DOCSLIB.ORG

Expression Pattern of the PRDX2, RAB1A, RAB1B, RAB5A and RAB25 Genes in Normal and Cancer Cervical Tissues

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression Pattern of the PRDX2, RAB1A, RAB1B, RAB5A and RAB25 Genes in Normal and Cancer Cervical Tissues INTERNATIONAL JOURNAL OF ONCOLOGY 46: 107-112, 2015 Expression pattern of the PRDX2, RAB1A, RAB1B, RAB5A and RAB25 genes in normal and cancer cervical tissues ANDREJ NIKOSHKOV1, KRISTINA BROLIDEN2, SANAZ ATTARHA1,3, VITALI SVIATOHA3, ANN-CATHRIN HELLSTRÖM4, MIRIAM MINTS1 and SONIA ANDERSSON1 1Department of Women's and Children's Health, Division of Obstetrics and Gynecology, Karolinska Institute, Karolinska University Hospital Solna, 171 76 Stockholm; 2Department of Medicine Solna, Unit of Infectious Diseases, Center for Molecular Medicine, Karolinska Institute, Karolinska University Hospital, 171 76 Stockholm; 3Department of Oncology-Pathology, Karolinska Institute, 171 76 Stockholm; 4Department of Gynecological Oncology, Radiumhemmet, Karolinska University Hospital, 171 76 Stockholm, Sweden Received July 11, 2014; Accepted August 28, 2014 DOI: 10.3892/ijo.2014.2724 Abstract. Cervical cancer is the second most prevalent RAB1B transcript occurs in normal cervical tissue and in malignancy among women worldwide, and additional preinvasive cervical lesions; not in invasive cervical tumors. objective diagnostic markers for this disease are needed. Given the link between cancer development and alternative Introduction splicing, we aimed to analyze the splicing patterns of the PRDX2, RAB1A, RAB1B, RAB5A and RAB25 genes, which Alternative splicing is a process in which either different are associated with different cancers, in normal cervical combinations of exons or parts of exons are employed to tissue, preinvasive cervical lesions and invasive cervical generate new transcripts through the use of alternative-splicing tumors, to identify new objective diagnostic markers. Biopsies sites. More than 90% of human intron-containing genes of normal cervical tissue, preinvasive cervical lesions and undergo alternative splicing, which allows a single transcript invasive cervical tumors, were subjected to rapid amplification to encode a number of RNAs that produce various protein of cDNA 3' ends (3' RACE) RT‑PCR. Resulting PCR products isoforms with different functions (1). A complex array of were analyzed on agarose gels, gel‑purified and sequenced. cis elements (the splicing code) embedded in pre-mRNAs, Normal cervical tissue, preinvasive cervical lesions and together with trans-acting factors that bind to these elements, invasive cervical tumors contained one PCR product are required for the precise process of pre‑mRNA splicing and corresponding to full-length PRDX2, RAB5A and RAB25 its regulation. The splicing code for the majority of introns transcripts. All tissues contained two RAB1A‑specific PCR comprises short sequences that include the 5' and 3' splice products corresponding to the full-length transcript and one sites located at both intron-exon junctions and at the branch new alternatively spliced RAB1A transcript. Invasive cervical point. These sequences are recognized by the spliceosome, tumors contained one PCR product corresponding to the which is composed of five small nuclear ribonucleoproteins full-length RAB1B transcript, while all normal cervical tissue and ~150 proteins. In addition to the core cis elements in and preinvasive cervical lesions contained both the full-length pre‑mRNAs, other sequences in introns and exons, which are RAB1B transcript and three new alternatively spliced RAB1B recognized by cellular trans-acting factors, are also critical to transcripts. Alternative splicing of the RAB1A transcript the determination of splicing outcomes (2). occurs in all cervical tissues, while alternative splicing of the In the last few years, a link has emerged between cancer development and deregulation of alternative splicing (3). Approximately 10% of inherited or somatic mutations are localized within sequences coding canonical splice sites (4), and these mutations have been implicated in cancer susceptibility and tumor progression. One such example is Correspondence to: Professor Sonia Andersson, Department of the tumor suppressor gene p53, the most commonly mutated Women's and Children's Health, Division of Obstetrics and Gynecology, Karolinska Institute, Elevhemmet H2:00, Karolinska gene in human cancers. Isoforms of the p53 gene are created University Hospital Solna, 171 76 Stockholm, Sweden through alternative splicing, and their tumor suppressor E‑mail: [email protected] functions differ (5). ‘Silent’ mutations in the p53 gene have been predicted to affect splicing by creating splice sites in the Key words: cervical cancer, alternative splicing, peroxiredoxin 2, middle of an exon (6). Recently, it has been reported that an RAB1B, member RAS oncogene family attenuated form of familiar adenomatous polyposis is caused by the insertion of a single T between the second and third nucleotide of intron 4 of the APC gene, which leads to the 108 NIKOSHKOV et al: ExpREssION PATTERN OF DIAGNOSTIC BIOMARKERS IN CERVICAL CANCER skipping of exon 4, and a predicted expression of a truncated Materials and methods protein (7). Another good example of altered splicing in tumorigenesis occurs in the tumor suppressor gene BRCA1. Between 2012 and 2013, 28 women were enrolled in the present Mutations in the BRCA1 gene are well-known markers of study: 10 healthy female volunteers (c1-c10), eight women susceptibility to ovarian and breast cancer, the latter being with preinvasive cervical lesions (p1-p8), and 10 women with the most common malignancy in women. One such mutation invasive cervical tumors (i1-i10). Each woman underwent in the BRCA1 gene is an inherited nonsense mutation within a pelvic examination followed by biopsy collection at one exon 18 that disrupts the exonic splicing enhancer of the gene, of two departments in Stockholm, Sweden: the Division of provoking exon skipping (8). Obstetrics and Gynecology, Karolinska University Hospital, or Alterations in signaling pathways cause changes in the the Department of Gynecological Oncology, Radiumhemmet, abundance, localization and activity of splicing regulators, Karolinska University Hospital. All biopsies were immediately which in turn can cause a general deregulation of splicing, and flash frozen in liquid nitrogen and then stored at ‑80˚C. result in the occurrence of cancer‑specific transcripts that are Biopsies were grouped according to morphological diagnosis. associated with tumorigenesis. Recent progress in molecular Ethical approval was obtained from the Regional Ethics and cell biology has indicated that altered splicing profiles of Review Board in Stockholm, and an informed consent form critical genes may impact all aspects of cancer cell biology (9), was signed by all participants prior to inclusion. resulting in the inactivation of tumor suppressor genes (6), or the gain of function of proteins implicated in cancer suscepti- RNA preparations, cDNA synthesis. Approximately 30 mg of bility and tumor progression (9,10). biopsy tissue was homogenized in microtubes with disposable Human papillomavirus (HPV) infection is a necessary, but pestles driven by cordless motor (VWR, Radnor, PA, USA). not sufficient factor in the development of cervical neoplasia, Total RNA from homogenized biopsies was isolated using and persistent infection with high-risk HPV types, especially RNeasy kits (Qiagen, Hilden, Germany) according to the HPV16, is a significant risk factor in the development of manufacturer's instructions. Total RNA (200 ng) was reverse precancerous lesions and squamous cell carcinoma (11‑14). transcribed with SuperScript Ⅲ, and amplified with Platinum HPV‑16, ‑18, ‑45, ‑31 and ‑33 are the most frequently identified Taq DNA polymerase in 30 µl of a one‑step RT‑PCR system high‑risk HPV types in high‑grade squamous intraepithelial (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's lesions and squamous cell carcinoma (15), though HPV16 instructions. The reverse transcription reaction was performed predominates (16). An association has also been suggested at 50˚C to destroy mRNA secondary structures. between high viral load and the