DOCSLIB.ORG

Understanding Genetic Diversity of the Liver Fluke Fasciola Hepatica

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Understanding Genetic Diversity of the Liver Fluke Fasciola Hepatica Understanding Genetic Diversity of the Liver Fluke Fasciola hepatica Mine Dosay-Akbuluta,b,*, Alan Trudgettb, and Michael Stanhopeb,c a Afyon Kocatepe University, Veterinary Faculty, Medical Biology and Genetics Department, Afyon, Turkey. Fax: 00902281349. E-mail: [email protected] b Biology and Biochemistry, Quenn’s University of Belfast, Belfast, UK c Department of Population Medicine and Diagnostic Sciences, College of Veterinary Medicine, Cornell University, Ithaca, NY, USA * Author for correspondence and reprint requests Z. Naturforsch. 60c, 774Ð778 (2005); received January 19/March 8, 2005 Economical breeding is important to obtain maximum gain from the breeding in the animal sector. The economic loss has to be eliminated or should be minimized. The liver fluke, Fasciola hepatica, present mostly in sheep and dairy cattle affect the yield of animals and even cause their death. To eliminate or minimize the impact of these parasites on the animals, it is important to understand the genetic diversity of the liver fluke populations and the relationship between parasite and host at regional bases. This research was carried out to determine diversity by sequence analysis of the mitochondrial ND1 gene and ribosomal ITS1 region. Key words: Fluke, Mitochondrial DNA and Ribosomal ITS Introduction Very little molecular population genetics or phy- logeographic work has been conducted on Fasciola The liver fluke, Fasciola hepatica, is a major spp. The few studies, that have dealt with popula- cause of economic loss to the stock- raising indus- tion differences in isozymes, suggest that proteins try in temperate regions of the world. In parts of are unlikely to provide the level of resolution nec- NW Europe infection rates of the liver may reach essary to detect cryptic species or distinct evolu- 60% of sheep and dairy cattle (Garey and Wolsten- tionary lineages. Even less work has been con- holme, 1989). ducted on nucleic acid variation in liver flukes and Although infections are rarely lethal in cattle (as there are no published accounts of molecular phy- it can be in sheep) it is associated with a reduction logeography studies involving DNA data. in milk yields, failure to gain weight, and poor Little is known about genetic diversity and its quality meat. At present infections are controlled distribution within the parasite genus Fasciola. by periodic dosing of cattle and sheep with various Genetic diversity in the liver fluke might be associ- drugs. Fasciolisis is a re-emerging parasitic disease ated with resistance to flukicidal drugs or manifest that mostly effects the Fasciola hepatica and its itself in different host-parasite immune responses. most common snail host Limnae truncatula in the Either of these possibilities would have important Bolivian Altiplano, which has been introduced implications for the design of therapeutic strate- from Europe (Meunier et al., 2001). gies. Liver flukes are polymorphic and vary morpho- After eggs are passed to the outside with defin- logically depending upon the host. Specimens itive host faeces, a miracidium larvae hatch from from different hosts manifest differences far the egg and enter a snail (asexual reproduction) greater than those usually employed to distinguish developing to a cercaria larvae. Cercaria are re- between species of other flatworms. A range of leased and encyst on vegetation, known as meta- morphological types of Fasciola has been reported cercaria, which is ingested by the host. Sexual re- in southeast Asian countries as well as in South production occurs within the host, possibly America. These morphological variants, as well as hermaphroditically. the different definitive and intermediate hosts the The principal aim of this study is to provide a parasites inhabit, suggest the possibility that there thorough understanding of liver fluke genetic di- may be a complex of subspecific or distinct evolu- versity, as well as the distribution of that genetic tionary lineages within the currently classified spe- diversity, both in a phylogenetic and geographic cies Fasciola hepatica. context. 