CHOLESTEROL 7 ALPHA-HYDROXYLASE IS REGULATED POST- TRANSLATIONALLY BY AMPK
A dissertation submitted to Kent State University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy
By
Mauris E.C. Nnamani
May 2009
Dissertation written by Mauris E. C. Nnamani B.S, Kent State University, 2006 Ph.D., Kent State University, 2009
Approved by
Diane Stroup Advisor
Gail Fraizer Members, Doctoral Dissertation Committee
S. Vijayaraghavan
Arne Gericke
Jennifer Marcinkiewicz
Accepted by
Robert Dorman , Director, School of Biomedical Science
John Stalvey , Dean, Collage of Arts and Sciences
ii TABLE OF CONTENTS
LIST OF FIGURES……………………………………………………………..vi
ACKNOWLEDGMENTS……………………………………………………..viii
CHAPTER I: INTRODUCTION……………………………………….…...... 1
a. Bile Acid Synthesis…………………………………………….……….2 i. Importance of Bile Acid Synthesis Pathway………………….….....2 ii. Bile Acid Transport..…………………………………...…...………...3 iii. Bile Acid Synthesis Pathway………………………………………...…4 iv. Classical Bile Acid Synthesis Pathway…..……………………..…..8 Cholesterol 7 -hydroxylase (CYP7A1)……...... ………….....8 Transcriptional Regulation of Cholesterol 7 -hydroxylase by Bile Acid-activated FXR…………………………….....…10 CYP7A1 Transcriptional Repression by SHP-dependant Mechanism…………………………………………………...10 CYP7A1 Transcriptional Repression by SHP-independent Mechanism……………………………………..…………….…….11 CYP7A1 Transcriptional Repression by Activated Cellular Kinase…….…………………………...…………………….……12 v. Alternative/ Acidic Bile Acid Synthesis Pathway…………...... …….12 Sterol 27-hydroxylase (CYP27A1)……………….…………….12 Sterol 12 -hydroxylase (CYP8B1)………………….….....……14 b. Cholesterol…………..………………………………………………...18 i. Effects of Excess Cholesterol………………………………..………….19 ii. Importance of Cholesterol……………………………………..…..…..20 c. Cholesterol Synthesis……………...…………………………………..21 d. Regulation of Cholesterol Synthesis…………………………..………25 i. HMG-CoA Reductase……………………………………………....……25 ii. Transcriptional Regulation of HMG-CoA Reductase…………...….25 iii. Regulation of HMG-CoA Reductase by Phosphorylation/Dephosphorylation Events……………………..27 iv. Repression of HMG-CoA Reductase by Statin Drugs………….…..27 e. Physiological Relevance and Significance of the Bile Acid Synthesis Pathway…………………………….…………………………………28
iii f. Experimental Rationale..…………………………………..…………………..30 i. Experimental Approach, Hypothesis, and Specific aims………...……..…..…33
CHAPTER II: MATERIALS AND METHODS……………………………….…….37
PART 1: Cholesterol 7 -hydroxylase Specific Antibodies………………...…...37 a. Rational for Cholesterol 7 -hydroxylase Specific Antibody Production...37 b. Antigen (C2) used for CYP7A1 Antibody Production…………………....37 c. Sub-cloning of the C2 cDNA Sequence into E. coli-expression Vector…..38 d. Expression of the C2 antigen……………………………………………...42 i. Expression of C2 with BL21 (DE3) E. coli Cell Line...... 42 ii. Expression of C2 with the Roche RTS 500 E. coli HY kit……………..46 e. Immunization for Antibody Production………………………………...... 49 f. Characterization of Anti-serum from Immunized Rabbits………………...51 g. Pre-absorption of Rabbit Serum with E. coli lysate………….……………57 h. Antibody Characterization with Purified C2 Antigen…………..………...59 i. Antibody Affinity Purification…..………………………………………..62 i.C2 Affinity Column Preparation………………………………………..62 j. C2 Antibody Affinity Purification…………………………………………63 PART 2: Expression of Recombinant CYP7A1 in E. coli…………………….....68 a. History of CYP7A1 Expression…………….……………………………..68 b.Sub-cloning WT CYP7A1 cDNA into E. coli-expression Vector…..……..68 c. Characterization of Recombinant CYP7A1 Protein…………...………….72 d. Characterization of Expressed 30KD Fragment…………………………..74 PART 3: CYP7A1 Enzymatic Assay………………………………..…………..82 a. History of CYP7A1 Assay Detection Methods……………………..…….82 b. CYP7A1 Assay Detection Method………………………………………..83 c. Internal Standard for Enzyme Assay………………………………………84 d. Evaluating Assay Detection……………………………………………….91 e. CYP7A1 Enzyme Assay…………………………………………………..91 f. Enzymatic Activity of the 30KD Fragment………………………………..99 PART 4: Mutagenesis…………………………………………………………..100 a. Site-directed Mutagenesis Strategy 1……………………………..…...…104 b. Site-directed Mutagenesis Strategy 2……………………...…………..…107 c. Site-directed Mutagenesis Strategy 3……………………...…………..…110 d. Site directed Mutagenesis Strategy 4…………………..….…………..…113 e. Mutant Sub-cloning and Characterization……………………………….116 f. Mutant Vector-construct Restriction Mapping…………………………..119
iv CHAPTER III: RESULTS AND CONCLUSIONS…………………………………124
PART 1: AICAR, an AMPK Kinase Activator, does not Affect CYP7A1 mRNA Steady-state Levels………………………………...…..……124 PART 2: CYP7A1 In-vitro Reconstituted Assay with E. coli-expressed and Microsomal HepG2 Cells Treated with AMPK, PKC, and JNK Kinases……………………………………………………...…….…128 a. Rational for Kinase Selection……………………....………………....…128 i. AMPK……………………………………………………………………..….128 ii. PKC……………………………………………………………...... 129 iii. JNK………………………………………………………………………....129 b. Kinase Treatment of Microsomal HepG2 Cells……..…………………..130 c. Kinase Treatment of E. coli-expressed CYP7A1 Recombinant Protein…………………………………………………………………...134 PART 3: AMPK Kinase Treated In-vitro CYP7A1 Enzymatic Assay with Mutant CYP7A1 Recombinant Protein……………………………...137 a. Rational for Mutation Design……………………………………….…....137 b. Rational for Mutation-site Selection……………………………...……...137 c. Mutation of AMPK Phosphorylation Sites………………………...... 141 d. CYP7A1 In-vitro Assay with T193A /T197A Double Mutant…………..141 e. CYP7A1 In-vitro Assay with T80A Mutant……………………………..145 f. CYP7A1 In-vitro Assay with S252G Mutant……………………...... 148 g. CYP7A1 in-vitro assay with Truncated WT CYP7A1 (1-729) Mutant…………………………………………..…...…………………..151
CHAPTER IV: DISCUSSION………………………………………………………..154
CHAPTER V: APPENDIX…………………………………………………………...172
APPENDIX A: EXPERIMENTAL PROTOCOLS………………...……….….172
APPENDIX B: ABBREVIATIONS……………………………………………191
REFERENCES………………………………………………………...……………...195
v LIST OF FIGURES
Figure 1. Differences Between Primary and Secondary Bile Acids………………7 Figure 2. Cholic Acid and Chenodeoxycholic Acid……………………………..15 Figure 3. Schematic Diagram of the Bile Acid Biosynthesis Pathway……….....17 Figure 4. Cholesterol Biosynthesis………………………………………………24 Figure 5. ClustalW (1.83) Multiple Sequence Alignment of C2 and Full-length CYP7A1……………………………………………………………..41 Figure 6. Western Blot Analysis of In-vitro Expressed C2 Fragment for Antibody Production………………………………………………………………………..45 Figure 7. RTS 500-expressed C2 Antigen for Antibody Production…..………...48 Figure 8. Western Blot of C2 Samples with the First Small Bleed of Immunized Rabbits…………………………………………………………………………...54 Figure 9. Western Blot of C2 Samples with Serum After Two Months of Immunization…………………………………………………………………….56 Figure 10. Western Blot Analysis of C2 Antigen with Pre-absorbed Rabbit Serum…………………………………………………………………….58 Figure 11. Western Blot Analysis of Purified C2………………………………..61 Figure 12. Coomassie Blue Staining of Purified C2 Polyclonal Antibody……...66 Figure 13. Western Blot Analysis with Affinity Purified C2 Polyclonal Antibodies……………………………………………………………67 Figure 14. Western Blot of E. coli-expressed WT CYP7A1 Recombinant Protein……………………………………………………………..71 Figure 15. Protein Sequence Alignment of Human Cytochrome P450 7A1 (CYP7A1) and the 30KD Isolated Fragment…………………………………….76 Figure 16. Protein Alignment of the C2 Polypeptide and the 30KD Fragment….78 Figure 17. Western Blot of E. coli-expressed WT CYP7A1 and Truncated CYP7A1 Recombinant Protein…………………………………………………..81 Figure 18a. Standard Curve of 7 -hydroxycholesterol using the HPLC-MS..…87 Figure 18b. Extracted Portion of the Standard Curve for 7 -hydroxycholesterol using the HPLC-MS……………………………………………………………..88 Figure 19. D7- and 7 -hydroxycholesterol Co-injection……………………….90 Figure 20. Complete and Extracted Ion Traces of Samples from the CYP7A1 Enzyme Assay………………………………………………………………...…96 Figure 21. CYP7A1 Reconstituted In-vitro Assay Performed with Vector only and WT CYP7A1 E. coli-expressed Recombinant Proteins……………………..…..98 Figure 22. Schematic Diagram to Illustrate Site-directed Mutagenesis Strategy 1……………………………………………………………………….106 Figure 23. Schematic Diagram to Illustrate Site-directed Mutagenesis Strategy 2……………………………………………………………………....109 vi Figure 24. Schematic Diagram to Illustrate Site-directed Mutagenesis Strategy 3….....112 Figure 25. Schematic Diagram to Illustrate Mutagenesis Strategy 4 used in Generate Truncated CYP7A1 polypeptide…………………………………………...... 115 Figure 26. Mini Plasmid prep of Colonies from Mutants Transformed into E.coli DH5 Cell Lines...... 118 Figure 27. Restriction Mapping of Mutant Plasmid…………………………………....122 Figure 28. Contiguous Alignment of Mutant Nucleotide Sequence …………………...123
Figure 29. AICAR, AMPK Kinase Activator does not Affect CYP7A1 mRNA Steady-state Levels……………………………………………………………………..127 Figure 30. AMPK, PKC, and JNK Kinase Activity Repressed CYP7A1 Enzymatic Activity in Microsomal HepG2 Cell Fractions…………………………………………133 Figure 31. AMPK Kinase Activity Represses CYP7A1 Enzymatic Activity in E. coli-expressed Recombinant Protein………………………………………………...136 Figure 32. Tabulated Results from Synthetic Peptides Treated with Commercially Available Protein Kinases………………………………………………………………140 Figure 33. AMPK Kinase Activity Represses T193A/T197A Double Mutant CYP7A1 Enzymatic Activity in E. coli-expressed Recombinant Protein………………………...144 Figure 34. AMPK Kinase Activity Represses T80A Mutant CYP7A1 Enzymatic Activity in E. coli-expressed Recombinant Protein…………………………………….147 Figure 35. AMPK Kinase Activity did not Repress S252G Mutant CYP7A1 Enzymatic Activity in E. coli-expressed Recombinant Protein………………………...150 Figure 36. AMPK Kinase Activity Stimulates WT CYP7A1 (1-729) Enzymatic Activity…………………………………………………………………...... 153 Figure 37. Crystal Structure of CYP7A1……………………………………………….166 Figure 38. AMPK Maintains Cholesterol Homeostasis………………………………...169
vii ACKNOWLEDGEMENTS
I would like to acknowledge those that made the completion of my Doctoral study a success. I would like to express my extreme gratitude to my advisor Dr. Diane Stroup, for her wisdom, encouragement, support, patience and most importantly, her trust throughout my graduate studies. Her scientific expertise and guidance made the completion of this dissertation a success.
I would like to thank my committee members: Dr. Gail C. Fraizer, Dr. Arne Gericke, Dr.
Jennifer Marcinkiewicz and Dr. S. Vijayaraghavan; for the valuable time they put into my work. Their scientific suggestions, guidance and support helped improve this dissertation. I would like to thank Dr. Robert J. Twieg, for allowing me full access to the
LC/MS in his lab. His support and confidence in my ability to operate the equipment, allowed me to complete my experiments in a timely fashion.
I would also like to thank my colleague, Jing Zhao, for her scientific discussions and assistance with the real-time PCR experiments. Our discussions helped spark ideas for solving experimental problems.
Last, but not least, I would like to thank my family; my parents Emmanuel and Martha
Nnamani; my sisters, Adaeze and Maryann Nnamani; my brothers, Kim and Jason
Nnamani; Alysse Ferranto and the Ferranto family. I want to thank them for believing in me and challenging me to achieve new heights. Without their love and support none of this would have been possible.
viii CHAPTER I
INTRODUCTION
The rate at which cholesterol is converted to bile acids is determined by
the activity of the cholesterol 7 -hydroxylase, encoded on the CYP7A1 gene [1-
3]. This rate-limiting enzyme is highly regulated on multiple levels, including control of initiation of transcription and message stability [1]. Transcriptional repression of CYP7A1 has been well documented [4-8], but less studied are the other levels of regulation that includes a possible post-translational control of the enzyme.
Published studies on the transcriptional regulation of CYP7A1 often did not include measurement of enzyme activity. However, when reported, the mRNA levels did not always correlate with bile acid production. Previous work in our lab show that bile acid production, in Human hepatoma liver carcinoma
(HepG2) cell line, is repressed by 5`AMP-activated protein kinase (AMPK) activator, AICAR (Stroup and Ramsaran, 2005). This is the first report of regulation of bile acid production through the AMPK pathway, an important pathway that has long been known as a repressor of cholesterol synthesis by shutting down 3-hydroxyl 3-methylglutaryl-coenzyme A (HMG-CoA) reductase.
1 2
The hypothesis for this study is that AMPK kinase activity regulates cholesterol 7
-hydroxylase enzymatic activity via phosphorylation at the enzyme level.
a. Bile Acid Synthesis
i. Importance of Bile Acid Synthesis Pathway
Bile acid synthesis is the major cholesterol disposal pathway and thus, influences
cholesterol homeostasis. Bile acids serve as detergents in the intestine and facilitate the
absorption, transport, and distribution of lipid soluble vitamins and dietary fats. They
also act as signaling molecules and regulate gene expression by acting as a ligand for the nuclear hormone receptor, farnesoid X-receptor (FXR) nuclear receptor, and by activating protein cellular kinases[2]. Bile acids also induce the cytochrome P450 3A
(CYP3A) family of cytochrome P450 enzyme, that play a role in drug metabolism and detoxification of xenobiotics in the liver and intestine[9].
Intermediates of the bile acids synthesis pathway and oxysterols, have a broad spectrum of biological effects on the activity of enzymes involved in cholesterol homeostasis[10]. Oxysterols, which are oxidized cholesterol, are potent signaling molecules that regulate cell proliferation, apoptosis, brain function and the immune system[2]. Several oxysterols including 20-, 22-, 25-, and 27-hydroxycholesterol are reported to be ligands of the nuclear hormone receptor, liver X receptor (LXR)[10]. This is significant, notably through genes whose promoters contain LXR binding elements, 3
and also through LXR’s interaction with other transcription factors, such as PPAR and
SHP.
The anti-apoptotic effect of ursodeoxycholic acid (UDCA), a bile acid conjugate,
has been used to reduce neurological damage following stroke and slow the progression
of Huntington’s disease[11, 12]. Alterations in bile acid synthesis have been associated
with diabetes and cardiovascular disease. Patients with diabetes mellitus and
streptozotocin-diabetic rats, show larger bile acid pools and bile acid excretion rates compared to normal individuals [2]. Disruption in the bile acid pathway has also been shown to be associated with hypercholesterolemia and cardiovascular disease.
ii. Bile Acid Transport
Bile acids are synthesized in the liver and stored in the gallbladder. After each meal, the gallbladder contracts and releases bile acids into the intestine to solubilize
dietary fats. The bile acids are reabsorbed in the ileum and transported back to the liver
by enterohepatic circulation. This process reabsorbs about 95% of bile acids in
humans[9]. Studies to determine the mechanism involved in the enetrohepatic
circulation, leading to bile acid turnover, is ongoing. It was suggested by Low-Beer, et al
1969[13]; that the main factors determining turnover and synthesis of the primary bile
acids is the emptying of the gallbladder. This assumption was deduced by the association
of delayed gallbladder emptying and increased bile acid pool in patients with celiac
disease. More recently, nuclear hormone receptors have been implicated in the regulation 4
of bile acid synthesis through the enterohepatic circulation through the FGF-19/FGFR4 pathway [14].
iii. Bile Acid Synthesis Pathways
Primary Bile acids and their conjugates
There are two pathways involved in bile acid synthesis, the classical (neutral)
pathway and the acidic (alternative) pathway. Both the classical and acidic bile acid
pathways lead to the production of cholic and chenodeoxycholic primary bile acids,
which are the most abundant bile acids produced. They differ in that cholic acid requires
an additional enzyme, 12 -hydroxylase, for synthesis and has a hydroxyl group at the
12 position.
Cholic and chenodeoxycholic acids are called ‘primary bile acids’ because they
are the principle bile acids formed form cholesterol in mammals and are precursors for
the production of secondary bile acid conjugates. Portions of the cholic acid and
chenodeoxycholic acid are conjugated in the liver by the addition of either glycine or
taurine to the side-chain carboxyl-group of the bile acid through amidation. As bile acid
is secreted into the intestines, cholic acid and chenodeoxycholic acid are converted into
deoxycholic acid and lithocholic acid respectively, by bacterial 7-dehydroxylase in the intestines[15]. The bile acids that were conjugated with glycine or taurine can be further modified, forming other forms of secondary bile acids. Bile acids in humans are 5 primarily, lithocholic, deoxycholic, chenodeoxycholic, and cholic acids, which can all be conjugated by either glycine or taurine[16]. 6
Figure 1. Differences between Primary and Secondary Bile Acids
Cholesterol gets converted into cholic and chenodeoxycholic primary bile acids in the liver. Portions of the primary bile acids can be conjugated by the addition of either glycine or taurine to the carboxyl-group of the primary bile acids to form the glyco- and tauro- conjugates respectively. 7-dehydroxylation takes place in the intestines by bacteria flora, and dehydroxylate the 7 -hydroxyl positions. Image modified from
Duarte et al., 2009[17]. 7
Figure 1. Differences Between Primary and Secondary Bile Acids 8
The three major enzymes that play important roles in regulating bile acid production through the two pathways are: cholesterol 7-hydroxylase (CYP7A1) is the rate limiting step in the classical pathway, sterol 27 hydroxylase (CYP27A1) is the first enzyme in the alternative pathway, and 12-hydroxylase (CYP8B1) is the specific enzyme that determines the ratio of cholic acid and chenodeoxycholic acid[18].
iv. Classical Bile Acid Synthesis Pathway
The rate at which cholesterol is converted to bile acids in the classical pathway is determined by the activity of the rate-limiting enzyme cholesterol 7 -hydroxylase[1-3].
Bile acid synthesis by this pathway has been reported to account for approximately 50% of total bile acid production in rats and mice, and greater than 90% of total bile acids in humans [19]. Cholesterol 7-hydroxylase is found solely in the liver, and the liver is the only organ capable of producing bile acids.
Cholesterol 7 -hydroxylase
Cholesterol 7 -hydroxylase is a 504 amino acid cytochrome P450 monooxygenase and is believed to be anchored to the smooth endoplasmic reticulum by a
23 amino acid N-terminal internal-membrane sequence. The enzyme contains a steroid binding site, an aromatic amino acid region and a heme region. Cholesterol 7 - hydroxylase hydroxylates cholesterol to 7 -hydroxycholesterol in the first step of the classical bile acid synthesis pathway. The 7 -hydroxycholesterol is converted to 7 - 9 hydroxy-4-cholesten-3-one (C4) by 3--hydroxysteriod dehydrogenase (3HSD). The pathway can then follow two different routes to produce the two major primary bile acids, cholic acid and chenodeoxycholic acid. The factor that determines whether the
3HSD will be converted to cholic or chenodeoxycholic acid is the enzymatic activity of sterol 12-hydroxylase (CYP8B1). A 12 hydroxylation by CYP8B1 will drive the reaction towards the formation of cholic acid. While a conversion of the 3HSD to 5- cholestane-3, 7-diol will drive the reaction towards the formation of chenodeoxycholic acid. This process is illustrated in Figure 3.
The expression of cholesterol 7 -hydroxylase is controlled at multiple levels, including control of initiation of transcription and message stability [1]. Transcription of
CYP7A1 is repressed by bile acids, phorbol esters, and insulin and is activated by cyclic-
AMP[20, 21]. The transcriptional repression of cholesterol 7 -hydroxylase by bile acids has been shown to occur through a feedback regulation mechanism. Bile acids feedback repression of cholesterol 7 -hydroxylase transcriptional activity is accomplished by a bile acid associated activation of farnesoid X-receptor (FXR). 10
Transcriptional Regulation of Cholesterol 7 -hydroxylase by Bile Acid-activated FXR
Bile acids are believed to regulate cholesterol 7 -hydroxylase gene expression by binding and activating FXR[14, 22-25] and by activating cellular kinases [23, 26-28].
FXR is expressed in the liver, intestine, kidney, and adrenal and regulates the synthesis of cholesterol 7 -hydroxylase and oxysterol 7 -hydroxylase (CYP8B1), both the rate limiting enzymes in the classical and acidic pathway for bile acid synthesis respectively[29, 30]. Bile acid activated FXR regulate bile acid synthesis through an indirect feedback repression of CYP7A1 transcriptional activity.
CYP7A1 Transcriptional Repression by SHP-dependant Mechanism
Bile acid activated FXR binds as a heterodimer with retinoid X receptor (RXR) to
DNA, recognizing an inverted hexanucleotide repeats composed of two nuclear receptor half sites of the consensus AG(G/T)TCA, and separated by a single nucleotide (IR-1 motif) [24, 29, 30]. The activated FXR/RXR heterodimer has been shown to repress
CYP7A1 promoter activity by the activation of other factors[24, 31]. Activated FXR can induce the expression of small heterodimer partner 1 (SHP-1) protein, an orphan nuclear receptor. Elevated levels of SHP-1 have been associated with repressed CYP7A1 transcription activity in mice. It has been proposed that elevated SHP-1 protein levels prevent CYP7A1 transcriptional activation by forming a heterodimer with the orphan nuclear receptor LRH-1 (liver receptor homolog 1) (CPF or FTF)[26] and by interfering with the activity of the liver X receptor (LXR). The importance of SHP in bile acid 11 synthesis feedback regulation was demonstrated in SHP -/- mice, where the mice were shown to have increased CYP7A1 expression, enzyme activity, and bile acid pool size[32]. It still remains controversial whether this mechanism exists in humans.
Notable differences exist in bile acid biosynthesis between rodents and human, most notable is the regulation of CYP7A1 promoter by LXR[33]. LXR stimulation in rodents leads to activation of CYP7A1 transcriptional activity[9], but this effect is not noticed in humans.
CYP7A1 Transcriptional Repression by SHP-independent Mechanism
Activated FXR induces the expression of fibroblast growth factor-19 (FGF-19) in primary human hepatocytes culture. FGF-19 is a secreted protein that has been proposed to regulate CYP7A1 transcription through a c-jun N-terminal kinase (JNK)-dependent pathway[34]. FGF-19 selectively binds to FGF receptor 4 (FGFR4), a transmembrane receptor with tyrosine kinase activity[35]. The FXR activated FGF-19/FGFR4 pathway has been proposed to be the mechanism by which bile acid synthesis is regulated through the enterohepatic circulation. This proposal was a result of experiments performed with the mouse ortholog FGF-15. FGF-15 was induced by FXR in the small intestines of mice and repressed bile acid synthesis through a mechanism involving FGFR4 and SHP[36]. 12
CYP7A1 Transcriptional Repression by Activating Cellular Kinase
It has been long speculated that bile acids can repress cholesterol 7 -hydroxylase
transcriptions through activating cellular kinases. HepG2 cells treated with bile acids
resulted in the activation and translocation of protein kinase C (PKC) from the cytosol to
the membrane[37, 38]. PKC inhibitors reduced the bile acid repression of transcription
from the CYP7A promoter[37]. Phorbol esters activate PKC and have been shown to
repress CYP7A1 transcription[37]. Bile acids have also been shown to activate c-Jun N-
terminal kinase (JNK) pathway and Raf-1/MEK/ERK signaling cascade in primary rat
hepatocytes[26, 39]. Although the mechanism by which bile acids activate cellular
kinases are not fully understood, it has been shown that transcription repression of
cholesterol 7 -hydroxylase is associated with kinase activation.
v. Alternative /Acidic Bile Acid Synthesis Pathway
Sterol 27-hydroxylase (CYP27A1)
Sterol 27-hydroxylase is the first enzyme in the acidic pathway, and in
contrast to cholesterol 7 -hydroxylase, is a widely distributed mitochondrial enzyme with high activity in vascular endothelial cells[40]. In the extrahepatic tissues, the acidic
pathway leads to the synthesis of 3, 7-dihydroxy-5-cholestenoic acid, which is a
precursor for chenodeoxycholic acid synthesis. 13
The purpose of the acidic pathway in extrahepatic tissues is apparently a salvage pathway for oxysterols. Recombinant CYP27A1 has been shown to have a wide substrate specificity[41]; it is possible that the enzyme has more roles beyond C27-sterol side chain cleavage. Studies have shown that oxysterol products from CYP27A1 activities, 27-hydroxycholesterol and 3 -hydroxy-5-cholestenoic acid, are ligands for the nuclear receptors LXR and LXR that are involved in transcriptional regulation of cholesterol homeostasis[42, 43]. Although a few studies argue against the regulatory role of CYP27A1[44, 45]. More recent studies have implicated CYP27A1 with activating the liver orphan receptor (LXR) and inducing cholesterol efflux transporters ABCA1 and
ABCG1 in macrophages[46]. It was also hypothesized earlier, CYP27A1 is likely to be an essential cholesterol mobilization mechanism and not primarily for producing bile acids [2]. This hypothesis is supported by numerous studies showing the insensitivity of
CYP27A1 to bile acid feedback regulating [47-49]
Patients with the rare inherited disease cerebrotendinous xanthomatosis (CTX), have a mutation on their CYP27A1 gene resulting in a partial or complete lack of
CYP27A1 activity[50]. Clinical manifestations of CTX vary and may include tendon xanthomas, bilateral cataracts, accelerated atherosclerosis and progressive neurological impairment[51]. There have been 40 different mutations found in CYP27A1 that are associated with causing CTX, but no phenotype-genotype correlation has been established so far[52-54]. 14
Sterol 12 -hydroxylase (CYP8B1)
Sterol 12 -hydroxylase (CYP8B1) is the specific enzyme that determines the ratio of cholic acid (CA) and chenodeoxycholic acid (CDCA) produced in the cell. Both primary bile acids are formed at a ratio of ~ 2:1 in humans[50]. CYP8B1 has a broad substrate specificity and is solely expressed in the liver[55, 56]. CA is more hydrophilic than CDCA; therefore, by controlling the synthesis of CA, CYP8A1 determines the overall hydrophobicity of the bile acid production. 15
OH
COOH COOH
OH OH OH OH Cholic acid Chenodeoxycholic acid
Figure 2. Cholic Acid and Chenodeoxycholic Acid.
