Usui 1,2,3,4, Stefano Berto5,AmiKonishi1, Makoto Kondo1,4, Genevieve Konopka5,HideoMatsuzaki 2,6,7 and Shoichi Shimada1,2,4 Abstract Zinc finger and BTB domain containing 16 (ZBTB16) play the roles in the neural progenitor cell proliferation and neuronal differentiation during development, however, how the function of ZBTB16 is involved in brain function and behaviors unknown. Here we show the deletion of Zbtb16 in mice leads to social impairment, repetitive behaviors, risk- taking behaviors, and cognitive impairment. To elucidate the mechanism underlying the behavioral phenotypes, we conducted histological analyses and observed impairments in thinning of neocortical layer 6 (L6) and a reduction of TBR1+ neurons in Zbtb16 KO mice. Furthermore, we found increased dendritic spines and microglia, as well as developmental defects in oligodendrocytes and neocortical myelination in the prefrontal cortex (PFC) of Zbtb16 KO mice. Using genomics approaches, we identified the Zbtb16 transcriptome that includes genes involved in neocortical maturation such as neurogenesis and myelination, and both autism spectrum disorder (ASD) and schizophrenia (SCZ) pathobiology. Co-expression networks further identified Zbtb16-correlated modules that are unique to ASD or SCZ, respectively. Our study provides insight into the novel roles of ZBTB16 in behaviors and neocortical development related to the disorders. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Introduction identified as a causative mutation for skeletal defects, ZBTB16 (PLZF) encodes a transcription factor, which genital hypoplasia, and mental retardation (SGYMR)6,7. -
Epigenetic Mechanisms of Lncrnas Binding to Protein in Carcinogenesis
cancers Review Epigenetic Mechanisms of LncRNAs Binding to Protein in Carcinogenesis Tae-Jin Shin, Kang-Hoon Lee and Je-Yoel Cho * Department of Biochemistry, BK21 Plus and Research Institute for Veterinary Science, School of Veterinary Medicine, Seoul National University, Seoul 08826, Korea; [email protected] (T.-J.S.); [email protected] (K.-H.L.) * Correspondence: [email protected]; Tel.: +82-02-800-1268 Received: 21 September 2020; Accepted: 9 October 2020; Published: 11 October 2020 Simple Summary: The functional analysis of lncRNA, which has recently been investigated in various fields of biological research, is critical to understanding the delicate control of cells and the occurrence of diseases. The interaction between proteins and lncRNA, which has been found to be a major mechanism, has been reported to play an important role in cancer development and progress. This review thus organized the lncRNAs and related proteins involved in the cancer process, from carcinogenesis to metastasis and resistance to chemotherapy, to better understand cancer and to further develop new treatments for it. This will provide a new perspective on clinical cancer diagnosis, prognosis, and treatment. Abstract: Epigenetic dysregulation is an important feature for cancer initiation and progression. Long non-coding RNAs (lncRNAs) are transcripts that stably present as RNA forms with no translated protein and have lengths larger than 200 nucleotides. LncRNA can epigenetically regulate either oncogenes or tumor suppressor genes. Nowadays, the combined research of lncRNA plus protein analysis is gaining more attention. LncRNA controls gene expression directly by binding to transcription factors of target genes and indirectly by complexing with other proteins to bind to target proteins and cause protein degradation, reduced protein stability, or interference with the binding of other proteins. -
TMC) Gene Family: Functional Clues from Hearing Loss and Epidermodysplasia Verruciformis૾
Available online at www.sciencedirect.com R Genomics 82 (2003) 300–308 www.elsevier.com/locate/ygeno Characterization of the transmembrane channel-like (TMC) gene family: functional clues from hearing loss and epidermodysplasia verruciformis૾ Kiyoto Kurima,a Yandan Yang,a Katherine Sorber,a and Andrew J. Griffitha,b,* a Section on Gene Structure and Function, National Institute on Deafness and Other Communication Disorders, National Institutes of Health, Rockville, MD 20850, USA b Hearing Section, National Institute on Deafness and Other Communication Disorders, National Institutes of Health, Rockville, MD 20850, USA Received 10 March 2003; accepted 15 May 2003 Abstract Mutations of TMC1 cause deafness in humans