0939Ð5075/2005/0900Ð0774 $ 06.00 ” 2005 Verlag der Zeitschrift für Naturforschung, Tübingen · http://www.znaturforsch.com · D M. Dosay-Akbulut et al. · Genetic Diversity of F. hepatica 775 Materials and Methods in a range of other taxa for which it has been ex- amined. Complete sequences of mtDNA are cur- rently available from two nematodes, a crustacean, Ribosomal ITS (internal transcribed spacer) was two sea urchins (Echinoderm), two insects Ð Dro- chosen because it is known to evolve relatively sophila (fruit flies) and Apis (honey bee) Ð, a bird, rapidly, and the mt DNA ND1 gene in order to frog, carp (fish), human, and several other mam- provide a mtDNA comparison to the nuclear ITS mals. The gene organisation is conserved in verte- sequence, the ND1 gene and ribosomal ITS1 re- brates but differs in several invertebrate groups. gion were sequenced. ND1 was chosen because its The gene organisation in flatworms is not known. sequence is available, and thus we can easily de- In this study, we designed primers from the avail- sign PCR (polymerase chain reaction) primers to able sequence CO1 and ND1 gene of different amplify these regions from our populations. species, chosen as closest to the platyhelminthes, Furthermore, ND1 is known to be quite variable and used them to amplify the aimed part. ITS1 primer positions: 18-S3 F: 5Ј GTAGGTGAACCTGCGGAAGGATCATT 3Ј ITS1 5.8-S4 R: 5Ј TTCATCGATCCACGAGCCGAGTGAT 3Ј ITS1 5.8-S5 R: 5Ј GGTGTTCATGTGTCCTGCAGTTCACATT 3Ј ITS1 ND1 primer positions: 1F: 5Ј TTATTTGGG TTTAAGTAGGTT 3Ј ND1 790 F: 5Ј ACCGTACTCCATTGGATTATGCT 3Ј ND1 997 R: 5Ј TGCTACTTTACCTCGTGTTCGGTAT 3Ј ND1 3R: 5Ј TATGTGGCGTTATGCTCTTTTATT 3Ј ND1 The present source of genetic data is based on from each of two sheep, and four flukes from two DNA sequences derived from the mtDNA ND1 cows, 3 from a single cow and 1 from another one gene, as well as the ITS1 region of the ribosomal which are all collected from Northern Ireland; cistron. Both loci were solated using PCR. These these sequences came from the same liver flukes loci were chosen because of their high levels of that were sampled for ITS1. Apart from these, one variation in a wide range of other taxonomic cattle liver fluke was collected from North Amer- groups. Primers for ITS1 were based on conserved ica (Utah) and used as a single-sequence in phylo- regions at the 3Ј end of the 18-S gene and within genetic analysis for the ND1 gene only. the 5.8-S locus. Primers for the ND1 gene were A Perkin Elmer DNA Thermal Cycler 480 or based on the published sequence for this locus a PTC-100TM Programmable Thermal Controller from F. hepatica (Garey and Wolstenholme, 1989); (MJ Research, Inc, Waltham, USA) was used for the sequence reported in this preliminary report all PCR amplifications. After extraction of tissue starts at the 3Ј end of the gene. DNA sequences sample, the double-stranded genomic DNA was were obtained via direct sequencing methods, em- used in 30 cycles of PCR amplification: 5 min ini- ploying dye terminator cycle sequencing reactions tial denaturing at 94 ∞C, followed by 1 min at 94 ∞C that were subsequently loaded on an ABI auto- and either 1 min annealing at 50Ð55 ∞C, followed mated DNA sequencer. by 2 min extension at 65 ∞C or 3 min annealing All liver flukes sampled in this preliminary re- plus extension at 60Ð65 ∞C, after 30 cycle, in a fi- port came from sheep and cattle hosts in Northern nal 10 min extension at 65 ∞C. 50 µl reaction mix- Ireland. For the ND1 gene these sequences were ture