ENGRAILED IS REQUIRED IN MATURING SEROTONIN NEURONS TO
REGULATE THE CYTOARCHITECTURE AND SURVIVAL OF THE DORSAL
RAPHE NUCLEUS
by
STEPHANIE R. FOX
Submitted in partial fulfillment of the requirements
For the degree of Doctor of Philosophy
Dissertation Advisor: Dr. Evan S. Deneris
Department of Neurosciences
CASE WESTERN RESERVE UNIVERSITY
August 2012 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of
Stephanie R. Fox .
candidate for the Doctor of Philosophy degree*.
(signed) Jerry Silver . (chair of the committee)
Evan Deneris .
Heather Broihier .
Stephen Maricich .
(date) 5/21/2012 .
*We also certify that written approval has been obtained for any proprietary material contained within.
Table of contents
List of tables ...... 4
List of figures ...... 5
Abstract ...... 7
Chapter 1 - Introduction to the central serotonin system and engrailed transcription factors ...... 9
Central serotonin system ...... 9
5-HT neuron identity ...... 11
Molecular control of 5-HT neuron development ...... 16
Setting up the A-P axis – Mid-hindbrain organizer ...... 17
D-V patterning ...... 22
Neurogenesis ...... 23
Terminal differentiation ...... 27
Maturation and maintenance ...... 31
Developmental neuroanatomy ...... 33
Cell body movements and formation of the 5-HT nuclei ...... 34
Formation of ascending and descending projections ...... 35
5-HT transcriptional network and components - relevance to human
health ...... 38
Maternal care ...... 40
Mood and emotional behaviors ...... 41
Neurodevelopment–implications for autism spectrum disorder . 44
1
Engrailed ...... 47
Roles in the CNS ...... 49
Tissue patterning ...... 50
Fate selection/ terminal cell type generation ...... 53
Cell survival ...... 57
Axon guidance ...... 58
Engrailed and mental health ...... 61
Aims of thesis ...... 64
Chapter 2-Engrailed is required in maturing serotonin neurons to regulate the cytoarchitecture and survival of the dorsal raphe nucleus ...... 75
Summary ...... 76
Introduction ...... 77
Materials and methods ...... 79
Results ...... 87
En1 and En2 are expressed in postmitotic 5-HT neurons...... 87
Conditional targeting of En in maturing 5-HT neurons ...... 89
Engrailed controls maturation of DRN cytoarchitecture ...... 90
Engrailed is required for perinatal maintenance of serotonergic
neuron identity...... 94
En1/2 deficiency causes 5-HT neuron cell death postnatally .... 98
En1/25HTCKO dams display mild deficits in pup rearing ...... 99
Discussion ...... 102
2
Chapter 3- Effect of genetic background on serotonergic system
development and the Pet-1-/- phenotype ...... 131
Summary ...... 132
Introduction ...... 133
Materials and methods ...... 135
Results ...... 139
Comparison of C57BL/6, SJL and wild-type 129/Sv*C57BL/6 139
Interaction between Pet-1 expression and background ...... 140
Reduced pup survival from C57BL/6-Pet-1-/- dams ...... 142
Discussion ...... 144
Chapter 4- Discussion ...... 156
5-HT neurogenesis...... 158
Cell migration and DRN formation ...... 159
Maintenance of 5-HT neuron identity ...... 164
Cell survival ...... 167
Axon projections ...... 173
Behavior consequences of conditional En1/2 ablation ...... 175
Final thoughts ...... 176
References ...... 179
3
List of tables
Chapter 2
Table. Summary of pup survival ...... 155
4
List of figures
Chapter 1
Figure 1. Major components of 5-HT neuron identity ...... 67
Figure 2. Determinants important for the development of 5-HT
neurons ...... 69
Figure 3. Neuroanatomical origins of 5-HT neurons ...... 71
Figure 4. Engrailed is highly conserved amongst species and
paralogs ...... 73
Chapter 2
Figure 1. Mating strategies for generation of each of the genotypes used
in analyses ...... 108
Figure 2. Spatiotemporal expression patterns of En1 and En2 in the rostral
hindbrain ...... 110
Figure 3. En1 expression in 5-HT neurons is maintained
postnatally ...... 112
Figure 4. Conditional targeting of En1/2 in 5-HT neurons after
neurogenesis ...... 114
Figure 5. Engrailed is required in rostral postmitotic 5-HT neurons to
regulate formation of the DRN ...... 116
Figure 6. Engrailed is not required for early maintenance of 5-HT neuron
identity ...... 119
5
Figure 7. Engrailed is required for maintenance of serotonergic identity in
the perinatal period ...... 121
Figure 8. Engrailed is required in postmitotic 5-HT neurons for
maintenance of brain 5-HT levels ...... 123
Figure 9. En1 is the predominant functional engrailed paralog for
maintenance of 5-HT neuron identity ...... 125
Figure 10. Engrailed is required for survival of postmitotic 5-HT
neurons ...... 127
Figure 11. Conditional targeting of En1/2 in 5-HT neurons negatively
impacts pup outcome measures ...... 129
Chapter 3
Figure 1. Comparison of wild-type C57BL/6, SJL and mixed
129/Sv*C57BL/6 backgrounds ...... 147
Figure 2. Immunohistological comparison of congenic C57BL/6 and SJL
and mixed 129/Sv*C57BL/6 Pet-1+/+ and Pet-1-/- mice ...... 149
Figure 3. HPLC analysis of congenic and mixed background in wild-type
and Pet-1 mutant mice ...... 151
Figure 4. Pup survival and nest building behavior in C57BL/6-Pet-1+/- and
Pet-1-/- dams ...... 153
.