Cholic and chenodeoxycholic acid are primary bile acids produced in the liver. The ratio
of the bile acids produced is determined by the enzymatic activity of CYP8B1. Cholic
acid is only produced by the natural pathway and has three hydroxyl groups at positions
3, 7, and 12, making it more hydrophilic than chenodeoxycholic acid. Chenodeoxycholic acid is produced by both the natural and acidic bile acid pathways and has hydroxyl groups at positions 3 and 7. 16
Figure 3: Schematic Diagram of the Bile Acid Biosynthesis Pathway.
In the classical pathway, cholesterol is hydroxylated at the 7 position by cholesterol 7- hydroxylase (CYP7A1) first, followed by several other oxidation reactions. What determines the ratio of cholic to chenodeoxycholic acid is the activity of sterol 12- hydroxylase (CYP8B1). In the alternative pathway, cholesterol is modified by sterol 27- hydroxylase first, and then is hydroxylated at the 7 position by oxyxterol 7 - hydroxylase (CYP7B1) (Image from Chiang, 2002). 17
Figure 3. Schematic Diagram of the Bile Acid Biosynthesis 18
b. Cholesterol
The levels of cholesterol in the body is determined by three major activities:
uptake of dietary cholesterol and transport, cholesterol synthesized by the body and the
conversion of cholesterol into other steroid compounds, such as bile acids and hormones
[2, 20].
Cholesterol from the diet is absorbed into the blood from the small intesines, and
transported to various tissues were they are needed. The hydrophobic cholesterol is
transported throughout the body by lipoproteins. Different types of lipoproteins are
classified based on their density as determined by ultracentrifugation. High density
lipoproteins (HDL) are believed to function by taking cholesterol away from the blood to
the liver were they are converted into bile acids and other steriod hormornes. HDL is
refered to as ‘good cholesterol’ because of clinical and epidemiological studies that show
an inverse relationship between levels of HDL-cholesterol, and the risk of coronary heart
disease (CHD) events [57]. LDL (low density lipoprotein) and VLDL (very low density
lipoprotein), carries cholesterol through the blood to the tissues and. Elevated levels of
LDL-cholesterol are shown to have a significantly positive correlation with a higher risk of CHD[58]. 19
i. Effects of Excess Cholesterol
Concentration of, and the ratio between, LDL and HDL are used to determine the risk of cardiovascular events. Hypercholesterolemia is a condition that results from high levels of serum cholesterol and is a strong risk factor for progression of atherosclerosis.
Atherosclerosis is a slowly progressive disease of the arterial wall leading to thickening of the wall and resulting in blood flow obstruction. A Multicentral study by the
Pathobiological Determinants of Atherosclerosis in Youth (PDAY), found that the atherosclerosis progression starts in childhood[59, 60], and progression accelerates up in aldulthood.
The earliest pathologic finding in atherosclerosis is thought to be the fatty streaks[61], which are characterized by lipid-filled macrophages within the artery[62].
Atherosclerosis progression starts with a disruption of the endothelium layer of the arterial wall followed by the migration and accumulation of lipid-filled macrophages and poliferation of vascular smooth muscles cells. As the smooth muscles cells poliferate and migrate to the outer lining of the arteries they accumulate and form lesions called fibrous plaques[62]. As atherosclerosis progresses, the fibrous plaques build up and thicken the arterial walls causing blood flow obstruction. The plaques can also build up and rupture, breaking off into the blood stream, and are responsible for adverse clinical outcomes, such as myocardial infarctions and ischemic stroke[61]. 20
Since cholesterol is the precursor for oxysterol, excess cholesterol leads to an
excess production of oxysterols in the cell. The ratio of oxysterol:cholesterol in plaque
are higher than in normal tissues or plasma, suggesting that they play a role in plaque
development[63]. They have been shown to influence the molecular order of the cell
membranes when compared to pure cholesterol, this suggests they might contribute to
cell membrane permeability changes affecting crucial cell functions and events leading to
vascular cell injury[64]. Oxysterols have also been shown to exhibit cytotoxicity in cells leading to angiotoxic and atherogenic effects; alter prostaglandin synthesis, stimulate platelet aggregation, and also alter the functionality of LDL receptors, possibly stimulating hypercholesterolemia[65].
ii. Importance of Cholesterol
Despite the negative effects associated with elevated levels of cholesterol, cholesterol is still a very essential molecule for cellular survival. It is the precursor for important steroid hormones such as the estradiol, testosterone and vitamin D, which is necessary to utilize calcium and form bone. Cholesterol inserts into the lipid bilayer of the cell and makes it less susceptible to permeability from small water-soluble molecules.
Cholesterol also stabilizes a cell against temperature changes. It is associated with the majority of membranes in the nervous system; in particular it is incorporated into the myelin sheath that insulates the nerves from the surrounding tissue. Cholesterol is a major part of membranes in the brain, the spinal cord and the peripheral nerves. 21
Cholesterol is the precursor for bile acids which have very important
physiological functions, including but not limited to: cholesterol solubilization in the bile,
in order to prevent precipitation in the gallbladder; facilitation of digestion of dietary
triacylglycerol by acting as detergents; facilitating intestinal absorption of fat-soluble
vitamins; and acting as signaling molecules in the cell. They are also oxygenated to oxysterols P450s, and function as signaling molecules in the cell. Cholesterol differs from the main steroid ring structures by having an aliphatic side chain at C17 of ring D, methyl groups at C10 and C13, a double bond in ring B, and a hydroxyl group on C3.
The position of the OH group makes cholesterol a steroid alcohol or sterol. Almost every cell in the body is capable of producing cholesterol, but the liver and the intestines produce the majority of cholesterol in the body.
c. Cholesterol Synthesis
Cholesterol synthesis occurs in the cytosol and starts with the condensation of acetyl-CoA and acetoacetyl-CoA to form 3-hydroxy 3-methylglutaryl-coenzyme A
(HMG-CoA), catalyzed by the enzyme HMG-CoA synthase. HMG-CoA is the precursor for cholesterol synthesis and is also an intermediate in the pathway for the synthesis of ketone bodies in the mitochondrial. The next step in cholesterol synthesis is the conversion of HMG-CoA to mevalonate. This reaction is catalyzed by the HMG-CoA reductase, which is the rate-limiting enzyme in cholesterol synthesis and utilizes
NADPH. In the next step of cholesterol synthesis, mevalonate is converted to 22
isopentenyl pyrophosphate, and this step utilizes ATP. There are several additional steps involved to the production of cholesterol and a schematic diagram depicting major
reactions in the mevalonate pathway for cholesterol synthesis is shown below [Fig. 4]. 23
Figure 4. Cholesterol Biosynthesis. Synthesis begins with the transport of acetyl-CoA from the mitochondria to the cytosol followed by condensation of acetyl-CoA and
Acetoacetyl-CoA into HMG-CoA. The rate-limiting step is catalyzed by HMG-CoA reductase, which is highly regulated by phosphorylation /dephosphorylation events by
AMPK kinase activity, and is the key regulatory region for cholesterol lowering drugs
(statins). (Cholesterol biosynthesis pathway was modified from The Medical
Biochimistry Page, M. King Ph. D. IU School of Medicine). 24
Figure 4. Cholesterol Biosynthesis 25
d. Regulation of Cholesterol Synthesis
i. HMG-CoA Reductase
Cholesterol synthesis is regulated by HMG-CoA reductase, which is the rate-
limiting enzyme in cholesterol biosynthesis. HMG-CoA reductase is regulated by protein
degradation, at the transcriptional level, and at the enzyme level by phosphorylation
/dephosphorylation events.
ii. Transcriptional Regulation of HMG-CoA Reductase
HMG-CoA reductase is regulated at the transcriptional level by a family of
transcription factors known as sterol regulatory element binding proteins (SREBP).
SREBPs are know to enhance transcription of over 30 genes involved in the uptake and
synthesis of cholesterol, fatty acids, triglycerides, and phospholipids[66]. There are three
SREBP isoforms: SREBP-1a, SREBP-1c/ADD1 and SREBP-2 encoded on two
genes[67]. SREBP1a activates all SREBP-responsive genes while SREBP-1c and
SREBP-2 are the predominant isoforms in the liver that regulate genes involved in fatty acid synthesis and sterol biosynthesis respectively[68]. SREBP is a membrane-bound transcription factor located in the endoplasmic reticulum (ER). The N-terminal domain of SREBP is a basic helix-loop-helix leucine zipper transcription factor and the c- terminal domain is bound to a SREBP-cleavage-activating protein (Scap) that acts as a sterol sensor[67, 69]. 26
In the presence of cholesterol, SREBPs are localized in the ER. SREBP-Scap
complex binds to cholesterol in the ER membrane and promotes binding to ER-resident
protein Insig (Insulin-induced genes). The binding to Insig retains the SREBP-Scap
complex in the ER by preventing the interaction of Scap with the COPII vesicle-
formation proteins Sar1, Sar23 and Sar24[70]. However, in the absence of cholesterol,
the SREBP undergoes specific proteolytic cleavage that leads to its translocation to the
nucleus. In the absence of cholesterol the SREBP-Scap complex is not bound to Insig
and is therefore packaged in the COPII-coated transport vesicles. The SREBP-Scap
complex is then transported to the golgi apparatus where it is proteolyticaly cleaved by
two sequential proteases, site1 (S1P) and site 2 (S2P). The sequential cleavage releases
the SREBP N-terminal transcription factor domain from the membrane. The SREBP N-
terminal transcription factor domain is transported into the nucleus as a dimer by
importin ß by interacting with the helix-loop-helix domain[71].
Once in the nucleus, SREBP activates the transcription of target genes involved
in cholesterol and lipid metabolism such as HMG-CoA reductase, by binding to the sterol
regulatory element (SRE) sequences in their promoter regions. The activation of SREBP
is inhibited by feedback regulation by increased synthesis and uptake of cholesterol as well as ubiquitin-dependent proteasomal degradation. 27
iii. Regulation of HMG-CoA Reductase by Phosphorylation/Dephosphorylation
Events
HMG-CoA reductase is highly regulated by phosphorylation / dephosphorylation
events at the enzyme level by AMP-activated protein kinase (AMPK) activity. The effect
of AMPK on cholesterol synthesis is well characterized[72-75]. Phosphorylated AMPK
regulates cholesterol synthesis by phosphorylating and inactivating HMG-CoA reductase.
iv. Repression of HMG-CoA Reductase by Statin Drugs
Pharmacological drugs are used to lower cholesterol levels by targeting HMG-
CoA reductase. Statin drugs lower cholesterol levels by acting as a competitive inhibitor of HMG-CoA reductase. Statin drugs mimic HMG-CoA molecular structure and bind to
HMG-CoA reductase, thereby inhibiting the synthesis of cholesterol in the cell. These drugs have been proven to lower total cholesterol levels; low-density lipoprotein cholesterol (LDL-C) by increasing LDL receptor synthesis; triglyceride; and reduce the occurrence of coronary events[76-79]. Statin drugs were also shown to slightly increase
HDL levels[79]. 28 e. Physiological Relevance and Significance of the Bile Acid Synthesis Pathway
Type II diabetes and dyslipidemia are common metabolic disorders. Individuals with type II diabetes are at a higher risk of cardiovascular disease and have abnormal serum lipid profile. Patients with diabetes mellitus and streptozotocin-diabetic rats, show larger bile acid pools and bile acid excretion rates compared to normal individuals [2]; suggesting an association between abnormal bile acid and cholesterol biosynthesis with type II diabetes and cardiovascular disease. Metformin, one of the most commonly used drugs for the treatment of type II diabetes, lowers serum glucose levels by activating
5`AMP-activated kinase (AMPK) [80, 81]. AMPK is a key kinase involved in many metabolic pathways including but not limited to: energy metabolism, stimulation of fatty acid oxidation, ketogenesis, cellular uptake of glucose, repression of gluconeogenisis, insulin secretion, cholesterol synthesis and more recently, the repression of bile acid production. Understanding the cross talk between AMPK and these pathways will help us better understand the progression, and treatment of type II diabetes.
The levels of lipoproteins are closely associated with the atherosclerotic vascular process. Elevated levels of high-density lipoprotein cholesterol (HDL-C) and apolipoprotein AI (apo AI) in plasma indicate a low probability of coronary heart disease
(CHD) together with enhanced longevity. In contrast, elevated levels of low-density lipoprotein cholesterol (LDL-C) and apo B indicate an increased risk of CHD, cerebrovascular events, other atherosclerotic diseases and death [82-84]. The discovery that plasma levels of LDL-C decreased with increasing P450 activity in the liver provides 29 a new avenue for fighting against atherosclerotic vascular process. P450- enzymes are important in maintaining cholesterol homeostasis by eliminating excess cholesterol. The most important P450-isoenzymes in the formation and metabolism of oxysterols in humans are: CYP7A1, CYP27A1, CYP46A1 and CYP3A4 [85]. Many pharmacological drugs indicated for the treatment of lipid disorders, such as statins, fibrates, cholestyramine and niacin; have been shown to activate genes that affect the fate of lipids [86, 87]. Recent results published in a European Journal of Clinical
Pharmacology review article, 2008 [82], showed that lipid lowering drugs resulted in an activation of P450, ABCA1, and Apo AI-S as well as regression of atherosclerosis.
CYP7A1 is the rate-limiting enzyme in the classical bile acid pathway and is the key P450-enzyme in maintaining cellular cholesterol levels. Disruption of the classical bile acid pathway in human patients, as a result of a mutation on the CYP7A1 gene, resulted in hypertriglyceridemia, premature gallstone disease, premature coronary disease, peripheral vascular disease, high levels of LDL, double the amount of normal hepatic cholesterol content, a markedly deficient rate of bile acid excretion, and evidence for up-regulation of the acidic bile acid pathway[88].
In-vivo experiments performed with homozygous CYP7A1 -/- mutant mice, had a very poor survival rate with 40% of the animals dieing between 1 and 4 days, and 45% between 11 and 18 days. Survival rates were increased by vitamin and cholic acid supplementations to nursing mothers at early and late developmental stages respectively.
Control mice where nursing mothers were not feed cholic acid supplemented chow showed phenotypic characteristics of oily coats, hyperkeratosis, and apparent vision 30
defects[89].
Fully understanding the regulation mechanisms involved with P450s will provide
insight on how metabolic disorders, cardiovascular disease and atherosclerosis can be
prevented.
f. Experimental Rationale
Bile acid feedback repression of the cholesterol 7 -hydroxylase transcriptional activity has been well studied and documented[4-7, 90], but less studied is the possible post-translational control of the enzyme. The cholesterol 7 -hydroxylase mRNA levels have been shown to correlate with repression by bile acids, phorbol esters, and insulin; and activated by cAMP, but in many studies the mRNA levels of the enzyme does not always correlate with the enzymatic activity when measured.
Pandak, et al., 1994[91], tested the effects of different bile salts on steady-state mRNA levels and transcriptional activity of cholesterol 7-hydroxylase. The experiments were conducted on male Sprague-Dawley rats and showed that feeding with chenodeoxycholic acid and deoxycholic acid resulted in a significant increase in cholesterol 7-hydroxylase mRNA levels with no correlating increase in enzymatic activity.
Drover, et al., 2004 [92], by inducing hypo and hyperthyroidism in transgenic mice carrying the human cholesterol 7 -hydroxylase were able to show that the mRNA 31
levels of the cholesterol 7 -hydroxylase gene was reduced 37% in hyperthyroid male mice, while the cholesterol 7 -hydroxylase enzymatic activity measured in the same group was 2-fold greater than control mice.
Charles, et al., 1982 [93] showed using rat liver cholesterol 7 -hydroxylase, that treatment with NaF, an inhibitor of phosphoprotein phosphatases, increased the cholesterol 7 -hydroxylase activity by 80%, compared to treated liver with NaCl. They also demonstrated that the hydroxylase activity decreased by 40% when microsomes were incubated with bacterial alkaline phosphatase, compared to incubation with phosphatase inhibitors.
These papers clearly show that the activity of cholesterol 7 -hydroxylase can
also be regulated at a level other than that of transcription. It is reasonable to suggest that
if bile acid synthesis is regulated by post-transcriptional events, it is most likely to do so
through the regulation of the rate-limiting enzyme cholesterol 7 -hydroxylase.
The activity of cholesterol 7-hydroxylase (gpCYP7A1) has been postulated to be
regulated by phosphorylation / dephosphorylation events[94, 95]. Previous data from our
lab, Stroup and Ramsaran, 2005 [1] showed that cholesterol 7-hydroxylase can be
covalently modified by the addition of phosphate groups and exists as a phosphoprotein
in the cell. An In-vitro kinase assays was performed on 45 synthetic 15-mer peptides based on the human cholesterol 7-hydroxylase amino acid sequence with 12 protein
kinases (AMPK, PKA, JNK, PKC, PKCI, PKCII, PKC, PKC, PKC, PKC, PKC,
and PKC) to determine whether the peptides could be modified by phosphate transfer. 32
Three of the 15-mer polypeptides were phosphorylated by almost all the kinase tested. Polypeptide F188/I202, which has 2 threonines at position 193 and 197, and its mutant, F188/I202B6, were phosphorylated by 9 out of 12 kinases (JNK, PKC, and
PKC being the exceptions). C69/L83, which also has a threonine at position 80, was phosphorylated by 11 out of 12 kinases (all except PKA). Other peptides showed more specificity: L22/N36 and A106/N120 associated with PKA; L247/M261 and N380/M394 with PKA and AMPK; L428/T442 with JNK; and D342/L356 and I349/R364 recognized by PKC, PKC, and PKC. By purifying phosphorylated proteins from metabolically labeled HepG2 cells, and immunoblot analysis, cholesterol 7 -hydroxylase was shown to exist as a phosphoprotein in the cell. These results indicate that cholesterol 7- hydroxylase can be covalently modified by the addition of phosphate groups and exists as a phosphoprotein in the cell.
Results from total bile acid assays from HepG2 cells treated with AMPK, PKC, and PKA kinase activators showed a repression in bile acid production[1]. PKC and
PKA kinase activity have been shown to affect the transcriptional activity of CYP7A1, but there is no known mechanism of AMPK transcriptional repression of CYP7A1.
Activation of AMPK is associated with low energy cell states and inhibits anabolic processes to prevent energy consumption while activating catabolic processes to provide cellular energy. Both cholesterol synthesis and bile acid synthesis are energy requiring processes. It is therefore reasonable to suggest that AMPK kinase activation will inhibit bile acid synthesis to conserve energy. It is also reasonable to suggest that the 33 mechanism by which AMPK represses bile acid production could be in the same manner that cholesterol synthesis is regulated, by phosphorylation of the rate-limiting enzyme in the pathway.
g. Experimental Approach, Hypothesis and Specific Aims
Cholesterol 7 -hydroxylase is the rate-limiting enzyme in bile acid biosynthesis and highly influences cholesterol homeostasis. The bile acid pathway is very important in maintaining normal cholesterol levels and disruption in the pathway can lead to hypercholesterolemia and cardiovascular diseases. Individuals with type II diabetes are at a higher risk of cardiovascular disease and show larger bile acid pools and bile acid excretion rates compared to normal individuals[2].
Transcriptional regulation of CYP7A1 has been well documented, but less studied is possible post-translational regulation of the enzyme. Previous studies have shown
CYP7A1 to be phosphorylated by kinase activity and exist as a phosphoprotein in the cell. The discovery that AMPK kinase activity phosphorylates CYP7A1 and represses bile acid production suggests that another mechanisms of regulation other than transcriptional might exist.
Hypothesis: Cholesterol 7 -hydroxylase enzyme activity is regulated by phosphorylation events at the enzyme level and that AMPK kinase activity regulates cholesterol 7 -hydroxylase enzymatic activity by direct phosphorylation. To test this hypothesis, the experimental design was divided into 2 specific aims. 34
Specific Aim 1: Characterize the Effects of Phosphorylation on the Activity of Recombinant Cholesterol 7 -hydroxylase.
The hypothesis is that cholesterol 7 -hydroxylase activity changes upon
phosphorylation. To test this hypothesis, E. coli expressed recombinant cholesterol 7 -
hydroxylase, was characterized as substrate for purified kinases. The kinases used were
commercially available AMPK, JNK and PKC kinases. The activity of the
phosphorylated enzyme was determined by using the phosphorylated enzyme in the
cholesterol 7 -hydroxylase in-vitro reconstitution assays. The amount of 7 - hydroxycholesterol produced in the assay was determined with a newly developed detection method with a HPLC/MS. Commercially available D7 7 -hydroxycholesterol was used as an internal standard to quantitatively determine the amount of 7 - hydroxycholesterol produced in the assay. 35
Specific Aim 2: Characterize the Specific Sites of Phosphorylation Responsible for the Regulation of Cholesterol 7 -hydroxylase Enzymatic Activity.
Once the effects of kinase activity on cholesterol 7 -hydroxylase enzyme activity has been determined, the specific amino acids responsible for the measured effect will be mapped.
a. Selecting Possible Phosphorylation Sites Responsible for Changes in Enzyme Activity.
By using the map generated from the in-vitro kinase assay on the human cholesterol 7 -hydroxylase polypeptide sequence[1], the specific amino acids that are susceptible to kinase activity will be determined. Threonine 193 and 197 (T193 and
T197) and serine 80 (S80) of cholesterol 7 -hydroxylase polypeptide sequence have been shown in kinase reactions to be phosphorylated by multiple kinases. Other sites showed more specificity to the different kinases. After the in-vitro reconstituted cholesterol 7-hydroxylase enzymatic assay with the different kinases are performed, the phosphorylation sites that corresponds with the kinase activity that affected CYP7A1 enzymatic activity will be mutated. 36 b. Determining the Effects of the Mutated Sites on CYP7A1 Enzymatic Activity.
The effects that the mutations have on phophorylated cholesterol 7 -hydroxylase enzymatic activity will be determined in the in-vitro reconstituted enzymatic assay.
This study will answer the question of whether a post-transcriptional mechanism of CYP7A1 regulation exists. It has long been hypothesized that cholesterol synthesis and bile acid synthesis are co-regulated; the effects that AMPK has on bile acid synthesis will be able to address the co-regulation between the two pathways. AMPK kinase activity is involved in many cellular metabolic pathways, this study will also provide information about the cross-talk between cholesterol synthesis, bile acid synthesis, and energy metabolism pathways in the cell. CHAPTER II
MATERIALS AND METHODS
PART 1: Cholesterol 7 -hydroxylase Specific Antibodies
a. Rationale for Cholesterol 7 -hydroxylase Antibody Production
Antibodies for cholesterol 7 -hydroxylase are commercially available
(Santa Cruz Biotechnology, Inc. CYP7A1 (H-58): sc-25536), but did not show strong affinity or specificity for the antigen when tested by immunoblot analysis.
In order to identify E. coli-expressed recombinant cholesterol 7 -hydroxylase antigens, anti-CYP7A1 antibodies were developed.
b. Antigen (C2) used for CYP7A1 Antibody Production
For CYP7A1 polyclonal antibody production, a 20.3 Kb polypeptide fragment (C2) was generated as antigen for immunization. The C2 nucleic acid sequence was cloned into the Roche pIVEX2.4b Nde vector. The expression vector is under the control of the T7 promoter and has an N-terminal linker 6X
His-tag for purification. The C2 polypeptide is 175 amino acids long
37 38
corresponding to N148-G323, which is located at the central region of the 504aa
CYP7A1 polypeptide sequence. The large antigen used for our antibody production is an
improvement over the antigen that was used for the production of the commercially
available antibody. The commercial antibody was raised against a smaller peptide
corresponding to amino acids 447-504. The larger C2 antigen provides more epitopes for
antibody generation, and is located in the central region of the enzyme. The location of
the epitopes will allow detection of both full-length and degraded E. coli-expressed
recombinant CYP7A1, with the goal of developing affinity purified antibody prep with
higher affinity/avidity and in sufficient quantity for the project.
c. Sub-cloning of the C2 cDNA Sequence into E. coli-expression Vector
The C2 pIVEX2.4b Nde vector construct was transformed into the E. coli DH5
cell line, and plated on 15% agar LB-antibiotic plates with 50mg/ml ampicillin. As a
negative control, the DH5 E. coli cell line was transformed with the pIVEX2.4b Nde
vector construct only. Transformation procedure was performed as described on page
126. Plates with transformed cells were incubated at 37oC overnight. Colonies were
selected from transformed plates and inoculated into 2ml LB + ampicillin broth, and
grown overnight. DNA mini plasmid prep isolation was performed on 1ml of the
cultured sample, and isolated DNA was separated by electrophoresis on a 1% agarose
gel.
Cultures that yielded plasmids that migrated slower than empty vector on agarose
gels, were streak plated and incubated overnight at 37oC in order to isolate single 39
colonies. The colonies were inoculated in 2ml LB + ampicillin overnight, and mini
plasmid preps were performed on the samples. The plasmid DNA isolated was separated
by electrophoresis on a 1% agarose gel to confirm plasmid size. Plasmid samples that
were positive for fragment insertion were restriction mapped by digesting with restriction
enzymes flanking the insert. The restriction-digested samples were separated by
electrophoresis on a 1% agarose gel to confirm insert size. Freezer stocks were made of
samples that had the appropriate fragment size, and stored at -70oC. Procedures for
freezer stock preparation are described in the material and methods section.