contained 200 ng µlÐ1 of two external primers, also compared to the single available North Amer- 10 mm of each nucleotide (dATP, dCTP, dGTP and ican sequence for F. hepatica from cattle. All DNA dTTP) ultrapure dNTP set from Pharmacia Bio- extractions were conducted on single liver flukes, tech (Denver, USA), 17.5 mm MgCl2 and 1.75 U using proteinase K and 70% phenol/water/chloro- of Taq polymerase (Boehringer Mannheim, Ger- form. For ITS1, sequences were obtained for three many) or Taq polymerase (ExpandTM High Fidel- liver flukes from each of two cattle and two sheep ity PCR system, Boehringer Mannheim) and at hosts, for a total of 12 sequences. For ND1, a total least 300 ng genomic DNA. After the first PCR to of 11 sequences were obtained, including 3 flukes estimate the size of the amplified fragment, this 776 M. Dosay-Akbulut et al. · Genetic Diversity of F. hepatica PCR product was run out on a 0.7% agarose gel, Results stained with ethidium bromide, visualised under low intensity ultraviolet light and photographed. Jukes and Cantor (1969) distances for the ND1 After determination of the approx. size of this gene ranged from 0.011 to 0.062 (approx. 1Ð6% fragment, the PCR sample was run on a 1% low sequence divergence) and for the ITS1 gene from melt agarose gel. Then the band was visualised un- 0.010 to 0.068 (approx. 1Ð7% sequence diver- der low intensity ultraviolet light, excised and gence). Neighbour-joining trees constructed from melted in a 65 ∞C heating block. This excised am- these divergence matrices did not show a mono- plified band was amplified again with the same phyletic grouping of sheep liver or of cattle liver PCR technique by using the same or internal flukes (Figs. 1 and 2). Furthermore, the ND1 se- primers. The final fragments were purified for se- quence of the North American cattle liver fluke quence by using a high- pure PCR product purifi- was not anymore divergent from either cattle or cation kit, according to the manufacturer’s instruc- sheep liver flukes from Northern Ireland, with se- tion. quence divergence figures involving this North The cycle sequence reaction was carried out American fluke ranging from 0.011 to 0.042.
Load more

Recommended publications
  • Round-Lobed Hepatica (Anemone Americana) – Wooly Harbinger of Spring
    Round-lobed Hepatica (Anemone americana) – Wooly Harbinger of Spring Did you Know? Hepaticas are one of the first flowers to bloom in Spring. Native Americans used a tea derived from the leaves to cure a number of ailments. Hepaticas are poisonous in large doses. They can also be irritating to the skin if handled. Photo : 2013 Brian Popelier Habitat – Upland woods and forests, deciduous forests Size – 70-170 cm in height Range – Manitoba, Ontario and Quebec south into the eastern United States Flowering Date – March - May Status – S5/ Common in Ontario Other Common Names – Liverleaf, Snow Trillium, Blue Anemone, Kidneywort The Bruce Trail Conservancy | PO Box 857 Hamilton, ON L8N 3N9 | 1.800.665.4453 | [email protected] Identification: Purple, pink or white six - ten petaled flowers sit atop a single, leafless stem covered in wooly hairs. Flowers often found in clumps. The leaves are distinct with three lobes ending in a rounded tip. The flower stocks are upright standing over the flattened basal leaves. The leaves are light green at first but turn a purplish, wine colour as the season wears on and can often be seen standing out from the snow in the winter. Photo : 2013 Brian Popelier Interesting Facts The plant gets its name from the leathery purple-brown basal leaves, which resemble the shape of the liver. Many early herbalists believed that the shape of the plant determined its usefulness in the treatment of liver ailments. Bees and flies are the primary pollinators. The plant uses ants to distribute their seeds. As the seeds drop ants pick them up and disperse the seeds to other areas.
    [Show full text]
  • Ranunculaceae) for Asian and North American Taxa
    Mosyakin, S.L. 2018. Further new combinations in Anemonastrum (Ranunculaceae) for Asian and North American taxa. Phytoneuron 2018-55: 1–11. Published 13 August 2018. ISSN 2153 733X FURTHER NEW COMBINATIONS IN ANEMONASTRUM (RANUNCULACEAE) FOR ASIAN AND NORTH AMERICAN TAXA SERGEI L. MOSYAKIN M.G. Kholodny Institute of Botany National Academy of Sciences of Ukraine 2 Tereshchenkivska Street Kiev (Kyiv), 01004 Ukraine [email protected] ABSTRACT Following the proposed re-circumscription of genera in the group of Anemone L. and related taxa of Ranunculaceae (Mosyakin 2016, Christenhusz et al. 2018) and based on recent molecular phylogenetic and partly morphological evidence, the genus Anemonastrum Holub is recognized here in an expanded circumscription (including Anemonidium (Spach) Holub, Arsenjevia Starod., Tamuria Starod., and Jurtsevia Á. Löve & D. Löve) covering members of the “Anemone ” clade with x=7, but excluding Hepatica Mill., a genus well outlined morphologically and forming a separate subclade (accepted by Hoot et al. (2012) as Anemone subg. Anemonidium (Spach) Juz. sect. Hepatica (Mill.) Spreng.) within the clade earlier recognized taxonomically as Anemone subg. Anemonidium (sensu Hoot et al. 2012). The following new combinations at the section and subsection ranks are validated: Anemonastrum Holub sect. Keiskea (Tamura) Mosyakin, comb. nov . ( Anemone sect. Keiskea Tamura); Anemonastrum [sect. Keiskea ] subsect. Keiskea (Tamura) Mosyakin, comb. nov .; Anemonastrum [sect. Keiskea ] subsect. Arsenjevia (Starod.) Mosyakin, comb. nov . ( Arsenjevia Starod.); and Anemonastrum [sect. Anemonastrum ] subsect. Himalayicae (Ulbr.) Mosyakin, comb. nov. ( Anemone ser. Himalayicae Ulbr.). The new nomenclatural combination Anemonastrum deltoideum (Hook.) Mosyakin, comb. nov . ( Anemone deltoidea Hook.) is validated for a North American species related to East Asian Anemonastrum keiskeanum (T.
    [Show full text]
  • Etude Sur L'origine Et L'évolution Des Variations Florales Chez Delphinium L. (Ranunculaceae) À Travers La Morphologie, L'anatomie Et La Tératologie
    Etude sur l'origine et l'évolution des variations florales chez Delphinium L. (Ranunculaceae) à travers la morphologie, l'anatomie et la tératologie : 2019SACLS126 : NNT Thèse de doctorat de l'Université Paris-Saclay préparée à l'Université Paris-Sud ED n°567 : Sciences du végétal : du gène à l'écosystème (SDV) Spécialité de doctorat : Biologie Thèse présentée et soutenue à Paris, le 29/05/2019, par Felipe Espinosa Moreno Composition du Jury : Bernard Riera Chargé de Recherche, CNRS (MECADEV) Rapporteur Julien Bachelier Professeur, Freie Universität Berlin (DCPS) Rapporteur Catherine Damerval Directrice de Recherche, CNRS (Génétique Quantitative et Evolution Le Moulon) Présidente Dario De Franceschi Maître de Conférences, Muséum national d'Histoire naturelle (CR2P) Examinateur Sophie Nadot Professeure, Université Paris-Sud (ESE) Directrice de thèse Florian Jabbour Maître de conférences, Muséum national d'Histoire naturelle (ISYEB) Invité Etude sur l'origine et l'évolution des variations florales chez Delphinium L. (Ranunculaceae) à travers la morphologie, l'anatomie et la tératologie Remerciements Ce manuscrit présente le travail de doctorat que j'ai réalisé entre les années 2016 et 2019 au sein de l'Ecole doctorale Sciences du végétale: du gène à l'écosystème, à l'Université Paris-Saclay Paris-Sud et au Muséum national d'Histoire naturelle de Paris. Même si sa réalisation a impliqué un investissement personnel énorme, celui-ci a eu tout son sens uniquement et grâce à l'encadrement, le soutien et l'accompagnement de nombreuses personnes que je remercie de la façon la plus sincère. Je remercie très spécialement Florian Jabbour et Sophie Nadot, mes directeurs de thèse.
    [Show full text]
  • Bovine Fascioliasis with Emphasis on Fasciola Hepatica
    PEER REVIEWED Bovine fascioliasis with emphasis on Fasciola hepatica Gary L. Zimmerman, MS, PhD, DVM 1106 West Park 424, Livingston, MT 59047 Corresponding author: Gary L. Zimmerman, [email protected], 406-223-3704 Abstract over 135 million years, with the divergent evolution of Fasciola hepatica and F. gigantica occurring ap­ Fasciola hepatica, the common liver fluke, is an proximately 19 million years ago. 14 In the continental economically important parasite of ruminants. Although United States, Fasciola hepatica is the most common and infections in cattle are generally chronic and sub-clinical, economically important fluke infecting domestic large the overall impacts on health and productivity can be and small ruminants. The related species F. gigantica, significant, including decreased feed efficiency, weight which is common worldwide, has also been reported in 24 32 gain, reproductive rates, immunity, immunodiagnostic the southeastern United States. • Fascioloides magna, tests, and responses to vaccinations. Acute infections normally a parasite of deer, elk, and moose, also occurs can occur in cattle, but are more common in sheep. There in cattle as an incidental finding at necropsy or slaugh­ 9 38 are no pathognomonic signs of fascioliasis. Fecal ex­ ter, whereas in sheep it is often fatal. • Previously aminations using sedimentation or filtration techniques reported to infect Bison bison, recent research efforts remain the most commonly used diagnostic tools. In the to experimentally infect bison with Fascioloides magna United States, albendazole and a combined clorsulon/ have not been successful.10,38 Dicrocoelium dendriticum ivermectin formulation are the only currently approved is a smaller and less pathogenic liver fluke ofruminants products for treatment of liver flukes.
    [Show full text]
  • Anemone Acutiloba – Hepatica
    Friends of the Arboretum Native Plant Sale Anemone acutiloba – Hepatica COMMON NAME: Hepatica, Sharp-lobed hepatica SCIENTIFIC NAME: Anemone acutiloba – the Greek word anemos is wind and acutiloba refers to the pointed leaves. The common name of hepatica comes from the fancied resemblance of the 3-lobed leaves to the liver. FLOWER: white, pink, lavender with six (usually) petal-like sepals. The color tends to fade with age. BLOOMING PERIOD: April, but maybe March with global warming! This is one of the earliest spring flowers. SIZE: 4 to 6 inches BEHAVIOR: This is a perennial herb with its distinctive 3-lobed leaves and fibrous roots. It will spread from seed and should be divided in fall. SITE REQUIREMENTS: Does best in rich, moist soil and dense shade of maple forests, but tolerates less shady habitats and drier, rocky soils. Look for it on steep, rocky hillsides and steep banks of creeks. NATURAL RANGE; Nova Scotia to northern Florida, west to Manitoba, Iowa, Missouri and even in Alaska. In Wisconsin it is more common in the southern 2/3 of the state. SPECIAL FEATURES: Old leaves may still be present in early spring, but will be looking kind of coppery. Then furry stems unfurl and hold the fragrant pastel flowers. The new leaves appear after flowering and will remain sort of green until the following spring. SUGGESTED CARE: Provide ample water in spring and fall, especially the first few years. Cover in winter with light mulch of maple leaves, but remove the mulch in mid to late March. COMPANION PLANTS: trillium, Solomon’s plume, toothwort, Dutchman’s breeches, spring beauty, wild geranium, bloodroot, troutlily, bedstraw, rue anemone SPECIAL NOTE: There is a similar specials, Anemone Americana, with round-lobed leaves.
    [Show full text]
  • Hepatica Acutiloba DC. Hepatica, Sharp-Lobed Hepatica, Liverleaf, Liverwort
    Kasey Hartz Natural Area Reference Sheet Hepatica acutiloba DC. Hepatica, sharp-lobed hepatica, liverleaf, liverwort. Ranunculaceae (Buttercup Family) Blooming season: March-early May. Plant: Fibrous rooted perennial. Low, to 23 cm. Unbranched, all stems arising from a central point, forming a rosette. Reported to prefer calcareous soils, but tolerant of acid. Leaves: Three-lobed leaves, with pointed tips to lobes; leaves about 10cm across. Sometimes with additional small lobes (up to total of 7). Persistent through winter with a maroonish/brownish color, lying flat on the ground instead of standing up. Involucral bracts are pointed, looking somewhat like sepals, but distinct from flower. New leaves appear after flowers. Flower: Sepals, the colored parts, vary in number from 6-12, usually 6-8. White, pink, and lavender flowers borne singly on hairy leafless stems. Hairs “directed backward along stems and leafstalks” (Rickett 1966, p. 126). Plants with different colors may grow together. Flowers close at night and on very dark days. One of earliest spring flowers. Fruit: Achene. Can be confused with: Hepatica americana (DC.) Ker, but leaf lobes and involucre of that species are rounded and the hairs on the stem point up. The two species do hybridize to some extent if found in the same area. Kasey Hartz Natural Area Reference Sheet Hepatica acutiloba DC. Hepatica, sharp-lobed hepatica, liverleaf, liverwort 2 Geographic range: Type specimen location: State: Throughout the Lower Peninsula; central and far western portions of the Upper Peninsula. Regional: Nova Scotia to Manitoba, south to Florida, Alabama, Missouri. Habitat: Local: rich woods Regional: “Almost entirely restricted to beech-maple woods” and in rich soils (Voss 1985, p.
    [Show full text]
  • Bloodroot (Sanguinaria Canadensis) • FACU Plant Family: Poppy (Papaveraceae)
    BWSR Featured Plant Statewide Wetland Indicator Status: • FACU Name: Bloodroot (Sanguinaria canadensis) Plant Family: Poppy (Papaveraceae) Emerging as early as March from last fall’s bed of leaves, bloodroot is one of the first signs of spring across Minnesota. Named for the red sap in its roots, it was once used as a dye by Native American artists and in the natural dying of yarn and fabrics. Roots and rhizomes are toxic to touch, so should be handled with gloves and no part of the plant should be ingested. A single flowering stem grows from the ground, encircled by a single 3-5” wide leaf. Typically found in wooded areas, flowers require some sun to bloom and must do so before towering trees sprout leaves and shade the forest floor. Once bloomed, leaves will unfurl and the fragrant flowers lasts only 1-2 days, closing at night – traits typical to the poppy family of plants. Leaves will persist throughout the growing season. Identification Leaves are basal only (growing from the root and not from stems). They are Bee on bloodroot flower oval to round in outline with 5-9 major lobes and several minor lobes. The Photo Amy Workman leaf is smooth with a radiating network of veins. The greyish-blue green leaves, with a whitish green underside, can grow from 3-12” tall and 3-5” across. The white flowers grow from reddish to green flower stalks and measure 1 ½-3” across and typically have 8-12 petals and many dark yellow- tipped stamens. Double flowers sometimes occur. Range Bloodroot is native north to Nova Scotia and south to Florida, from eastern United States to the Great Plains region.