6
Engrailed is Required in Maturing Serotonin Neurons to Regulate the
Cytoarchitecture and Survival of the Dorsal Raphe Nucleus
Abstract
By
STEPHANIE R FOX
Serotonin (5-HT) neuron development and signaling output is driven by a regulatory transcriptional network. Alterations in the development and function of the 5-HT system via the transcription factor network can alter mouse behavior and physiology. While there is increasing understanding of the factors involved, there are still many important factors to identify.
Analysis of constitutive Engrailed (En) null mice implicated the two homeobox paralogs in the development of 5-HT neurons; however, it is unclear whether En play intrinsic roles. En1 and En2 are expressed in maturing 5-HT neurons that will form the dorsal raphe nucleus (DRN) and dorsal part of the median raphe nucleus. En1 expression in 5-HT neurons continues in adulthood, while En2 expression diminishes by E17.5. Conditional targeting of En1/2 in 5-HT neurons after neurogenesis identified intrinsic roles in 5-HT neuron maturation.
En1/2 are necessary for the formation of the DRN cytoarchitecture, apparently through regulation of 5-HT neuron secondary migration. Furthermore, En1/2 are necessary for perinatal maintenance of 5-HT neuron identity and postnatally for
7
maintenance of 5-HT levels and 5-HT neuron survival. Analysis of an En allelic
series revealed that En1 is the dormant functional paralog in maturing 5-HT
neurons, while En2 contributes prior to its downregulation. Therefore, there are
important intrinsic roles for En1/2 in 5-HT neuron development.
The Pet-1 transcription factor is an important determinant for 5-HT neuron
development and maintenance. The Pet-1-/- model has been used to study 5-HT
system development and function using combinations of C57BL/6, 129/Sv and
SJL backgrounds. Variations in the 5-HT system or in the interaction between
5-HT system dysfunction due to Pet-1-targeting and genetic modifiers in the background could cause inconsistencies in phenotype and confusion over 5-HT
system or Pet-1 function. Indeed, conflicting anxiety behavioral data has arisen,
potentially due to genetic background. Congeneric C57BL/6- and SJL-Pet-1 lines were generated and compared to the original 129/Sv*C57BL/6-Pet-1 line.
Genetic background did not obviously alter the distribution of 5-HT neurons or
brain 5-HT. However, differences in newborn 5-HT metabolism and adult blood
5-HT levels suggest differences in 5-HT synthesis, release, reuptake and/or
degradation, which could alter brain development and 5-HT function.
8
Chapter 1
Introduction to the central serotonin system and
engrailed transcription factors
Central serotonin system
The serotonergic (5-HT) system is composed of a relatively small number of neurons, but their early development and widespread projections affords 5-HT neurons with a unique ability to impact the development and function of the central nervous system (CNS). In the mouse brain, there are an estimated
26,000 5-HT neurons (Ishimura et al., 1988) and in the human, an estimated
300,000 5-HT neurons (Baker et al., 1991; Hornung, 2003). This small number of neurons innervates almost every cytoarchitectural area of the brain and spinal cord. 5-HT neuron development is initiated by the specification of 5-HT progenitors by intrinsic and extrinsic signals. Subsequently, a primarily intrinsic network of transcription factors drives the specification and differentiation of 5-HT precursors into immature 5-HT neurons, directing neurons to initiate and maintain expression of genes necessary for 5-HT signaling, migrate to adult positions, extend neurites and integrate into the CNS circuitry (Deneris and Wyler, 2012).
Some of these developmental transcription factors are retained in the mature system to maintain 5-HT neurons and may influence their function.
9
5-HT neurons are born in two domains (rostral and caudal) of paired nuclei on either side of the midline in the hindbrain. The rostral domain is located in the rostral hindbrain just caudal to the mid-hindbrain organizer (MHO) and isthmus at the levels of r1–r3 and the caudal domain is located at the levels of r5–r8 (Figure 3A). From these initial positions, neurons migrate to form the various adult nuclei within the brainstem. Traditionally, 5-HT nuclei are described as nine groups based on anatomical differences, labeled caudal to rostral B1–B9
(Dahlstroem and Fuxe, 1964). B1-B3 are derived from the caudal domain and are located in the medulla, while B4-B9 are derived from the rostral domain and are located in the midbrain and pons (Figure 3B). The rostral 5-HT neurons are also classified by their location in the dorsal raphe nucleus (DRN) and median raphe nucleus (MRN). The DRN includes B4, B6 and B7 along with other non-5-
HT neurons. The MRN contains B5 and B8. B9 lies lateral to the MRN. There has been discussion concerning whether B4 should be included as part of the rostral or caudal groups, however recent developmental analysis have definitively shown that the cells populating B4 are derived from the rostral domain, and thus, confirming its inclusion in the rostral group (Jensen et al., 2008).
Alterations in 5-HT system function has been associated with numerous, diverse neurodevelopmental and neuropsychiatric disorders, including anxiety, depression and sudden infant death syndrome. Interactions between the genetic
5-HT neuron determinants, 5-HT neuron-specific components and the environment can influence the development and signaling of 5-HT neurons
(Gaspar et al., 2003). Consequently, changes in the amount of 5-HT released,
10
whether too high or too low, can alter the development and level of function of 5-
HT targets during critical developmental periods, thus conferring susceptibility for
development of mental illness.