Positive samples were grown in a larger volume of LB + 50mg/ml ampicillin
overnight, and plasmid preparation was performed using the Nucleobond DNA
purification kit from Clontech (Palo Alto, CA). The plasmid prep kit provided a higher
concentration of DNA plasmid that was clean from contaminants. This sample was
sequenced to confirm that the inserted fragment was in-frame with the vector-construct;
and no unwanted mutations were made to the sequence. The C2 cDNA sequencing was
performed by the Ohio State University Plant-Microbe Genomics Facility using T7
forward (T7P) and T7 reverse (T7T) primers. Contiguous alignment of the sequence was
generated using both Map Vector 2.3 and ClustalW (1.83) multiple sequence alignment
programs [Fig. 5]. The sequence alignment showed that the C2 fragment was in-frame
with the vector initiation site, and no unwanted mutations were made to the DNA sequence. 40
Figure 5. ClustalW (1.83) Multiple Sequence Alignment of C2 and Full-length
CYP7A1
C2 sequence alignment with full-length CYP7A1 cDNA sequence. C2 sequencing was performed using T7 promoter and T7 terminator primers provided by sequencing company. “ * “ Indicates consensus sequences between the nucleic acid sequence from full-length CYP7A1 cDNA sequence and sequence results from the C2 fragment. A
100% homology was obtained from the multiple sequence alignments. 41
Figure 5. ClustalW (1.83) Multiple Sequence Alignment of C2 and Full-length
CYP7A1 42
d. Expression of the C2 Antigen
For the expression of the C2 fragment, the vector-construct was transformed into
the E. coli BL21 (DE3) expression system. The BL21 (DE3) cell line allows for high
protein expression of vector constructs under the control of the T7 promoter and have a
ribosome-binding site. The BL21 (DE3) cell line contains a T7 bacteriophage gene that
encodes for T7 RNA polymerase under the control of the lac operon. Expression of the
gene of interest can be induced by the addition of isopropyl -D-1-thiogalactopyranoside
(IPTG), which will trigger the transcription of the T7 RNA polymerase and promote
transcription of the gene of interest.
i. Expression of C2 with BL21 (DE3) E. coli Cell Line
An expression time course, using different concentrations of IPTG, was performed to determine the appropriate parameters for C2 expression. Figure 6 is the
results from the immunoblot analysis of the IPTG induced expression of the C2
polypeptide. Fig. 6A is the induction of the C2 pIVEX 2.4b Nde construct with 1mM
IPTG for 0, 2, and 4 hrs, and Fig. 6B is the induction of the C2 pIVEX 2.4b Nde
construct with 2.5mM IPTG for 0, 2, 4, and 6 hrs. The immunoblot detection was
performed with anti-His antibodies. The results showed that 2.5mM of IPTG was
capable of inducing expressing of the C2 fragment. Expression proceeded for 4hrs of
induction and decreased at the 6 hrs time point. The expression of the C2 fragment was 43 very temperamental as 0 time point, with no IPTG, showed leaky expression in gel B, but there was no detection in gel A. Scaling up the expression did not produce substantial C2 antigen for antibody production. 44
Figure 6. Western Blot Analysis of In-vitro Expressed C2 Antigen for Antibody
Production.
6A: Induction of C2 pIVEX 2.4b Nde BL21 (DE3) vector construct with 1 mM IPTG for
0, 2, and 4 hrs, corresponding to lanes 2, 3 and 4 respectively. 6B: Induction of C2 pIVEX 2.4b Nde BL21 (DE3) vector construct with 2.5 mM IPTG for 0, 2, 4, and 6 hrs, corresponding to lanes 6, 7, 8 and 9 respectively. Lanes 1 and 5 are pre-stained low molecular weight markers. Western blot was performed with anti-His antibodies. 45
A B 1 2 3 4 5 6 7 8 9 KD
106.5 97.6 50
36.9
28.9
19.9
Figure 6. Western Blot Analysis of In-vitro Expressed C2 Antigen for Antibody
Production. 46
ii. Expression of C2 with the Roche RTS 500 E. coli HY kit
The Roche RTS 500 E. coli HY cell free system was used to improve expression
of the C2 antigen. The RTS 500 is a coupled transcription/translation reaction, which
utilizes the T7 RNA polymerase. The transcription and translation machinery that are
used in the expression system are present in the E.coli lysate provided. The expression system consists of two chambers, a 1ml chamber that serves as the reaction compartment were expression takes and a feeding compartment that supplies the necessary amino acids, nucleotides and energy substrates. A semi permeable dialysis membrane is used to separate the two chambers and it keeps the waste components at a minimum in the reaction chamber. With this system, the C2 antigen was expressed to a maximum of 5 mg per ml at 20 hrs of expression [Fig. 7]. The C2 RTS 500 expression system produced substantial amounts of C2 that was used for antibody production. 47
Figure 7. RTS 500-expressed C2 Antigen for Antibody Production.
In-vitro expression of C2 in the RTS 500 E. coli expression system for 0, 2, and
20 hrs corresponding to lanes 1, 2, and 3 respectively. Western blot was performed with anti-His primary antibodies at a 1: 6,000 dilution and goat-anti- mouse-HRP secondary at 1:10,000 dilutions. Solid Arrow on the right indicates
C2 antigen detection. 48
KD 1 2 3
106.5 97.6
50
36.9 28.9
19.9
Figure 7. RTS 500-expressed C2 Antigen for Antibody Production. 49
e. Immunization for Antibody Production
Two New Zealand White Female Rabbits, tagged 20967 and 20966, were used for antibody production. Pocono Rabbit Farm & Laboratory Inc. (PRF&L), located in
Canadensis, PA, performed the rabbit’s Immunizations. 100 – 200 μg of the C2 antigen
was used for each immunization. The timeline and procedures for the immunizations are
outlined in table 1. Rabbits 20966 and 20967 were maintained on a four-week cycle of
immunizations with the C2 antigen. A small bleed of 3-5ml were collected from the
rabbits and characterized for production of C2 specific polyclonal antibodies. 50
Day 0 Small preimmune bleed (3-5ml sera). Immunize with 100-200 μg/rabbit antigen in complete freund’s adjuvant (CFA) intradermally. Day 14 Immunize with 50-100 μg/rabbit antigen in incomplete freund’s adjuvant (IFA) intradermally. Day 28 Immunize with 50-100 μg/rabbit antigen in IFA subcutaneously Day 42 Small bleed 3-5ml sera Day 44 Receive small bleeds from preimmune and immune serum Day 56 Immunize with 25-50 μg/rabbit antigen in IFA subcutaneous Day 70 Small bleed (3-5ml sera), continuing every 28 days Day 72 Received small bleed Day 84 Immunize with 25-50 μg/rabbit antigen in IFA subcutaneous and continuing every 28 days.
Table 1. Polyclonal Antibody Production Schedule
Table 1 shows the timeline and procedure for rabbit immunization. 100 – 200 μg of the
C2 antigen was used for each immunization and subsequent antibody boosts. The rabbits are maintained on a four-week cycle of immunizations and small bleeds, until antibody specificity for C2 is determined. 51
f. Characterization of Anti-serum from Immunized Rabbits
The serum was characterized for each rabbit small bleed after the immunization cycle was completed (refer to Table 1). For the rabbit serum characterization, serum from rabbits’ 20966 and 20967 were used as primary antibodies (dilutions from 1:500 to
1:20,000), with goat anti-rabbit-HRP secondary antibodies (1:10,000) for western blot analysis of the RTS 500-expressed C2 antigen [Fig. 8 and Fig. 9].
In figure 8, the C2 antigen sample was overloaded; necessary adjustments were made on subsequent western blots. Figure 8, Lane 1 and 6 are western blot analysis performed with pre-immune serum as the primary antibody from rabbits 20966 and
20967 respectively. Dilution used for the pre-immune serum was 1:500. Western blot showed that the serum had no specificity for the C2 antigen prior to immunization of the rabbits. Lanes 2-5, and lanes 7-10, is the western blots that were performed with serum from the immunized rabbits 20966 and 20967 respectively. From left –right, dilutions of the serum used for the western blot analysis are 1:100, 1:500, 1:1,000, and 1:5,000.
Arrow on the right side of the gel indicates C2 migration.
Figure 9 is the western blot analysis of the C2 antigen with rabbits 20966 and
20967 serum after two months of immunization. Lanes 1- 4, from the left –right, rabbit
20966 Pre-immune serum (1:500), immunized serum, 1:1,000, 1:5,000, 1:10,000 dilutions. Lanes 5-8, from left – right, rabbit 20967 pre-immune serum (1:500), followed by immunized serum from rabbit 20967 in the same dilution order as the previous rabbit.
The serum from the immunized rabbits showed strong affinity for the C2 polypeptide even at a 1:10,000 dilution. Indicating that the rabbits were producing 52 antibodies against the C2 antigen. The serum also showed affinity for non-specific E. coli proteins, which were present in the RTS 500 C2 assay sample used for immunization. The following experiments were performed to confirm the presence of C2 specific antibodies in the rabbit serum. 53
Figure 8. Western Blot of C2 Samples with Serum from the First Small Bleed of Immunized rabbits
Lanes 1-5 – from left –right, 20966 Pre-immune (1:500 dilution) lane1, immunized rabbit 20966 serum lanes 2-5 are 1:100, 1:500, 1:1,000, 1:5,000 dilutions. Lanes 6-10 is for rabbit 20967 in the same order with lane 6 being the pre-immune serum. Arrow on the right indicates C2 migration. 54
1 2 3 4 5 6 7 8 9 10 KD 106.5
97.6 50
36.9 28.9
19.9
Figure 8. Western Blot of C2 Samples with Serum from the First Small Bleed
of Immunized rabbits 55
Figure 9. Western Blot of C2 Samples with Serum After Two Months of
Immunization
Lanes 1-4 – from left –right, 20966 Pre-immune (1:500 dilution) lane1, immunized rabbit 20966 serum lanes 2-4 are 1:1,000, 1:5,000, 1:10,000 dilutions.
Lanes 5-8 is for rabbit 20967 in the same order with lane 5 being the pre-immune serum. Arrow on the right indicates C2 migration. 56
1 2 3 4 5 6 7 KD 8 106.5 97.6
50
36.9
28.9
19.9
Figure 9. Western Blot of C2 Samples with Serum After Two Months of
Immunization 57
g. Pre-absorption of Rabbit Serum with E. coli Lysate
In order to determine whether the serum contained antibodies specific to C2, and
that the band detected in the western blot analysis was not a co-migrating E. coli protein,
the rabbit serum was pre-absorbed with E. coli lysate from the RTS cell free system. The rationale for this experiment is: the E. coli lysate will absorb any E. coli specific antibodies present in the serum, but will not have an effect on C2 specific antibodies.
The serum for rabbits 20966 and 20967 were pre-incubated with the RTS 500 E. coli lysate, for 15 min in TTBS buffer. The pre-absorbed serum was used as the primary antibody, in a western blot analysis of the C2 antigen prepared with the RTS 500 assay
[fig. 10]. The experiment showed that the pre-incubation of the serum with E. coli lysate, pre-absorbed the E. coli specific antibodies. Thereby, diminished the specificity of the serum to the E. coli proteins. Fig. 10 shows the band intensity of the E. coli proteins diminish in the western blot analysis when comparing complete serum detection lane 1 and 3 to pre-absorbed serum detection lanes 2 and 4, for rabbits 20966 and 20967 respectively. The E. coli antibody pre-absorption had no effect on the specificity and affinity of the serum to the C2 polypeptide. The band intensity of the C2 antigen remained the same, when comparing complete serum to pre-absorbed serum western blots. This indicates that the serum contains antibodies that react to the C2 polypeptide, and the band observed is not a co-migrating E. coli protein. 58
1 2 3 4
Figure 10. Western Blot Analysis of C2 Antigen with Pre-absorbed Rabbit
Serum
The rabbit serum was pre-absorbed with E. coli lysate prior to using it as the primary antibody for C2 RTS samples at a dilution of 1:10,000. Lanes 1 and 2 are un-absorbed and pre-absorbed antibody for rabbit 20967. Arrow indicates migration of the C2 polypeptide. 59 h. Antibody Characterization with Purified C2 Antigen
To further confirm that the rabbit serum contained antibodies specific for the C2 polypeptide, the serum was tested against purified C2 antigen. The C2 antigen was purified as described in the protein purification section of this chapter. The serum was used for a western blot analysis of the purified C2 antigen. Western blot analysis of the purified and unpurified C2 antigen was also performed with anti-His antibody as a positive control. Figure 11 shows the results from the western blot analysis of unpurified
C2 antigen (lanes 1, 3, and 5) and purified C2 antigen (lanes 2, 4, and 6). Primary antibodies used were: anti-His antibodies for lanes 1 and 2 at a concentration of 1:3,000, lanes 3 and 4 was with Rabbit 20966 serum and lanes 5 and 6 was with rabbit 20967 serum, both at a concentration of 1:10,000.
The western blot analysis shows strong affinity and specificity of the serum to the purified C2 antigen. The experiment provided additional evidence that the serum is capable of reacting with the C2 polypeptide. The positive bands on the anti-His western blot shows that the isolated protein was fused with the 6x His-tag, and is therefore a product from the vector construct. The blot with the two rabbit serum (20966 and 20967) showed that the same peptide reacts with the rabbit serum, confirming that the serum contains anti-C2 antibodies. 60
Figure 11. Western Blot Analysis of Purified C2
Western blots of unpurified C2 (lanes 1, 3, and 5) and purified C2 (lanes 2, 4, and
6). Primary antibodies used were: Anti-His antibody for lanes 1 and 2 at a
concentration of 1:3,000, lanes 3 and 4 was with Rabbit 20966 serum and lanes 5 and 6 were with rabbit 20967 serum, both at a concentrations of 1:10,000. 61
1 2 3 4 5 6 KD
106.5 97.6
50
36.9
28.9
19.9
Figure 11. Western Blot Analysis of Purified C2 62 i. Antibody Affinity Purification:
i. C2 Affinity Column Preparation
In order to purify C2 antibodies from the rabbit serum, a C2 affinity column was prepared using a cyanogen bromide activated matrices. The cyanogen bromide reacts with hydroxyl groups on agarose in alkaline solutions, to form very active cyanate esters, and a small portion of slightly active imidocarbonates. These groups react with the primary amines of the ligand at very mild conditions, forming a covalent coupling of the ligand to the agarose matrix.
The purified C2 polypeptide was dialyzed against cyanogen-bromide activated matrix coupling buffer (0.1M NaHCO3 containing 0.5M NaCl, pH 8.3-8.5). The cyanogen-bromide activated resin was washed and swelled in cold 1 mM HCl for 30 minutes with continuous buffer exchange. The resin was then washed in distilled water,
5-10 column volumes, and then washed in the coupling buffer (5 ml per gram dry gel).
After adding the coupling buffer, the purified C2 polypeptide was immediately added (5-
10mg protein per ml of gel) and rocked at room temperature for 2 hours. Un-reacted ligands were washed away with two washes using the coupling buffer at a volume that is two times the column volume. The un-reacted groups on the resin were blocked with 0.2
M glycine, pH 8.0 for 2 hours at room temperature. The column was washed extensively to remove the blocking solution, first with basic coupling buffer at pH ~ 8.5, then with acetate buffer (0.1 M, pH4) containing NaCL (0.5 M). The wash cycle of high and low 63 pH buffer was completed five times and the C2 column was stored in 1.0 M NaCL at 4oC with 0.05% of a suitable bacteriostat.
j. C2 Antibody Affinity Purification
The C2 cyanogen-bromide activated matrix column was first washed twice with distilled water. The resin was transferred into a 50 ml sterol tube and washed five times with 1X TBS (tris-buffered saline, 20 mM tris 50 mM NaCL, Ph 7.5). The resin was then washed two times with 20 ml of 100 mM glycine HCL/150 mM NaCL, followed by two washes with 20 ml of 1X TBS. Serum was spun down at 3K RPM for 1 Min to remove precipitation and then added to the equilibrated C2 column for binding. The column was mixed gently for 30 min by gently rolling and allowing settling before rolling again. The column was then settled and the serum was allowed to flow through. The column was then washed with 100-times the resin volume with 1x TBS. The antibodies were eluted with 10 ml of 100 mM glycine HCL pH 2.4/ 150 mM NaCL and 1 ml fractions were collected in eppendorf tubes containing 200 μl of 1M tris pH 9 to neutralize the eluted samples.
The protein concentration was determined using a BCA (bicinchoninic acid) protein assay and the apparent molecular weight of the eluted protein was determined by electrophoresis on a 10% SDS polyacrylamide gel, and stained with coomassie blue [Fig.
12]. The eluted fractions peaked at fraction 3. The band noticed indicated the heavy chain of the eluted antibody. The affinity of the purified antibodies was determined by 64 western blot analysis of purified C2. The western blot analysis showed that the purified antibodies had strong affinity and specificity for the purified C2 antigen [Fig. 13]. 65
Figure 12. Coomassie Blue Staining of C2 Polyclonal Antibody Purification
Lanes 1-8 is collected fractions from the C2 cyanogens-bromide activated matrixes column. Coomassie stain of eluted fractions separated on a 10% SDS-
PAGE. Fractions peaked at fraction 3. 66
1 2 3 4 5 6 7 8
KD 106 97.6
50
36.9
28.9
Figure 12. Coomassie Blue Staining of Purified C2 Polyclonal Antibody 67
KD
106 97.6
50
36.9
28.9
19.9
Figure 13. Western Blot Analysis with Affinity Purified C2 Polyclonal Antibodies
Affinity purified polyclonal antibodies eluted from the C2 cyanogen-bromide activated matrix column were used for a western blot analysis of purified C2 polypeptide. The antibodies showed strong specificity for the C2 antigen 68
PART 2: Expression of Recombinant CYP7A1 in E. coli
a. History of CYP7A1 Expression
The difficulties with expressing cholesterol 7 -hydroxylase have been well documented. The low levels of CYP7A1 expression in COS cells has been reported[96,
97]. Expression of recombinant CYP7A1 in E. coli cell lines has also been a challenge.
The enzyme has been successfully expressed in E. coli cells, but the levels of expression are low. It has been suggested that the membrane-binding nature of CYP7A1, make it difficult to express in E. coli cell, due to the lack of an internal membrane system for the enzyme to insert into[98].
b. Sub-cloning WT CYP7A1 cDNA into E. coli-expression Vector
To overcome the difficulties in CYP7A1 in-vitro expression, the invitrogen pTrc-
His2b expression vector was chosen to express CYP7A1 recombinant protein in E.coli
Top 10 cells. The pTrc-His2b vector was chosen because of its advantageous features. It
is not under the control of the T7 promoter but instead a Trc promoter (a hybrid of the trp
and lac promoters for high-level expression of fusion proteins); it also contained a mini
cistron, and a re-initiation ribosome binding site up-stream of the transcription start site.
The mini-cistron loads multiple ribosomes, and brings them in close proximity to the
transcription start site. Because the expression vector is not under the control of the T7
promoter, the plasmids were amplified and expressed in E. coli cell lines with high 69
transformation efficiencies (eg. DH5 and Top 10 cell lines). The vector also has a c-
terminal 6X His-tag for purification of in-frame recombinant protein.
The full-length cDNA sequence of CYP7A1 was sub-cloned into the pTrc-His2b
vector using 5`GGGACCATGGCTACCACATCTTTGATTTGG-`3 (pTrc-5`[NcoI]-F)
forward and 5`GGGTAGAAAGCTTCGCAAATGCTTGAATTTATA-`3(pTrc-
3`[HindIII]-R) reverse primers. E. Coli Top 10 cells were transformed with either the
pTrc-His2b vector only, or vector sub-cloned with the CYP7A1 cDNA sequence.
Expression of the CYP7A1 recombinant protein was performed as described in the
materials and methods section. Isolated protein samples were separated by electrophoresis on a 12.5% polyacrylamide SDS-PAGE gel, and transferred onto PVDF transfer membrane for immunoblot assay detection. Both anti-His and anti-CYP7A1 antibodies were used to confirm protein expression off the plasmid construct [Fig. 14].
70
Figure 14. Western Blot of E. coli-expressed WT CYP7A1 Recombinant
Protein
Lane 1-pre-stained low molecular weight markers. Lane 2- C2 His tagged positive control. Lane 3- E. coli expressed vector only negative control. Lane 4-
E. coli expressed CYP7A1 recombinant protein. Fig. 14A and 14B are immunoblot analysis with anti-His and anti-CYP7A1 antibodies respectively. 71
KD C WT C WT c2 KD c2 A B 107 98 107 98
50 50
37 37
29 29
20 20
Figure 14. Western Blot of E. coli-expressed WT CYP7A1 Recombinant Protein 72
c. Characterization of Recombinant CYP7A1 Protein
Figure 14 shows the immunoblot analysis of recombinant protein expression from the CYP7A1 cDNA sequence. Both gels were loaded in the same order with equal amounts of total protein, using BSA as the mass standard. Lane 1 is a pre-stained low molecular weight marker. Lane 2 is the positive control for the western blot analysis, using the C2 His-tagged polypeptide that was previously described in the production of anti-CYP7A1 antibodies section. Lane 3 is the negative control, using expressed proteins from the E. coli Top 10 cells transformed with vector only construct. Lane 4 is the expressed sample from the CYP7A1 cDNA vector construct.
Immunoblot analysis of the E. coli Top 10 cells transformed with the CYP7A1- pTrc-His2b vector construct, showed positive detection of expressed proteins. In contrast, the vector-only construct showed no detectable bands. This indicated that the observed proteins expressed were from the CYP7A1 cDNA construct. The positive bands detected from the CYP7A1 cDNA construct with the anti-His antibodies, confirm that the expressed protein was in-frame with the c-terminal 6X His-tag.
Multiple bands were detected in the CYP7A1 sample. The approximate molecular weight for the full-length CYP7A1 and the linker-His tag was determined with Science
Gateway molecular weight calculator to be 60KD. Five high molecular weight bands corresponding to 60, 49, 47.6, 46.4, and 44.5 KD, and a predominant 30KD fragment, were detected in the immunoblot analysis of recombinant protein expressed off the
CYP7A1 cDNA vector construct. The approximate molecular weights of the detected 73 bands were determined by using the Kodak 1D 3.5.3 imaging software. The bands from the molecular weight markers were used to determine the approximate molecular weights of the detected bands. The higher molecular weight bands, from 49 to 44.5 KD, were attributed to protein degradation because of the laddering effect, and the positive detection with the anti-His and anti-CYP7A1 antibodies.
The positive detection with the anti-CYP7A1 antibodies, confirmed that the expressed proteins had the same specific epitopes as the C2 polypeptide that was used to generate the anti-CYP7A1 antibodies. The predominant 30KD fragment was not detected in the anti-CYP7A1 immunoblot assay, but was detected in the anti-His immunoblot assay. The detection with the anti-His antibody indicated that the expressed
30KD fragment was in frame with the CYP7A1 full-length cDNA construct. The fact that the fragment could have been a product of degradation was considered, but this hypothesis was not consistent with the observed results. If the 30KD polypeptide were a product of degradation, there would be expected laddering of various molecular weights migrating faster and slower than the prominent band, as seen in the higher molecular weight bands. The two other explanations could be; the 30KD fragment is a result of a single proteolytic cleavage, resulting in two bands of the same intensity and molecular weight; secondly, the 30KD fragment is a result of an internal start in the CYP7A1 cDNA sequence. 74
d. Characterization of Expressed 30KD Fragment
Manual sequence analysis of the CYP7A1 cDNA sequence revealed a sequence
with homology to an E. coli consensus ribosome binding site located between nucleic
acids T965 to A970, approximately in the middle of the cDNA sequence. The presence
of an internal start site was further confirmed by CYP7A1 cDNA sequence analysis with
the Gene Locator and Interpolated Markov ModelER (GLIMMER) software. The
GLIMMER software was also used to predict the efficiency of the open reading frames
(ORF). The efficiency of the ORF as determined by the GLIMMER software, starting at
amino acids 965, was 1.44 times greater than that of the full-length CYP7A1 cDNA
sequence. The higher efficiency of the internal start site would explain the approximate
1:2 ratio in expression between the higher molecular weight bands compared to the 30KD
fragment. The ratios between the expressed proteins were determined by comparing
triplicate densitometry measurements of the higher molecular weight bands to the 30KD
fragment from anti-His western blot analysis. Method for determining specific protein
amounts using the densitometry measurements are described in the appendix
experimental protocols.
An internal start site from amino acids 965 would result in a fragment
approximately the same size as the band observed in the western blot. This was
determined by using a molecular weight calculator. To confirm that the predominant
30KD fragment was a result of an internal start site, the polypeptide was isolated and
sequenced. The 30 KD fragment was purified with a Ni-NTA Purification system and
separated by electrophoresis on a 12.5% SDS-PAGE gel. The gel was stained and the 75
30KD fragment was cut out and sequenced by The Ohio State, Plant-Microbe Genomics
Facility.
The sequencing result from the 30KD fragment was aligned with the
CYP7A1 full-length protein sequence and resulted in a 964-point identity [Fig.15]. The sequencing results confirmed that the 30KD fragment was a truncated peptide from the
CYP7A1 polypeptide and also confirmed that is was a result of an internal start from the
CYP7A1 cDNA sequence.
The immunoblot with the anti-CYP7A1 antibodies did not detect the 30KD fragment. The 30KD fragment was not detected in the immunoblot with the anti-
CYP7A1 antibody because of the lack of specific epitopes. The anti-CYP7A1 antibodies were produced with the C2 antigen as described in the material and methods section.
Protein alignment of the C2 polypeptide and the 30KD fragment showed only a 16 amino acid overlap between the two polypeptides [Fig.16].
76
1 MMTTSLIWGI AIAACCCLWL ILGIRRRQTG EPPLENGLIP YLGCALQFGA 51 NPLEFLRANQ RKHGHVFTCK LMGKYVHFIT NPLSYHKVLC HGKYFDWKKF 101 HFATSAKAFG HRSIDPMDGN TTENINDTFI KTLQGHALNS LTESMMENLQ 151 RIMRPPVSSN SKTAAWVTEG MYSFCYRVMF EAGYLTIFGR DLTRRDTQKA 201 HILNNLDNFK QFDKVFPALV AGLPIHMFRT AHNAREKLAE SLRHENLQKR 251 ESISELISLR MFLNDTLSTF DDLEKAKTHL VVLWASQANT IPATFWSLFQ 301 MIRNPEAMKA ATEEVKRTLE NAGQKVSLEG NPICLSQAEL NDLPVLDSII 351 KESLRLSSAS LNIRTAKEDF TLHLEDGSYN IRKDDIIALY PQLMHLDPEI 401 YPDPLTFKYD RYLDENGKTK TTFYCNGLKL KYYYMPFGSG ATICPGRLFA 451 IHEIKQFLIL MLSYFELELI EGQAKCPPLD QSRAGLGILP PLNDIEFKYK 501 FKHL
Figure 15. Protein Sequence Alignment of Human Cytochrome P450 7A1 (CYP7A1) and the 30KD Isolated Fragment
Amino acids 1-501 represent the full-length protein sequence of CYP7A1. Bold red lettering represents positive sequence alignment between WT CYP7A1 and the 30KD fragment. The alignment match score was 964. 77
Figure 16. Protein Alignment of the C2 Polypeptide and the 30KD Fragment
Sequence alignment of the C2 polypeptide used for anti-CYP7A1 antibody production and the 30KD fragment from in-vitro expressed recombinant CYP7A1 revealed a 16 amino acid overlap. The bold underline represents the sequence identity between the two polypeptides. 78
Figure 16. Protein Alignment of the C2 Polypeptide and the 30KD Fragment 79
To farther confirm that the 30KD fragment was in-fact a product from an internal
start, the CYP7A1 cDNA sequence was truncated at the N-terminus and sub-cloned into
the pTrc-His2b vector. 729 nucleotides were deleted from the N-terminus. The N-
terminus was truncated out-of-frame from the WT CYP7A1 cDNA reading frame. The
purpose of truncating the CYP7A1 cDNA sequence out-of-frame was to insure that the
CYP7A1 cDNA sequence was not read in-frame with the linker 6x His tag. If the
construct resulted in the synthesis of a polypeptide from the vectors’ initiation site, it
would result in a polypeptide that is out-of-frame with the 6X linker His-tag, and therefore will not be detected with the anti-His antibodies. If the 30KD fragment is a result from an internal start, expression should proceed from the AUG down stream of the ribosome-like binding site, and the expressed polypeptide will be in-frame with the
6X linker.
Figure 17 shows the immunoblot analysis from the expression of the CYP7A1 full length and truncated (1-729) vector constructs. Lane 1 is the pre-stained low molecular weight marker, lanes 2 and 3 are the recombinant proteins expressed from the full length and truncated (1-729) CYP7A1 cDNA vector constructs respectively. Immunoblot analysis was performed with anti-His antibodies. The immunoblot shows the detection of the 30KD fragment in both the full length and truncated constructs. This result provided additional evidence that the 30KD fragment was a product of an internal start. The immunoblot also provides evidence that the higher molecular weight polypeptides that are detected in the CYP7A1 full-length vector construct are products from the CYP7A1 full-length cDNA sequence. 80
Figure 17. Western Blot of E. coli-expressed WT CYP7A1 and Truncated CYP7A1
Recombinant Protein
Lane 1-pre-stained low molecular weight marker. Lane 2- E. Coli expressed WT
CYP7A1 recombinant protein. Lane 3- E. Coli expressed truncated (1-729) CYP7A1.
Immunoblot detection was performed with anti-His antibodies. Arrow labeled “A” shows the expression of the higher molecular weight proteins from the CYP7A1 full- length construct. Arrow labeled “B” shows the expression of the 30KD fragment from the CYP7A1 full-length construct and the truncated (1-729) CYP7A1construct. 81
WT WT KD
104 97
50 A
37 B 29 20
Figure 17. Western Blot of E. coli-expressed WT CYP7A1 and Truncated CYP7A1 Recombinant Protein 82
PART 3: CYP7A1 Enzymatic Assay
a. History of CYP7A1 Assay Detection Methods
The difficulty in assaying the enzyme activity of cholesterol 7 -hydroxylase has
been well documented [98, 99]. Problems arising from the low levels of the cholesterol 7
-hydroxylase enzyme peptide and activity, compounded by issues of sensitivity of
detecting the end product in the enzyme assay. Recent techniques for quantifying
CYP7A1 enzymatic activity involves the quantification of 7-hydroxy-4-cholesten-3-one
(C4), the product of the next oxidative enzymatic reaction after CYP7A1 in the classical
bile acid synthesis pathway[19]. It has been reported that serum concentration of C4 and
7-hydroxycholesterol, the immediate product from CYP7A1 enzyme activity, reflects
both CYP7A1 enzymatic activity and bile acid synthesis in humans [19, 100, 101].
Because of the low detection sensitivity of 7-hydroxycholesterol, C4 has been the
intermediate of choice for characterizing the enzyme activity of cholesterol 7 -
hydroxylase.
Gälman, et al.[102], measured CYP7A1 enzymatic activity by monitoring C4,
using the conventional HPLC-ultraviolet method. With their technique, they were able to
separate C4 from peripheral blood and used it to quantify the activity of cholesterol 7 -
hydroxylase. Akira, et al.[19], developed a new technique to quantify serum C4 by liquid
chromatography-tandem mass spectrometry (LC-MS/MS). In their method, C4 was derivated into the picolinoyl ester (C4-7-picolinate), and then purified using a C18 cartridge. The derivation made the C4 picolinoyl ester more sensitive (with a reported 83 detection limit of 100ƒg) than the detection limits of C4 with a conventional HPLC- ultraviolet method.
b. CYP7A1 Assay Detection Method
A new detection method, using HPLC-MS, was developed in this study to quantify cholesterol 7 -hydroxylase enzyme activity by directly measuring 7 - hydroxycholesterol. Measuring 7 -hydroxycholesterol will be a direct measurement of cholesterol 7 -hydroxylase enzyme activity. 7 -hydroxycholesterol is the immediate product from the enzymatic reaction of CYP7A1 activity. The MS used in the assay, uses an orthogonal atmospheric pressure chemical ionization source (APCI) that improves sensitivity and reproducibility over a wide range of liquid chromatography
(LC) operating conditions.
The detection limit of the new method was evaluated by analyzing commercially available 7 -hydroxycholesterol (Steraliods, Inc. Newport, RI) that was diluted stepwise and analyzed in quadruplicates. The detection was linear down to 0.4moles of 7 - hydroxycholesterol with an R2 = 0.9829 [Fig. 18a and 18b]. Figure 18a shows the complete standard curve for 7 -hydroxycholesterol, and figure 18b shows the extracted linear portion of the standard curve. The assay was shown to be just as sensitive for 7 - hydroxycholesterol, as the detection reports of C4 by Gälman, et al. This method eliminates, the derivation steps required to detect C4 in the LC MS/MS method presented by Akira, et al., and the purification steps required for detecting C4 with the conventional 84
HPLC-ultraviolet method. By eliminating these steps, the new method is less time
consuming, and less expensive than the previously proposed methods.
c. Internal Standard for Enzyme Assay
For the quantification of 7 -hydroxycholesterol, a stable isotopic form of 7 -
hydroxycholesterol is needed as an internal standard. Deuterium (2H or D) compounds
2 have been used as an internal standard for quantifying C4[19]. 7-Deuterated ( H7) 7-
hydroxycholesterol (D7), is commercially available from Steraloids inc. Newport, RI, and
was used as the internal standard for quantifying CYP7A1 enzymatic activity. An
alternative to purchasing D7 was to perform a hydrogen/deuterium exchange on
exchangeable hydrogens of 7 -hydroxycholestrol. Exchangeable hydrogens are those bond to nitrogen, oxygen, and sulfer[103]. In the case of 7 -hydroxycholesterol, the
hydroxyl groups will exchange its hydrogen with the deuterium.
Unlike the commercially available D7, which the deuterium is covalently linked
to the hydrocarbon ring (C-2H bond), the hydrogen/deuterium exchange will replace
hydrogen atoms on the hydroxyl-groups of 7 -hydroxycholesterol (O-2H). The hydroxyl group is a commonly lost group during mass spectrometry; therefore, the O-2H
7 -hydroxycholesterol will not make a good internal standard. Upon fragmentation, the
O-2H group will be lost, and the internal standard will not be distinguishable from the
assay produced 7 -hydroxycholesterol. 85
The detection sensitivity of the internal standard was analyzed by co-injecting
triplicate samples of the commercially available 7 -hydroxycholesterol and D7 in
stepwise dilutions [fig. 19]. The internal standard was determined to elute at the same
time as 7-hydroxycholesterol when injected through the HPLC-MS equipped with a
C18 column, and had a molecular weight of 392 m/z. The concentration of D7 was normalized so the relative intensity between the D7 internal standard and 7 - hydroxycholesterol were comparable. The co-injected samples had the same slope, and
R2 values of 1 and 0.9917, for D7 and 7 -hydroxycholesterol respectively. Because of the sensitivity of the MS to the internal standard; ƒmoles quantities of the D7 compound was sufficient for the quantification of assay produced 7-hydroxycholesterol. 86
Figure 18a. Complete Standard Curve of 7 -hydroxycholesterol using the
HPLC-MS
Graph representation of intensity verses concentration (moles) of commercially purchased 7 -hydroxycholesterol. Extracted portion of the graph is enlarged in figure 18b. Detection limits of the HPLC-MS for 7 -hydroxycholesterol was linear down to 0.4moles at 385 m/z with an R2 value of 0.9829. 87
Figure 18a. Complete Standard Curve of 7 -hydroxycholesterol using the HPLC-
MS 88
Figure 18b. Extracted Portion of the Standard Curve for 7 -hydroxycholesterol using the HPLC-MS 89
2 Figure 19. 7-Deuterated ( H7) 7-hydroxycholesterol (D7) and 7 -
hydroxycholesterol Co-injection
Graph representation of intensity verses concentration (moles) of co-injecting triplicate
samples of the commercially available 7 -hydroxycholesterol and D7 in stepwise dilutions. Internal standard eluted at the same time as 7-hydroxycholesterol from the
HPLC-MS equipped with a C18 column. The internal standard is easily distinguishable
from 7 -hydroxycholesterol because of an additional +7 molecular weight for the internal standard. Sensitivity and intensity of both compounds was similar, therefore, no additional standardization was necessary 90
2 Figure 19. 7-Deuterated ( H7) 7-hydroxycholesterol (D7) and 7 - hydroxycholesterol Co-injection 91
d. Evaluating Assay Detection
E. Coli-expressed recombinant cholesterol 7 -hydroxylase has been previously
reported to be catalytically active [98]. The following experiments were performed to
determine whether the product from the enzymatic assay, 7 -hydroxycholesterol, could
be detected with the new detection method. Two in-vitro reconstituted CYP7A1
enzymatic assays were performed using recombinant proteins expressed from E. coli Top
10 cells, transformed with either vector only or vector containing full-length CYP7A1
cDNA. The CYP7A1 in-vitro reconstituted assay was performed as described below.
e. CYP7A1 Enzyme Assay
The enzyme assay was carried out in 500 μl containing 0.5-1 mg of either HepG2
cell microsomal protein or E. coli membrane fractions, 100 μM cholesterol in 3% Triton
X-100, 0.015% CHAPS, 0.1 M sodium phosphate buffer, pH 7.4, 1 mM EDTA, 5 mM
DTT, 100 μM ATP, 100 μM MgCl2, 200 M NADPH (in a regenerative system containing 5 mM isocitric acid, 0.01 U of isocitrate dehydrogenase). For CYP7A1 enzymatic assays performed with kinase treated samples, the protein samples were incubated at 30oC for five minutes with 0.5 – 1 μg of JNK, PKC, or AMPK kinase, prior
to the addition of the reducing agent. In AMPK kinase assays, adenosine 5`-
monophosphate (AMP) is reported to increase enzymatic activity by greater than two-
fold. This increase was not noticed in the CYP7A1 enzymatic assay, when compared to 92
AMPK treated assay without AMP. Therefore, AMP was omitted from the enzymatic
assay.
The kinases used for the in-vitro assay were commercially available from
Millipore, Temecula, CA. For the assay with the microsomal proteins, the macrolide
antibiotic, oleandomycin, was added to a final concentration of 50-M to inhibit
synthesis of the down stream products following 7 -hydroxycholesterol production.
Oleandomycin is not widely used in the CYP7A1 enzymatic assays, but has been
reported to correlated with an increase in 7 -hydroxycholesterol [104]. In my
experiments, with microsomal fractions, oleandomycin decreased the production of
secondary products and correlated with an increase in production of 7 -
hydroxycholesterol. The use of the antibiotic had no effect the production of 7 -
hydroxycholesterol in the recombinantly expressed protein assay because none of the
enzymes necessary for catalyzing the down stream reactions are present in the assay.
Therefore, it was not necessary to include the oleandomycin in the E. coli-expressed
CYP7A1 enzymatic assay.
Samples that were not treated with kinases were also incubated for five-minute at
30oC prior to the addition of NADPH. For the negative control, the assay was performed
with 1 mg of E. coli membrane fractions that were prepared from cells transformed with
vector alone. After the addition of the reducing agent, the assay was incubated at 37oC for 20 minutes. The reaction was stopped by the addition of anhydrous ether and was immediately ether extracted. 93
The reaction sample was ether extracted five times and the combined ether layers
were dried in a speed vacuum and suspended in 100 μl of methanol. The sample was then centrifuged to pellet the insoluble compounds. 10 μl of the sample was used per injected into a HPLC/MS equipped with a reverse phase C18 column. A quadruplicate injection of each sample was performed with an internal standard of 0.12 nmoles of D7 7-
hydroxycholesterol added to the fraction before injecting into the HPLC/MS. The
HPLC was connected to a Bruker Esquire 3000 plus-MS (APCI) system. Total ion and extracted ion chromatographs of the injected samples were obtained for the production of
7-hydroxycholesterol (385 m/z) and the internal standard D7 7-hydroxycholesterol
(392 m/z).
Figure 20 shows the complete and extracted ion chromatograph traces of samples
from the CYP7A1 reconstituted in-vitro enzyme assay. Fig. 20(a) represents the
complete ion chromatograph traces of samples from the CYP7A1 enzymatic assay
performed with E. coli-expressed recombinant protein from negative control vector only, and WT CYP7A1 respectively. Fig. 20(b) and 20(c) represent traces of the extracted ion chromatograph from both vector only and WT CYP7A1 respectively. The peak at
385m/z represents 7 -hydroxycholesterol extracted ion trace, and the 392m/z peak
represents the internal standard D7 7-hydroxycholesterol extracted ion trace. The
specific enzymatic activity was determined per mg of total E. coli protein. E. coli cells harboring the vector only did not have significant measurable enzymatic activity. This was concluded by the absence of the 385m/z peak, which indicates the production of 7 - 94
hydroxycholesterol. The extracted ion chromatograph for the internal standard, D7 7-
hydroxycholesterol (392 m/z), in the vector only assay was detectable as shown in Fig.
20b, with no detectable peak for 7 -hydroxycholesterol (385m/z). In contrast the E. coli
cells that was transformed with the WT CYP7A1 cDNA construct, produced a significant
amount of 7 -hydroxycholesterol (385m/z) [Fig 20c].
The results from this experiment indicated that the assay was successful in
producing 7 -hydroxycholesterol. It also confirmed that the new enzymatic detection
method was successful in detecting the production of 7 -hydroxycholesterol from the
assay. To confirm that 7 -hydroxycholesterol was produced from the enzymatic activity
of the recombinant protein; the reducing agent was omitted from the assay. The 7 - hydroxycholesterol peak that was measured in the NADPH absent assay was comparable to that of the assay performed with vector only.
D7 was used to quantify the amount of 7 -hydroxycholesterol produced in the assay. The results were normalized to reflect the specific activity per min per mg of total
E. coli protein used in the assay. Figure 21 is the graphical representation of the specific enzymatic activity of the in-vitro expressed recombinant CYP7A1 protein compared to assay performed with E. coli cells harboring the vector only. Specific enzymatic activity measured was 2.2 ± 0.3 and 174 ± 27.6 moles/min/mg of total protein for the vector only and WT CYP7A1 enzyme assay respectively. The error bars indicate the variation in measurements associated with a quadruplicate injection of the same assay and is recorded as the standard deviation of the mean. 95
Figure 20. Complete and Extracted Ion Traces of Samples from the CYP7A1
Enzyme Assay.
Fig. 20(a)- traces represent the complete ion chromatograph representing samples from
CYP7A1 enzymatic assay performed with E. coli-expressed recombinant protein expressing the negative control vector only and WT CYP7A1 respectively. Fig. 20(b) and 20(c)- traces represents the extracted ion chromatograph from assay performed with vector only and recombinant CYP7A1respectively. Arrows within the extracted ion chromatograph indicate the peaks for 7 -hydroxycholesterol (385m/z) and the internal standard D7 7-hydroxycholesterol (392 m/z). The only peak present in the vector only chromatograph (20(b)) represents D7 7 -hydroxycholesterol. Extracted ion chromatograph from the assay performed with recombinant CYP7A1 protein (20(c)) shows the appearance of the 385m/z peak corresponding to 7-hydroxycholesterol. 96 A
392 7 D7 m/z -hydroxycholesterol
B
Time 7 385 -hydroxycholesterol m/z
C
D7 392 m/z
Figure 20. Complete and Extracted Ion Traces of Samples from the CYP7A1
Enzyme Assay 97
Figure 21. CYP7A1 Reconstituted In-vitro Assay Performed with Vector only and
WT CYP7A1 expressed protein.
Enzymatic assay was normalized to reflect the amount of total protein used per assay.
Solid bar represents the measured enzymatic activity for vector only. The white bar
represents the measured enzymatic activity for the E. coli-expressed recombinant
CYP7A1 protein. Specific activity measured were 2.2 ± 0.3 and 174 ± 27.6
moles/min/mg for the vector only and WT CYP7A1 enzyme assay respectively. The error bars represent standard deviation associated with quadruplicate injection measurements of samples. 98
Figure 21. CYP7A1 Reconstituted In-vitro Assay Performed with Vector Only and
WT CYP7A1 E. coli-expressed Recombinant Protein. 99
f. Enzymatic Activity of the 30KD Fragment
The purpose of this experiment was to determine if the enzymatic activity
measured in the in-vitro reconstituted assay was from the 30KD fragment or the higher molecular weight proteins. To answer this question, two in-vitro reconstituted CYP7A1 enzymatic assays were performed with recombinant proteins expressed from E. coli Top
10 cells transformed with either, vector containing full-length CYP7A1 cDNA, or vector containing the truncated (1-729) CYP7A1 construct. The CYP7A1 in-vitro reconstituted assay was performed as previously described, and the assay was normalized to reflect the amount of specific proteins expressed.
The 30 KD fragment was shown to have enzymatic activity, but the measured activity was significantly lower than that measured from the WT CYP7A1. The 30KD
fragment had an activity that was 30% ± 4.1 RSD of the measured enzymatic activity of
WT CYP7A1 100% ± 5.7 RSD. 100
PART 4: MUTAGENESIS
To generate the individual mutations, site directed mutagenesis was performed on the cholesterol 7 -hydroxylase sequence, using a primer-directed PCR. Invitrogen Life
Technologies synthesized eighteen oligonucleotide primers that were used for the site directed mutagenesis [table 2].
Primer T193A-F contained a single nucleotide mismatch that resulted in a change from Threonine (T) Alanine (A) at position 193. This single mismatch is the same for other primers, with the numbers corresponding to the position of the amino acid change.
Primer T193A/T197A-F is a double mutation at positions 193 and 197. Primers T193A-
F, T197A-F and T193A/T197A-F all have a BgIII site at the 5` end of the primer which was used as a fusion point for the mutations. Primers C1-F (Not I) and C3-R (Sac I) are primers for generating the full-length CYP7A for the pIVEX 2.3mcs vectors with extended restriction sites at the 5` and 3` positions respectively. Primers pTrc-His2b-
[NcoI]-F and pTrc-His2b[HindIII]-R are primers for generating the full-length CYP7A for the pTrc-His2b vector. The C1-F (Not I) primer was constructed to introduce a start
(ATG) at the 5` amino terminus, and the C3-R (Sac I) primer was constructed to delete the stop at the 3` carboxyl terminus of the CYP7A gene. The stop codon on the CYP7A1 gene was deleted to allow fusion of the linker His-tag to the expressed polypeptide. The stop codon down stream from the Linker His-tag was used to terminate the translation of the gene product. 101
Table 2. Synthesized Primers used for Site-directed Mutagenesis.
Table 2, shows eighteen oligonucleotide primers that were used for the site directed mutagenesis and cloning into expression vectors. Primers were synthesized by Invitrogen
Life Technologies. 102
Table 2. Synthesized Primers used for Site-directed Mutagenesis.
Oligonucleotide Primers (F=forward and R=reverse)
1 5`GGCAGAGATCTTGCAAGGCGGGACACACAG3` (T193A-F
[BglII])
2 5`GGCAGAGATCTTACAAGGCGGGACGCACAG3` (T197A-
F[BglII])
3 5`GGCAGAGATCTTGCAAGGCGGGACGCACAG3`
(T193A/T197A-F[BglII])
4 5`CAAGCGGGTGAACCACCTCTAGAG3` (T29A-F),
5 5`CTCTAGAGGTGGTTCACCCGCTTG3` (T29A-R),
6 5`GTCCATTTCATCGCAAATCCC3` (T80A-F),
7 5`GGGATTTGCGATGAAATGGAC3` (T80A-R),
8 5`GGGAGCTCGCAAATGCTTGAATTTATATTT3` (1574-R [sac1]),
9 5`TTTTTTTTTGCGGCCGCACCACATCTTTGATTTGGGGG3`(C1-
66-F[Not1]),
10 5`GGGCTCGAGTTAGACTGGAGGTCTCATGATACG3` (C1-530-
R[Xho1]), 103
Table 2. Synthesized Primers used for Site-directed Mutagenesis.
Continued..
11 5`TTTTTTTTTGCGGCCGCATGACCACATCTTTGATTTGGGGG3`
(C1-F [not1],+ ATG),
12 5`GGGGGGAGCTCCAAATGCTTGAATTTATATTTAAATTC3` (C3-
R[sac1],-ACT)
13 5`GGGACCATGGCTACCACATCTTTGATTTGG 3` (pTrc-His2b[NcoI]- F)
14 5`GGGTAGAAAGCTTCGCAAATGCTTGAATTTATA3` (pTrc- His2b[HindIII]-R)
15 5`CTCCAAAAGAGGGAAGGCATCTCAGAACTG3` (S252G-F)
16 5`CAGTTGTGAGATGCCTTCCCTCTTTTGGAG3` (S252G-R)
17 5`ATCCGAAAAGATGACATCATAGCTCTTTAC3` (S385D-F)
18 5`GTAAAGAGCTATGATGTCATCTTTTCGGAT3` (S385D-R)
104
Due to the positions of the nucleic acids, various strategies were used to generate the site directed mutations. Four different strategies were used to generate the site- directed mutations. The strategies were adjusted accordingly to suit the site of the enzyme that was to be mutated. Adjustments made include: additional PCR purification steps, adjusting PCR conditions, and adjusting primer lengths
a. Site-directed Mutagenesis Strategy 1
Step A
This strategy was used to take of the Bgl II site that is up-stream from the desired mutation site. The full-length cDNA sequence of the CYP7A1 gene was cloned into the pIVEX2.3mcs vector. Restriction digestion was performed on the construct with Bgl II and Nde1 restriction enzymes. This restriction digest liberated 3 fragments because the
Bgl II restriction sites were present in both the CYP7A1 cDNA sequence and the vector sequence up stream of the multiple cloning sites. The fragment of interest, CYP7A1 N- terminus fragments with an Nde1 5` and a Bgl II 3` restriction site, was separated from the other fragments on a 1% agarose gel. The fragment was cut out from the gel and electro-eluted out of the gel. Ethanol precipitation was performed in order to purify and concentrate the DNA fragment. The N-terminus fragment was saved for the next step in the mutation design. 105
Step B
In step two, the C-terminus fragment with the mutation was produced. Forward
primers with the single nucleotide mismatch were used for PCR with the reverse primer
of the full-length CYP7A1 sequence. The forward primers were designed with the Bgl II
restriction site on the N-terminus in order to fuse the fragment to the gel isolated N-
terminus fragment isolated from step 1. After the PCR was performed with the mutant
forward primers and the full-length reverse primers, the resulting fragment was separated
on a 1% agarose gel. The DNA fragment was extracted by electro-elution and the
isolated DNA fragment was concentrated by ethanol precipitation.
Step C
In step three, the C-terminus fragment was digested with the Bgl II restriction enzyme and ligated with the N-terminus fragment from step one to produce the full- length cDNA CYP7A1 sequence with the desired mutation. The full-length cDNA sequence with the mutation was digested with SacI and ligated into the pIVEX2.3mcs vector that was digested with Nde1 and Sac1 restriction enzymes. Figure 22 is a schematic diagram of the procedures used in strategy 1 to produce the desired site directed mutation. 106
Figure 22. Schematic Diagram to Illustrate Site-directed Mutagenesis Strategy 1 107
b. Site-directed Mutagenesis Strategy 2
Step A
This strategy was designed as an improvement of strategy 1, and was used in the double mutant design. Digestion of the CYP7A1 full-length cDNA construct to produce the N-terminus fragment, in step one of strategy 1, resulted in a low concentration of isolated N-terminus fragment. The Nde1 restriction site, when digested, produced a two- nucleotide overhang that also made ligation difficult. Therefore, the restriction site was changed. Strategy 2 also took advantage of the Bgl II restriction site, which is up-stream from the desired mutation sites. In step one; the N-terminus fragment was produced using the full-length CYP7A1 forward primer with the Not1 restriction site at the 5` region, with a reverse primer that is down stream from the internal Bgl II restriction site.
The reverse primer was designed to incorporate the internal Bgl II restriction site in order to use it for fusing in subsequent steps. The PCR product was gel isolated from a 1% agarose gel by electro-elution and the extracted DNA was concentrated by ethanol precipitation.
Step B
In step two, a second PCR fragment was performed to produce the C-terminus fragment with the desired mutations. Forward primers with the single nucleotide 108 mismatch were used for PCR with the reverse primer of the full-length CYP7A1 sequence. The forward primers were designed with the Bgl II restriction site on the N- terminus in order to fuse the fragment to the gel-isolated N-terminus PCR fragment from step one. After the PCR was performed with the mutant forward primers and the full- length reverse primers, the resulting fragment was separated on a 1% agarose gel. The
DNA fragment was extracted by electro-elution and the isolated DNA fragment was concentrated by ethanol precipitation.
Step C
In step three, the two PCR fragments from step one and two were digested and then ligated together. The PCR fragment from step one was digested with Not1 and Bgl
II restriction enzymes. The PCR fragment form step two was digested with Bgl II and
Sac1 restriction enzymes. The two fragments were ligated together by the Bgl II site and the Not1 and Sac1 restriction sites were used to ligate the full-length CYP7A1 fragment, with the desired mutation, into the pIVEX2.3mcs vector. Figure 23 is a schematic diagram of the procedures used in strategy 2 to produce the desired site directed mutation.
109
Figure 23. Schematic Diagram to Illustrate Site-directed Mutagenesis Strategy 2 110
c. Site-directed Mutagenesis Strategy 3
Step A
This strategy was used for designing mutations on sites that were not in close
proximity to a single internal restriction site. In this site directed mutation strategy, the
forward and reverse mutant primers were complimentary sequences. In step one, a PCR
reaction was performed with the forward full-length CYP7A1 primer and the mutant
reverse primer. This PCR reaction will generate an N-terminus fragment with the desired
mutation at the C-terminus. The fragment was separated on a 1% agarose gel and gel
isolated by electro-elution. The fragment was concentrated by ethanol precipitation and
saved for subsequent steps.
Step B
In step two, a second PCR reaction was performed to produce the N-terminus
fragment. The PCR was performed with the mutant forward primer and the full-length
CYP7A1 reverse primer. The resulting fragment from this PCR reaction had the desired
mutation at the N-terminus of the fragment. The fragment was purified as previously described and saved for subsequent steps. 111
Step C
In step three, the PCR fragments that were generated in steps one and two above, were used as mega-primers for another PCR reaction. Because of the complimentary sequence present in both fragments, two annealing positions are possible. The first is the annealing of the 3` coding strand of the N-terminus fragment to the 3` template strand of the C-terminus fragment. This annealing results in an available 3` hydroxyl ends. The second possible annealing position is the 5` template strand of the N-terminus fragment annealing with the 5` coding strand of the C-terminus fragment. This annealing position results in open 5` phosphate ends. Of the two possible annealing positions, only the first position described will be able to elongate.
Step D
The resulting full-length CYP7A1 cDNA sequence from step three is further amplified by a PCR reaction with the full-length forward and reverse primers. The amplified fragment is separated on a 1% agarose gel and isolated by electro-elution. The fragment was digested with Not1 and Sac1 restriction enzymes and ligated into the pIVEX2.3mcs vector. Figure 24 is a schematic diagram of the procedures used in strategy
3 to produce the desired site directed mutation.