    [Show full text]
  • Notes on South-East Asian Limacodidae (Lepidoptera, Zygaenoidea) with One New Genus and Eleven New Species
    Notes on South-East Asian Limacodidae (Lepidoptera, Zygaenoidea) with one new genus and eleven new species Alexey V. Solovyev Eleven new species of Limacodidae from South-East Asia are described here as new: Barisania honeyi sp. n. from central Myanmar, northern and central Vietnam and central Thailand, Pseudaltha eboris sp. n., from northern Thailand, P. sapa sp. n., from northern Vietnam and northern Thailand, Austrapoda seres sp. n. from China (Chekiang and Shaanxi), Euphlyctinides indi sp. n. from India, E. aeneola sp. n. from northern and western Thailand, Pseudonagoda siniaevi sp. n. from southern Andaman, Atosioides accola sp. n. from western Sumatra and southern Thailand, Pseudidonauton siamica sp. n. from northern Thailand and central Vietnam, P. chihpyh sp. n. from Taiwan and P. vexa sp. n. from central Vietnam and south- eastern Thailand. The genus Atosioides Solovyev is erected here with type-species Atosia rochei Holloway, 1986. Brief morphological reviews of all examined genera are given. All diagnostic features are illustrated. Alexey V. Solovyev, Zoology Department, Ulyanovsk State Pedagogical University, Ulyanovsk, RUS-432700, Russia. E-mail: [email protected] Introduction recognition of a new genus, Atosioides Solovyev, This article is devoted to the description and mor- gen. n. with type-species Atosia rochei Holloway, phological review of seven small and poorly known 1986. limacodid genera from South-East Asia: Barisania Holloway, 1990, Pseudaltha Hering, 1931, Austrap- oda Inoue, 1982, Euphlyctinides Hering, 1931, Pseu- Material and methods donagoda Holloway, 1990, Pseudidonauton Hering, The material from the MWM is the basis for this 1931, and Atosioides Solovyev, gen. n. (Figs 1–24).
    [Show full text]
  • Hepatica Display at the Chelsea Flower Show
    Part of the Ashwood Nurseries’ Hepatica display at the Chelsea Flower Show 50 Rock Garden Quarterly Vol. 76 (1) A Journey Up the Rocky Road of Hepatica GLENN SHAPIRO HEPATICAS ARE ONE of the most stunningly beautiful early spring flowers, coming in a spectacular range of colors. A snow melt plant of mountain woodlands, hepaticas often grow on the side of village footpaths of local communities in every continent of the Northern Hemisphere, but sadly not in England or the rest of the United Kingdom. Perhaps that is one reason why I love and appreciate them all so much and decided to dedicate myself to growing them. Recently, hepaticas gained a huge boost to their popularity since Ashwood Nurseries won not only a gold medal but the ‘Diamond Jubilee Award,’ the very top award in the Floral Marquee, for their exhibit at Chelsea Flower Show in May 2016. This was the first, and possibly the last, time that hepaticas have been exhibited at Chelsea. This award was an extremely well-deserved appreciation of the huge amount of work and skill required to exhibit perfect early-spring flowering mountain plants out of season, something those of us who were lucky enough to see will never forget. The display was the incarnation of a lifelong dream of the nursery’s owner, John Massey, our doyen of Hepatica, and a wonderful source of help and inspiration to me. Hepatica (named for the liver-shaped leaves, once thought to be of medicinal value for liver diseases) is a member of my favorite plant family Ranunculaceae, the buttercups.
    [Show full text]
  • Hepatica. Liverwort Liver-Leaf Anemone Acutiloba
    BUTTERCUP FAMILY RANUNCULACEAE Hepatica. Liverwort Liver-leaf Anemone acutiloba Found in April and May, on hillsides, along the edge of woods, and in rocky ground The leaf-stems and flower-stems rise from the ground to the height of 4 or 6 inches The leaf is heart-shaped, and 3-lobed, of a tough, strong fibre that often survives the winter. Its color is dark green above and dull violet beneath. The beautiful flower is composed of 6 to 9 petal-like calyx-parts, of an oval shape, and thin texture, whose color varies from light to dark violet, and from lavender-tinted white to a very pink-lavender, or lilac ; the sta- mens are many, and thread-like, and of a pale straw color. Close beneath the flower are 3 reddish-brown, downy little leaves, bearing the semblance of a calyx. The flower is set on a slender, very downy stem, which springs from amidst the leaves. The harmony of color in this plant as seen in the flower and leaf is striking, a preponderance of violet showing throughout. It is very downy, the young leaves being covered with long silky hairs. The numerous half- opened flowers and buds are slightly nodding, but become more erect when fully spread in the sunlight. The Hepatica is often frequented by small lavender butterflies, in size and color resembling the blossoms, when they rise and flutter in the soft spring ail’, it is as though the flowers them- selves are taking flight. Photo credits: kbarton Text and drawing excerpted from Wildflowers from the North-Eastern States by Ellen Miller and Margaret Christine Whiting, 1895 Nomenclature and Families updated.