5-HT neuron identity
5-HT neurons are classified as such based on their production and release of the neurotransmitter 5-HT. Therefore, in addition to the expression of genes necessary for neuronal identity, function and survival, 5-HT neurons must also express those genes necessary for the synthesis, release, reuptake and degradation of 5-HT. Furthermore, some of the same enzymes and transporters used in 5-HT signaling are also used by other monoamine systems or 5-HT
neuron targets. Therefore, it is the combination of all of these 5-HT specific and non-5-HT specific components that defines a 5-HT neuron (Figure 1).
In order to use 5-HT as a signaling molecule, 5-HT neurons must synthesize 5-HT from L-tryptophan in a two-step process by the enzymes tryptophan hydroxylase (Tph) and aromatic-L-amino acid decarboxylase (Aadc,
Ddc). In the first step, Tph and a cofactor, tetrahydrobiopterin or BH4 convert L-
tryptophan to 5-hydroxy-L-tryptophan. Two independent genes encode Tph,
Tph1 and Tph2. Tph1 is expressed in enterochromaffin cells in the
gastrointestinal tract and in the pineal gland where it is involved in the production
of melatonin (Walther and Bader, 2003; Patel et al., 2004). Mice with germline
targeting of Tph1 have only a small decrease in brain 5-HT levels, but have
minimal levels of 5-HT in blood, gut and pineal gland (Côté et al., 2003; Walther
11 et al., 2003; Savelieva et al., 2008). Tph2 is primarily expressed in 5-HT neurons of the brain (Walther et al., 2003; Patel et al., 2004), although it is also expressed in enteric neurons of the gut (Neal et al., 2009). In Tph2-deficient mice, 5-HT levels are almost completely ablated in the brain while peripheral levels are unaltered (Gutknecht et al., 2008; Savelieva et al., 2008; Alenina et al., 2009). In these mice, central 5-HT neurons are still present, but do not produce detectable levels of 5-HT. Therefore, Tph2 is the paralog primarily responsible for CNS 5-HT neuron function. Tph2 expression is detectable in the rostral hindbrain at E11.25 expression increases through embryogenesis, peaking just after birth (Gutknecht et al., 2009). After an early postnatal drop, Tph2 expression increases to similar levels in the late developmental period. In the second step of 5-HTsynthesis,
Aadc decarboxylases 5-hydroxy-L-tryptophan to 5-HT. Aadc is expressed in other monoamine systems and contributes to the biosynthesis of dopamine (DA) and noradrenaline (NA) (Tison et al., 1991; Beltramo et al., 1993; Eaton et al.,
1993). The Aadc gene contains distinct promoters for neuronal and nonneuronal tissue and various splice forms unique to specific tissues, however the protein generated from these mRNAs is usually the same, suggesting that alternative mRNA forms regulate Aadc production (Albert et al., 1992; Ichinose et al., 1992;
Sumi-Ichinose et al., 1992; O’Malley et al., 1995; Chatelin et al., 2001;
Vassilacopoulou et al., 2004).
After synthesis, 5-HT is packaged into secretory vesicles by vesicular monoamine transporter 2 (Vmat2, Slc18a2) for storage until release and to protect it from being metabolized (Schuldiner et al., 1995). Vmat2 is primarily
12
expressed in neuronal tissues and is necessary for packaging all monoamines
(Peter et al., 1994, 1995; Adam et al., 2008). Without the ability to package monoamines into vesicles, germline targeting of Vmat2 results in a rapid rate of
monoamine metabolism; mice have very low levels of dopamine, norepinephrine,
and 5-HT but normal levels of metabolites (Fon et al., 1997; Wang et al., 1997).
Newborn pups are small and feed poorly, generally dying within the first week.
Vmat2+/- mice have decreased levels of monoamines compared to wild type
littermates but are viable (Fon et al., 1997; Takahashi et al., 1997). Mice with
conditional ablation of Vmat2 only in Sert expressing cells are viable, although
they also have very low levels of 5-HT in brainstem and in 5-HT neuron target
tissues (Narboux-Nême et al., 2011).
There are seven subfamilies of 5-HT receptors (5-HT1-7) of which six
subfamilies are G-protein coupled receptors, and one subfamily, 5-HT3, is a
ligand gated ion channel (Bockaert et al., 2010; D’Souza and Craig, 2010).
However, only one subfamily, 5-HT1 is expressed in 5-HT neurons. 5-HT1A
(Htr1a) and 5-HT1B (Htr1b) are the most studied of these autoreceptors, although
5-HT1D and 5-HT1F are also expressed in 5-HT neurons so may act as
autoreceptors as well. 5-HT1A receptors are located on the cell body and
dendrites, while 5-HT1B receptors are primarily located on 5-HT axons away from
the terminals (Riad et al., 2000). In 5-HT neurons, 5-HT1 receptors reduce cell
activity by coupling to Gi/o to inhibit adenylyl-cyclase, though they may also work
through other mechanisms as well. In the absence of 5-HT1A receptor function, 5-
HT levels are normal throughout the brain, however 5-HT turnover rate is
13
increased in the DRN and MRN, as well as in some target areas, due to an
increased spontaneous firing rate (Ase et al., 2000; Richer et al., 2002). Similar
increases in firing rate and 5-HT turnover are observed with treatment with
selective 5-HT1A antagonists (Fornal et al., 1996). In mice lacking the 5-HT1B
-/- gene (5-HT1B ) there are lower levels of 5-HT but normal 5-HIAA levels in some
target areas, which could be due to dysregulation of 5-HT metabolism (Ase et al.,
2000) as the spontaneous firing rate is unaltered (Evrard et al., 1999).
Another important component of 5-HT neurons is the 5-HT transporter
(Sert, 5-HTT, Slc6a4), which it the primary transporter for the reuptake of 5-HT
from the synapse (Blakely et al., 1991; Hoffman et al., 1991; Chang et al., 1996).
Sert expression in 5-HT neurons can be detected as early E10 in the mouse or
E11 in the rat (Schroeter and Blakely, 1996; Hansson et al., 1998). Soon
thereafter, Sert is also transiently expressed in 5-HT neuron target regions,
including telencephalon, hippocampus, dorsal thalamus and limbic cortex
(Lebrand et al., 1996, 1998; Cases et al., 1998; Hansson et al., 1998; Pavone et
al., 2008). Some brain regions, such as the hippocampus and thalamus, also
express Vmat2, suggesting that these cells can package and release the 5-HT
that they accumulate. This could allow for additional control of extracellular 5-HT,
which can act as developmental signal for circuit formation and cell survival
(Gaspar et al., 2003). In the adult CNS, Sert expression is mostly limited to the 5-
HT system. Removal of Sert expression, by germline targeting, results in high
extracellular and low intracellular 5-HT levels (Bengel et al., 1998; Persico et al.,
2001; Mathews et al., 2004). Abnormal levels of 5-HT cause desensitization or
14 downregulation of 5-HT1A receptors (Li et al., 1999, 2000; Fabre et al., 2000;
Mannoury la Cour et al., 2001) and increased 5-HT synthesis (Kim et al., 2005).
Finally, 5-HT degradation is primarily carried out by monoamine oxidases
A and B (Maoa and Maob), which metabolize 5-HT into 5-HIAL (Greenawalt and
Schnaitman, 1970). 5-HIAL is rapidly degraded to 5-HIAA by aldehyde dehydrogenase and is eliminated by diffusion and eventually excretion into urine.
Mao proteins are widely expressed and are localized to the outer membrane of mitochondria. Maoa preferentially oxidizes 5-HT, norepinephrine and epinephrine, while Maob preferentially oxidizes phenylethylamine and benzylamine (Edwards, 1980; Bortolato et al., 2010). Both act on dopamine, tyramine and tryptamine. Maoa and Maob are found in the adult rat DRN and
MRN (Levitt et al., 1982; Luque et al., 1995; Jahng et al., 1997). Maoa is strongly expressed in 5-HT neurons from E12.5 until birth, after which, its expression declines to a low level in rostral 5-HT neurons and is undetectable in medullary nuclei (Vitalis et al., 2002). Maob is expressed weakly at E12, but its expression increases through at least P10. In mice lacking a functional Maoa gene, the levels of 5-HT were dramatically higher and 5-HIAA were much lower than in controls during the early postnatal period (Cases et al., 1995). However, the difference in 5-HT and 5-HIAA levels between Maoa null mice and control mice decreased with age until no differences were observable at seven months of age, perhaps due to compensation. In mice without a functional Maob allele, levels of brain 5-HT and 5-HIAA are similar to controls in adult mice (Grimsby et al.,
1997). It is surprising that 5-HT levels are not altered in Maob null mice. Maoa
15 levels have not been measured, so perhaps it is upregulated in compensation.
An alternative hypothesis is that different subcellular localization of Maoa and
Maob influence their access to 5-HT and their purpose within the 5-HT neuron
(Arai et al., 2002; Bortolato et al., 2010). In mice lacking any functional Mao alleles, 5-HT levels are further increased and 5-HIAA levels decreased over that observed in Maoa null mice (Chen et al., 2004).
Molecular control of 5-HT neuron development
The development of a mature 5-HT neuron that expresses all of the necessary 5-HT components and is integrated within the CNS circuitry is a stepwise process from neuronal stem cell to 5-HT progenitor to postmitotic 5-HT precursor to mature 5-HT neuron. The progenitor domain is specified by a combination of intrinsic and secreted factors, including anterior-posterior (A-P) signals and dorsoventral (D-V) signals (Figure 2A). Subsequently, 5-HT neurogenesis, differentiation and maturation are largely driven by an intrinsic transcription factor network (Figure 2C) (Deneris and Wyler, 2012), in which transcription factors in progenitors activate expression of the next set of transcription factors in the postmitotic precursor that will induce expression of genes necessary for 5-HT identity. Some of these factors continue to regulate 5-
HT neuron maintenance and maturation processes, such as migration.
16
Setting up the A-P axis – Mid-hindbrain organizer
The combination of A-P and D-V signals within the ventral hindbrain specify the location and number of 5-HT progenitors and precursors. The major
A-P patterning signals for r1, and to a lesser extent r2-r3, arise from the mid- hindbrain organizer (MHO) at the isthmus (Figure 2A,B) (Zervas et al., 2005).
These patterning signals have less effect on the caudally-derived 5-HT lineage.
Additionally, Fgf4 signaling prepatterns the hindbrain to distinguish it from mesoderm. The primary dorsoventral signal for the ventral neural tube is Shh, which is secreted from the notochord and the floor plate (Echelard et al., 1993;
Martí et al., 1995).
