sign in sign up
<<
Home , Aldosterone synthase, Cytochrome P450

2016, 63 (3), 301-310

Original The combination of a novel 2 bp deletion mutation and p.D63H in CYP11B1 cause congenital adrenal hyperplasia due to 11β-hydroxylase deficiency

Yang Long1), 2), Su Han3), Xiangxun Zhang1), Xiaojuan Zhang1), Tao Chen3), Yun Gao3) and Haoming Tian3)

1) Laboratory of Endocrinology and , West China Hospital of Sichuan University, Chengdu, Sichuan 610041, P R China 2) Laboratory of Endocrinology, Experimental Center, Affiliated Hospital of Luzhou Medical College, Luzhou, Sichuan 646000, P R China 3) Department of Endocrinology and Metabolism, West China Hospital of Sichuan University, Chengdu, Sichuan 610041, P R China

Abstract. Deficiency of steroid 11β-hydroxylase activity occurs in 5–8% of patients with congenital adrenal hyperplasia (CAH). The aim of the current study was to identify mutations in the CYP11B1 of a patient with CAH due to deficiency of steroid 11β-hydroxylase activity, and to study the functional and structural consequences of these mutations. A molecular genetic analysis of the CYP11B1 gene in this patient and her parents identified a known missense mutation g.5194G>C (p.D63H) and a novel 2 bp deletion mutation (g.9525_9526delCT, corresponding to p.L380V…R420X) in the patient. In vitro expression studies in COS7 cells revealed a decreased 11β-hydroxylase activity in the p.D63H mutant to 2.0±0.8% and in the p.L380V…R420X mutant to 0.2±2.2% for the conversion of 11-deoxycortisol to . Three dimensional models for the normal and mutant were built by using the recently published x-ray structure of the human CYP11B2 as a template. Presumably, the g.9525_9526delCT mutation in CYP11B1 resulted in a truncated with a misfolded C-terminal domain that could not efficiently bind , , and adrenodoxin and had lost its biochemical function. In summary, CAH due to steroid 11β-hydroxylase deficiency can be attributed to both the novel deletion mutation (g.9525_9526delCT, corresponding to p.L380V…R420X) and known missense mutation (g.5194G>C corresponding to p.D63H) in CYP11B1.

Key words: Congenital adrenal hyperplasia, Steroid 11β-hydroxylase activity deficiency, CYP11B1, Mutation, Protein model