and mice. TMC1 and a related gene, TMC2, are the founding members of a novel gene family. Here we describe six additional TMC paralogs (TMC3 to TMC8) in humans and mice, as well as homologs in other species. cDNAs spanning the full length of the predicted open reading frames of the mammalian genes were cloned and sequenced. All are strongly predicted to encode proteins with 6 to 10 transmembrane domains and a novel conserved 120-amino-acid sequence that we termed the TMC domain. TMC1, TMC2, and TMC3 comprise a distinct subfamily expressed at low levels, whereas TMC4 to TMC8 are expressed at higher levels in multiple tissues. TMC6 and TMC8 are identical to the EVER1 and EVER2 genes implicated in epidermodysplasia verruciformis, a recessive disorder comprising susceptibility to cutaneous human papilloma virus infections and associated nonmelanoma skin cancers, providing additional genetic and tissue systems in which to study the TMC gene family. © 2003 Elsevier Science (USA). -
Co-Occurrence Based Meta-Analysis of Scientific Texts
Vol. 21 no. 9 2005, pages 2049–2058 BIOINFORMATICS ORIGINAL PAPER doi:10.1093/bioinformatics/bti268 Data and text mining Co-occurrence based meta-analysis of scientific texts: retrieving biological relationships between genes R. Jelier1,∗ G. Jenster2, L. C. J. Dorssers3, C. C. van der Eijk1, E. M. van Mulligen1, B. Mons1 and J. A. Kors1 1Department of Medical Informatics, 2Department of Urology and 3Department of Pathology, Erasmus MC—University Medical Center, Rotterdam, The Netherlands Received on July 15, 2004; revised on December 22, 2004; accepted on January 6, 2005 Advance Access publication January 18, 2005 ABSTRACT are studied, the number of relevant publications will frequently be Motivation: The advent of high-throughput experiments in molecu- prohibitively large. This renders the traditional approach of manu- lar biology creates a need for methods to efficiently extract and use ally searching bibliographic databases for every gene and reading information for large numbers of genes. Recently, the associative scientific articles inadequate. It is therefore an important challenge concept space (ACS) has been developed for the representation of at this time to make the available information both accessible and information extracted from biomedical literature. The ACS is a Euc- interpretable for molecular biologists. lidean space in which thesaurus concepts are positioned and the An interesting current development is the use of annotations of distances between concepts indicates their relatedness. The ACS genes with gene ontology (GO) terms (Ashburner et al., 2000; Camon uses co-occurrence of concepts as a source of information. In this et al., 2004) for the analysis of the results of microarray experiments paper we evaluate how well the system can retrieve functionally (Zhang et al., 2004; Al Shahrour et al., 2004). -
Gamma Tubulin (TUBG1) (NM 001070) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC119462 gamma Tubulin (TUBG1) (NM_001070) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: gamma Tubulin (TUBG1) (NM_001070) Human Untagged Clone Tag: Tag Free Symbol: TUBG1 Synonyms: CDCBM4; GCP-1; TUBG; TUBGCP1 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC119462 sequence for NM_001070 edited (data generated by NextGen Sequencing) ATGCCGAGGGAAATCATCACCCTACAGTTGGGCCAGTGCGGCAATCAGATTGGGTTCGAG TTCTGGAAACAGCTGTGCGCCGAGCATGGTATCAGCCCCGAGGGCATCGTGGAGGAGTTC GCCACCGAGGGCACTGACCGCAAGGACGTCTTTTTCTACCAGGCAGACGATGAGCACTAC ATCCCCCGGGCCGTGCTGCTGGACTTGGAACCCCGGGTGATCCACTCCATCCTCAACTCC CCCTATGCCAAGCTCTACAACCCAGAGAACATCTACCTGTCGGAACATGGAGGAGGAGCT GGCAACAACTGGGCCAGCGGATTCTCCCAGGGAGAAAAGATCCATGAGGACATTTTTGAC ATCATAGACCGGGAGGCAGATGGTAGTGACAGTCTAGAGGGCTTTGTGCTGTGTCACTCC ATTGCTGGGGGGACAGGCTCTGGACTGGGTTCCTACCTCTTAGAACGGCTGAATGACAGG TATCCTAAGAAGCTGGTGCAGACATACTCAGTGTTTCCCAACCAGGACGAGATGAGCGAT GTGGTGGTCCAGCCTTACAATTCACTCCTCACACTCAAGAGGCTGACGCAGAATGCAGAC TGTGTGGTGGTGCTGGACAACACAGCCCTGAACCGGATTGCCACAGACCGCCTGCACATC CAGAACCCATCCTTCTCCCAGATCAACCAGCTGGTGTCTACCATCATGTCAGCCAGCACC ACCACCCTGCGCTACCCTGGCTACATGAACAATGACCTCATCGGCCTCATCGCCTCGCTC ATTCCCACCCCACGGCTCCACTTCCTCATGACCGGCTACACCCCTCTCACTACGGACCAG TCAGTGGCCAGCGTGAGGAAGACCACGGTCCTGGATGTCATGAGGCGGCTGCTGCAGCCC -
Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement. -
Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses
medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened.