Understanding Genetic Diversity of the Liver Fluke Fasciola hepatica Mine Dosay-Akbuluta,b,*, Alan Trudgettb, and Michael Stanhopeb,c a Afyon Kocatepe University, Veterinary Faculty, Medical Biology and Genetics Department, Afyon, Turkey. Fax: 00902281349. E-mail: [email protected] b Biology and Biochemistry, Quenn’s University of Belfast, Belfast, UK c Department of Population Medicine and Diagnostic Sciences, College of Veterinary Medicine, Cornell University, Ithaca, NY, USA * Author for correspondence and reprint requests Z. Naturforsch. 60c, 774Ð778 (2005); received January 19/March 8, 2005 Economical breeding is important to obtain maximum gain from the breeding in the animal sector. The economic loss has to be eliminated or should be minimized. The liver fluke, Fasciola hepatica, present mostly in sheep and dairy cattle affect the yield of animals and even cause their death. To eliminate or minimize the impact of these parasites on the animals, it is important to understand the genetic diversity of the liver fluke populations and the relationship between parasite and host at regional bases. This research was carried out to determine diversity by sequence analysis of the mitochondrial ND1 gene and ribosomal ITS1 region. Key words: Fluke, Mitochondrial DNA and Ribosomal ITS Introduction Very little molecular population genetics or phy- logeographic work has been conducted on Fasciola The liver fluke, Fasciola hepatica, is a major spp. The few studies, that have dealt with popula- cause of economic loss to the stock- raising indus- tion differences in isozymes, suggest that proteins try in temperate regions of the world. In parts of are unlikely to provide the level of resolution nec- NW Europe infection rates of the liver may reach essary to detect cryptic species or distinct evolu- 60% of sheep and dairy cattle (Garey and Wolsten- tionary lineages. Even less work has been con- holme, 1989). ducted on nucleic acid variation in liver flukes and Although infections are rarely lethal in cattle (as there are no published accounts of molecular phy- it can be in sheep) it is associated with a reduction logeography studies involving DNA data. in milk yields, failure to gain weight, and poor Little is known about genetic diversity and its quality meat. At present infections are controlled distribution within the parasite genus Fasciola. by periodic dosing of cattle and sheep with various Genetic diversity in the liver fluke might be associ- drugs. Fasciolisis is a re-emerging parasitic disease ated with resistance to flukicidal drugs or manifest that mostly effects the Fasciola hepatica and its itself in different host-parasite immune responses. most common snail host Limnae truncatula in the Either of these possibilities would have important Bolivian Altiplano, which has been introduced implications for the design of therapeutic strate- from Europe (Meunier et al., 2001). gies. Liver flukes are polymorphic and vary morpho- After eggs are passed to the outside with defin- logically depending upon the host. Specimens itive host faeces, a miracidium larvae hatch from from different hosts manifest differences far the egg and enter a snail (asexual reproduction) greater than those usually employed to distinguish developing to a cercaria larvae. Cercaria are re- between species of other flatworms. A range of leased and encyst on vegetation, known as meta- morphological types of Fasciola has been reported cercaria, which is ingested by the host. Sexual re- in southeast Asian countries as well as in South production occurs within the host, possibly America. These morphological variants, as well as hermaphroditically. the different definitive and intermediate hosts the The principal aim of this study is to provide a parasites inhabit, suggest the possibility that there thorough understanding of liver fluke genetic di- may be a complex of subspecific or distinct evolu- versity, as well as the distribution of that genetic tionary lineages within the currently classified spe- diversity, both in a phylogenetic and geographic cies Fasciola hepatica. context. 0939Ð5075/2005/0900Ð0774 $ 06.00 ” 2005 Verlag der Zeitschrift für Naturforschung, Tübingen · http://www.znaturforsch.com · D M. Dosay-Akbulut et al. · Genetic Diversity of F. hepatica 775 Materials and Methods in a range of other taxa for which it has been ex- amined. Complete sequences of mtDNA are cur- rently available from two nematodes, a crustacean, Ribosomal ITS (internal transcribed spacer) was two sea urchins (Echinoderm), two insects Ð Dro- chosen because it is known to evolve relatively sophila (fruit flies) and Apis (honey bee) Ð, a bird, rapidly, and the mt DNA ND1 gene in order to frog, carp (fish), human, and several other mam- provide a mtDNA comparison to the nuclear ITS mals. The gene organisation is conserved in verte- sequence, the ND1 gene and ribosomal ITS1 re- brates but differs in several invertebrate groups. gion were sequenced. ND1 was chosen because its The gene organisation in flatworms is not known. sequence is available, and thus we can easily de- In this study, we designed primers from the avail- sign PCR (polymerase chain reaction) primers to able sequence CO1 and ND1 gene of different amplify these regions from our populations. species, chosen as closest to the platyhelminthes, Furthermore, ND1 is known to be quite variable and used them to amplify the aimed part. ITS1 primer positions: 18-S3 F: 5Ј GTAGGTGAACCTGCGGAAGGATCATT 3Ј ITS1 5.8-S4 R: 5Ј TTCATCGATCCACGAGCCGAGTGAT 3Ј ITS1 5.8-S5 R: 5Ј GGTGTTCATGTGTCCTGCAGTTCACATT 3Ј ITS1 ND1 primer positions: 1F: 5Ј TTATTTGGG TTTAAGTAGGTT 3Ј ND1 790 F: 5Ј ACCGTACTCCATTGGATTATGCT 3Ј ND1 997 R: 5Ј TGCTACTTTACCTCGTGTTCGGTAT 3Ј ND1 3R: 5Ј TATGTGGCGTTATGCTCTTTTATT 3Ј ND1 The present source of genetic data is based on from each of two sheep, and four flukes from two DNA sequences derived from the mtDNA ND1 cows, 3 from a single cow and 1 from another one gene, as well as the ITS1 region of the ribosomal which are all collected from Northern Ireland; cistron. Both loci were solated using PCR. These these sequences came from the same liver flukes loci were chosen because of their high levels of that were sampled for ITS1. Apart from these, one variation in a wide range of other taxonomic cattle liver fluke was collected from North Amer- groups. Primers for ITS1 were based on conserved ica (Utah) and used as a single-sequence in phylo- regions at the 3Ј end of the 18-S gene and within genetic analysis for the ND1 gene only. the 5.8-S locus. Primers for the ND1 gene were A Perkin Elmer DNA Thermal Cycler 480 or based on the published sequence for this locus a PTC-100TM Programmable Thermal Controller from F. hepatica (Garey and Wolstenholme, 1989); (MJ Research, Inc, Waltham, USA) was used for the sequence reported in this preliminary report all PCR amplifications. After extraction of tissue starts at the 3Ј end of the gene. DNA sequences sample, the double-stranded genomic DNA was were obtained via direct sequencing methods, em- used in 30 cycles of PCR amplification: 5 min ini- ploying dye terminator cycle sequencing reactions tial denaturing at 94 ∞C, followed by 1 min at 94 ∞C that were subsequently loaded on an ABI auto- and either 1 min annealing at 50Ð55 ∞C, followed mated DNA sequencer. by 2 min extension at 65 ∞C or 3 min annealing All liver flukes sampled in this preliminary re- plus extension at 60Ð65 ∞C, after 30 cycle, in a fi- port came from sheep and cattle hosts in Northern nal 10 min extension at 65 ∞C. 50 µl reaction mix- Ireland. For the ND1 gene these sequences were ture contained 200 ng µlÐ1 of two external primers, also compared to the single available North Amer- 10 mm of each nucleotide (dATP, dCTP, dGTP and ican sequence for F. hepatica from cattle. All DNA dTTP) ultrapure dNTP set from Pharmacia Bio- extractions were conducted on single liver flukes, tech (Denver, USA), 17.5 mm MgCl2 and 1.75 U using proteinase K and 70% phenol/water/chloro- of Taq polymerase (Boehringer Mannheim, Ger- form. For ITS1, sequences were obtained for three many) or Taq polymerase (ExpandTM High Fidel- liver flukes from each of two cattle and two sheep ity PCR system, Boehringer Mannheim) and at hosts, for a total of 12 sequences. For ND1, a total least 300 ng genomic DNA. After the first PCR to of 11 sequences were obtained, including 3 flukes estimate the size of the amplified fragment, this 776 M. Dosay-Akbulut et al. · Genetic Diversity of F. hepatica PCR product was run out on a 0.7% agarose gel, Results stained with ethidium bromide, visualised under low intensity ultraviolet light and photographed. Jukes and Cantor (1969) distances for the ND1 After determination of the approx. size of this gene ranged from 0.011 to 0.062 (approx. 1Ð6% fragment, the PCR sample was run on a 1% low sequence divergence) and for the ITS1 gene from melt agarose gel. Then the band was visualised un- 0.010 to 0.068 (approx. 1Ð7% sequence diver- der low intensity ultraviolet light, excised and gence). Neighbour-joining trees constructed from melted in a 65 ∞C heating block. This excised am- these divergence matrices did not show a mono- plified band was amplified again with the same phyletic grouping of sheep liver or of cattle liver PCR technique by using the same or internal flukes (Figs. 1 and 2). Furthermore, the ND1 se- primers. The final fragments were purified for se- quence of the North American cattle liver fluke quence by using a high- pure PCR product purifi- was not anymore divergent from either cattle or cation kit, according to the manufacturer’s instruc- sheep liver flukes from Northern Ireland, with se- tion. quence divergence figures involving this North The cycle sequence reaction was carried out American fluke ranging from 0.011 to 0.042.