CONGENITAL ADRENAL HYPERPLASIA fasciculata/reticularis and and cat- (CAH) is an inheritable disorder of cortisol deficiency. alyzes 11β- of 11-deoxycortisol to cor- Deficiency of steroid 11β-hydroxylase activity occurs tisol and of 11-deoxycorticosterone to corticoste- in 5–8% of CAH [1, 2], and ranks behind the 21-hydrox- rone. Decreased or loss of 11β-hydroxylase activity ylase deficiency which is the most common cause of interrupts the process of adrenal biosynthe- CAH, up to 90–95% [3]. Steroid 11β-hydroxylase, a sis, and results in the excessive production of adrenal mitochondrial P450, is expressed in zona and non-11β-hydroxylated steroid precur- Submitted Jul. 22, 2015; Accepted Dec. 11, 2015 as EJ15-0433 sors while biosynthesis of cortisol and Released online in J-STAGE as advance publication Jan. 22, 2016 is impaired. Consequently, CAH patient due to defi- Correspondence to: Haoming Tian, M.D., Department of ciency of steroid 11β-hydroxylase activity develop Endocrinology and Metabolism, West China Hospital, Sichuan severe , , or both. Moreover, University, 37 GuoXue Street, Chengdu, Sichuan 610041, China. affected females are born with masculinized external E-mail: [email protected] genitalia, while male patients develop isosexual pre- Abbreviations: CAH, congenital adrenal hyperplasia; Adx, adrenodoxin; AR, adrenodoxin ; PTC, premature cocious puberty. Short adult stature, owing to rapid translation-termination codon somatic growth with premature epiphyseal closure, is ©The Japan Endocrine Society 302 Long et al. observed in both sexes patients as a result of excessive preformed, and delta was taken irregularly. plasma level of [2]. When she was 12 years old menophania took place and Gene for steroid 11β-hydroxylase, denominated as she experienced severe menorrhalgia. CYP11B1, has nine exons of 5.4Kb in size and locates at 8q21-22, tandemly arranged with the DNA preparation, PCR amplification and sequencing CYP11B2 gene encoding synthase. Most of Genomic DNA was isolated from peripheral blood known mutations are clustered in exons 2, 6, 7, 8 [4, 5]. leukocytes using standard procedures. The entire In our current study, we reported a case of congenital encoding region of CYP11B1 gene was amplified by adrenal hyperplasia due to 11β-hydroxylase deficiency PCR. Four pairs of specific primers (see Table 1) and performed mutation analysis of CYP11B1 gene for were used to amplify exons 1–2, exons 3–5, exon 6–7, the family of the patient. The patient was heterozy- exon 8–9, respectively. The samples were heated at gous in p.D63H mutation, and inherited the allele with 94°C for 4 min, and then 94°C for 30 sec, annealing p.L380V…R420X mutation from her father and loss for 30 sec, 72°C for 1 min for a total of 30 cycles; a of the wild-type allele from her mother and resulted in final cycle consisted of 72°C for 10 min. The ampli- absolutely loss of function of 11β-hydroxylase and the fied PCR productions were purified and sequencing occurrence of CAH. To explore the influence of the was performed on ABI 377XL DNA sequencer using a mutations reported in this study on the protein struc- BigDye Terminator v3.1 Cycle Sequencing Kit. ture and function, three dimensional homology mod- els for the normal and mutant proteins were built. Construction of plasmids and site-directed - Additionally, in vitro expression and activ- esis ity assays were performed to demonstrate whether Total RNA was extracted from human adrenal these mutations were responsible for the phenotypical using Trizol reagent (Invitrogen Corp., Carlsbad, CA, expression of CAH due to 11-hydroxylase deficiency USA) and RNA concentration and purity were deter- in our patient. mined by measuring OD260, OD260/280 ratio and OD260/230 ratio. RNA was reverse transcribed into Materials and Methods cDNA using PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (TAKARA Bio Inc., Dalian, Subjects China). The human full-length CYP11B1, adrenodoxin A 19-yr-old woman who was clinically diagnosed (Adx), and (AR) cDNA were with CAH due to 11β-hydroxylase deficiency and amplified using primers shown as follow: CYP11B1 with 146cm in height, 40Kg in weight and hyper- (S: 5′ ATCAAGCTTAATGGCACTCAGGGCAAA 3′; tension (210-240/140-150 mmHg) was studied. The AS: 5′ ATGCTCGAGTTAGTTGATGGCTCTGAAG patient was born with masculinized external genita- GT 3′), ADX (S: 5′ ATCAAGCTTAGTTCCCGACCG lia. Clitoridectomy and exploratory laparotomy were CGGGCGATGGCT 3′; AS: 5′ AGTCTCGAGTAGTT practiced when she was 3 years old, and during the CAGGAGGTCTTGCCCACAT 3′), AR (S: 5′ ATCA operation ovaries and uterus were seen in the pelvis. AGCTTGCAGGTTGCTGTTCCCAGCCAT 3′; AS: When she was 10-years old cortisol replacement was 5′ ATGCTCGAGCGGGGCTGGGGCTGGGCTCAG

Table 1 List of primers used for amplification and sequencing of CYP11B1 Primer Location Amplification Sequence 5′→3′ Purpose 1 (s) 5′-untranslated CGAAGGCAAGGCACCAGGCAAGAT PCR/sequencing Exon 1, 2 2 (as) Intron 2 CAGGCTGCCCACCCAGC PCR/sequencing 3 (s) Intron2 GCAGACACTTCACTGGGGCTG PCR/sequencing Exon 3, 4, 5 5 (as) Intron 5 CCTAATGCCCATCCAAACCC PCR/sequencing 6 (s) Intron 5 TCTGTGGAGGACTCAGGGAAAG PCR/sequencing Exon 6, 7 7 (as) Intron 7 CTGCCCAGTCCAGGAAACAT PCR/sequencing 8 (s) Intron 7 CAGTCATTCCCTGATCC PCR/sequencing Exon 8, 9 9 (as) 3′-untranslated TGCTGCTTAGCCTGGCAAACCCTG PCR/sequencing Novel 2 bp deletion mutation in CYP11B1 303

T 3′), and cloned into pMD 18-T Vector (TAKARA anti-Grp75 antibody (Santa Cruz Biotechnology, Inc, Bio Inc., Dalian, China). The was per- CA, USA), as a mitochondrial marker, each in a 1:100 formed from the pMD-CYP11B1 construct using dilution. As secondary antibodies the anti-- TaKaRa MutanBEST Kit (TAKARA Bio Inc., Dalian, ALEXA594 antibody (ZSGB-Bio, Beijing, China) China). The sequence of full length of Adx, AR, and the anti-rabbit- ALEXA594 antibody (ZSGB-Bio, CYP11B1 cDNA and the mutagenesis of c.187G>C Beijing, China) were used in 1:100 dilutions. and c.1138_1139delCT were confirmed by sequencing. The confirmedCYP11B1 , mutated CYP11B1, Adx, and Structural analysis AR cDNA fragments were cloned into the HindIII/ To explore the influence of the mutations reported XhoI site of the pcDNA3.1/Zeo(+) expression vector, in the current study on the protein structure and func- resulting pcDNA-CYP11B1, pcDNA-CYP11B1-D63H, tion, three dimensional homology models for the nor- pcDNA-CYP11B1-ΔL380, pcDNA-Adx, and pcDNA- mal and mutant proteins were developed using Beta AR constructs. SWISS MODEL (http://beta.swissmodel.expasy.org/) [6, 7], a free tool for protein structure modeling. The In vitro expression and enzyme activity assays methods of building model are briefly described as COS7 cells were cultured in high-glucose DMEM follow. Firstly, the wild-type sequence of CYP11B1 supplemented with 100 U of penicillin/mL, 100 μg protein was obtained from the National Center of streptomycin/mL, and 10% FBS in 5% CO2, 37°C for Biotechnology Information (NCBI Reference incubator. Approximately 1 × 105 cells were plated Sequence: NP_000488.3). Then, the SWISS-MODEL and transiently transfected with 0.4 μg of each pcDNA- template library (SMTL version 16-12-13, PDB release CYP11B1 construct, 0.3 μg pcDNA-Adx, and 0.3 μg 06-12-2013) was searched with Blast and HHBlits for pcDNA-AR using Lipofectamine® LTX Reagent evolutionary related structure matching the sequence (Invitrogen Corp., Carlsbad, CA, USA) according to of CYP11B1 [8-10]. The template’s quality was pre- the manufacturer’s protocol. dicted by the target-template alignment. PDB ID: The 11β-hydroxylase activity was measured in intact 4DVQ.1.A, which is crystal structure of human aldo- COS7 24 after transient transfection. The cells were sterone synthase (mitochondrial P450 11B2) with res- incubated with 0.5 mL full DMEM medium containing olution of 2.49Å and with sequence identity of 93.6% 250 nmol/L 11-deoxycortisol for 24 h at 37°C. After with CYP11B1, was selected as the template for model incubation, culture medium was collected and concen- building of CYP11B1 using Promod. At the end of trations of cortisol were detected using 125I Cortisol modeling, the global and per-residue model quality Radioimmunoassay Kit (Beijing north institute of bio- was assessed using the QMEAN scoring function [11]. logical technology, Beijing, China). Cells were lysed The structural representations were generated with in lysis buffer (Beyotime Institute of Biotechnology, PyMOL, a Python based open-source viewer for visu- Beijing, China) followed by determination of pro- alization of macromolecular structures. tein concentration with Thermo Scientific Pierce BCA Protein Assay Kit. Statistics The activity of cells expressing the CYP11B1 wild- Data are expressed as mean ± SEM. Data were ana- type protein was defined as 100% after correction lyzed by 1-way ANOVA. P values of less than 0.05 for the activity of cells transfected with the empty were considered statistically significant. pcDNA3.1/Zeo (+) vector. The 11β-hydroxylase activ- ity of the mutant was expressed as a percentage of sub- Results strate conversion in nanomoles per milligram per min- ute of wild type activity. Clinical characteristics of a female CAH patient due to 11β-hydroxylase deficiency Immunofluorescence Table 2 summarizes the clinical, biochemical data The immunofluorescence was performed using a of the affected subject. The patient had severe hyper- standard protocol. The anti-CYP11B1 rabbit anti- tension, hypokalemia and ambiguity of the external body (Santa Cruz Biotechnology, Inc, CA, USA) was genitalia. Physical examination showed that the body used as primary antibody in combination with a mouse height was 146cm and was 1.1 standard deviation (SD) 304 Long et al.

Table 2 Summary of clinical, biochemical data of the affected subject with steroid 11β-hydroxylase deficiency Parameters Results Reference range (mmHg) 210 - 240 / 140 - 150 < 120 / < 80 Testosterone (ng/mL) 3.8 0.06 - 0.8 (pg/mL) 115.0 100 - 130 (ng/mL) 4.89 0.2 - 1.3 at 0800 h 121.4 138 - 690 Cortisol (nmol/L) at 1600 h 108.4 70 - 345 at 2400 h 73.6 < 140 Serum K+ (mmol/L) 3.12 3.5 - 5.0 Urine K+ (mmol/24h) 20.36 51 - 100 (On the premise of normal serum K+) Supine 0.09 0.42 ± 0.37 Angiotensin I (ng/L·h) Upright 0.10 1.68 ± 1.12 Supine 17.6 40.2 ± 12 Angiotensin II (ng/L) Upright 18.3 50.3 ± 21.3 Supine 57.1 45 - 175 Aldosterone (ng/L) Upright 70.3 98 - 275 DHEA (ng/mL) 2.3 0.8 - 10.5 DHEAS (μg/dL) 85 19 - 63 K+, potassium; DHEA, dehydroepiandrosterone; DHEAS, dehydroepiandrosterone sulphate

below the mean level of normal control with the same Otherwise, this patient carried a novel homozygous 2 chromosomal sex and age. These signs implied andro- bp deletion (g.9525_9526delCT in exon 7) resulting in gen excess and elevated metabolites with mineralo- a frameshift with premature termination of a truncated corticoid activity such as deoxycorticosterone and its protein (p.L380V…R420X). The g.9525_9526delCT derivatives which resulted in hypertension. As shown mutation was also found in heterozygous state in the in Table 2, plasma levels of , progestogen father of the patient. were markedly elevated in the affected subject, while the plasma level of cortisol at 0800 h was low, with In vitro expression of wild type and mutant CYP11B1 no aldosterone and plasma angiotensin II response for and 11β-hydroxylase activity assays upright posture. Diagnose of 11β-hydroxylase activity To clarify whether these mutations found in this arti- deficiency was made. cle were responsible for the phenotypical expression of CAH due to 11-hydroxylase deficiency in our patient, a Sequencing analysis of CYP11B1 gene for the family further functional in vitro analysis was performed. The of the patient results of immunofluorenscence studies showed that To identify the genetic defect in the affected subject the wild type and mutants were correctly localized in sequencing analysis of CYP11B1 gene was performed. the mitochondrial membrane of transiently transfected The results of sequencing analysis (Fig. 1) showed that COS-7 cells (Fig. 2). Enzyme activity studies demon- two previously described variant (g.5194G>C, cor- strated that the p.D63H and p.L380V…R420X muta- responding to c.187G>C in exon 1 and g.8499G>A, tions reduced the 11β-hydroxylase activity to 2.0% corresponding to c.873G>A in exon 5) and a novel (P<0.001) and 0.2% (P<0.001) for the conversion of 2 bp deletion (g.9525_9526delCT, corresponding 11-deoxycortisol to cortisol respectively (Fig. 3). to c.1138_1139delCT in exon 7) were found in the patient. The g.5194G>C missense mutation was in Discussion heterozygous state in the patient and her parents. This mutation resulted in the substitution of aspartic acid In this present study, we described that the combina- to histidine at position 63 (p.D63H) of the tion of the novel frameshift deletion p.L380V…R420X 11β-hydroxylase. The variant g.8499G>A in exon and known missense mutation p.D63H in the CYP11B1 5 of CYP11B1 gene was found in homozygous state gene led to 11β-hydroxylase activity deficiency in a in the patient and in heterozygous state in her father. patient suffering from CAH. And our functional anal- Novel 2 bp deletion mutation in CYP11B1 305

Fig. 1 Mutation analysis of the CYP11B1 gene in the Chinese family. For each mutation, the CYP11B1 gene sequences of patient (left panel), father (the second panel from left) and mother (the second panel from right ) are shown. The right panel shows the pedigree tree for each mutation.

Fig. 2 The immunofluorescence studies of expression and location of wild-type (WT), p.D63H and p.L380V…R420X mutant. In the left panel, the mitochondrial Grp75 protein was marked by using a mouse anti-Grp75 antibody as primary antibody and stained by the anti-mouse-ALEXA594 antibody as secondary antibody. The second panel from the left shows mitochondrial localization of the human 11-hydroxylase by using anti-human-CYP11B1 rabbit polyclonal antiserum as primary and the anti- rabbit-ALEXA488 antibody as secondary antibody. The second panel from the right shows the nucleus stained with DAPI. The intracellular colocalization of the CYP11B1 protein and the Grp75 protein in COS-7 cells is depicted in the right panel. 306 Long et al.

mutation via mitotic recombination in an early zygote stage [18]. Except that, loss of one allele of CYP11B1 gene in the patient may be another explanation. The mother may be carry a large deletion in one allele of CYP11B1 gene or a chimeric CYP11B1/CYP11B2 gene which lost 3′ coding sequence of CYP11B1 gene, and unfortunately the patient inherited it from her mother and p.L380V…R420X was in a hemizygous state in the patient. The three-dimensional structural model of CYP11B1 was built by using the recently published x-ray struc- ture of the human CYP11B2 as a template and showed Fig. 3 11-hydroxylase activities of CYP11B1. The activities of that the aspartic acid 63 residue was localized just mutants are expressed as percentage of wild-type activity, before the beginning of A-helix of CYP11B1 (Fig. 4a) which is defined as 100%. Values are depicted for the [19]. The proteins encoded by CYP11B1 and CYP11B2 conversion of 11-deoxycortisol to cortisol at a substrate concentration of 250 nmol/L of unlabeled steroid (time of share 93% identity but perform different function. The incubation, 24h). Error bars represent the mean±SD (%). classical steroid 11β-hydroxylase (CYP11B1) just has **P < 0.001 11β-hydroxylase activity to hydroxylate 11-deoxy- cortisol to cortisol as well as 11-deoxycorticoste- rone to cortisosterone, while ysis demonstrated that p.D63H, which has been reg- (CYP11B2) has steroid 18- hydroxylase activity to syn- istered in SNP database as rs5282 [12], significantly thesize aldosterone and 18-oxocortisol as well as ste- reduced the 11β-hydroxylase activity. Here, we also roid 11β-hydroxylase activity. The nonidentical amino described a known synonymous variant g.8499G>A in acids may account for the isoform-sepecific activ- exon 5 of CYP11B1 gene which has also been register ity and the substrate specificity [19]. The aspartic in SNP database as rs34570566 [13]. acid 63 residue of CYP11B1 is one of the amino acids As showed in the pedigree graph (Fig. 1), the which are different from CYP11B2 and as most of the p.L380V…R420X was heterozygous in her father’s different amino acids it is located far away from the genome and her mother displayed the wild-type and at the surface of the predicted model of CYP11B1 sequence. As for the patient, retention of the CYP11B1 (Fig. 5 and Fig. 6a). Surprisingly, the results allele with p.L380V…R420X mutation from her father of our in vitro expression experiments showed that the and loss of the wild-type allele from her mother resulted 11β-hydroxylase which carried the p.D63H mutation in absolutely loss of function of 11β-hydroxylase and led to a residual enzyme activity of 2% (Fig. 3). the occurrence of CAH. Here, we hypothesized that the The novel 2 bp deletion mutation p.L380V… maternal wild-type CYP11B1 allele of the patient expe- R420X was predicted to acquire a misfolded fragment rienced deleterious DNA damage and some kind of at the C-terminal and to generate a truncated protein repairing mechanism was employed to repair the dam- with a premature stop codon at amino acid position aged DNA by using paternal allele as temple in early 420 of CYP11B1 (Fig. 6b). As expected, the truncated zygote stage. As a result, the patient was homologous CYP11B1 completely lost the function of 11 hydroxy- in p.L380V…R420X. Deleterious damaged DNA, lase activity. There are three possible explanations for such as double-strands break, should be repaired by the almost complete loss of CYP11B1 enzyme activity reciprocal crossover, break-induced replication, con- caused by the p.L380V…R420X mutation. version without crossover and chromosome loss, all of pocket in the active site are a highly conserved regions in which should resulted in loss of heterozygosity. Loss (Fig. 4b). Cysteine at posi- of heterozygosity of wild-type allele of specific gene, tion 450 (C450) locates in the Cys-pocket in CYP11B1 such as RB-1 [14, 15], DICER1 [16, 17], in somatic and is presumed to form the fifth to heme iron cell are reported to be associated with the occurrence (Fig. 6c). Mutations around C450 in CYP11B1, such of some kind of tumor. Moreover, A. Neuhäuser-Klaus as p.R448H [20, 21], p.R453Q [22], were reported to has reported loss of heterozygosity of a specific locus cause almost complete loss of 11β-hydroxylase activ- Novel 2 bp deletion mutation in CYP11B1 307

Fig. 4 Multiple CYP11B1 Clustal Omega alignments. The D63 (a), cysteine pocket (including C450) (b) and C-GR/KR-E motif (c) of human CYP11B1 and corresponding amino acids of the aligned CYPs are shaded.

Fig. 5 Molecular surface representations of CYP11B1 (a) and mutant with p.D63H mutation (b). ity, and the p.L451F [23] mutation in aldosterone syn- 6d). Secondly, the truncated protein with p.L380V… thase abolished CYP11B2 enzyme activity. The trun- R420X mutation was not efficient in binding substrate cated protein with p.L380V…R420X mutation was because of substitution of L380V, F381S and L382G lack of C450 and residues around it and could not cor- and lacking of F487 and I488 which were predicted rectly interact with the heme prosthetic group (Fig. to forming the active site for binding deoxycorticoste- 6d). In addition to C450, the truncated protein was rone (Fig. 6e, 6f). In addition, the p.L380V…R420X also lack of 10 amino acids, eight of which (P442, mutation could have a negative impact on the inter- F443, G444, L445, R448, Q449, L451, G452) are action with the providing protein adreno- located between K″ and L helix and the other two doxin. The activity of 11β-hydroxylase depends on (L455, A456) on the L helix of the predicted model two electron transfer proteins, adrenodoxin reduc- of CYP11B1, which were predicted to be involved in tase and Adx that transfer 2 from NADPH to forming the active site for binding heme iron (Fig. 6c, the P450. The C-GR/KR-E motif is specifically con- 308 Long et al.

Fig. 6 Three-dimensional molecular models of CYP11B1 and mutant with p.L380V…R420X mutation. (a) Total view of the three- dimensional model structure of CYP11B1. Amino acid residue D63 is shown in purple sphere, and the fragment from L380 to the C-terminal of CYP11B1 is shown in white. (b) The three dimensional model structure of mutant with p.L380V…R420X mutation. The fragment from L380 to the C terminal of the mutant is shown in white. (c) The active site of CYP11B1 for binding heme iron. The violet amino acids residues are depicted for amino acids which were predicted to forming the active site for binding heme iron. (d) The active site of mutant with p.L380V…R420X mutation for binding heme iron. (e) The active site of CYP11B1 for binding substrate (DOC). The violet amino acids residues are depicted for amino acids which were predicted to forming the active site for binding DOC. (f) The active site of mutant with p.L380V…R420X mutation for binding DOC. (g) Molecular surface representations of CYP11B1. The corresponding residues of C-GR/KR-E motif (R453, R454 and E457) in human CYP11B1 are colored by blue. The fragment from L380 to the C-terminal of CYP11B1 is shown in white. (h) Molecular surface representation of mutant with p.L380V…R420X mutation. The fragment from L380 to the C-terminal of the mutant is shown in white. Novel 2 bp deletion mutation in CYP11B1 309 served in mitochondrial P450s (Fig. 4c) and is impor- Conclusion tant for the interaction with Adx and enzymatic activ- ity [24, 25]. The corresponding residues of human In this current study, we reported the combination CYP11B1 (Arg453, Arg454 and Glu457) are located in of the novel frameshift deletion p.L380V…R420X and L-helix and involved in form the interaction interface known missense mutation p.D63H in the CYP11B1 with Adx (Fig. 6g). One can expect that the CYP11B1 gene led to 11β-hydroxylase activity deficiency in mutant with p.L380V…R420X mutation, in which patient suffering from CAH. By the means of in vitro Arg453, Arg454 and Glu457 are absent (Fig. 6g, 6h), enzyme activity analysis we demonstrated that mutant affects the interaction between CYP11B1 and Adx. CYP11B1 which carried the novel p.L380V…R420X Now, we can come to a conclusion that the p.L380V… mutation and the previously known p.D63H mutations R420X mutation in CYP11B1 results in a truncated led to significantly decreased 11-hydroxylase activity. protein with misfolded C-terminal which cannot effi- However, there are still some limitations in our paper. ciently bind of heme iron, substrate and Adx and lose We could not draw a conclusion that p.L380V… its biochemical function in converting of 11-deoxycor- R420X was in homologous or hemizygous state in the tisol to cortisol and deoxycorticosterone to corticos- patient. Long PCR, micro satellite analysis, multiplex terone. In addition to the influence of the p.L380V… ligation-dependent probe amplification (MLPA) or R420X mutation on protein structure of 11-hydroxy- quantitative PCR should be adopted to administrate it. lase, premature translation-termination codon (PTC), as a consequence of 2-bp deletion mutation, may be Competing of Interests initiate nonsense-mediated decay of mRNA with PTC [26]. As a result, the protein level of 11-hydroxylase The authors declare that there is no competing of should be decreased. interests regarding the publication of this article.

References 1. White P C, Dupont J, New M I, Leiberman E, Hochberg SWISS-MODEL: An automated protein homology- Z, et al. (1991) A mutation in CYP11B1 (Arg-448---- modeling server. Nucleic Acids Res 31: 3381-3385. His) associated with steroid 11 beta-hydroxylase defi- 8. Remmert M, Biegert A, Hauser A, Soding J (2011) ciency in Jews of Moroccan origin. J Clin Invest 87: HHblits: lightning-fast iterative protein sequence 1664-1667. searching by HMM-HMM alignment. Nat Methods 9: 2. Zhao L Q, Han S, Tian H M (2008) Progress in molec- 173-175. ular-genetic studies on congenital adrenal hyperplasia 9. Soding J (2005) Protein homology detection by HMM- due to 11beta-hydroxylase deficiency. World J Pediatr HMM comparison. Bioinformatics 21: 951-960. 4: 85-90. 10. Altschul S F, Gish W, Miller W, Myers E W, Lipman D 3. Sarafoglou K, Lorentz C P, Otten N, Oetting W S, J (1990) Basic local alignment search tool. J Mol Biol Grebe S K (2012) Molecular testing in congenital adre- 215: 403-410. nal hyperplasia due to 21alpha-hydroxylase deficiency 11. Benkert P, Biasini M, Schwede T (2011) Toward the in the era of newborn screening. Clin Genet 82: 64-70. estimation of the absolute quality of individual protein 4. Nimkarn S, New M I (2008) Steroid 11beta- hydroxy- structure models. Bioinformatics 27: 343-350. lase deficiency congenital adrenal hyperplasia. Trends 12. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref. Endocrinol Metab 19: 96-99. cgi?rs=5282. 5. Curnow K M, Slutsker L, Vitek J, Cole T, Speiser P W, 13. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref. et al. (1993) Mutations in the CYP11B1 gene causing cgi?rs=34570566. congenital adrenal hyperplasia and hypertension clus- 14. Price E A, Price K, Kolkiewicz K, Hack S, Reddy M A, ter in exons 6, 7, and 8. Proc Natl Acad Sci U S A 90: et al. (2014) Spectrum of RB1 mutations identified in 4552-4556. 403 retinoblastoma patients. J Med Genet 51: 208-214. 6. Arnold K, Bordoli L, Kopp J, Schwede T (2006) 15. Conkrite K, Sundby M, Mu D, Mukai S, MacPherson D The SWISS-MODEL workspace: a web-based envi- (2012) Cooperation between Rb and Arf in suppressing ronment for protein structure homology modelling. mouse retinoblastoma. J Clin Invest 122: 1726-1733. Bioinformatics 22: 195-201. 16. Sahakitrungruang T, Srichomthong C, Pornkunwilai S, 7. Schwede T, Kopp J, Guex N, Peitsch M C (2003) Amornfa J, Shuangshoti S, et al. (2014) Germline and 310 Long et al.