112
Figure 24. Schematic Diagram to Illustrate the Site-directed Mutagenesis Strategy 3 113 d. Site-directed Mutagenesis Strategy 4
Step A
This strategy was used for designing the truncated CYP7A1 polypeptide. In this truncated mutation strategy no primers were necessary. In step one, the full-length
CYP7A1 pTrc-His2b vector construct was digested with BamH I and Stu I restriction enzymes. The BamH I site was located at the multiple cloning site of the vector construct. The Stu I restriction site is in an internal restriction site in the CYP7A1 cDNA sequence, and is located at nucleotide 720. The product from this restriction digest were two fragments, the n-terminal CYP7A1 cDNA sequence, approximately 729 nucleic acids and the pTrc vector construct with the c-terminal CYP7A1 cDNA sequence. The linearized vector construct was separated on a 1% agarose gel and gel isolated by electro- elution. The fragment was concentrated by ethanol precipitation and saved for subsequent steps.
Step B
In step two, the 5` overhang produced from the BamH I restriction digest was
‘filled-in’, to produce a blunt end, by using a bacteriophage T4 DNA polymerase with a high concentration of dATP, dTTP, dGTP, dCTP, in a low Mg2+ ionic buffer. The high concentration of dNTPs facilitates polymerization of the single-strand overhang. An alternative approach will be to exploit the exonuclease activity of the T4 DNA 114 polymerase. Bacteriophage T4 DNA polymerase has a very strong exonuclease activity.
By omitting the dNTPs from the reaction, the T4 polymerase will cleave off the single- stranded DNA overhang produced from the restriction enzyme digestion. The polymerase activity of T4 was chosen in this experiment in order to cause a frame-shift in the CYP7A1 cDNA sequence.
Step C
The two blunt ends from the Stu I restriction digest and the 5` overhang from the
BamH I restriction digest that was filled in with the bacteriophage T4 DNA polymerase, were ligated together. Figure 25 is a schematic diagram of the procedures used in strategy 4 to produce the desired truncation mutation. 115
Figure 25. Schematic Diagram to Illustrate the Mutagenesis Strategy 4 used to Generate Truncated CYP7A1 Polypeptide 116
e. Mutant Sub-cloning and Characterization
Each mutant-vector construct was transformed into the E. coli DH5 cell line, plated on LB + amp agar plate, and incubated overnight at 37oc. Single colonies were
selected from the plates and grown in 2ml LB + amp overnight. 1 ml of the cell culture
was used to perform a plasmid mini prep analysis to confirm fragment ligation into
plasmids [fig. 26]. In the figure, lane 1 is the DNA molecular weight marker, lane 2 is
the E. coli cell line transformed with vector only, Lanes 3-17 are mutant-vector
constructs transformed into E. coli DH5 cell line. The arrow on the left shows the
migration of the empty vector used as a negative control. Arrows on the right, from top
to bottom, show the migration of the positive CYP7A1 DNA fragment-vector construct
and the vector without fragment insert respectively. The colonies that showed a slower
migration when separated on a agarose gel were streak plated to get single colonies. 117
Figure 26. Mini Plasmid prep of Colonies from Mutants Transformed into E.coli DH5 Cell Lines.
Lane1: DNA molecular weight markers, lane 2: control plasmid (E. coli cells transformed
with vector only without insert), lanes 3-17: colonies from mutant transformation, shift in
plasmid migration indicates plasmid contains insert. Arrow on the left, labeled “A”
shows migration of empty vector. Arrows on the right labeled “B and C”, from top to
bottom, show the migration of positive insert-vector construct and plasmids that do not
have an insert respectively. 118
Figure 26. Mini Plasmid prep of Colonies from Mutants Transformed into E.coli DH5 Cell Lines. 119
f. Mutant Vector-construct Restriction Mapping
Colonies were selected from the streak plates and grown in 2ml LB + amp
overnight. 1ml of the cell culture were used for mini plasmid prep, and isolated plasmid
DNA was used for restriction mapping. Restriction mapping of the mutant plasmid was
performed using Hind III and Not I restriction enzymes and separated by electrophoresis
on a 1% agarose gel [fig. 27]. The Not I restriction site was created during the mutant
design and was therefore not present in the starting WT CYP7A1 cDNA fragment. The
Not 1 site was used to distinguish newly generated cDNA fragments from starting
templates. In the figure, lanes 2,4,6, and 8 were plasmid DNA digested with only Hind
III restriction enzyme. The two fragments that were produced from the digestion
migrated at 2695 and 2426 bp, which is a sum of the insert with the His-tag (1551bp),
and the pIVEX 2.3 MCS vector (3553bp). Lanes 3,5,7 and 9 were plasmid DNA
digested with Hind III and Not I restriction enzymes. The liberated fragments were 2695,
2129 and 297 bp. The digestion of the Not 1 restriction enzyme confirmed that the
cDNA fragments were from the mutant design and not the starting template cDNA.
Freezer stocks of the positive plasmid preps were made and plasmid prep was
performed using Nucleobond DNA purification kit from Clontech (Palo Alto, CA) for
DNA sequencing. Cleveland Genomics sequenced the purified plasmid, and a
contiguous alignment of the fragments was used to ensure that no additional mutation was made in the sequence. Four primers were used for the sequencing, two forward primers and two reverse primers. The sequencing results from the four primers were aligned to form overlapping sequences using map vector and Clustal W (1.83) 120 sequencing alignment programs. Figure 28 illustrates the positions of the sequence alignments used to confirm positive mutation. 121
Figure 27. Restriction Mapping of Mutant Plasmid
Lane1: DNA lambda HindIII and EcoR I molecular weight marker, lanes 2,4,6 and 8, are plasmids digested with only HindIII
Lanes 3,5, 7 and 9 are plasmids digested with HindIII and Not1.
(Digestion with only HindIII liberates 2695 & 2426 bp, Hind III and Not1 liberates
2695,2129 &297 bp) 122
1 2 3 4 5 6 7 8 9
21Kbp 2695bp 5Kbp 3Kbp 2129bp 2Kbp
564bp
297bp
Figure 27. Restriction Mapping of Mutant Plasmid 123
T193/197A S252G S385D
504aa’s long TMD Cholesterol 7-Hydroxylase
-60 T7 665
95 C1-66-F 781
258 C2-R 1010
854 C3-R 1551
Figure 28. Contiguous Alignment of Mutant Nucleotide Sequence
Four primers were used to sequence the mutant CYP7A1 cDNA sequence. Two end primers and two internal primers were used to create overlapping sequences in order to confirm sequence identity. CHAPTER III
RESULTS AND CONCLUSIONS
PART 1: AICAR, an AMPK Kinase Activator, does not Affect CYP7A1
mRNA Steady-state Levels.
AICAR, an AMPK kinase activator, has been shown to repress bile acid
production in HepG2 cell culture. To determine if the bile acid repression
observed by the activation of AMPK, was a result of transcriptional control, the
mRNA levels of CYP7A1 in treated HepG2 cells was measured using real-time
PCR. Figure 29 shows a time course of the effects of AICAR and CDCA, on the steady-state mRNA levels of CYP7A1 in HepG2 cells. CDCA was used as a positive control because of its well-established repressive effects on CYP7A1 transcription. HepG2 cells were treated with 20μM AICAR and 25μM CDCA for
0h, 0.5h to 24h as indicated.
Relative mRNA levels of CYP7A1 were calculated with respect to UBC
mRNA. The mRNA expression at 0h was set as 1. With treatment of HepG2 cells
124 125 with CDCA, the repression on the CYP7A1 transcript happens quickly and is maximal at the 2h point. The repression of CYP7A1 transcription by CDCA is through a feedback repression and involves the activation of FTF, therefore, the mRNA levels of FTF in cells treated with CDCA was also measured. The repression of the mRNA steady-state levels of CYP7A1, when treated with CDCA, correlates with the increase in FTF mRNA expression in the same cells. The activation of FTF transcription by CDCA is as previously reported and supports the repression of CYP7A1, at the transcriptional level, by bile acid mediated FTF activation[9, 18]. Activation of AMPK did not change the transcription of CYP7A1 within the time course of the experiment. This result in combination with the total bile acid production results from AICAR treated HepG2 cell, supports the hypothesis that CYP7A1 enzymatic activity can be regulated at a level other than that of transcription. 126
Figure 29. AICAR, AMPK Kinase Activator does not Affect CYP7A1 mRNA
Steady-state Levels
Real-time PCR data for hepG2 cells treated with AICAR and CDCA. HepG2 cells were
treated with 20μM AICAR and 25μM CDCA for 0h, 0.5h, up to 24h as indicated. The
total RNA was prepared and measured with real-time PCR. Relative mRNA levels of
CYP7A1 were calculated with respect to UBC mRNA. The mRNA expression at 0h was
set as 1. A rapid repression of CYP7A1 is observed at the 2h time point and this
correlates with an increase in FTF mRNA levels. AICAR treatment did not have an
effect on CYP7A1 mRNA levels throughout the time course of the experiment. 127
Figure 29. AICAR, AMPK Kinase Activator does not affect CYP7A1 mRNA
Steady-state Levels 128
PART 2: CYP7A1 In-vitro Reconstituted Assay with E. coli-expressed and Microsomal HepG2 Cells Treated with AMPK, PKC, and JNK Kinases
To determine if kinase activity had an effect on CYP7A1 enzymatic activity,
microsomal proteins from HepG2 cells and E. coli-expressed recombinant CYP7A1, were treated with various commercially available kinases prior to performing the in-vitro
reconstituted CYP7A1 enzymatic assay. The effects of the kinases on enzymatic activity were measured with the new detection method described in the material and methods
section. AMPK, PKC and JNK kinases were used in the in-vitro enzymatic assay
because of their already well-established effects on cholesterol and bile acid synthesis,
and feedback regulation of bile acid synthesis.
a. Rationale for Kinase Selection
i. AMPK
The effect of AMPK on cholesterol synthesis is well characterized[72-75].
Phosphorylated AMPK regulates cholesterol synthesis by phosphorylating and
inactivating 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase. The
ability for AMPK to regulate cholesterol synthesis, and also phosphorylate cholesterol 7
-hydroxylase, the rate-limiting enzyme in bile acid synthesis, suggests a possible
mechanism by which bile acid synthesis and cholesterol synthesis could be co-regulated
through phosphorylation events. AMPK is also a well-established energy sensor in the 129 cell. The effects of AMPK on cholesterol 7 -hydroxylase enzymatic activity will also provide insight on the cross talk between bile acid synthesis and energy metabolism.
ii. PKC
Bile acids have been shown to regulate gene expression of CYP7A1 both by binding farnesoid X receptor (FXR)[14, 22, 24, 25] and by activating cellular Kinases
[23, 26, 27]. Both bile acids and phorbol esters activate protein kinase C (PKC).
Treatment of HepG2 cells with bile acids resulted in the translocation of PKC, and PKC inhibitors reduced the bile acid repression of transcription from the CYP7A promoter
[105]. The regulation of cholesterol 7 -hydroxylase by PKC kinase activity will provide an additional mechanism by which bile acids regulate CYP7A1 enzymatic activity at the enzyme level.
iii. JNK
The activation of FXR by bile acids has also been shown to indirectly repress
CYP7A1 transcriptional activity by activating small heterodimer proteins (SHP-1) [26].
It has been proposed that SHP-1 can repress transcription of CYP7A1 through the activation of the JNK/c-jun pathway. Primary rat hepatocyte cultures treated with taurocholate (TCA) was shown to strongly activate JNK in a time- and concentration- dependant manner[26, 28]. This activation of JNK correlated with SHP-1 activation and
CYP7A1 transcriptional repression. In a more recent study using human primary 130
hepatocytes, activation of JNK by chenodeoxycholic acid (CDCA) and interleukin-1
(IL-1) represses CYP7A1 transcriptional activity by interacting with HNF4 [106]. It was proposed in this study that the activation of JNK indirectly repressed CYP7A1 gene transcription by blocking HNF4 recruitment of PPAR coactivator-1 (PGC-1) to the
CYP7A1 chromatin. This study will address the possible direct effect that JNK kinase has on CYP7A1 enzymatic activity.
b. Kinase Treatment of Microsomal HepG2 Cells
The purpose of this experiment is to determine if kinase activity has a direct effect on CYP7A1 enzymatic activity. HepG2 cells were used to prepare microsomal fractions, as described in the material and methods section, for the CYP7A1 in-vitro reconstituted assay. The cells were grown to confluency in dulbecco’s modified eagle’s medium
(DMEM): F12 with no phenol red, 10% fetal calf serum, 100units/ml penicillin, in
o 100mm tissue culture plates incubated at 3% CO2 at 37 c. After cells reached
confluency, the overlay medium was changed to medium without fetal calf serum. The
cells were monitored and the medium was changed twice within four hours. The removal
of the medium is to remove any bile acids accumulated over the cells. The presence of
bile acids in the medium will repress the transcriptional activity of the CYP7A1 gene.
The cells were collected after the four-hour incubation and microsomal fractions were
prepared.
The CYP7A1 in-vitro enzymatic assay was performed as described in the material
and methods section. Microsomal fractions were treated with AMPK, PKC , or JNK 131
kinases, and compared to untreated assay. Percent activity was determined by combining
results from 3-4 individual enzyme assays. Comparisons were only made between assays
performed with the same protein preps. Specific enzyme activity was determined for
pmoles of 7 -hydroxycholesterol produced per min per milligram of total microsomal
protein, by using the D7 internal standards. Because of the day-to-day variation in assay
activity, the statistical significance of the treatments were determined by using a single
classification ANOVA analysis of the percentage of specific enzymatic activity measured
in each assay.
In the CYP7A1 in-vitro reconstituted assay performed with microsomal HepG 2
cells [Fig. 30], kinase treatment significantly repressed CYP7A enzymatic activity with a
p-value <0.001. AMPK, JNK, and PKC all repressed CYP7A1 enzymatic activity by
51% ± 5, 57% ± 11, and 48% ± 6 respectively when compared to WT CYP7A1 enzymatic activity. Error bars represent standard error of the mean between experimental samples. This result provided clear evidence that endogenous CYP7A1 enzymatic activity can be regulated by phosphorylation events at the post-translational level. This data is supported by the real-time PCR data of HepG2 cells treated with kinase activators.
The repression of bile acid production in the AICAR treated HepG2 cells was not a result of limited cholesterol, but a result of phosphorylation events at the protein level. 132
Figure 30. AMPK, PKC and JNK Kinase Activity Repressed CYP7A1 Enzymatic
Activity in Microsomal HepG2 Cell Fractions
In-vitro CYP7A1 reconstituted enzymatic assay performed with microsomal HepG2 cells pretreated with AMPK, PKC, and JNK kinases for 5 min prior to the addition of
NADPH. Percent activity was determined for 3-4 individual assays that were combined for statistical analysis. AMPK, JNK, and PKC all significantly repressed CYP7A enzymatic activity with a p-value of <0.001.
** = p-value <0.01, and *** = p-value <0.001. Error bars represent standard error of the mean. 133
*** *** ***
Figure 30. AMPK, PKC and JNK Kinase Activity Repressed CYP7A1 Enzymatic
Activity in Microsomal HepG2 Cell Fractions 134
c. Kinase Treatment of E. coli-expressed CYP7A1 Recombinant Protein
To confirm the regulation of CYP7A1 enzymatic activity by phosphorylation
events, the in-vitro reconstituted assay was performed with CYP7A1 E. coli-expressed
recombinant protein. Full-length CYP7A1 cDNA sequence was cloned into the pTrc-
His2b expression vector. The sample preparation of the recombinant protein and CYP7A
assay were performed as previously described with a few changes. In the in-vitro assay
performed with E. coli-expressed recombinant proteins, oleandomycin was omitted from the assay. The oleandomycin was omitted because it served no function in the recombinant CYP7A1 enzyme assay, since the enzymes required for proceeding through the classical bile acid pathway are absent in the reaction mixture. Also the addition of oleandomycin did not have an effect on measured enzymatic activity.
In contrast to the in-vitro assay with HepG2 cell microsomal fractions, in the in-
vitro enzymatic assay using E. coli-expressed CYP7A1 recombinant protein, AMPK kinase activity was the only kinase capable of repressing the enzymatic activity of
CYP7A1 [Fig. 31]. AMPK significantly repressed CYP7A enzymatic activity by 63% ±
6 s.e.m with a p-value <0.01. PKC showed a tendency of increasing enzymatic activity in the E. coli in-vitro assay, with a 23% ± 19 s.e.m. The effects measured for both JNK and PKC were not significant, both having a p-value >0.05. This result, in combination with the in-vitro assay performed with the HepG2 cell microsomal fraction, and the real- time PCR results from treated HepG2 cells, confirmed that CYP7A1 enzymatic activity is directly regulated by phosphorylation at the post-translational level. 135
Figure 31. AMPK Kinase Activity Represses CYP7A1 Enzymatic Activity in E. coli- expressed Recombinant Protein.
In-vitro CYP7A1 reconstituted enzymatic assay was performed with E. coli-expressed
CYP7A1 recombinant protein that was pretreated with AMPK, PKC, and JNK kinases for 5 min prior to the addition of NADPH to the reaction mixture. Percent activity was determined for 3-4 individual assays that were combined for statistical analysis. AMPK was the only kinase that significantly repressed CYP7A enzymatic activity with a p-value of <0.01. PKC and PKA did not have a significant effect on CYP7A1 enzymatic activity. Both PKC and PKA had a p-value >0.05.
** = p-value <0.01, and *** = p-value <0.001. Error bars represent standard error of the mean. 136
n/s
n/s
**
Figure 31. AMPK Kinase Activity Represses CYP7A1 Enzymatic Activity in E. coli- expressed Recombinant Protein. 137
PART 3: AMPK Kinase Treated In-vitro CYP7A1 Enzymatic Assay with Mutant
CYP7A1 Recombinant Protein
a. Rationale for Mutation Design
To expand on the discovery that AMPK represses CYP7A1 enzymatic activity, both in the microsomal HepG2 cell and the E. coli-expressed recombinant protein, the following experiments were designed to determine the specific sites on the CYP7A1 polypeptide that was responsible for the AMPK repressive effect. Various AMPK phosphorylation sites were mutated on the enzyme and an in-vitro reconstitution assay was performed to determine the effects of the mutations. The sites that were mutated were chosen from a CYP7A1 phosphorylation map previously published from our lab
(Stroup and Ramsaran; 2005).
b. Rationale for Mutation-site Selection
Stroup et al[1], performed an in-vitro kinase assays where 45 synthetic 15-mer peptides, based on the human cholesterol 7-hydroxylase amino acid sequence, were challenged with 12 protein kinases (AMPK, PKA, JNK, PKC, PKCI, PKCII, PKC,
PKC, PKC, PKC, PKC, and PKC). In the kinase assay, three of the 15-mer polypeptides were phosphorylated by almost all the kinase tested. Polypeptide
F188/I202, which has 2 threonines at position 193 and 197, and its mutant F188/I202B6 were phosphorylated by 9 out of 12 kinases (JNK, PKC, and PKC being the 138 exceptions). C69/L83, which also has a threonine at position 80, was phosphorylated by
11 out of 12 kinases (all except PKA). Other peptides showed more specificity: L22/N36 and A106/N120 associated with PKA; L247/M261 and N380/M394 with PKA and
AMPK; L428/T442 with JNK; and D342/L356 and I349/R364 recognized by PKC,
PKC, and PKC. This result provided the starting point for choosing AMPK phosphorylation sites. AMPK was shown to strongly phosphorylate threonines at positions 80, 193 and 197, and serines at positions 252 and 385 [Fig. 32]. 139
Figure 32. Tabulated Results from Synthetic Peptides versus Commercially
Available Protein Kinases.
Data from autoradiography of SDS-PAGE gels of 45 synthetic peptides reacted with 12 protein kinases. Shading of boxes corresponds to the relative amount of radioactive phosphorous incorporated into each peptide. From the far left column, sequence of peptides, results from individual kinases: 95% gray, most intense labeling for given kinases; 50% gray, less than the strongest signal, but significantly above background; and lightest gray, peptide detectable, but close to background (marked to donate specificity of labeling) D. Stroup, J.R. Ramsaran, Cholesterol 7-hydroxylase is phosphorylated at multiple amino acids, BBRC 329 (2005) 957-965. 140
D. Stroup, J.R. Ramsaran, Cholesterol 7-hydroxylase is phosphorylated at multiple amino acids, BBRC 329 (2005) 957-965.
Figure 32. Tabulated Results from Synthetic Peptides Treated with Commercially Available Protein Kinases 141 c. Mutations of AMPK Phosphorylation Sites
The threonine (T) at position 80 was mutated to alanine (A). Threonines at positions 193 and 197 were mutated as a double mutant, because both sites are in close proximity of each other and were shown in the kinase assay to be non-specifically phosphorylated by kinase activity. Only when both sites were removed, was phosphate transfer not observed in the assay. Serine (S) at position 252 was mutated to glycine (G) and the 30 KD fragment, described in the materials and methods section, was used for
S385. The 30KD fragment was shown to have catalytic activity and S385 was the only
AMPK phosphorylation site present on the polypeptide. Four different strategies were used to design the mutations and are described in detail in the material and methods section. The mutated CYP7A1 recombinant protein was used in an in-vitro reconstituted assay to determine which site(s) is responsible for the AMPK repressive effect that was observed in the CYP7A1 reconstituted enzymatic assay.
d. CYP7A1 In-vitro Assay with T193A/T197A Double Mutant
Site directed mutagenesis strategy two, described in the material and methods section, was used to create the T193A/T197A double mutant. The double mutant design was confirmed by restriction mapping of the vector construct followed by cDNA sequencing using 5` and 3` full-length primers, and forward and reverse internal primers.
The multiple sequence results were aligned to provide an overlapping sequence, confirming sequence identity and positive mutation sites. The CYP7A1 T193A/T197A double mutant was cloned into the pTrc-His2b expression vector and transformed into the 142
E. coli Top10 cell line as described in the material and methods section. The CYP7A1
T193A/T197A double mutant was expressed and E. coli protein prep was performed for the CYP7A1 in-vitro reconstituted enzyme assay.
The CYP7A1 in-vitro assay with E. coli-expressed T193A/T197A double mutant recombinant protein showed an approximately two-fold less enzymatic activity when compared to WT CYP7A1. Assay was normalized to reflect total amount of specific protein used in each assay. The enzymatic activity of the T193A/T197A CYP7A1 mutant was 58% ± 6 RSD of the enzymatic activity measured for that of WT, 100% ±
16.2 RSD. Although enzymatic activity of the double mutant was lower than WT
CYP7A1, the mutant was still able to convert cholesterol to 7 -hydroxycholesterol in the enzymatic assay, and AMPK kinase activity repressed CYP7A1 enzymatic activity
[Fig. 33]. AMPK repressed the double mutants enzymatic activity by 43% ±1.7 RSD, when compared to untreated double mutant recombinant protein. This result suggested that threonines at positions 193 and 197 were not responsible for the repressive effect of
AMPK kinase activity on CYP7A1 enzymatic activity. 143
Figure 33. AMPK Kinase Activity Represses T193A/T197A Double Mutant
CYP7A1 Enzymatic Activity in E. coli-expressed Recombinant Protein.
In-vitro CYP7A1 reconstituted enzymatic assay was performed with E. coli-expressed
T193A/T197A double mutant CYP7A1 recombinant protein. Enzymatic activity of the double mutant was 58% ± 6 RSD of the enzymatic activity measured in WT CYP7A1,
100% ± 16.2 RSD. Double mutant was pretreated with AMPK kinase for 5 min prior to the addition of NADPH to the reaction mixture. AMPK kinase activity repressed total enzymatic activity of the double mutant by 43% ± 1.7 RSD. Mutations at T193 and T197 did not abolish the repressive effect observed by AMPK kinase activity. Error bars represent relative standard deviation between quadruplicate injections of the samples measured. 144
***
Figure 33. AMPK Kinase Activity Represses T193A/T197A Double Mutant
CYP7A1 Enzymatic Activity in E. coli-expressed Recombinant Protein. 145
e. CYP7A1 In-vitro Assay with T80A Mutant
Threonine at amino acid position 80 was another site that showed low specificity
to kinase activity. The site was strongly phosphorylated by seven of the twelve kinases
used in the in-vitro assay. Site directed mutagenesis strategy three described in the
materials and methods section was used to generate the desired T80A mutation.
Restriction mapping and cDNA sequencing, as previously described, was used to confirm
the mutation.
The CYP7A1 in-vitro assay with E. coli-expressed T80A mutant recombinant protein, had a total enzymatic activity that was 34% ± 11 RSD of the enzymatic activity measured for WT CYP7A1, 100 ± 9 RSD. The measured enzymatic activity was normalized to reflect equal amount of specific protein used per assay. Upon AMPK kinase treatment, the enzyme activity of the T80A mutant protein was repressed by 24%
± 5.5 RSD when compared to untreated T80A mutant [Fig. 34]. Noticeably, the repression observed with the T80A mutant was two times less than the repressive effect of AMPK on WT CYP7A1 enzymatic activity. This result suggested that AMPK phosphorylation at T80 might be required for complete suppression of WT CYP7A1 enzymatic activity, but is not sufficient in preventing the repressive effect of AMPK kinase activity on CYP7A1 enzymatic activity. 146
Figure 34. AMPK Kinase Activity Represses T80A Mutant CYP7A1 Enzymatic
Activity in E. coli-expressed Recombinant Protein.
In-vitro CYP7A1 reconstituted enzymatic assay was performed with E. coli-expressed
T80A mutant CYP7A1 recombinant protein. Enzymatic activity of the mutant was 34%
± 11 RSD of the enzymatic activity measured in WT CYP7A1, 100% ± 9 RSD. The
T80A mutant was pretreated with AMPK kinase for 5 min prior to the addition of
NADPH to the reaction mixture. AMPK kinase activity repressed total enzymatic activity of the mutant by 24% ± 5.5 RSD. Mutation at T80A did not abolish the repressive effect observed by AMPK kinase activity. Error bars represent relative standard deviation between quadruplicate injections of the samples measured. 147
*
Figure 34. AMPK Kinase Activity Represses T80A Mutant CYP7A1
Enzymatic Activity in E. coli-expressed Recombinant Protein. 148 f. CYP7A1 In-vitro Assay with S252G Mutant
The other sites that were tested showed more specificity to kinase activity in the in-vitro kinase assay. S252 and S385 were both heavily phosphorylated by AMPK kinase activity. The two sites are located towards the central and n-terminal region of the
CYP7A1 polypeptide sequence respectively. The S252G CYP7A1 mutant was designed with the site directed mutagenesis strategy three. S252 mutant was characterized in the same manner as previously described for the other mutations. The CYP7A1 in-vitro assay, with E. coli-expressed S252G mutant recombinant protein, showed comparable enzymatic activity compared to WT CYP7A1 recombinant protein. Unlike previous results that showed repression of CYP7A1 enzymatic activity upon AMPK kinase treatment, the S252G CYP7A1 mutant enzymatic activity was not repressed by AMPK kinase activity [Fig. 35]. The measured enzymatic activity was the same for treated and untreated samples with percent activity of 100% ± 6.3RSD and 100% ± 1.4RSD respectively. This result provided evidence that serine at position 252 was responsible for the AMPK repressive effect on CYP7A1 enzymatic activity. 149
Figure 35. AMPK Kinase Activity did not Repress S252G Mutant CYP7A1
Enzymatic Activity in E. coli-expressed Recombinant Protein.