persistence of HPV infection (17). Promising HPV‑related markers of the risk of 3' RACE RT‑PCR. To detect multiple transcripts of the PRDX2, progression to cervical cancer include the integration status of RAB1A, RAB1B, RAB5A and RAB25 genes, we applied the high-risk HPV DNA in precancerous cervical lesions (18). HPV rapid amplification of cDNA 3' ends (3' RACE) RT‑PCR DNA integration into the host cell genome usually disrupts the approach, which uses the natural polyA tail that exists at the E1 and E2 open reading frames, but leaves those of E6 and 3' end of most eukaryotic mRNAs for priming during reverse E7 intact (19,20). The deletion of the E2 open reading frame transcription. cDNAs were generated using an oligo-dT‑adaptor due to HPV DNA integration leads to the disruption of E2 GACTCGAGTCGACATCGATAG(T)19 primer that comple- protein expression, and the upregulation of E6 and E7 protein ments the polyA stretch and adds a special adaptor sequence to transcription (21); continuous production of the oncogenic E6 the 5' end of each cDNA. Further amplification of cDNAs in and E7 proteins contribute to malignant progression. the one-step RT‑PCR reaction was performed using the reverse It was recently demonstrated that level of the splicing TAILR, GACTCGAGTCGACATCGATAG primer targeting activator ASF/SF2 (also known as arginine/serine-rich splicing the adaptor sequence, and forward PRDX164F, CAGTC factor 1) is modulated in the presence of HPV infection (22), ATGGCCTCCGGTAA; RAB1A397F, CTGCAGTGACAT as is the splicing
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • Anti-Rab11 Antibody (ARG41900)
    Product datasheet [email protected] ARG41900 Package: 100 μg anti-Rab11 antibody Store at: -20°C Summary Product Description Goat Polyclonal antibody recognizes Rab11 Tested Reactivity Hu, Ms, Rat, Dog, Mk Tested Application IHC-Fr, IHC-P, WB Host Goat Clonality Polyclonal Isotype IgG Target Name Rab11 Antigen Species Mouse Immunogen Purified recombinant peptides within aa. 110 to the C-terminus of Mouse Rab11a, Rab11b and Rab11c (Rab25). Conjugation Un-conjugated Alternate Names RAB11A: Rab-11; Ras-related protein Rab-11A; YL8 RAB11B: GTP-binding protein YPT3; H-YPT3; Ras-related protein Rab-11B RAB25: RAB11C; CATX-8; Ras-related protein Rab-25 Application Instructions Application table Application Dilution IHC-Fr 1:100 - 1:400 IHC-P 1:100 - 1:400 WB 1:250 - 1:2000 Application Note IHC-P: Antigen Retrieval: Heat mediation was recommended. * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Hepa cell lysate Calculated Mw 24 kDa Observed Size ~ 26 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer PBS, 0.05% Sodium azide and 20% Glycerol. Preservative 0.05% Sodium azide www.arigobio.com 1/3 Stabilizer 20% Glycerol Concentration 3 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Download Download
    Supplementary Figure S1. Results of flow cytometry analysis, performed to estimate CD34 positivity, after immunomagnetic separation in two different experiments. As monoclonal antibody for labeling the sample, the fluorescein isothiocyanate (FITC)- conjugated mouse anti-human CD34 MoAb (Mylteni) was used. Briefly, cell samples were incubated in the presence of the indicated MoAbs, at the proper dilution, in PBS containing 5% FCS and 1% Fc receptor (FcR) blocking reagent (Miltenyi) for 30 min at 4 C. Cells were then washed twice, resuspended with PBS and analyzed by a Coulter Epics XL (Coulter Electronics Inc., Hialeah, FL, USA) flow cytometer. only use Non-commercial 1 Supplementary Table S1. Complete list of the datasets used in this study and their sources. GEO Total samples Geo selected GEO accession of used Platform Reference series in series samples samples GSM142565 GSM142566 GSM142567 GSM142568 GSE6146 HG-U133A 14 8 - GSM142569 GSM142571 GSM142572 GSM142574 GSM51391 GSM51392 GSE2666 HG-U133A 36 4 1 GSM51393 GSM51394 only GSM321583 GSE12803 HG-U133A 20 3 GSM321584 2 GSM321585 use Promyelocytes_1 Promyelocytes_2 Promyelocytes_3 Promyelocytes_4 HG-U133A 8 8 3 GSE64282 Promyelocytes_5 Promyelocytes_6 Promyelocytes_7 Promyelocytes_8 Non-commercial 2 Supplementary Table S2. Chromosomal regions up-regulated in CD34+ samples as identified by the LAP procedure with the two-class statistics coded in the PREDA R package and an FDR threshold of 0.5. Functional enrichment analysis has been performed using DAVID (http://david.abcc.ncifcrf.gov/)
    [Show full text]
  • Genome-Wide Rnai Screening Identifies Human Proteins with A
    RESOURCES Genome-wide RNAi screening identifies human proteins with a regulatory function in the early secretory pathway Jeremy C. Simpson1,7, Brigitte Joggerst2, Vibor Laketa2, Fatima Verissimo2, Cihan Cetin2, Holger Erfle2,6, Mariana G. Bexiga1, Vasanth R. Singan1, Jean-Karim Hériché3, Beate Neumann3, Alvaro Mateos2, Jonathon Blake4, Stephanie Bechtel5, Vladimir Benes4, Stefan Wiemann5, Jan Ellenberg2,3 and Rainer Pepperkok2,7 The secretory pathway in mammalian cells has evolved to facilitate the transfer of cargo molecules to internal and cell surface membranes. Use of automated microscopy-based genome-wide RNA interference screens in cultured human cells allowed us to identify 554 proteins influencing secretion. Cloning, fluorescent-tagging and subcellular localization analysis of 179 of these proteins revealed that more than two-thirds localize to either the cytoplasm or membranes of the secretory and endocytic pathways. The depletion of 143 of them resulted in perturbations in the organization of the COPII and/or COPI vesicular coat complexes of the early secretory pathway, or the morphology of the Golgi complex. Network analyses revealed a so far unappreciated link between early secretory pathway function, small GTP-binding protein regulation, actin cytoskeleton organization and EGF-receptor-mediated signalling. This work provides an important resource for an integrative understanding of global cellular organization and regulation of the secretory pathway in mammalian cells. Within higher eukaryotic cells membrane traffic pathways connect the Extensive efforts over many years have revealed a significant number various membrane-bounded organelles, thereby ensuring that they of regulators associated with the secretory pathway. Early biochemical retain the correct complement of proteins and lipids to maintain approaches to identify individual machinery components have started cellular homeostasis.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Nuclear PTEN Safeguards Pre-Mrna Splicing to Link Golgi Apparatus for Its Tumor Suppressive Role
    ARTICLE DOI: 10.1038/s41467-018-04760-1 OPEN Nuclear PTEN safeguards pre-mRNA splicing to link Golgi apparatus for its tumor suppressive role Shao-Ming Shen1, Yan Ji2, Cheng Zhang1, Shuang-Shu Dong2, Shuo Yang1, Zhong Xiong1, Meng-Kai Ge1, Yun Yu1, Li Xia1, Meng Guo1, Jin-Ke Cheng3, Jun-Ling Liu1,3, Jian-Xiu Yu1,3 & Guo-Qiang Chen1 Dysregulation of pre-mRNA alternative splicing (AS) is closely associated with cancers. However, the relationships between the AS and classic oncogenes/tumor suppressors are 1234567890():,; largely unknown. Here we show that the deletion of tumor suppressor PTEN alters pre-mRNA splicing in a phosphatase-independent manner, and identify 262 PTEN-regulated AS events in 293T cells by RNA sequencing, which are associated with significant worse outcome of cancer patients. Based on these findings, we report that nuclear PTEN interacts with the splicing machinery, spliceosome, to regulate its assembly and pre-mRNA splicing. We also identify a new exon 2b in GOLGA2 transcript and the exon exclusion contributes to PTEN knockdown-induced tumorigenesis by promoting dramatic Golgi extension and secretion, and PTEN depletion significantly sensitizes cancer cells to secretion inhibitors brefeldin A and golgicide A. Our results suggest that Golgi secretion inhibitors alone or in combination with PI3K/Akt kinase inhibitors may be therapeutically useful for PTEN-deficient cancers. 1 Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of Chinese Ministry of Education, Shanghai Jiao Tong University School of Medicine (SJTU-SM), Shanghai 200025, China. 2 Institute of Health Sciences, Shanghai Institutes for Biological Sciences of Chinese Academy of Sciences and SJTU-SM, Shanghai 200025, China.
    [Show full text]
  • CHML Promotes Liver Cancer Metastasis by Facilitating Rab14 Recycle
    ARTICLE https://doi.org/10.1038/s41467-019-10364-0 OPEN CHML promotes liver cancer metastasis by facilitating Rab14 recycle Tian-Wei Chen1,2,3, Fen-Fen Yin1,2, Yan-Mei Yuan1,2, Dong-Xian Guan1, Erbin Zhang1,2, Feng-Kun Zhang1,2, Hao Jiang1,2, Ning Ma1,2, Jing-Jing Wang1, Qian-Zhi Ni1,2, Lin Qiu1, Jing Feng3, Xue-Li Zhang3, Ying Bao4, Kang Wang5, Shu-Qun Cheng5, Xiao-Fan Wang6, Xiang Wang7, Jing-Jing Li1,2 & Dong Xie1,2,8,9 Metastasis-associated recurrence is the major cause of poor prognosis in hepatocellular 1234567890():,; carcinoma (HCC), however, the underlying mechanisms remain largely elusive. In this study, we report that expression of choroideremia-like (CHML) is increased in HCC, associated with poor survival, early recurrence and more satellite nodules in HCC patients. CHML promotes migration, invasion and metastasis of HCC cells, in a Rab14-dependent manner. Mechanism study reveals that CHML facilitates constant recycling of Rab14 by escorting Rab14 to the membrane. Furthermore, we identify several metastasis regulators as cargoes carried by Rab14-positive vesicles, including Mucin13 and CD44, which may contribute to metastasis- promoting effects of CHML. Altogether, our data establish CHML as a potential promoter of HCC metastasis, and the CHML-Rab14 axis may be a promising therapeutic target for HCC. 1 CAS Key Laboratory of Nutrition, Metabolism and Food Safety, Shanghai Institute of Nutrition and Health, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Xuhui district 200031, China. 2 University of Chinese Academy of Sciences, Chinese Academy of Sciences, Xuhui district 200031, China. 3 Department of General Surgery, Fengxian Hospital Affiliated to Southern Medical University, 6600 Nanfeng Road, Shanghai 201499, China.
    [Show full text]
  • Rabbit Anti-RABEP1 Antibody-SL19721R
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-RABEP1 antibody SL19721R Product Name: RABEP1 Chinese Name: RABEP1蛋白抗体 Neurocrescin; Rab GTPase binding effector protein 1; RAB5EP; Rabaptin 4; Rabaptin Alias: 5; Rabaptin 5alpha; RABPT5; RABPT5A; Renal carcinoma antigen NY REN 17; Renal carcinoma antigen NYREN17. Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Rat, ELISA=1:500-1000IHC-P=1:400-800IHC-F=1:400-800ICC=1:100-500IF=1:100- 500（Paraffin sections need antigen repair） Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 99kDa Cellular localization: The cell membrane Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human RABEP1:501-600/862 Lsotype: IgGwww.sunlongbiotech.com Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. PubMed: PubMed RABEP1 is a Rab effector protein acting as linker between gamma-adaptin, RAB4A and RAB5A. It is involved in endocytic membrane fusion and membrane trafficking of Product Detail: recycling endosomes. Stimulates RABGEF1 mediated nucleotide exchange on RAB5A.
    [Show full text]
  • Downloaded and Presented
    International Journal of Molecular Sciences Article Comprehensive Analysis of Expression, Clinicopathological Association and Potential Prognostic Significance of RABs in Pancreatic Cancer Shashi Anand 1,2, Mohammad Aslam Khan 1,2, Moh’d Khushman 3 , Santanu Dasgupta 1,2 , Seema Singh 1,2,4 and Ajay Pratap Singh 1,2,4,* 1 Department of Pathology, College of Medicine, University of South Alabama, Mobile, AL 36617, USA; [email protected] (S.A.); [email protected] (M.A.K.); [email protected] (S.D.); [email protected] (S.S.) 2 Cancer Biology Program, Mitchell Cancer Institute, University of South Alabama, Mobile, AL 36604, USA 3 Department of Medical Oncology, Mitchell Cancer Institute, University of South Alabama, Mobile, AL 36604, USA; [email protected] 4 Department of Biochemistry and Molecular Biology, College of Medicine, University of South Alabama, Mobile, AL 36688, USA * Correspondence: [email protected]; Tel.: +1-251-445-9843; Fax: +1-251-460-6994 Received: 3 July 2020; Accepted: 30 July 2020; Published: 4 August 2020 Abstract: RAB proteins (RABs) represent the largest subfamily of Ras-like small GTPases that regulate a wide variety of endosomal membrane transport pathways. Their aberrant expression has been demonstrated in various malignancies and implicated in pathogenesis. Using The Cancer Genome Atlas (TCGA) database, we analyzed the differential expression and clinicopathological association of RAB genes in pancreatic ductal adenocarcinoma (PDAC). Of the 62 RAB genes analyzed, five (RAB3A, RAB26, RAB25, RAB21, and RAB22A) exhibited statistically significant upregulation, while five (RAB6B, RAB8B, RABL2A, RABL2B, and RAB32) were downregulated in PDAC as compared to the normal pancreas.