Somatic DICER1 Mutations in a Pituitary Blastoma ated with nonclassic and three mutations causing clas- Causing Infantile-Onset Cushing’s Disease. J Clin sic 11{beta}-hydroxylase deficiency. J Clin Endocrinol Endocrinol Metab 99: E1487-1492. Metab 95: 779-788. 17. de Kock L, Sabbaghian N, Druker H, Weber E, Hamel 22. Krone N, Grotzinger J, Holterhus P M, Sippell W G, N, et al. (2014) Germ-line and somatic DICER1 muta- Schwarz H P, et al. (2009) Congenital adrenal hyperpla- tions in pineoblastoma. Acta Neuropathol 128: 583-595. sia due to 11-hydroxylase deficiency--insights from two 18. Favor J, Neuhäuser-Klaus A (1998) Loss of heterozy- novel CYP11B1 mutations (p.M92X, p.R453Q). Horm gosity at the dilute-short ear (Myo5a-Bmp5) region of Res 72: 281-286. the mouse: mitotic recombination or double non-dis- 23. Nguyen H H, Hannemann F, Hartmann M F, Wudy junction? Genet Res 72: 199-204. S A, Bernhardt R (2008) Aldosterone synthase defi- 19. Strushkevich N, Gilep A A, Shen L, Arrowsmith C H, ciency caused by a homozygous L451F mutation in the Edwards A M, et al. (2013) Structural insights into aldo- CYP11B2 gene. Mol Genet Metab 93: 458-467. sterone synthase substrate specificity and targeted inhi- 24. Liu J, Tawa G J, Wallqvist A (2013) Identifying cyto- bition. Mol Endocrinol 27: 315-324. chrome p450 functional networks and their allosteric 20. Dumic K, Wilson R, Thanasawat P, Grubic Z, Kusec regulatory elements. PLoS One 8: e81980. V, et al. (2010) Steroid 11-beta hydroxylase deficiency 25. Strushkevich N, MacKenzie F, Cherkesova T, Grabovec caused by compound heterozygosity for a novel muta- I, Usanov S, et al. (2011) Structural basis for pregneno- tion in intron 7 (IVS 7 DS+4A to G) in one CYP11B1 lone biosynthesis by the mitochondrial allele and R448H in exon 8 in the other. Eur J Pediatr system. Proc Natl Acad Sci U S A 108: 10139-10143. 169: 891-894. 26. Brogna S, Wen J (2009) Nonsense-mediated mRNA 21. Parajes S, Loidi L, Reisch N, Dhir V, Rose I T, et al. decay (NMD) mechanisms. Nat Struct Mol Biol 16: (2010) Functional consequences of seven novel muta- 107-113. tions in the CYP11B1 gene: four mutations associ-