The mid-hindbrain boundary and MHO is located at the interface between the homeobox transcription factors, Otx2 and Gbx2. Otx2 and Gbx2 divide the early embryo along the A-P axis by their juxtaposed expression patterns on the rostral and caudal sides, respectively, of what will become the mid-hindbrain boundary and thus the caudal boundary of the mesencephalon and the rostral boundary of the metencephalon. This opposing expression pattern is required to correctly place the mid-hindbrain boundary and thus define the position and size of the fields that will produce t terminal neuronal cell types (Brodski et al., 2003).
In mice lacking Otx2 expression (Otx1-/-;Otx2+/- or Otx2hOtx1/hOtx1), Gbx2
expression and the MHO is shifted rostrally to the diencephalic-mesencephalic
border, resulting in rostral shift of mesencephalic dopamine (mesDA) neurons
and a corresponding expansion of the rostral domain of 5-HT neurons (Li and
Joyner, 2001; Brodski et al., 2003). In contrast, a caudal shift in Otx2 expression
17
to the r1-r2 boundary by misexpression under the En1 promoter (En1+/Otx2) results in a reduction of r1 5-HT neurons paralleled by an expansion of the mesDA domain (Brodski et al., 2003). Similarly, Otx2 expression, as well as
MHO gene expression is caudally shifted in Gbx2-/- mice (Li and Joyner, 2001).
Otx2 and Gbx2 are required to define the location of the MHO, but not for
expression of MHO genes. In absence of both genes (Gbx2-/-; Otx2hOxt1/hOtx1),
expression of genes involved in mesencephalon and metencephalon
specification (Fgf8, Pax2, En1 and Wnt1) are induced, however their domains of
expression are generally expanded. Interestingly, Wnt1 and Fgf8 expression
overlap suggesting that Otx2 and Gbx2 are also involved in defining the
boundary through regulation of genes on the other side of the border (Li and
Joyner, 2001). In addition to positioning the MHO, Gbx2 is necessary to specify a
hindbrain fate (Sunmonu et al., 2011). Fate mapping experiments found that in
absence of Gbx2 function, hindbrain cells express midbrain markers and fail to
segregate from midbrain-derived cells.
En1 and En2 are homeodomain transcription factors expressed through
the mesencephalon and r1 from the 1-somite stage and 5-somite stage
respectively (Davis and Joyner, 1988). En1/2 maintain expression of MHO
genes. In mice with germline targeting of En1 and En2 genes, MHO gene (Gbx2,
Pax5, Wnt1, and Fgf8) expression is induced, though at a lower level; however,
Fgf8, Pax5 and Wn1 expression rapidly decline (Liu and Joyner, 2001a).
Furthermore, En2 and Pax5 regulate the expression of each other in a reciprocal
fashion in response to Fgf8b. Ectopic expression of En1 in the chick
18 mesencephalon and posterior diencephalon can induce expression of Fgf8
(Shamim et al., 1999). En1 mutant embryos lack large portions of midbrain and rostral hindbrain tissue (Wurst et al., 1994), in part due to excessive cell death
(Chi et al., 2003). En2 mutant mice have defects in the cerebellar patterning
(Joyner et al., 1991; Millen et al., 1994).
Pax2 and Pax5 are paired-rule transcription factors expressed across the mid-hindbrain boundary in both the mesoderm and r1. Pax genes are expressed prior to the formation of the MHO, contribute to the expression of MHO genes and may be instrumental in setting up the MHO (Joyner, 1996; Aroca and
Puelles, 2005). As such, they contribute to the patterning of the mesoderm and rostral hindbrain. Pax2 expression begins prior to the onset of somitogenesis, while Pax5 expression is detectable at the 5 somite stage (Asano and Gruss,
1992; Rowitch and McMahon, 1995). Pax2 induces the expression of Fgf8, Pax5 and Pax8 at the MHO (Ye et al., 2001). In mice with homozygous mutant alleles of Pax2, many MHO genes are expressed at the isthmus but Fgf8 expression is never detectable (Favor et al., 1996; Torres et al., 1996; Schwarz et al., 1997; Ye et al., 2001). The penetrance and extent of Pax2 defects in the mid-hindbrain region depend on the particular allele and genetic background, including defects in neural tube closure and proliferation. While, Pax5 mutants only display minor alterations in cerebellar foliation and a smaller inferior colliculus (Urbánek et al.,
1994). Pax transcription factors may also contribute to the expression of En in the mid-hindbrain region. In one Pax2 mutant, En2 expression was diminished
(Favor et al., 1996). Moreover, in mice with mutant alleles of both
19 homologs(Pax2-/-; Pax5+/- or Pax2-/-; Pax5-/-), En1 expression is greatly diminished and mice display a similar loss of mid-hindbrain tissue as En mutants
(Schwarz et al., 1997).
Wnt1 expression in the presumptive mesoderm begins by the 1-somite stage and is soon widely expressed across the mesodermal neural plate
(Wilkinson et al., 1987; Echelard et al., 1994). During the formation of the MHO,
Wnt1 expression becomes limited to just rostral to the boundary, along the dorsal and ventral midlines in the mesoderm, and along the dorsal midline of the hindbrain (Echelard et al., 1994; Zervas et al., 2004). Homozygous Wnt1 null mice have a highly disrupted mesencephalon and rostral hindbrain (Thomas and
Capecchi, 1990) or complete loss of the mesencephalon and most of the cerebellum (McMahon and Bradley, 1990; McMahon et al., 1992). In these mutants, En is initially expressed at the isthmus, but it rapidly diminishes. Pax5 and Fgf8 expression is also lost. Replacement of Wnt1 with En1 by knockin of
En1 into the Wnt1 coding region mostly rescues the expression of MHO genes and formation of midbrain and cerebellar tissue. Wnt1 in the midbrain and Fgf8 in r1 create a feedback loop for the maintenance of both genes that involves En
(Danielian and McMahon, 1996; Canning et al., 2007). Therefore, the deficits observed in the Wnt1 mutants are at least partially due to loss of En and Fgf8 expression.
One of the major organizing factors of the MHO is Fgf8. It is expressed in a broad portion of the rostral hindbrain at the 3-somite stage, then its expression becomes limited to a narrow region just caudal to the MHB (Heikinheimo et al.,
20
1994; Crossley and Martin, 1995). In mice with conditional targeting of Fgf8
around the isthmus region, there is a loss of dorsal midbrain and rostral hindbrain
tissues due to a combination of fate transformation and apoptosis (Chi et al.,
2003; Sato and Joyner, 2009). Expression of MHO genes, such as Fgf17, Fgf18,
Wn1 and Gbx2, are missing from the early isthmus region. In addition, blocking
Fgf8 in hindbrain extracts, prevents the formation of 5-HT neurons (Ye et al.,
1998). Two FGF8 spliceforms are secreted from the MHO and act as morphogens, providing A-P positioning information and allowing for distinct Fgf8
roles. Fgf8a diffuses rostrally, promoting a midbrain phenotype and stimulating
proliferation (Liu et al., 1999; Shamim et al., 1999; Irving and Mason, 2000; Liu
and Joyner, 2001a; Aroca and Puelles, 2005; Partanen, 2007). Isthmus and
hindbrain tissue do not respond to Fgf8a. Overexpression of Fgf8a in the
midbrain or caudal diencephalon causes excessive proliferation and expression
of En2. In r1, Fgf8b represses midbrain and r2 genes, while inducing and
maintaining r1 genes. Placement of Fgf8b soaked beads into midbrain or caudal
forebrain explants or forced expression under the Wnt1 promoter (Wnt1-Fgf8b)
represses Otx2 and Wn1, while inducing hindbrain characteristics including
expression of En1/2, Pax5, and Gbx2. In addition to maintaining the mid-
hindbrain organization, Fgf8 also designates the r1-r2 border. In chick, ectopic
Fgf8 via coated beads placed at the r1/r2 boundary can induce expression of
En1/2 and repress expression of Hoxa2 in r2. En2 expression can also be
induced by Fgf8 at the r2/r3 boundary. Blocking Fgf8 using antisera allows
Hoxa2 expression to expand rostrally into r1. Fgf8 expression is not required for
21 the development of caudal 5-HT neurons, which develop far from the MHO (Ye et al., 1998; Irving and Mason, 2000). Besides maintenance or induction of MHO genes, Fgf8 maintains the mid-hindbrain boundary, because when Fgf8 expression is lost in the hindbrain, midbrain- and hindbrain-derived cells mix at the boundary (Sunmonu et al., 2011).
Fgf4 prepatterning is required for specification of hindbrain tissues (Ye et al., 1998; Shamim et al., 1999). Fgf4 has been found to be secreted from the mouse primitive streak and the chick notochord. Like Fgf8, Fgf4 can induce expression of midbrain/r1 genes, such as En1/2 and Pax2, when ectopically expressed. When neural tube explants are exposed to Fgf8 or both Fgf8 and
Fgf4, different terminal neuronal types are generated. Ectopic expression of Fgf8 in the ventral midbrain or rostral forebrain where Shh levels are high can induce ectopic DA neurons. However, when tissue is exposed to Fgf4 expression early, ectopic 5-HT neurons are produced instead.
D-V patterning
Shh signaling pathways are the primary D-V signals acting on early 5-HT neuron development (Figure 2A). Shh is released from the floor plate, providing a ventral to dorsal gradient (Echelard et al., 1993; Martí et al., 1995; Chiang et al.,
1996; Ericson et al., 1996). Elimination of the Shh signal reduces the number of
5-HT neuron progenitors and thus, 5-HT neurons produced. In Gli2 mutants, the floor plate fails to form, eliminating the Shh gradient (Matise et al., 1998). In these mice, there are fewer progenitors that will produce the vMN and 5-HT
22 precursors, and these are displaced into the midline, instead of flanking it.
Furthermore, only about half of the normal number of 5-HT+ neurons are generated. Similarly, blocking Shh signaling using antibodies against Shh prevents the development of 5-HT neurons in hindbrain explants (Ye et al.,
1998). In addition to induction of Shh expression, Gli2 also responds to Shh to induce expression of neurogenic factors including Ascl1 (Voronova et al., 2011).
Forced activity of the Shh signaling pathway produces ectopic 5-HT neurons.
Expression of a constitutively active form of the Shh coreceptor, smoothened, throughout the D-V axis of the neural tube results in ectopic 5-HT neurogenesis in the dorsal hindbrain through a cell intrinsic induction of Gata2 (Hynes et al.,
2000; Craven et al., 2004). A similar effect is observed in mice misexpressing
Gli1 throughout the D-V axis of the neural tube in the mesoderm and rostral hindbrain (Hynes et al., 1997). Nkx2.2 interprets the level of Shh to specify the
P3 progenitors that give rise to vMN and 5-HT precursors (Briscoe et al., 1999).
In mice with germline targeting of Nkx2.2, these progenitors take on the fate of a more dorsal population that is exposed to lower levels of Shh.
Neurogenesis
5-HT progenitors are specified by their expression of Ascl1, Nkx2.2 and
Foxa2 (Figure 2C). En1/2 also contribute to 5-HT neurogenesis, although specific roles are unknown. 5-HT progenitors give rise to postmitotic 5-HT precursors in parallel bands flanking the floor plate in at the levels of r1-r3 and r5-r8 (Lidov and
Molliver, 1982a; Wallace and Lauder, 1983). Neurogenesis occurs in the ventral
23
ventricular zone in two waves (Pattyn et al., 2003). During the first wave,
precursors in r1 are generated, while progenitors at more caudal levels are
producing visceral motor neurons (vMN). During the second wave beginning
~E10.5, 5-HT precursors are primarily produced at the levels of r2-r3 and r5-r8.
5-HT neurons are never generated in r4 as the population of progenitors
continues to give rise to vMN through this second wave of neurogenesis. This
switch between Nkx2.2+ P3 progenitors producing vMN and 5-HT precursors is
mediated by a molecular switch composed of Phox2b and Foxa2. Ascl1
independently promotes 5-HT neurogenesis. These transcription factors also
induce expression of the next wave of transcription factors necessary for terminal
differentiation.
Nkx2.2+/Nkx2.9+ P3 progenitors are 5-HT progenitors if Foxa2+ and vMN
progenitors if Phox2b+. The vMN to 5-HT progenitor switch is initiated by the
downregulation of Phox2b and upregulation of Foxa2 in r2-3 and r5-8. Nkx2.2+/
Nkx2.9+/Phox2b+ P3 progenitors produce vMN precursors starting at the same
time that 5-HT precursors begin to be produced in r1 (Pattyn et al., 2003). At
about E10.5, Nkx2.9 and Phox2b expression diminishes while Foxa2 expression
increases in the ventral Nkx2.2+ progenitor population, initiating the switch from
vMN production to 5-HT precursor production (Briscoe et al., 1999; Pattyn et al.,
2003; Jacob et al., 2007). During this second wave of neurogenesis, Nkx2.2
downregulates Nkx2.9 and Phox2b expression in P3 progenitors. Loss of Nkx2.2
expression results in a failure to downregulate Nkx2.9 and Phox2b, leading to
reduced numbers of 5-HT precursors and corresponding expansion of vMN
24 precursors in r2-r8 (Cheng et al., 2003; Pattyn et al., 2003). Nkx2.2 is not necessary for 5-HT neurogenesis in r1 (Ding et al., 2003; Jensen et al., 2008).
Phox2b and Foxa2 mutually inhibit one another as the elimination of the expression of either gene allows the other to expand expression in P3 progenitors (Jacob et al., 2007). In Phox2b null mice, vMN are not produced; instead Foxa2 expression in P3 progenitors is upregulated early, resulting in production of 5-HT precursors prematurely in r2-r3 and r5-r8 and ectopically in r4
(Pattyn et al., 2003; Jacob et al., 2007). Conditional targeting of Foxa2 using
Wnt1-Cre results in the ectopic expression of Phox2b and Nkx2.9 and ectopic production of vMN in r1 (Jacob et al., 2007). A dominant negative Foxa2 construct has similar effects in the more caudal hindbrain in chick. Furthermore, ectopic expression of Foxa2 prior to the switch reduces the number of vMN precursors and increases the number of 5-HT precursors. In r1, Foxa2 is expressed in Nkx2.2+ P3 progenitors and Phox2b is never expressed, while in r4,
Phox2b expression is maintained and Foxa2 expression is never increased.
Nkx2.2 may play additional roles in 5-HT neurogenesis after initiation of the vMN to 5-HT switch. Ectopic expression of Nkx2.2 and Nkx6.1 in chick r1 lateral to normal expression areas induces Gata2 and Gata3 expression and ectopic 5-HT neurons (Craven et al., 2004). Additionally, similar ectopic expression of Nkx2.2 in r2-r7 ventricular zone induces Nkx6.1, Gata2 and Gata3 expression, as well as 5-HT neurons. In mice homozygous null for Nkx2.2, transcription factors involved in the terminal differentiation of 5-HT neurons, such as Lmx1b and Gata3, are not induced (Ding et al., 2003). Nkx2.2 functions in
25 combination with Nkx6.1, because elimination of Nkx6.1 in the chick r1 does not alter Nkx2.2 expression, but prevents the generation of 5-HT precursors. This suggests that Nkx2.2, in combination with Nkx6.1, can induce the 5-HT neuron fate.
Ascl1/Mash1 is another transcription factor important for 5-HT neurogenesis, separate from the vMN to 5HT precursor switch. It is a basic helix- loop-helix protein expressed in P3 progenitors prior to the onset of 5-HT neurogenesis. In absence of Ascl1 function, normal expression patterns of
Nkx2.2, Pax6, Nkx2.9 and Shh are observed, however expression of early postmitotic 5-HT neuron markers (Gata2, Gata3, Pet-1, and Lmx1b) are almost eliminated (Pattyn et al., 2004). However, a small number of 5-HT neurons near the mid-hindbrain boundary do differentiate. Because there is an absence of cell bodies where 5-HT neurons should be located and no indications for cell death, this is thought to be a failure of neurogenesis.