In-vitro CYP7A1 reconstituted enzymatic assay was performed with E. coli-expressed
S252G mutant CYP7A1 recombinant protein. Enzymatic activity of the S252G mutant was comparable to activity measured with WT CYP7A1. S252G mutant was pretreated with AMPK kinase for 5 min prior to the addition of NADPH. AMPK kinase activity did not have a significant effect on the total enzymatic activity of the S252G mutant when compared to untreated mutant. Mutation at S252 abolished the repressive effect observed by AMPK kinase activity. Error bars represent relative standard deviation between quadruplicate injections of the samples measured. 150
Figure 35. AMPK Kinase Activity did not Repress S252G Mutant CYP7A1
Enzymatic Activity in E. coli-expressed Recombinant Protein. 151
g. CYP7A1 In-vitro Assay with Truncated WT CYP7A1 (1-729) Mutant
The 30KD fragment was previously shown to have enzymatic activity, therefore the effects of AMPK on the fragments activity was determined in the CYP7A1 in-vitro assay. The fragment consists of amino acids methionine (M) 308 to leucine (L) 504 and covers the catalytic region of the CYP7A1 polypeptide that includes: the steroid-binding site, the aromatic amino acid region and the heme region. The fragment consists of only one of the sites that are phosphorylated by AMPK, S385. By using the fragment in this experiment, the effects of AMPK on S385 can be determined. This experiment will also be used to confirm whether S252 is needed for AMPK repression of CYP7A1 enzymatic activity, since the site is missing from the 30 KD fragment.
In the CYP7A1 in-vitro reconstituted assay with E. coli-expressed 30KD fragment recombinant protein, AMPK kinase activity did not repress enzyme activity, rather treatment of the 30KD fragment with AMPK kinase increased enzymatic activity by 46% ± 6.8 RSD, when compared to untreated 30KD fragment [Fig. 36]. This experiment provided evidence that S385 phosphorylation was not responsible for the repressive effect on CYP7A1 enzymatic activity by AMPK. It also provided supporting evidence for the conclusions made about AMPK kinase activity regulating CYP7A1 through the phosphorylation of S252. The increase in enzymatic activity suggests that phosphorylation could also have a stimulatory effect on CYP7A1 enzymatic activity. 152
Figure 36. AMPK Kinase Activity Stimulates WT CYP7A1 (1-729)
Enzymatic Activity
In-vitro CYP7A1 reconstituted enzymatic assay was performed with E. coli-
expressed WT CYP7A1 (1-729) truncated recombinant protein. Enzymatic
activity measured for the truncated fragment was 30% ± 4.1 RSD of the
enzymatic activity measured in WT CYP7A1, 100% ± 5.7 RSD. The 30KD
fragment has only one known AMPK phosphorylation site at position S385. The
fragment was pretreated with AMPK kinase for 5 min prior to the addition of
NADPH to the reaction mixture. AMPK kinase activity stimulated enzymatic activity of the mutant by 46% ± 6.8 RSD. Error bars represent relative standard
deviation between quadruplicate injections of the samples measured. 153
***
Figure 36. AMPK Kinase Activity Stimulates WT CYP7A1 (1-729) Enzymatic
Activity CHAPTER IV
DISCUSSION
Cholesterol and bile acid synthesis are major metabolic pathways, and disruptions in these pathways are associated with metabolic disorders and progression of atherosclerosis. Bile acid synthesis is the major cholesterol disposal pathway, and influences cholesterol homeostasis in the cell.
Understanding the cross talk between cholesterol and bile acid synthesis will help in the treatment of metabolic disorders and prevention of atherosclerosis.
The goal of this study is to determine if cholesterol 7 -hydroxylase enzymatic activity is regulated by phosphorylation events at the post-translational level, and whether AMPK kinase activity represses bile acid production by direct phosphorylating CYP7A1. To answer this question, the experiments were divided into two specific aims. Specific aim 1 was designed to address the question of whether CYP7A1 enzymatic activity changed upon phosphorylation events.
Specific aim 2 was designed to determine the specific sites, on the CYP7A1 polypeptide, that are responsible for the effects noticed by kinase activity. The
154 155
difficulty in assaying the enzyme activity of cholesterol 7 -hydroxylase has been well
documented [98, 99]. This study presents a new technique using HPLC-MS to quantify
cholesterol 7 -hydroxylase enzymatic activity, by directly measuring 7 -
hydroxycholesterol. The new detection method proved to be very sensitive, and was
capable of detecting 7-hydroxycholesterol in the moles range.
Published studies on transcriptional regulation of CYP7A1 have shown mRNA
levels to correlate with repression by bile acids, phorbol esters, and insulin, and activated by cAMP. The transcriptional studies often did not include measurements of enzyme activity, and when reported, the mRNA levels did not always correlate with bile acid
production. Results from our lab demonstrated bile acid repression in HepG2 cells
treated with various kinase activators [1]. HepG2 cells treated with cAMP, a PKA
activator; AICAR, an AMPK activator; and PMA, a PKC activator, showed a 19%, 28%,
and 35% repression in bile acid production respectively, when compared to untreated
HepG2 cells. PKC and PKA have been previously shown to affect the transcriptional
level of the CYP7A1 gene. Unlike PKC and PKA, this was the first report of bile acid
repression by an AMPK kinase pathway.
There have been suggestions that cholesterol synthesis and cholesterol disposal,
via bile acid synthesis, are coordinated in the cell. If cholesterol and bile acid synthesis
are co-regulated, there are two possible scenarios by which this would be possible: first,
repression of cholesterol biosynthesis with a stimulation in bile acid synthesis, to
facilitate the removal of excess cholesterol in the cell; second, repression/stimulation of 156
cholesterol biosynthesis associated with similar repression/stimulation of bile acid
synthesis, in order to maintain cholesterol homoeostasis in the cell. The discovery that
bile acid synthesis can be repressed by AMPK kinase activity will provide a possible mechanism by which the two pathways are co-regulated in the cell.
Specific Aim 1: CYP7A1 Enzymatic Activity is Regulated by Phosphorylation Events
To determine whether the repression of bile acid production in HepG2 cell treated with AMPK kinase activator was a result of transcriptional control, the mRNA level of
CYP7A1 was measured by real-time PCR. The real-time PCR results showed that the repression of bile acid production was not a result of transcriptional control. AICAR treatment repressed bile acid production in a 90 min time course, but the mRNA level of
CYP7A1 did not change in the treated cells [fig. 29]. This provided evidence that the repressive effect of AMPK kinase activity on bile acid synthesis, was occurring at a level other than that of transcription.
A possible mechanism for the AMPK repressive effect on bile acid synthesis could be explained by the AMPK-dependant repression of HMG-CoA reductase.
Phosphorylation of HMG-CoA reductase, by AMPK, shuts down cholesterol synthesis.
Lowering the amount of cholesterol present would result in decreased bile acid production. The in-vitro reconstituted CYP7A1 enzymatic assay experiments were performed to address the question of whether AMPK was phosphorylating CYP7A1 directly or was the effects of bile acid repression a result of a reduction in cholesterol 157 levels via phosphorylation of HMG-CoA. In the in-vitro reconstituted CYP7A1 enzymatic assay, cholesterol will not be rate limiting in the reaction because excess cholesterol will be added to the assay.
To investigate the possibility of post-translational regulation by phosphorylation events, CYP7A1 in-vitro assays were compared between microsomal HepG2 cells and E. coli-expressed CYP7A1 recombinant protein. In the in-vitro assay using microsomal
HepG2 cells [Fig. 29], AMPK, JNK, and PKC kinases all significantly repressed
CYP7A1 enzymatic activity, with a p-value <0.001 when compared to untreated control.
This was the first direct evidence that CYP7A1 enzymatic activity was regulated by phosphorylation events at the enzyme level.
The in-vitro CYP7A1 enzymatic assay with E. coli-expressed recombinant protein was performed in the same manner as described for the in-vitro assay with microsomal fractions, with the exception of omitting oleandomycin from the reaction. E. Coli- expressed CYP7A1 recombinant protein was treated with AMPK, JNK, and PKC kinases, and the enzymatic activity was compared to untreated assay samples. In contrast to the results from the in-vitro enzyme assay performed with microsomal HepG2 cells,
AMPK was the only kinase capable of repressing enzymatic activity [Fig. 31]. AMPK repressed CYP7A1 enzymatic activity by 63% ± 6 S.E.M with a p-value <0.01.
Although PKC showed a tendency of increasing enzymatic activity by 23% ± 19 S.E.M, both PKC and JNK did not have a significant effect on CYP7A1 enzymatic activity. 158
The difference in enzymatic activity noticed upon kinase treatment, between the
microsomal fractions and recombinant protein assays, suggests that multiple kinase
activities could be involved in regulating CYP7A1 enzymatic activity. Endogenous
CYP7A1 has been shown to exist as a phosphoprotein in the cell [1]. Although other
post-translational modification has not been identified for the enzyme, this cannot be
discounted. The effects of the kinase activity on endogenous CYP7A1 enzymatic activity
could be a result of a combination of native post-translational modifications with kinase
activity, and not just phosphorylation events. E. coli-expressed CYP7A1 recombinant
protein has been previously shown to be catalytically active (Chiang et al. 1991). The recombinant protein is hypophosphorylated, therefore, the effects of kinase activity on the enzymatic activity represents phosphorylation events alone. The in-vitro enzyme assay experiments performed with recombinant CYP7A1 confirm that CYP7A1 enzymatic activity could be regulated by phosphorylation events alone.
The in-vitro assays also suggest that the regulation of the enzymatic activity of
CYP7A1 by kinase activity could result in either a repressive or stimulatory effect.
Phosphorylation by JNK kinase repressed CYP7A1 enzyme activity in microsomal fractions but had no effect on E. coli-expressed recombinant protein. This Suggests that other forms of post-translational modifications might be required to observe the repressive effect by JNK kinase activity. Phosphorylation by PKC kinase activity also repressed enzymatic activity in HepG2 microsomal fractions, but slightly increased enzymatic activity in E. coli-expressed recombinant protein assays. Even though the measured increase in activity was not significant; the slight increase suggests that some 159
kinase activity might have a stimulatory effect on CYP7A1 enzymatic activity. This
avenue of investigation was not followed up in this study; rather, the definite repressive
effect of AMPK on enzymatic activity was further pursued.
AMPK was the only kinase tested capable of significantly repressing CYP7A1
enzymatic activity in the in-vitro assay with both recombinant protein and microsomal
fractions. AMP is reported to increase enzymatic activity of AMPK by greater than two
fold. This increase was not noticed in the CYP7A1 enzymatic assay, when compared to
AMPK treated assay without AMP. Therefore, AMP was omitted from the enzymatic
assay. AMPK activity has been reported to be stimulated in muscle cells by anti-diabetic
agents through an AMP-independent pathway[107]. The enzymatic activity of the
commercially available AMPK was reported to be 636 U/mg, where 1 unit of AMPK
activity is defined as 1 nmole phosphate incorporated into 200 μM substrate per minute at
30oC with a final ATP concentration of 100 μM. The amount of AMPK kinase used in the in-vitro assay was in excess, therefore, the absence of AMP in the in-vitro assay does not influence the final observations. The next experiments were designed to determine the specific sites responsible for the repressive effects of AMPK on CYP7A1 enzymatic activity. 160
Specific Aim 2: Determine Sites Responsible for AMPK Repressive Effects
The in-vitro assay with CYP7A1 recombinant protein was used to determine the site(s) necessary for AMPK repression of CYP7A1 enzymatic activity. The advantage of using the recombinant protein is that the specific sites on the human cholesterol 7- hydroxylase polypeptide, which are phosphorylated by AMPK kinase, have been mapped in an in-vitro kinase assays[1]. The recombinant protein is also hypophosphorylated, therefore, effects of AMPK alone on the enzymatic activity can be determined for the specific site(s). T193, T197, T80, S252, and S385 were determined in the kinase assays to be strong AMPK phosphorylation sites. T193 and T197 were mutated as a double mutant to alanines, T80 was mutated to an alanine, and S252 was mutated to glycine. For
S385, the truncated 30KD polypeptide was used for the in-vitro assay. S385 was the only
AMPK phosphorylation site present on the polypeptide. The mutated recombinant proteins were used in an AMPK kinase treated assay, to determine which site(s) is involved in the repressive effects observed by AMPK kinase activity.
T193/T197, and T80 were non-specific to kinase activity in the in-vitro kinase assay previously reported. AMPK kinase activity repressed the double mutant and T80A mutant enzymatic activity by 43% ±1.7 and 24% ± 5.5 RSD respectively, when compared to untreated assay. The reduction in enzymatic activity noticed with untreated mutants compared to WT, and the non-specificity of the sites to kinase activity, suggests that
T193, T197 and T80 are more likely involved in enzyme activation. The lower activity 161
measured in the double mutant and T80A mutant suggests that these sites might be
needed for complete enzyme activity.
CYP7A1 exists as a phosphoprotein in the cell; therefore, it is reasonable to
assume the sites that are non-specific to kinase phosphorylation will most likely be
phosphorylated in the cell. If T193, T197 and T80 were phosphorylation repressive sites,
then the enzymatic activity of CYP7A1 would be inactive at a high regularity in the cell.
This is not the case because bile acid production is measured in HepG2 cell at short time courses. A simpler explanation would be that the enzymatic activity of CYP7A1 is regulated by the phosphorylation of specific sites, which have a stronger effect on the enzyme activity than the effects by phosphorylations that already exist on the enzyme.
These non-specific sites might serve to enhance effects of other specific phosphorylation sites.
The other prominent AMPK phosphorylation sites, S252 and S385, showed more specificity in the in-vitro kinase assays. S252 was mutated to glycine and the recombinant protein was used in the CYP7A1 enzymatic assay. The specific enzymatic activity measured from the S252 mutant was comparable to that of WT. Upon AMPK kinase treatment, there was no significant difference between treated and untreated assays. The measured enzymatic activity for treated and untreated samples were 100% ±
6.3RSD and 100% ± 1.4RSD respectively. This result suggested that S252 is the phosphorylation site needed for AMPK repression of CYP7A1 enzymatic activity. 162
The 30KD fragment, which was previously characterized in this study, was used to test S385 as a possible site for the AMPK repressive effect on CYP7A1 enzymatic activity. The fragment served two purposes in this experiment. First, the fragment only has one of the AMPK phosphorylation sites, S385. The effects of AMPK on its enzymatic activity will address the importance of the site for AMPK repression.
Secondly, since S252 is missing from the 30KD fragment, the effects that AMPK kinase activity has on the fragment will help support the conclusions made about S252. AMPK kinase activity on the 30KD fragment, interestingly resulted in an increase in specific enzymatic activity. Phosphorylation by AMPK resulted in a 46% increase in enzymatic activity, when compared to the untreated assay. This result confirmed S385 was not responsible for the AMPK repression of CYP7A1 enzymatic activity. It also provided additional evidence to support the hypothesis that S252 is the site responsible for the repression of CYP7A1 enzymatic activity by AMPK kinase.
The result also suggests that other sites might be required for maintaining
CYP7A1 enzymatic activity. It was only when the N-terminus was removed did enzymatic activity increase upon phosphorylation. The N-terminus could be functioning as a regulatory region on the CYP7A1 polypeptide. The fragment does not have S252, which was shown in this study to be responsible for the repressive effect of AMPK on
CYP7A1 enzyme activity. The 30KD fragment has all the catalytic regions of the
CYP7A1 polypeptide. Losing the regulatory region of the enzyme could result in an increase in total enzymatic activity upon phosphorylation events. 163
Mapping of the S252 AMPK Phosphorylation Sites to the CYP7A1 Crystal Structure
In an attempt to understand the mechanism by which AMPK represses CYP7A1 enzymatic activity through the phosphorylation of S252, the AMPK phosphorylation site was mapped to the CYP7A1 crystal structure. Seven residues on the CYP7A1 polypeptide have been mapped as the steroid binding pocket, and shown to interact with the cholesterol molecule[108]. More recently, the crystal structure of CYP7A1 was determined, and is available on the Protein Data Bank (PDB), EC no: 1.13.14.17.
Figure 37 shows the crystal structure of CYP7A1, which was modified to illustrate the locations of AMPK phosphorylation sites and important amino acids involved in cholesterol binding. AMPK phosphorylation sites S80 (cyan), T193 and
T197 (magenta), S252 (yellow), S385 (red), the steroid binding site (black), and the amino acids that interact with cholesterol, ‘cholesterol binding-pocket’ (green). The cholesterol binding-pocket is located in the center of the crystal structure, and consists of amino acid residues L280, L283, W284, A288, S358, S360, G485, and I488 located on two different alpha-helix strands. The cholesterol molecule was determined to bind in the pocket with its 7 -hydroxyl group oriented towards the heme group[108]. The steroid binding-pocket also has a helix-loop-helix structure sitting on top of it. S252 is located on the outer part of the crystal structure, a position suitable for phosphorylation events.
The S252 site is located on a loop that is located between the helix-loop-helix structure,
(blocking the cholesterol binding-pocket) and one of the alpha helix strands harboring the 164 amino acids involved in cholesterol interaction with CYP7A1. S252 is also located adjacent to two hydrophobic amino acids isoleucine 187 and phenylalanine 188.
The locations of the S252 on the crystal structure, suggests a possible mechanism by which AMPK kinase activity regulates CYP7A1 enzymatic activity. The phosphorylation of S252 could result in a structural change by which the helix-loop-helix structure, blocking the cholesterol binding-pocket, is moved further into the grove. The movement of the helix-loop-helix structure, upon phosphorylation, might be a result of the proximity of the phosphorylated serine 252 and the hydrophobic amino acids adjacently located. The blocking of the cholesterol binding-pocket will influence the accessibility of the binding-pocket to its ligand. 165
Figure 37. Crystal Structure of CYP7A1
The crystal structure of CYP7A1 was obtained from the Protein Data Bank (PDB), EC no: 1.13.14.17. The structure was modified to illustrate the AMPK phosphorylation sites and important amino acids involved in cholesterol binding. S80 (cyan), T193 and T197
(magenta), S252 (yellow), S385 (red), the steroid binding site (black), and the amino acids that interact with cholesterol, ‘cholesterol binding-pocket’ (green). Attention is drawn to the helix-loop-helix structure (blue) that is attached to S252 and blocking the cholesterol binding-pocket. Alternative views of the structure are provided. 166 S25 T193 Cholesterol Cholesterol Binding
T197
S38 Site Binding Steroid
T80
Figure 37. Crystal Structure of CYP7A1 167
It has long been hypothesized that there exists a mechanism by which cholesterol synthesis and cholesterol disposal is coordinated in the cell. The evidence provided here, that AMPK kinase activity represses the enzymatic activity of CYP7A1 by phosphorylation, is the first step to answering that question. The regulation of cholesterol synthesis by AMPK phosphorylation of HMG-CoA has been well documented. Here
AMPK is shown to also regulate cholesterol 7-hydroxylase, the rate-limiting enzyme in bile acid production through the classical pathway. This study provides evidence of how cholesterol homoeostasis is maintained in the cell by kinase activity. AMPK phosphorylation of both HMG-CoA and cholesterol 7-hydroxylase, the two rate limiting enzymes in cholesterol synthesis and bile acid synthesis respectively, result in a repression of their enzymatic activities, thereby maintaining cholesterol homeostasis in the cell [fig.38].
The discovery that CYP7A1 enzymatic activity can be modified by phosphorylation events, presents a rapid method of regulation bile acid biosynthesis.
This study also provides evidence of how cellular energy homeostasis is co-regulated with cholesterol homeostasis and bile acid synthesis. AMPK kinase is a serine/threonine protein kinase that is highly conserved in higher eukaryotes, yeast and plants[109, 110] and serves as an energy gauge for the cell. During energy starvation conditions such as anoxia or exercise-induced muscle contraction, ATP concentrations are decreased resulting in an increase in cellular AMP levels. The fluctuations in the AMP:ATP ratios result in the activation of AMPK. Activated AMPK leads to increase in cellular energy 168 by inhibiting anabolic energy consuming pathways such as fatty acid, cholesterol, and amino acid synthesis, and stimulates catabolic energy producing pathways such as fatty acid oxidation, glycolysis and glucose transport. By regulating both anabolic and catabolic pathways, AMPK is able to maintain the energy homeostasis in the cell when in low energy states.
The ability for AMPK kinase activity to repress CYP7A1 enzymatic activity is consistent with energy preservation during low cellular energy states. Cholesterol and bile acid synthesis are both energy-consuming pathways. HMG-CoA reductase and
CYP7A1 are the rate-limiting enzymes in cholesterol synthesis and bile acid production respectively. In low cellular energy states, the activation of AMPK will represses both cholesterol and bile acid synthesis to preserve energy, and the repression of both pathways together maintains cholesterol homeostasis in the cell.
In summary, the present study provides evidence to support the hypothesis that
CYP7A1 enzymatic activity is regulated at the post-translational level by phosphorylation events. AMPK kinase activity was shown to repress CYP7A1 enzymatic activity by directly phosphorylating the enzyme at S252. This study provides a mechanism by which cholesterol synthesis and bile acid biosynthesis is co-regulated in the cell. It also provides information about the cross talk between cholesterol synthesis, bile acid production, and energy homeostasis. 169
Cholesterol Synthesis Cholesterol Disposal
P P
AMPK
Figure 38. AMPK Maintains Cholesterol Homeostasis
Figure 38 is a schematic depiction to illustrate a mechanism by which cholesterol homeostasis is maintained in the cell. The phosphorylation of HMG-CoA reductase and cholesterol 7 -hydroxylase, both the rate-limiting enzymes in cholesterol synthesis and cholesterol disposal pathways respectively, represses both pathways and thereby maintains the cellular cholesterol levels. 170
Future Experimental Direction
Based on the results from this study, there are several directions in which future
investigations can be focused. The difference in enzymatic activity between microsomal
fractions and E. coli-expressed recombinant proteins, combined with the result from
PKCs’ slight stimulation of recombinant protein and AMPKs’ stimulation of the 30KD
fragment suggests multiple mechanisms by which kinase activity regulates CYP7A1
enzymatic activity. It is possible that some kinases, or combinations of kinases, would result in a stimulation of CYP7A1 enzymatic activity. These combinations, and the sites
that they phosphorylate should be investigated in future work. The phosphorylation state
of endogenous CYP7A1 is another avenue of investigation. JNK and PKC kinase
activity repressed CYP7A1 enzymatic activity in microsomal fractions but had no effect
on recombinant protein enzyme activity. This suggests that additional post-translational
modifications are needed to observe the effects of the kinase on enzymatic activity. By
investigating the native modification on endogenous CYP7A1 enzyme associated with
different cell states, the post-translational modifications that are associated with specific
activity can be determined. Treating cells with agents known to effect bile acid
production and determining the modification state of CYP7A1 in these cells will provide
information of modifications associated with various cell states.
Last but not least, the 30KD fragment that was shown to have enzymatic activity
should be further investigated. Does the N-terminus serve only as a determinant for
ligand specificity, or does its function include regulation on enzyme activity? The 171 physiological relevance of truncating the N-terminus of the CYP7A1 polypeptide should be investigated in-vivo. CHAPTER V
APPENDIX A
EXPERIMENTAL PROTOCOLS
a. Freezer Stock Preparation
Freezer stock solutions were made for colonies that have been analyzed for the appropriate vector construct. Streak plates were made to insure that single colonies were selected. The colony was grown overnight in 2mL LB + amp
(50mg/mL) and the culture was mixed with the 50% glycerol at a 1:1 ratio (v/v).
The freezer stock culture was stored at -70oC.
172 173
b. Restriction Digestion
Single-enzyme digest 5μl DNA to be digested Incubate at 37oC
1μl restriction enzyme for 1-2 hrs
2μl 10x restriction enzyme buffer
12μl dH2O
Double- enzyme digest To 20μl from first digest add : Incubate at 37oC
2μl 2nd restriction enzyme for 1-2 hrs
8μl 10x restriction enzyme buffer
70μl dH2O
Restriction digest was performed in a 0.5 ml sterilized eppendorf tubes at 37oc.
For single-enzyme digestion, the DNA sample was mixed with 1μl of restriction enzyme, and 2μl of 10x restriction enzyme buffer. The final volume was brought up to 20μl with sterile water. The DNA sample was incubated for 1-2 hrs at 37oC. For a double-enzyme
sequential digest, the DNA was first digested with the restriction enzyme of lower ion
concentration. After incubation of the first digestion, the total mixture was mixed with
2μl of the second enzyme; 8μl of the 10x restriction enzyme buffer and the final volume
was brought up to 100μl with sterile water. The sample was incubated for an additional
1-2 hrs at 37oC. For double-enzyme digestions that required the same buffer system, 1μl of both enzymes were incubated with DNA at the same time with 2μl of 10x restriction enzyme buffer and the final volume was brought up to 20μl with sterile water. After 174 restriction digest, ethanol precipitation was performed to concentrate DNA and remove restriction enzymes and smaller DNA fragments.
c. Ethanol Precipitation
To the total volume of DNA to be precipitated, add Na Acetate (1/10 the total volume of DNA sample) and 2 times the total volume of DNA with 95% ethanol.
Incubate sample on ice for 5-10 min. Centrifuge DNA sample in micro centrifuge for 15 min. Pipette off ethanol supernatant and wash pellet with 70% ethanol. Centrifuge sample again for 10 min. Dry down sample in a speed-vac and re-suspend DNA pellet in the desired amount of dH2O or tris buffer.
d. Ligation Protocol
DNA fragments to be ligated must have compatible ends. To facilitate ligation of the fragments in the correct orientation, use two different restriction enzymes for both ends of the DNA fragment. Used the same restriction enzymes to digest the DNA that the fragment will be ligated to. Make sure the restriction enzyme used on the n-terminal and the c-terminal of both the fragment and the host DNA is the same. Ligation was performed at room temperature in a sterilized 0.5ml eppendorf tubes. Ligation was performed in a total volume of 20μl with 1μl ligase enzyme, ligase buffer, and the two
DNA fragments to be ligated together. For ligation of a DNA fragment into a digested plasmid, the concentration of the DNA fragment was intentionally larger than plasmid 175
DNA to facilitate fragment ligation into the plasmid. Samples were incubated overnight and used for E. coli transformation.
Ligation Ligation Control
Vector 1μl 1μ
Insert 16μl ------
10x ligase buffer 2μl 2μ
ligase enzyme 1μ 1μ
dH2O ----- 16μl
e. Competent Cell Preparation
E.coli DH5 (or another strain to be made competent) was grown in 2ml luria broth (LB) to an O.D. ~ 2 x 109 cells/ml (overnight growth) and then inoculated at a
1:100 or 1:200 dilution in 100ml LB and grown to an O.D. of 5 x 108 cells/ml (~2-3hrs).
Swirling the growth flask over an ice-bath quickly chilled the cells culture. Cells were centrifuged at 4oC, 8min at 5,000 rpm in Tj-25 centrifuge (TA-10-250 rotor) to pellet cells. The cell pellet was resuspended in 25ml ice cold 0.1M MgCl2 by gently sloshing up and down repeatedly with a 25mL pipette. The cell suspension is immediately centrifuged at 4oC, 8min at 4,000 rpm. Resuspend pellet gently in 25ml ice cold 0.1M
o o CaCl2 and incubate cell suspension at 0 for 20 minutes. Centrifuge at 4 C for 8min at 176
4,000 rpm to collect cell pellet. Perform the next steps in a cold room or always have cell
suspension on ice. Dissolve cell pellet gently in a 2.5mL mixture of 86% glycerol and
14% CaCl2. Chill sterile storage tubes (0.5ml micro centrifuge tubes) on dry ice and aliquot 0.2 – 0.4 mL of cell suspension into the chilled tubes. Label tubes before chilling.
The cells should freeze immediately. Cap vials quickly and store at -70 to -80oC.
f. Transformation Procedure using Competent Cells
Thaw frozen competent cells in an ice bucket. To 20μl of DNA to be transformed
into the E. coli cell line, (20μl from ligation mixture) or ~ 0.5 μg DNA per
transformation, add 100μl of competent cells and incubate on ice (4oC) for 25 minutes.
Heat shock cells by incubating at 42oC for 90 seconds. Allow cells to equilibrate to room
temperature, 1-3 mins. Add 1ml LB that has been pre-equilibrated to room temperature to the cell mixture. Incubate mixture at 37oC ( 2 hours for cells that were transformed
with ligation samples, 1 hour for DNA plasmid samples that were not digested). Plate
mixture on LB + amp plates (15% agar + LB + 50 μg/mL amp) with different dilutions and incubate at 37oC overnight. Select colonies and perform mini prep plasmid purification to determine fragment insertion into plasmids. 177
g. LB broth
10g Bacto tryptone, 5g yeast extract, 10g NaCl, bring up to 1L with dH2O.
Sterilize by autoclaving in storage bottle. (For LB-antibiotic broth add 50μg/ml of
desired antibiotic to LB when cool and store at 4oC)
h. LB-antibiotic Plates 15% Agar
Add 15g agar to 1L LB and sterilize by autoclave. Allow media to cool down before adding antibiotic. By using aseptic techniques, pour LB-antibiotic agar mixture into 100ml plates until the media reaches approximately 1/4th to 1/3rd the plate volume.
Allow plates to solidify at room temperature and then store plates at 4oC.
i. Mini Plasmid Isolation
The mini plasmid isolation protocol was a quick and relatively inexpensive
method for isolating plasmid DNA. Multiple colonies could be analyzed to determine the
presence of inserts before the colonies were used for further experiments. Inoculate 2ml
LB-antibiotic broth with a single colony from the transformation plates and grow
overnight. Transfer 1 mL of culture to a 1.5 mL eppendorf tube and centrifuge for 30
sec. in a micro centrifuge. Resuspend pellet in 100μl lysis solution. Add 200μl alkaline
SDS and gently mix by inversion and incubate for 5 min. on ice. Add 150μl 3M Na
acetate, pH 4.8 to the mixture and gently mix by inversion and incubate for 10 min on 178
ice. Centrifuge sample for 10 min (until supernatant is clear) and transfer supernatant to
a clean tube. Add 1ml 100% ethanol to the supernatant and mix by inversion. Centrifuge the sample for 15 min. Pour off supernatant and wash the pellet with 70% ethanol.
Centrifuge the sample for 10 min. Dry pellet in a speed vacuum and re-suspend pellet in
50μl dH2O. Separate isolated plasmid by agarose gel electrophoresis to determine
molecular weight of isolated plasmid.
Lysis solution 20 mM Tris/HCl, pH 7.4
1 mM EDTA, pH 8.0
Alkaline SDS (stable for 1 week) 1% SDS
0.2 M NaOH
RNase A 10 mg/ml in 5 mM Tris/HCl, pH7.4
heat for 10 min. in boiling water to
inactivate DNases
j. High Copy Plasmid Purification
This plasmid preparation was used to obtain high copy of purified plasmid DNA
for transformations, transfections and DNA sequencing. For the high copy plasmid 179 purification the BD Bioscience Nucleobond Nucleic Acid Purification Tools was used following the manufactures instructions for the midi and maxi preparations. The midi and maxi preparation depended on the volume of LB culture and had an expected DNA yield of 20-100 μg and 100-500 μg respectively.
k. Agarose Gel Electrophoresis
10x TBE buffer: 108g Tris Base, 55g Boric Acid, 4ml of 0.5M EDTA, bring solvent up to 1L with dH2O. For 1% agarose gel: to 50ml of 1X TBE buffer (100ml 10X
TBE buffer in 900ml dH2O), add 0.5g agarose and heat in a microwave until all the agarose has dissolved. Allow solution to cool for 2-3 min and add 3-5μl of ethidiu bromide. Swirl the solution to mix and pour into the electrophoresis chamber. Apply well combs and allow mixture to solidify. Fill chamber up with 1X TBE buffer and load samples. Run the gel at 100v until dye front reaches the bottom of the gel or until desired separations are obtained. Visualize DNA samples under UV light.
l. Electro Elution
There were two different strategies used to isolate the desired DNA samples from the agarose gel after separation. In the first technique the sample is electrophoresed on a
1% agarose gel until the desired DNA band is separated (use UV light to see when this result is obtained). Next cut a well in the gel about 0.5-1 inches below the desired band 180 and block the bottom of the well with molecular porous membrane (this will prevent the
DNA from re-entering the gel). Turn on electrophoresis for 1-2 min (time may vary) intervals until the DNA has migrated into the wells that was created (a hand held UV light is useful to determine when this result is obtained. Removal of the gel from the electrophoresis chamber will result in lose of DNA samples to the buffer). Use a micropipette to extract the DNA from the well into an eppendorf tube. Continue short runs and extraction until the entire desired sample is collected. Perform an ethanol precipitation on the extracted DNA to concentrate the sample and remove ethidium bromide from the collected fraction. Dry down the sample in a speed vacuum and resuspend in desired volume of dH2O.
The second method was an improvement over the first. A Model 422 gel eluter was purchased from Bio-Rad Laboratories, Hercules, CA. The electro-eluter was convenient in assembly and provided minimum leakage that resulted in higher sample yield. The eluted volume was also smaller which eliminated the need for sample concentration after elution. The apparatus is assembled with a glass tube, frit (to hold gel slice), membrane cap (to collect eluted samples), and silicon adaptor (to hold membrane cap in place). The gel spice is put in the glass tube from the open end, and the tube is filled with elution buffer. A sample is eluted at 8-10mA /glass tube constant current for
3-5 hours. Protein elution buffer consisted of 25mM Tris base, 192mM glycine and
0.1% SDS. DNA elution buffer consisted of 40mM Tris, 20 mM Glacial acetic acid, 1 mM EDTA pH 8.0, 0.1% SDS. 181 m. PCR Reaction
Template DNA 50-100 pg per reaction (2 μl)
Forward primer 50 pmols per reaction (1 μl)
Reverse primer 50 pmols per reaction (1 μl)
2x PCR primer mix 25 μl
dH2O 21 μl
Total volume per reaction 50 μl
PCR reaction was performed with the GeneAmp PCR system 9700. Each cycle for the PCR reaction consisted of denaturing temperature at 92oC for 30 sec., annealing temperature at 60oC for 30 sec. and extension temperature at 72oC for 1 min. The PCR was performed for 30 cycles and set to hold at 4oC. 50 – 100 pg of template DNA was used for each PCR reaction with 50 pmoles of the forward and reverse primers. The template, primers, and sterile water were mixed in a PCR reaction tube and set in the
GeneAmp PCR system. The reaction solution was hot started for 1 min prior to the addition of 25 μl of the 2x PCR primer mix. The reaction was run for the complete 30 cycles and the reaction sample was run on a 1% agarose gel to analyze the amplified
DNA fragment. 182 n. Bile Acid Assay
Bile acid assay was performed with the Total Bile Acids Assay Kit (Enzymatic
Cycling) obtained from Bio Quant, San Diego, CA. In the presence of Thio-NAD, the enzyme 3- hydroxysteriod dehydrogenase (3--HSD) converts bile acids to 3-keto steroids and Thio-NADH. The enzymatic reaction is reversible. In the presence of excess NADH, the enzyme cycling occurs efficiently and the rate of formation of Thio-
NADH is determined by measuring specific change of absorbance at 405nm. A calibrator is provided that is used as the standard for the enzymatic reaction. The reaction solvents are provided in two solutions (R1, Thio-NAD and R2, 3HSD).
The bile acid assay was performed on a 96 well plate and triplicate samples of the standards and the experimental samples were used. R1 and R2 are pre-warmed to room temperature in the dark. 180 μl of R1 was pipetted into the wells and 4 μl of sample, standard, or water (as blank) was added. The reaction mixture was incubated at 37oC for
3 min and then 60 μl of R2 was added to the wells, mixed and immediately monitored at absorbance of 405nm for 2 min intervals until change in absorbance was minimal.
Subtracting the 405nm absorbance at time 0 normalized the reaction. A standard bile acid samples were used to prepare a standard curve by plotting absorbance verses time.
The slops of the graph were used to plot a graph of slop verses concentration, which was then used to interpolate the bile acid concentrations of the experimental samples. The triplicate samples were used to determine the statistical error of the experiment. 183 o. Phenol / Chloroform Extraction
The phenol/chloroform extraction was used to purify isolated DNA samples from mini plasmid preparations. A volume of sodium acetate that is 1/10th the total starting volume of the DNA sample is added to the reaction. Alternatively, equal volume of 2M- ammonium acetate can be used. Add an equal volume of the phenol/chloroform solution to the reaction sample and vortex. Centrifugation of the reaction solution will separate the organic phase form the aqueous phase. Transfer the aqueous phase to a new tube and add equal volume of chloroform. Vortex the reaction solution and spin the sample to separate the organic and aqueous phases. Transfer the aqueous phase to a new tube and perform an ethanol precipitation to concentrate purified DNA sample.
p. Reverse Staining Using Imidazole-Zinc
This staining technique was used prior to protein electro-elution because it is easily reversible. Protein samples were separated on a SDS-PAGE gel, and the gel was rinsed in water for 5 sec. The gel was soaked in 0.2M imidazole with gentle agitation for
5-30 minutes depending upon the gel concentration. The gel was then soaked in 0.3M zinc acetate (zinc sulfate or zinc chloride can also be used) with gentle agitation for 1 minute or until background becomes opaque white with transparent bands. The bands of interest were cut out of the gel and destained by washing the gel pieces for 10 minutes with 2-3 changes of 2% citric acid. The protein of interest was then electro-eluted from the gel. 184
q. Silver Stain
Protein samples were separated on SDS-PAGE gel. The gel was prefixed in 50% methanol, 10% acetic acid for 30 minutes followed by 5% methanol, 7% acetic acid for
30 minutes. The gel is rinsed in distilled water for 30 minutes. If the gel was fixed with glutaraldehyde after the prefixing step, then the gel should be soaked in water overnight before proceeding. Soak the gel in 5 μg/mL dithiothreitol (DTT) for 30 minutes. Pour off the solution and without rinsing, add 0.1% silver nitrate to the gel and treat for 30 minutes. Rinse the gel rapidly with a small amount of distilled water and then twice rapidly with a small amount of developer (50 μl of 37% formaldehyde in 100ml 3% sodium carbonate). Soak the gel in the developer solution until the desired level of staining is attained. Stop the staining by adding 5 ml of 2.3M citric acid directly to the developer and agitating the gel for an additional 10 minutes. Discard the solution and wash the gel several times in water over a 30-minute period. Soak the gel in 0.03% sodium carbonate to prevent bleaching. Destaining the gel after silver stain is accomplished by soaking the gel in 0.1% potassium ferricyanide for 2-3 minutes and the solution is poured off. Soak the gel in water with continues changing until destaining stops. Change the water more frequently if the gel persists to destain. Soak the gel in
0.03% sodium carbonate for storage to prevent bleaching.
185 r. Protein Purification
This protein purification technique was used to purify the C2 polypeptide that was used in generating the CYP7A1 polyclonal antibodies. The C2 polypeptide was synthesized with the Roche RTS 500 E. coli HY kit and was separated on a 50ml 12.5%
SDS-PAGE gel. The gel was reverse stained using imidazole-Zinc staining protocol and desired band was cut out. The gel slices were destained with two 10 minutes wash with
2% citric acid. The protein was electro-eluted from the gel with the Model 422 gel eluter purchased from Bio-Rad Laboratories. The protein concentration was measured using the Spectra Max Plus 384 spectrophotometer. Coomassie staining and western blot analysis of the eluted sample separated on a 12.5% SDS-PAGE gel was used to conform the isolated protein as the C2 polypeptide.
s. Preparation of HepG2 Cells for Self-Generating Density Gradient (Optiprep)
HepG2 Cell Preparation:
HepG2 cells were plated on 100 mm tissue culture plates and incubated in 3%
o CO2 at 37 C until the cells were grown to confluency. Dulbecco’s modified eagle’s medium (DMEM): F12 medium with no phenol red was used as the growth medium with the addition of penicillin and 10% fetal calf serum. The medium on the confluent cells was exchanged with medium without fetal calf serum and the cells were incubated for an additional four hours. The cells were scraped off the plates and transferred to 1.5ml 186
eppendorf tubes. The cells were centrifuged at 600 x g for 1 min and the supernatant was
aspirated out. The cells were re-suspended in 1 x hypotonic extraction buffer (10mM
HEPES, pH 7.8, 25mM potassium chloride and 1mM EDTA) equivalent to 3 times the
packed cell volume (PCV) and incubated on ice for 15 min to allow cells to swell. The
cells were centrifuged at 600x g for approximately 2 min and the supernatant was
removed and the new PCV was measured. The cells were then re-suspended in 1 x
isotonic extraction buffer (10mM HEPES, pH 7.8, 250mM sucrose, 25mM potassium
chloride, and 1mM EDTA) equivalent to 2 times the new PCV and immediately transferred to a 7ml Dounce homogenizer. The cells were broken with approximately 20
- 25 strokes and then preceded to the self-generating density gradient protocol.
Self-Generating Density Gradient (Optiprep)
Optiprep is a 60% (w/v) solution of iodixanol in water, density =
1.32g/ml. iodixanol is a low osmolarity, iodinated density gradient medium that is biologically inert. The HepG2 cell preparation was adjusted to 20% (w/v) optiprep by using a 50% optiprep working solution. The working solution and all other subsequent dilutions were made by dilutions with 1 x isotonic extraction buffer. 2ml of a 30% solution was layered at the bottom of a 10ml optiseal tube, and the 20% cell sample was carefully layered on top of the 30% solution by using a pipette and applying the sample slowly to the wall of the tube close to the bottom layer. A 15% solution of the optiprep was then layered on top of the sample. The balancing tube was made with a similar 187 gradient (the 20% solution did not contain HepG2 cell extract). The sample was then centrifuged in a Beckman Coulter ultracentrifuge using a swinging bucket rotor Ti 41 for
3hrs @40K rpm, 4o. After centrifugation, the tube was carefully removed. By inserting a needle from the bottom of the tube, 0.5ml fractions were collected and further analyzed.
Fractions were also collected from the balancing tube that was poured in the same form as the experimental tube. The fractions from the balancing tube were analyzed to determine the gradient distribution.
t. E. coli Preparation for Enzyme Assay
The E. coli cells that have been transformed with the plasmid of interest were grown over night in 2ml LB+ amp. A larger volume of LB + amp was inoculate with the cell culture at 1:100 dilution. The cells were then grown to an OD of 0.6 and protein expression was induced with 4mM IPTG for 4 hours. Cells were collected by centrifugation at 5.5k rpm; 4oc for 5 min in a Beckman Coulter TJ-25 centrifuge with a
TA-10-250 rotor. The pellet was washed with 10mM tris-HCL pH 8.0 0oC. The cells were then re-suspend in 30mM tris-HCL pH 8.0, 20% sucrose. EDTA and lysozyme were added to the suspension at a final concentration of 10mM and 0.5mg/ml respectively, and the suspension was incubated at room temperature for 30 min.
The cell suspension was then centrifuged in the TJ-25 centrifuge at 16K x g for 15 min at 4oc in a TA-14-50 rotor until the supernatant was clear. The cellular pellet was re- suspended in 0.1M Na2HPO4 pH 6.6 20% sucrose 20 mM MgSO4. Dnase and RNase were added to the cell suspension and then homogenized in a hand homogenizer with 20 188
to 30 strokes. The suspension was homogenized until it was uniformly dispersed and
then immediately added directly to 50 mM Na2HPO4 pH 6.6 that had been equilibrated to
37oC. The sample is then incubated for 15 mins at 37oC with vigorous swirling.
After 15min, EDTA is added to a final concentration of 10 mM and incubation is
continued for 15min. MgSO4 is added to a final concentration of 15 mM and incubation
is continued for an additional 15 min. The sample is centrifuged at 16K x g for 30 min to
collect the cell pellet. The cell pellet is re-suspended in 0.1M Na2HPO4 pH 6.6 10 mM
EDTA at 0oC by hand homogenization until suspension is uniformly dispersed. The
suspension is centrifuged for 30 min in a Beckman Coulter optima L-90K ultracentrifuge
at 45K x g, 4oC with a Ti-90 rotor. The pellet is collected and re-suspended by homogenization in 0.1M Na2HPO4 pH 6.6 10 mM EDTA. The suspension is centrifuged at 800 x g for 30 min to remove large cellular debris in the TJ-25 centrifuge. The milky supernatant is collected and centrifuged in the ultracentrifuge for 30 min at 45K x g, 4oC
in the Ti-90 rotor.
The pellet is finally homogenized in 500l of microsome buffer containing 0.1 M phosphate buffer pH 7.5, 0.1 mM EDTA, 5 mM DTT, 5 mM MgCl2, 50 mM NaF and
0.25 mM sucrose. Bradford protein assay is performed to determine total amount of
protein isolated and western blot analysis is performed to confirm isolation of CYP7A1
recombinant protein. 189
u. Microsome Preparation
HepG2 cells were plated in 100 mm tissue culture plates and incubated in 3% CO2
at 37oc until the cells were grown to confluency. Dulbecco’s modified eagle’s medium
(DMEM): F12 medium with no phenol red was used as the growth medium with the
addition of penicillin and 10% fetal calf serum. The medium on the confluent cells was
exchanged with medium without fetal calf serum. The medium was changed twice
within four hours to remove any bile acids produced in the medium because this will
down regulated the expression of cholesterol 7 -hydroxylase. The cells were harvested
by centrifugation and suspended in homogenizing buffer containing 0.1 M KH2PO4 /
Na2HPO4 pH7.4, 0.25 M sucrose, 20 mM DTT, 50 mM NaF and 1.0 mM EDTA using a
hand homogenizer. The suspension was centrifuged at low speed to remove large cellular
debris and the supernatant was then centrifuged in a Beckman Coulter optima L-90K
ultracentrifuge for 70 mins (38,000 rpm, 4oC, Ti-90 rotor). The pellet was suspended in
pyrophosphate buffer (0.1 M Na Pyrophosphate pH 7.4, 10 mM EDTA, 50 mM NaF and
2 mM DTT) and centrifuged at 38,000 rpm for 45 mins. The pellet was then
homogenized in 400 l microsome buffer containing 0.1 M phosphate buffer pH 7.5, 0.1
mM EDTA, 5 mM DTT, 5 mM MgCl2, 50 mM NaF and 0.25 mM sucrose. 190
v. Densitometry Measurements
The densitometry measurements were used to quantify the relative specific
protein in the E. coli-expressed recombinant CYP7A1. This method was also used to determine the ratio between the 30KD fragment and the higher molecular weight proteins expressed off the full-length CYP7A1 cDNA sequence. The first step was to determine the optimal amount of total protein to use for the immunoblot assay. The goal was to obtain the optimal amount of specific protein without overloading the immuno-detection.
The optimal concentration for my assay was determined to be between 1 and 2 μg for the
30 KD fragment and between 3 and 5 μg for the higher molecular weight bands. Western
blot analysis was performed with triplicate samples of each E. coli-expressed
recombinant protein, and immuno-detection was performed with anti-His antibodies. The
C2 polypeptide used for CYP7A1 antibody production was used as a positive control for detection and quantification of E. coli-expressed proteins.
Approximate molecular weight and densitometry measurements were performed
with the Kodak 1D 3.5.3 imaging software. The molecular weight was determined by
comparing expressed protein to the molecular weight markers. The relative intensity of
the bands was compared to the known concentration of the C2 positive control. The
triplicate samples were used to determine to relative error in detection and sensitivity of
the immunoblot analysis. The relative intensity of the bands were then used to determine
the ration between the 30KD fragment and the higher molecular weight bands, and the
relative specific amount of specific protein used in each assay. APPENDIX B
ABBREVIATIONS
3--HSD 3- Hydroxysteriod Dehydrogenase 3--HSD 3--hydroxysteriod Dehydrogenase AAs Amino acids ABC (A1/G1) ATP-binding Cassette Protein (A1/G1) Acetyl-CoA Acetyl-coenzyme A AICAR Aminoimidazole Carboxamide Ribonucleotide AMP Adenosine 5`-monophosphate AMPK Adenosine 5`-monophosphate Activated Protein Kinase APCI Atmospheric Pressure Chemical Ionization Apo AI Apolipoprotein AI ATP Adenosine 5`-Triphosphate BCA Bicinchoninic Acid C4 7 -hydroxy-4-cholesten-3-one CA Cholic Acid cAMP Cyclic Adenosine Monophosphate CDCA Chenodeoxycholic Acid CHD Coronary Heart Disease CPF CYP7A Promoter-binding Factor CTX Cerebrotendinous Xanthomatosis
191 192
CYP27A1 Sterol 27- Hydroxylase CYP3A Cytochrome P450 3A CYP7A1 Cholesterol 7 -hydroxylase CYP7B1 Oxysterol 7 -hydroxylase CYP8B1 12 -hydroxylase 2 D7 7-Deuterated ( H7) 7-hydroxycholesterol DCA Deoxycholic Acid DTT Dithiothreitol EDTA Ethylenediaminetetraacetic Acid ER Endoplasmic Reticulum FGF Fibroblast Growth Factor FGFR Fibroblast Growth Factor Receptor FTF -Fetoprotein Transcription Factor FXR Farnesoid X-receptor GCA Glycocholic Acid GCDCA Glycochenodeoxycholic Acid GDCA Glycodeoxycholic Acid GLCA Glycolithocholic Acid GLIMMER Gene Locator and Interpolated Markov ModelER GUDCA Glycoursodeoxycholic Acid HDL High Density Lipoprotein HDL-C High Density Lipoprotein Cholesterol HepG2 cell Human Hepatocellular Liver Carcinoma cell line HMG-CoA 3-hydroxyl 3-methylglutaryl-coenzyme A HNF4- Hepatocyte Nuclear Fatcor 4- HPLC High-pressure Liquid Chromatography IL-1 Interleukin-1 Insig Insulin-induced genes IPTG Isopropyl -D-1-thiogalactopyranoside 193
JNK c-jun N-terminal Kinase LB Luria Broth LCA Lithocholic Acid LDL Low Density Lipoprotein LDL-C Low Density Lipoprotein Cholesterol LRH-1 Liver Receptor Homolog LXR Liver X Receptor MS Mass Spectrometry MCS Multiple Cloning Sites NADPH Nicotinamide Adenine Dinucleotide Phosphate ORF Open Reading Frame PCR Polymerase Chain Reaction PCV Packed Cell Volume PDAY Pathobiological Determinants of Atherosclerosis in Youth PDB Protein Data Bank PGC-1 PPAR coactivator-1 PKA Protein Kinase A PKC Protein Kinase C PMA Phorbol 12-myristate 13-acetate PPAR Peroxisome Proliferator Activated Receptor RTS Rapid Translation System RXR Retinoid X Receptor SCAP SREBP-cleavage-activating Protein SDS-PAGE Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis SHP-1 Small Heterodimer Partner 1 SREs Sterol Regulatory Elements SREBP Sterol Regulatory Element Binding Protein TCD Taurocholic Acid TCDCA Taurochenodeoxycholic Acid 194
TDCD Taurodeoxycholic Acid TLCA Taurolithocholic Acid UDCA Ursodeoxycholic Acid UV Ultraviolet VLDL Very Low Density Lipoprotein REFERENCES
1. D. Stroup, J.R., Ramsaran, Cholesterol 7-hydroxylase is Phosphorylated at Multiple Amino Acids. BBRC, 2005. 329: p. 957-965.
2. Stroup, D., Kinase/Phosphatase Regulation of CYP7A1. Frontiers in Bioscience, 2005. 10: p. 1678-1692.
3. Stroup, D., Role of Kinases in Coordinating Cholesterol Metabolism with Bile Acid Synthesis. Recent Res. Devel. Lipids, 2004. 7: p. 49-63.
4. Li Y. C., D.P., Wang, J. Y. Chiang, Regulation of Cholesterol 7 Alpha- hydroxylase in the Liver. Cloning, Sequencing, and Regulation of Cholesterol 7 alpha-hydroxylase mRNA. J. Biol. Chem., 1990. 265: p. 12012-12019.
5. Wang D.P., D., Stroup, M. Marrapodi, M. Crestani, G. Galli, J.Y. Chiang, Transcriptional Regulation of the Human Cholesterol 7 Alpha- hydroxylase Gene (CYP7A) in HepG2 Cells. J. Lipid Res., 1996. 37: p. 1831-1841.
6. Jelinek D.F., S., Andersson, C. A. Slaughter, D. W. Russell, Cloning and Regulation of Cholesterol 7 Alpha-hydroxylase, The Rate-Limiting Enzyme in Bile Acid Biosynthesis. J. Biol. Chem., 1990. 265: p. 8190- 8197.
7. Sundseth S. S., D.J., Waxman, Hepatic P-450 Cholesterol 7 Alpha- hydroxylase. Regulation In-vivo at the Protein and mRNA Level in Response to Mevalonate, Diurnal Rhythm, and Bile Acid Feedback. J. Biol. Chem., 1990. 265: p. 15090-15095.
195 196
8. Crestani, M., W. G. Karam, and J. Y. Chiang, Effects of Bile Acid and Steroid/Thyroid Hormones on the Expression of Cholesterol 7 Alpha-hydroxylase mRNA and the CYP7 Gene in HepG2 Cells. Biochem. Biophys. Res. Commun., 1994. 198: p. 546-553.
9. Chiang, J., Bile Acids Regulation of Gene Expression: Roles of Nuclear Hormone Receptors. Endocrine Reviews, 2002. 23(4): p. 443-463.
10. M. Norlin, U., Andersson, I. Bjorkhem, and K. Wikvall, Oxysterol 7 alpha- hydroxylase Activity by Cholesterol 7 alpha-hydroxylase (CYP7A). J. Biol. Chem., 2000. 275(44): p. 34046-34053.