    [Show full text]
  • Inhibition of TFG Function Causes Hereditary Axon Degeneration by Impairing Endoplasmic Reticulum Structure
    Inhibition of TFG function causes hereditary axon degeneration by impairing endoplasmic reticulum structure Christian Beetza, Adam Johnsonb, Amber L. Schuhb, Seema Thakurc, Rita-Eva Vargaa, Thomas Fothergilld, Nicole Hertele, Ewa Bomba-Warczakd, Holger Thielef, Gudrun Nürnbergf, Janine Altmüllerf,g, Renu Saxenah, Edwin R. Chapmand, Erik W. Dentd, Peter Nürnbergf,g,i, and Anjon Audhyab,1 aDepartment of Clinical Chemistry and Laboratory Medicine, Jena University Hospital, 07747 Jena, Germany; bDepartment of Biomolecular Chemistry, University of Wisconsin School of Medicine and Public Health, Madison, WI 53706; cDepartment of Genetics and Fetal Medicine, Fortis La Femme, New Delhi 110048, India; dDepartment of Neuroscience, University of Wisconsin Medical School, Madison, WI 53706; eInstitute of Anatomy I, Jena University Hospital, 07740 Jena, Germany; fCologne Centre for Genomics, University of Cologne, 50931 Cologne, Germany; gCologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases, University of Cologne, 50931 Cologne, Germany; hCentre of Medical Genetics, Sir Ganga Ram Hospital, New Delhi 110048, India; and iCenter for Molecular Medicine Cologne, University of Cologne, 50931 Cologne, Germany Edited by Charles Barlowe, Dartmouth Medical School, and accepted by the Editorial Board February 15, 2013 (received for review October 2, 2012) Hereditary spastic paraplegias are a clinically and genetically hetero- (iii) components of the early secretory pathway that control vesicle geneous group of gait disorders. Their pathological hallmark is a biogenesis and egress (10–16). Among the best-characterized HSP length-dependent distal axonopathy of nerve fibers in the cortico- genes are SPAST, ATL1,andREEP1, all of which encode proteins spinal tract. Involvement of other neurons can cause additional (spastin, atlastin-1, and REEP1, respectively) that potentially neurological symptoms, which define a diverse set of complex regulate ER organization.
    [Show full text]
  • Loss of Rab25 Promotes the Development of Intestinal Neoplasia in Mice and Is Associated with Human Colorectal Adenocarcinomas
    Loss of Rab25 promotes the development of intestinal neoplasia in mice and is associated with human colorectal adenocarcinomas Ki Taek Nam, … , Robert J. Coffey, James R. Goldenring J Clin Invest. 2010;120(3):840-849. https://doi.org/10.1172/JCI40728. Research Article Oncology Transformation of epithelial cells is associated with loss of cell polarity, which includes alterations in cell morphology as well as changes in the complement of plasma membrane proteins. Rab proteins regulate polarized trafficking to the cell membrane and therefore represent potential regulators of this neoplastic transition. Here we have demonstrated a tumor suppressor function for Rab25 in intestinal neoplasia in both mice and humans. Human colorectal adenocarcinomas exhibited reductions in Rab25 expression independent of stage, with lower Rab25 expression levels correlating with substantially shorter patient survival. In wild-type mice, Rab25 was strongly expressed in cells luminal to the proliferating cells of intestinal crypts. While Rab25-deficient mice did not exhibit gross pathology, ApcMin/+ mice crossed onto a Rab25-deficient background showed a 4-fold increase in intestinal polyps and a 2-fold increase in colonic tumors Min/+ compared with parental Apc mice. Rab25-deficient mice had decreased β1 integrin staining in the lateral membranes of villus cells, and this pattern was accentuated in Rab25-deficient mice crossed onto the ApcMin/+ background. Additionally, Smad3+/– mice crossed onto a Rab25-deficient background demonstrated a marked increase in colonic tumor formation. Taken together, these results suggest that Rab25 may function as a tumor suppressor in intestinal epithelial cells through regulation of protein trafficking to the cell surface. Find the latest version: https://jci.me/40728/pdf Research article Loss of Rab25 promotes the development of intestinal neoplasia in mice and is associated with human colorectal adenocarcinomas Ki Taek Nam,1,2 Hyuk-Joon Lee,2,3 J.
    [Show full text]