    [Show full text]
  • By Don Jacobs 45
    Bulletin of the American Rock Garden Society Volume 49 Number 1 Winter 1991 Cover: Hepatica americana Watercolor by Vickie Danielsen of Englewood, Colorado Bulletin of the American Rock Garden Society Features Saga of a Woodland Garden, by Harold Epstein 3 Fatal Treatments of Seed, by Norman C. Deno 11 Hepaticas and Anemonellas, by Jeanie Vesall 21 Preparing a Plant for the Farrer Medal, by Jack Elliott 29 Stonecrop in the Nineties, by Frank Cabot 33 The Puzzle of the Eastern Foamflowers, by Don Jacobs 45 Alpine Nurseries of the United Kingdom, by Paul H. Halladin 53 Variations in Aquilegia jonesii, by Jerry DeSanto 60 Gardening in Old Age, by Geoffrey Charlesworth 66 Departments Books 68 Obituaries 69 Tsuga canadensis 'Cole's Prostrate' photo by Harold Epstein 2 Bulletin of the American Rock Garden Society Vol. 49(1) Saga of a Woodland Garden by Harold Epstein I he saga of our garden begins in Rock Garden (1935), and Adventures the spring of 1937, when my wife, with Hardy Bulbs (1936). British publi• Esta, and I purchased our present home cations were also suggested, but the situated in the woodlands of rocky librarian's advice was to concentrate on Larchmont, a yachting center in experienced United States authors. The Westchester, suburb of New York City. books we found that day were to Our new home was in a dense forest of remain major reference sources for oaks amid huge rock outcrops. We did many years. not realize the challenge we confronted Next we consulted with Thomas H. in taming this wild, rough parcel of Everett, who was then supervising the land.
    [Show full text]
  • Endoparasites of the Siberian Tiger (Panthera Tigris Altaica)
    REVIEW Endoparasites of the Siberian tiger (Panthera tigris altaica) Running title: Endoparasites of the Siberian tiger Tatyana V. Moskvina 1, Michail Yu.Shchelkanov 1,2,3, Mariya A. Begun 1 1 Far Eastern Federal University, Sukhanova, 8, Vladivostok, Primorsky krai, 690091 Russia. e-mail: [email protected] 2 Federal Scientific Center of Terrestrial Biodiversity of Eastern Asia, Far Eastern Branch of Russian Academy of Sciences, Stoletiya Vladivostoku, 159/1, Vladivostok, Primorsky krai, 690022 Russia. 3 National Scientific Center of Marine Biology, Far Eastern Branch of Russian Academy of Sciences, Palchevskogo, 17, Vladivostok, Primorsky Krai, 690041 Russia; e-mail: [email protected] Corresponding author: Tatyana Moskvine; e-mail: [email protected] Author's contribution All authors work equally on the manuscript. Both authors read and approved the final version of the manuscript. Abstract There have been few reports on the diversity and prevalence of parasitic fauna of the endangered Siberian tiger, which inhabits the territory of the Russian Far East. The present review attempts to summarize the information about the parasitic fauna of wild Siberian tigers, which includes 15 helminths and 3 protozoan species. The most prevalent parasitic species was found to be Toxocara cati, followed by Toxascaris leonina. Another commonly recorded Platyhelminth species is Paragonimus westermani, which causes a lethal infection of the lung parenchyma in Siberian tigers. However, the information about infections by this fluke in the Siberian tigers is scarce, although P. westermani infections pose a serious health hazard to tiger populations. The nematodes Aelurostrongylus abstrusus and Thomix aerophilus are found in Siberian tigers with an occurrence rate of 2.3% and 19%, respectively.
    [Show full text]