11. Rodrigues C. M., S., Sola, Z. Nan, R. E. Castro, P. S. Ribeiro, W. C. Low and C. J. Steer, Tauroursodeoxycholic Acid Reduces Apoptosis and Protects Against Neurological Injury After Acute Hemorrhagic Stroke in Rats. Proc. Natl. Acad. Sci. USA, 2003. 100: p. 6087-6092.
12. Keene C. D., C.M.R., T. Eich, M.S. Chhabra, C. J. Steer and W. C. Low, Tauroursodeoxycholic acid, a bile acid, is neuroprotective in a transgenic animal model of Huntington's disease. Proc Natl Acad Sci U S A, 2002. 99: p. 10671- 10676.
13. Low-Beer T.S, T.M.P., and Lack L., Effects of sulfation of taurolithocholic and glycolithocholic acids on thier intestinal transport. Gastroenterology, 1969. 56: p. 721-726.
14. D. J. Parks, S.G., Blanchard, R. K. Bledsoe, G. Chandra, T. G. Consler, S. A. Kliewer, J. B. Stimmel, T. M. Willson, A. M. Zavacki, D. D. Moore, J. M. Lehmann, Bile Acids: Natural Ligands for an Orphan Nuclear Receptor. Science, 1999. 284: p. 1365-1358.
15. S. Narushima, K., Itoh, Y. Miyamoto, S. Park, K. Nagata, K. Kuruma, and K. Uchida, Deoxycholic Acid Formation in Gnotobiotic Mice Associated with Human Intestinal Bacteria. Lipids, 2006. 41(9): p. 835-843.
16. B. C. Musial and Williams C. N., Quantitative Assay of Conjugated and Free Bile Acids as Heptafluorobutyrate by Gas-Liquid Chromatography. J. Lipid Res., 1979. 20: p. 78-85.
17. Lola F. Duarte, C., Legido-Quigley, David A. Parker, Jonathan R. Swann, Manfred Spraul, Ulrich Braumann, Ana M. Gil, Elaine Holmes, Jeremy K. Nicholson, Gerard M. Murphy, Hector Vilca-Melendez, Nigel Heaton, John C. Lindon, Identification of Metabolites in Human Hepatic Bile using 800 MHz 1H 197
NMR Spectroscopy, HPLC-NMR/MS and UPLC-MS. Mol.BioSyst., 2009. 180(DOI:10.1039/b814426e).
18. Antonio del Castillo-Olivares, Gregorio Gil, Role of FXR and FTF in Bile Acid- mediated Suppression of Cholesterol 7 Alpha-hydroxylase Transcription. Nucleic Acids Research, 2000. 28(18): p. 3587-3593.
19. Akira Honda, K., Yamashita, Mitsuteru Numazawa, Tadashi Ikegami, Mikio Doy, Yasushi Matsuzaki and Hiroshi Miyazaki, Highly Sensitive Quantification of 7 Alpha-hydroxy-4-cholesten-3-one in Human Serum by LC-ESI-MS/MS. J. Lipid Res., 2007. 48: p. 458-464.
20. Russell, D.W., the enzymes regulation, and genetics of bile acid synthesis. ANNU. Rev. Biochem. , 2003. 72: p. 137-174.
21. Chiang, J.Y., Regulation of Bile Acid Synthesis Pathways, Nuclear Receptors, and Mechanisms. J. Hepatol, 2004. 40: p. 539-551.
22. B.M. Forman, E.G., J. Chen, A.E. Oro, D. J. Bradley, T. Perlmann, D.J. Noonan, L.T. Burka, T.McMorris, W.W. Lamph, R.W. Evana, C. Weinberger, Identification of a nuclear receptor that is activated by farnesol metabolites. Cell, 1995. 81: p. 687-694.
23. R.T Stravitz, Z.R.V., E. C. Gurley, P. B. Hylemons, Repression of cholesterol 7- hydroxylase transcription by bile acids is mediated through protein Kinase C in primary cultures of rat hepatocytes. J. Lipid Res., 1995. 36: p. 1359-1368.
24. M. Makishima, A.Y.O., J.J. Repa, H. Tu, R. M. Learned, A. Luk, M. V. Hull, K.D. Lustig, D. J. Mangelsdorf, B. Shan, Identification of a nuclear receptor for bile acids. Science, 1999. 284: p. 1362-1365.
25. H. Wang, J.C., K. Hollister, L. C. Sowers, B. M. Forman, Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol. Cell, 1999. 3: p. 543-553.
26. Seema Gupta, R.T.S., Paul Dent, Phillip B. Hylemon, Down-regulation of Cholesterol 7-hydroxylase (CYP7A1) Gene Expression by Bile Acids in Primary Rat Hepatocytes Is Mediated by the c-Jun N-terminal Kinase Pathway The Journal of Biological Chemistry, 2001. 276(19): p. 15816-15822.
27. L. Wang, Y.K.L., D. Bundman, Y. Han, S. Thevananther, C.S. Kim, S. S. Chua, P. Wei, R. A. Heyman, M. Karin, D. D. Moore, Redundant pathways for negative feedback regulation of bile acid production. . Dev. Cell, 2002. 2: p. 721-731. 198
28. S. Gupta, R., Natarajan, S. G. Payne, E. J. Studer, S. Spiegel, P. Dent, P. B. Hylemon, Deoxycholic Acid Activates the c-Jun N-terminal Kinase Pathway via FAS Receptor Activation in Primary Hepatocytes. Role of Acidic Sphingomyelinase-mediated Ceramide Generation in FAS Receptor Activation. J. Biol. Chem., 2004. 279: p. 5821-5828.
29. Seol, W., Choi, H. S., Moore, D. D., Isolation of Proteins That Interact Specifically with Retinoid X Receptor: Two Novel Orphan Receptore. Mol. Endocrinol, 1995. 9(1): p. 72-85.
30. Forman, B.M., et al.,, Identification of a Nuclear Receptor that is Activated by Farnesol Metabolites. Cell, 1995. 81(5): p. 687-693.
31. Chiang, J.Y., Kimmel, R., Weinberger, C., and Stroup,. D. , Farnesoid X Receptor Responds to Bile Acids and Represses Cholesterol 7 Alpha-hydroxylase Gene (CYP7A1) Transcription. J. Biol. Chem., 2000. 275(15): p. 10918-10924.
32. Kerr, T.A., Saeki, S., Schneider, M., Schaefer, K., Berdy, S., Redder, T., Shan, B., Russell, D. W., and Schwarz, M, loss of nuclear receptor SHP impairs but does not eliminate negative feedback regulation of bile acid synthesis. Dev. Cell, 2002. 2: p. 713-720.
33. S. M. Houten, M., Watanabe, J. Auwerx, Endocrine Functions of Bile Acids. EMBO, 2006. 25: p. 1419-1425.
34. Holt, J.A., Luo, G., Billin, A. N., Bisi, J., McNeill, Y.Y, Kozarsky, K.F., Donahee, M., Wang da, Y., Mansfield, T.A., Kliewer, S. A., et al., definition of a novel growth factor-dependent signal cascade for the suppression of bile acid biosynthesis. Genes Dev., 2003. 17: p. 1581-1591.
35. Xie, M.H., Holcomb, I., Deuel, B., Dowd, P., Huang, A., Vagts, A., Foster, J., Liang, J., Brush, J., Gu, Q., et al., FGF-19, a Novel Fibroblast Growth Factor with Unique Specificity for FGFR4. Cytokine, 1999. 11: p. 729-735.
36. Inagaki, T., Choi, M., Moschetta, A., Peng, L., Cummins, C. L., McDonald, J. G., Luo, G., Jones, S. A., Goodwin, B., Richardson, J. A., Gerard, R. D., Repa, J. J., Mangelsdorf, D. J., and Kliewer, S. A., Fibroblast growth factor 15 functions as an enteropatic signal to regulate bile acid homeostasis. Cell Metabolism, 2005. 2: p. 217-225.
37. R. T. Stravitz, Z.R.V., E. C. Gurley, P. B. Hylemons, bile acids in gastroenterology: basic and clinical advances, in: A.F. Hofmann, G. Paumgartner, A. Stiehl (Eds.), Kluwer, Dordrecht, Boston, London,. 1995: p. 119- 128. 199
38. U. Beuers, D., Throckmorton, M. Anderson, C. Isales, W. Thasler, G. Kullak- ublick, G. Sauter, H. Koebe, G. Paumgartner, J. Boyer, Tauroursodeoxycholic Acid Activates Protein Kinase C in Isolated Rat Hepatocytes. Gastroenterology, 1996. 110: p. 1553-1563.
39. Y. P. Rao, E.J., Studer, R. T. Stravitz, S. Galli, L. Qiao, P. Dent, P.B. Hylemon,, Activation of the Raf-1/MEK/ERK Cascade by Bile Acids Occurs via the Epidermal Growth Factor Receptor in Primary Rat Hepatocytes. Hepatology, 2002. 35: p. 307-314.
40. Javitt, N.B., Bile acid synthesis from cholesterol: regulatory and auxiliary pathway. The FASEB Journal, 1994. 8(Dec. 1994): p. 1308-1311.
41. M. Norlin, S.B., I. Bjorkhem, and K. Wikvall, on the substrate specificity of human CYP27A1: implications for bile acid and cholestanol formation. J Lipid Res, 2003. 44: p. 1515-1522.
42. Song, C., and Liao, S., Cholestenoic Acid is a Naturally Occuring Ligand for Liver X Receptor Alpha. Endocrinology, 200. 141: p. 4180-4184.
43. Fu, X., Menke, J. G., Chen, Y., Zhou, G., MacNaul, K. L., Wright, S. D., et al., 27-Hydroxycholesterol is an Endogenous Ligand for Liver X Receptor in Cholesterol-Loaded Cells. J Biol Chem, 2001. 276: p. 38378-38387.
44. Bjorkhem I., D.U., Oxysterols: Friends, Foes, or Just Fellow Passengers? Arterioscler Thromb Vasc Biol, 2002. 22: p. 734-742.
45. Javitt, N.B., 25 alpha, 26-hydroxycholesterol revisited: synthesis, metabolism, and biologic roles. J. Lipid Res, 2002. 43: p. 665-670.
46. Li, T., W. Chen, and J. Y. L. Chiang, PXR induces CYP27A1 and regulates cholesterol metabolism in the intestine. J Lipid Res, 2007. 48: p. 373-384.
47. Schwarz M., D.W., Russell, J. M. Dietschy and S. D. Turley, Alternate Pathway of Bile Acid Synthesis in the Cholesterol 7 Alpha-hydroxylase Knockout Mouse are not Upregulated by Either Cholesterol or Cholestyramine Feeding. J. Lipid Res., 2001. 42: p. 1594-1608.
48. Bjorkhem I., Z., Araya, M. Rudling, B. Angelin, C. Einarsson and K. Wikvall, Differences in the Regulation of the Classical and the Alternative Pathway for Bile Acid Synthesis in Human Liver. No Coordinate Regulation of CYP7A1 and CYP27A1 J. Biol. Chem., 2002. 277: p. 26804-26807. 200
49. Tiemann M., Z., Han, R. Soccio, J. Bollineni, S. Shefer, E. Sehayek and J. L. Breslow, Cholesterol Feeding of Mice Expressing Cholesterol 7 Alpha- hydroxylase Increases Bile Acid Pool Size Despite Decreased Enzyme Activity. Proc. Natl. Acad. Sci. USA, 2004. 101: p. 1846-1851.
50. Pikuleva, I.A., Cytochrome P450s and cholesterol homeostasis. Pharmacology and Therapeutics, 2006. 112(3): p. 761-773.
51. Bjorkhem I., K.M., Boberg, and Leitersdorf, E., Inborn Errors in Bile Acid Biosynthesis and Storage of Sterols Other Than Cholesterol. In A. L. Scriver, A. L. Beaudet, W. S. Sly, D. Valle, and B. Childs (Eds.). The Metabolic and Molecular Bases of Inherited Disease (7th ed.) New York: McGraw-Hill, 1995: p. 2073-2099.
52. Cali, J.J., Hsieh, C. J., Francke, U., and Russell, D. W., Mutations in The Bile Acid Biosynthetic Enzyme Sterol 27-hydroxylase Underlie Cerebrotendinous Acid Xanthomatosis. J Biol Chem, 1991. 266: p. 7779-7783.
53. Lee, M.-H., Hazard, S., Carpten, J. D., Yi, S., Cohen, J., Gerhardt, G. T., et al., Fine-mapping, mutational analysis, and structural mapping of cerebrotendinous xanthomatosis in U.S. pedigrees. J. Lipid Res, 2001. 42: p. 159-169.
54. Verrips, A., Hoefsloot, L. H., Steenbergen, G. C., Theelen, J. P., Wevers, R. A., Gabreels, F. J., et al., Clinical and Molecular Genetics Characteristics of Patients with Cerebrotendinous Xanthomatosis. Brain, 2000. 123(5): p. 908-919.
55. Andersson S., E.G., and Bjorkhem I., , Rabbit liver contains one major sterol 12 alpha-hydroxylase with broad substrate specificity. Biochim. Biophys. Acta, 1998. 1389: p. 150-154.
56. Eggertsen G., M., Olin, Andersson U., Ishida H., Kubota S., Hellman U., et al., Molecular Cloning and Expression of Rabbit Sterol 12 Alpha-hydroxylase J. Biol. Chem., 1996. 271: p. 32269-32275.
57. Gordon T., B.M., Rifkind High Density Lipoproteins-Clinical Implication of Recent Studies. N. Engl. J. Med., 1989. 321: p. 1311-1315.
58. A. R. Sharrett, C.M., Ballantyne, S. A. Coady, G. Heiss, P. D. Sorlie, D. Catellier, and W. Patsch, Coronary Heart Disease Prediction From Lipoprotein Cholesterol Levels, Triglycerides, Lipoprotein(a), Apolipoprotein A-1 and B, and HDL Density Subfractions: The Atherosclerosis Risk in Communities (ARIC) Stucy. Circulation, 2001. 104: p. 1108-1113. 201
59. McGill H. C. jr, M.C.A., Zieske A. W., Malcom G. T., Tracy R. E., Strong J. P. , Effects of nonlipid risk factors on atherosclerosis in youth with favorable lipoprotein profile. Pathobiological determinants of atherosclerosis in youth (PDAY) research group. Circulation, 2001. 103(11): p. 1546-1550.
60. McGill H. C. jr, M.C.A., Malcom G. T., Oalmann M. C.,Strong J. P., Effects of serum lipoproteins and smoking on atherosclerosis in young men and women. the PDAY research group. Arterioscler Thromb Vasc Biol, 1997. 17(1): p. 95-106.
61. S. R. Daniels, F.R., Greer, and The Committee on Nutrition, Lipid Screening and Cardiovascular Health in Childhood. American Academy of Pediatrics, 2008. 10: p. 198-208.
62. Stary H.C., A.B., Chandler, Dinsmore R.E.,et al., A Definition of Advanced Types of Atherosclerotic Lesions and Histological Classification of Atherosclerosis: a Report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association. Arterioscler. Thromb. Vasc. Biol., 1995. 15(9): p. 1512-1531.
63. A.J. Brown, W., Jessup, Oxysterol and Atherosclerosis. Atherosclerosis, 1999. 142(1): p. 1-28.
64. J.C. Verhagen, P.t.B., J. Teunissen, G van Ginkel and A. Sevanian, Physical effects of biological formed cholesterol oxidation products on lipid membrane investigated with fluorescence depolarization spectroscopy and electron spin resonance. Journal of Lipid Research, 1996. 37: p. 1488-1502.
65. F. Guardiola, R., Codony, P.B. Addia, M. Rafecas and J. Boatella, Biological Effects of Oxysterols: Current Status. Food and Chemical Toxicology, 1996. 34(2): p. 193-211.
66. Horton, J.D., Shah, N. A., Warrington, J. A., Anderson, N. N., Park, S. W., Brown, M. S. and Goldstein, J. L., Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc Natl Acad Sci U S A, 2003. 100: p. 12027-12032.
67. M.S. Brown , J.L., Goldstein, The SREBP Pathway: Regulation of Cholesterol Metabolism by Proteolysis of a Membrane-bound Transcription Factor. Cell, 1997. 89: p. 331-340.
68. Horton, J.D., Goldstein, J. L and Brown, M. S. , SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest., 2002. 109: p. 1125-1131. 202
69. Tontonoz, P., Kim, J. B., Graves, R. A., and Spiegelman, B. M., A Novel Helix- loop-Helix Transcription Factor Associated with Adipocyte Determination and Differentiation. Mol. Cell. Biol., 1993. 13: p. 4753-4759.
70. Rawson, R.B., The SREBP pathway-insights from Insigs and insects. Nat. Rev. Mol. Cell. Biol, 2003. 4: p. 631-640.
71. Lee, S.J., Sekimoto, T., Yamashita, E., Nagoshi, E., Nakagawa, A., Imamoto, N., Yoshimura, M., Sakai, H., Chong, K. T., Tsukihara, T. et al., the structure of importin-beta bound to SREBP-2: nuclear import of a transcription factor. Science, 2003. 302: p. 1571-1575.
72. Cheryl D. W. Smythe, M.G., T. Kealey, The Activity of HMG-CoA Reductase and Acetyl-CoA Carboxylase in Human Apocrine Sweat Glands, Sebaceous Glands, and Hair Follicles is Regulated by Phosphorylation and by Exogenouse Cholesterol. The Journal of Investigative Dermatology, 1998. 111(1): p. 139-148.
73. Z. H. Beg, J.A., Stonik, H. B. Brewer Jr., Modulation of the Enzyme Activity of 3- hydroxy-3-methylglutaryl Coenzyme A Reductase by Multiple Kinase Systems Involving Reversible Phosphorylation: a review. Metabolism, 1987. 36: p. 900- 917.
74. Rodwell V. W., N.J.L., Mitschelen J. H. , Regulation of HMG-CoA reductase. Adv. Lipid Res, 1976. 14: p. 1-74.
75. Wakil S. J., J.K., Stoops, Joshi V. C., Fatty Acid Synthesis and its Regulation. Annu. Rev. Biochem., 1983. 52: p. 537-539.
76. Scandinavian Simvastatin, S.G., Randomized Trial of Cholesterol Lowering in 4444 Patients with Coronary Heart Disease. Lancet, 1994. 344: p. 1383-1389.
77. Miettinen T. A., P.K., Olsson A. G., et al., cholesterol-lowering therapy in women and elderly patients with myocardial infarction or angina pectoris. Circulation, 1997. 96: p. 4211-4218.
78. Shepherd J., S.M., Cobbe, Ford I., et al. , Prevention of Coronary Heart Disease with Pravastatin in Men with Hypercholesterolemia. N. Engl. J. Med., 1995. 333: p. 1301-1307.
79. J. LaRossa, J.H., S. Vupputuri, Effects of statins on risk of coronary disease a meta-analysis of randomized controlled trials. Jama, 1999. 282(24): p. 2340- 2346. 203
80. J. Hyun Um, S.Y., S. Yamazaki, H. Kang, B. Viollet, M. Foretz, and J. H. Chung, Metformin Induces Casein Kinase I(CKI )-dependent Degradation of clock protein mPer2. J Biol Chem, 2007. 282(29): p. 20794-20798.
81. D. Carling, V.A., Zammit, and D. G. Hardie, A Common Bicyclic Protein Kinase Cascade Inactivates the Regulatory Enzymes of Fatty Acid and Cholesterol Biosynthesis. FEB, 1987. 223(2): p. 217-222.
82. Luoma, P.V., Cytochrome P450 and gene activation-from pharmacology to cholesterol elimination and regression of atherosclerosis. Eur J Clin Pharmacol, 2008. 64: p. 841-850.
83. Luoma, P.V., Pelkonen R.O., Sotaniemi E.A. , Plasma high-density lopiprotein cholesterol and hepatic drug metabolizing enzyme activity in man. Acta. Physiol. Scand. Suppl., 1979. 473.
84. Luoma, P.V., Sotaniemi E.A.,Pelkonen R.O., Ehnholm C, Plasma high density lipoprotein and liver microsomal enzyme activity in man. in: Pilli-Sihvola AS, Laaksovirta TH (Eds) The Medical Research Council 1977-1979. the Academy of Finland; Helsinki, 1980.
85. Bjorkhem I., D.U., Hydroxycholesterols-Friends, Foes, or Just Fellow Passengers. Arterioscler Thromb Vasc Biol, 2002. 22: p. 734-741.
86. Lehmann JM, M.D., Watson MA, Willson TM, Moore JT, Kliewer SA, Human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. J Clin Invest, 1998. 102: p. 1016- 1023.
87. El-Sankary W, G.G., Gibson, Aurton A., Plant N., Use of a Reporter Gene Assay to Predict and Rank the Potency and Efficacy of CYP3A4 Inducers. Drug Me. Dispos., 2001. 29: p. 1499-1504.
88. C. R. Pullinger, C.E., G. Salen, S, Shefer, A. K. Batta, S. K. Erickson, A. Verhagen, C. R. Rivera, S. J. Mulvihill, M. J. Malloy, and J. P. Kane, Human Cholesterol 7 Alpha-hydroxylase (CYP7A1) Deficiency Has a Hypercholesterolemic Phenotype. J. Clin. Invest., 2002. 110(1): p. 109-117.
89. S. Ishibashi, M., Schwarz, P. K. Frykman, J. Herz, and D. W. Russell, Disruption of Cholesterol 7 Alpha-hydroxylase Gene in Mice. J. Biol. Chem., 1996. 271(30): p. 18017-10823.
90. Crestani M., W.G.K.J.Y.Chiang., Effects of Bile Acid and Steroid/Thyroid Hormones on the Expression of Cholesterol 7 Alpha-hydroxylase mRNA and the 204
CYP7A gene in HepG2 cells. Biochem Biophys Res Commun, 1994. 198: p. 546- 553.
91. Pandak, W.M., Z.R. vlahcevic, D.M. Heuman, K.S. Redford, J.Y.L. Chiang, P.B. Hylemon, Effects of Different Bile Salts on Steady-state mRNA Levels and Transcriptional Activity of Cholesterol 7.ALPHA.-Hydroxylase. Hepatology, 1994. 19: p. 941-947.
92. Victor A. B. Drover, L.B.A., regulation of the human cholesterol 7 alpha- hydroxylase gene (CYP7A1) by thyroid Hormone in Transgenic mice. Endocrinology, 2004. 145(2): p. 574-581.
93. Charles D. Goodwin, B.W., Cooper, and Simeon Margolisg, Rat Liver Cholesterol 7 Alpha-hydroxylase. J. Biol. Chem., 1982. 257(8): p. 4469-4472.
94. A. Sanghvi, E., Grassi, V. Warty, W. Diven, C. Wight, R. Lester, Reversible Activation-Inactivation of Cholesterol 7 Alpha-hydroxylase Possibly Due to Phosphorylation-Dephosphorylation. BBRC, 1981. 103: p. 886-892.
95. T.J. Scallen and Sanghvi A., Regulation of Three Key Enzymes in Cholesterol Metabolism by Phosphorylation/Dephospjorylation. Proc. Natl. Acad. Sci., 1983. 80: p. 2477-2480.
96. Jelinek D. F., A.S., Slaughter C. A., and Russell D. W., J Biol Chem, 1990. 265: p. 8190-8197.
97. Noshiro M., N.M., Morohashi K., and Okuda K., FEBs Lett., 1989. 257: p. 97- 100.
98. Yan Chun Li, a.J.Y.L., Chiang, The Expression of a Catalytically Active Cholesterol 7 Alpha-Hydroxylase Cytochrome P450 in Escherichia coli J. Biol. Chem., 1991. 266(29): p. 19186-19191.
99. John Y. L. Chiang, W.F.M., Guey-Meei Lin, Regulation of Cholesterol 7- hydroxylase in the Liver: Purification of Cholesterol 7-hydroxylase and the immunochemical evidence for the induction of Cholesterol 7-hydroxylase by cholestyramine and circadian rhythm. The Journal of Biological Chemistry, 1990. 265(7): p. 3889-3897.
100. Sauter, G., F. Berr, U. Beuers, S. Fischer, and G. Paumgartner, Serum Concentrations of 7-hydroxy-4-cholesten-3-one Reflect Bile Acid Synthesis in Humans. Hepatology, 1996. 24: p. 123-126. 205
101. Hahn, C., C. Reichel, and K. von Bergmann, serum concentration of 7- hydroxycholesterol as an indicator of bile acid synthesis in human. J.Lipid Res, 1995. 36: p. 2059-2066.
102. Cecilia Gälman, I.A., Bo Angelin and Mats Rudling, Monitoring Hepatic Cholesterol 7 Alpha-hydroxylase Activity by Assay of The Stable Bile Acid Intermediate 7 Alpha-hydroxy-4-cholesten-3-one in Peripheral Blood. J. Lipid Res., 2003. 44: p. 859-866.
103. E. S. Benson, B.E., Hallaway, and R. W. Lumry, Deuterium-Hydrogen Exchange Analysis of pH-Dependant Transitions in Bovine Plasma Albumin. J. Biol. Chem., 1964. 239(1): p. 122-129.
104. J. Charoenteeraboon, K.N., W. B. Campbell, P. Piyachaturawat, P. Wilairat, P. Rongnoparut, Induction of Human Cholesterol 7 Alpha-hydroxylase in HepG2 cells by 2,4,6-trihydroxyacetophenone. Eur j Pharm., 2005. 515: p. 43-46.
105. R.T Stravitz, Z.R.V., E. C. Gurley, P. B. Hylemons, Basic and Clinical Advances, in: A.F. Hofmann, G. Paumgartner, A. Stiehl (Eds.), Kluwer, Dordrecht, Boston, London. bile acids in gastroenterology, 1995: p. 119-128.
106. Tiangang Li, A.J., and John Y.L. Chiang, Bile Acids and Cytokines inhibit the Human Cholesterol 7 -hydroxylase gene via the JNK/c-Jun Pathway in Human Liver Cells. Hepatology, 2006. 43: p. 1202-1210.
107. Lee G. D. Fryer, A.P.-P., and D. Carling, The Anti-diabetic Drugs Rosiglitazone and Metformin Stimulate AMP-activated Protein Kinase Through Distinct Signaling Pathways. J. Biol. Chem., 2002. 277(28): p. 25226-25232.
108. N. Mast, S.E., Graham, U. Andersson, I. Bjorkhem, C. Hill, J. Peterson, and I. A. Pikuleva, Cholesterol Binding to Cytochrome P450 7A1, a Key Enzyme in Bile Acid Biosynthesis. Biochemistry, 2005. 44: p. 3259-3271.
109. Hardie, D.G., and Carling, D., The AMP-activated Protein Kinase: Fuel Gauge of the Mammalian Cell? Eur. J. Biochem, 1997. 246: p. 259-273.
110. Hardie, D.G., Carling, D., and Carlson, M., The AMP-activated/SNF1 Protein Kinase Subfamily: Metabolic Sensors of the Eukaryotic Cell? Annu. Rev. Biochem, 1998. 67: p. 821-855.