En1 and En2 also play a role in 5-HT neurogenesis or terminal differentiation. While there is no loss of 5-HT+ neurons in either En1 or En2 germline targeted mice, in compound En1 and En2 null mice, there is a large deficit in the number of 5-HT+ neurons in the DRN (Simon et al., 2005). This loss is observable at E12.5 along with a coincident loss of Pet-1 expression, suggesting that En contribute to 5-HT neurogenesis prior to the onset of Pet-1 expression. Because constitutive null alleles were used for analysis, it is difficult to determine whether En1/2 are involved in a cell intrinsic manner. 5-HT neurons born in r1 are derived from En1 expressing cells (Zervas et al., 2004) and
26 express En1and En2 at E12.5, suggesting that they have cell autonomous roles.
However, En1/2 are important components of the mid-hindbrain organizer and maintenance of Fgf8 expression(Liu and Joyner, 2001a, 2001b), which is necessary for 5-HT neurogenesis (Ye et al., 1998), thus suggesting that the loss of 5-HT neurons in r1 could be due to non-intrinsic roles of En in the MHO.
Furthermore, it is not clear whether cell loss is due to effects on 5-HT progenitors or precursors.
Terminal differentiation
As neurogenesis ends, 5-HT precursors are beginning to express transcription factors important for initiation of 5-HT-type gene expression. The first of these to become detectable are Gata3 and Lmx1b. Pet1 expression becomes detectable slightly later. 5-HT synthesis can be detected soon after neurogenesis in the rostral group but is delayed 1–2 days in the caudal domain
(Lidov and Molliver, 1982a). Even though these cells are producing 5-HT, they are still immature.
Several of the transcription factors important for neurogenesis continue to play a role in the terminal differentiation of 5-HT precursors. Foxa2 is involved in differentiation of 5-HT neurons upstream of Pet1, Lmx1b and Gata2, because conditional targeting of Foxa2 after neurogenesis by Nestin-Cre results in a 50% decrease in 5-HT neurons throughout the rostral and caudal domains, including expression of these genes (Jacob et al., 2007). However, the cell bodies are still present, because Gata3 expression is unaffected. Ascl1 also plays an early role
27 in 5-HT differentiation. Although it is primarily expressed in dividing progenitors,
Ascl1 induces expression of factors involved in the differentiated phenotype including direct induction of Insm1 (Pattyn et al., 2004; Jacob et al., 2009).
Insm1 expression begins just before cells exit the cell cycle and is important early in the differentiation of 5-HT neurons for the induction and/or maintenance of terminal gene expression (Jacob et al., 2009). In Insm1 null mice, 5-HT progenitors appear unaffected, however by E12.5 expression of other early terminal determinates are disrupted. Lmx1b expression is decreased across all rostrocaudal positions, while Gata2 expression is only diminished rostrally. Pet-1 expression is decreased at all positions; however loss is greatest in r2-r3 and only moderately at r6-r7. This pattern of expression loss is similar to the distribution of 5-HT+ neuron loss: moderate in r1 and r6-r7 and high in r2-r3.
Although Tph2 expression is already diminished at E12.5, Aadc expression does not dramatically decrease until several days later.
Gata3 is particularly important in the caudal raphe nuclei for the expression of the 5-HT phenotype. In Gata3-deficint mice, normal numbers of 5-
HT precursors are produced, but only a small proportion become Tph+ or 5-HT+ in the caudal raphe (van Doorninck et al. 1999; Pattyn et al. 2004). There is only a small deficit in the number of 5-HT neurons in the rostral raphe nuclei.
Expression of other 5-HT genes, including Aadc, Sert and Vmat2, are also diminished, along with 5-HT levels in the forebrain and spinal cord (Liu et al.,
2010). Because Gata3 expression continues into adulthood, it is not clear whether these deficits are entirely due to early developmental deficits or also
28
include long-term roles. Although Gata3 is not necessary for 5-HT neuron
generation in r1, its misexpression in the chick hindbrain induces additional,
ectopic 5-HT+ neurons (Craven et al., 2004).
Gata2 acts in a transcriptional pathway separate from Gata3. Gata2 can
directly regulate Pet-1 expression (Krueger and Deneris, 2008), which is
eliminated in Gata2 null mice (Craven et al., 2004). While Gata3 expression, and
thus progenitors, is not affected, differentiated 5-HT neurons are not present.
Excessive Gata2 expression in the chick hindbrain cell autonomously induces ectopic 5-HT neurons in r1 by progenitor respecification, while expression of a dominant negative form of Gata2 cell autonomously prevents differentiation into
5-HT neuron (Craven et al., 2004).
Lmx1b expression begins soon after cells become postmitotic (Ding
2003). In Lmx1b-deficient mice, normal numbers of precursors are produced, but
these fail to differentiate completely. Undifferentiated precursors are maintained
at least through E15.5. These cells fail to express genes involved in 5-HT identity
including Pet-1, Sert, Tph2, Vmat2 and calcitonin receptor, at all axial levels as
well as Gata3 and Aadc in the caudal domain (Ding 2003, Cheng 2003). Other
genes important for 5-HT neurogenesis, Nkx2.2, Shh and Gata3, are unaltered.
While Lmx1b is necessary for 5-HT neuron differentiation, it is not sufficient to
induce ectopic 5-HT neurons when misexpressed the in chick hindbrain (Craven
et al., 2004). In mouse neural progenitors in vitro, forced expression of Lmx1b
increases the differentiation of progenitors into 5-HT neurons, including
29
expression of Pet-1 (Dolmazon et al., 2011). This effect was increased when
cultures were treated with Shh.
Pet-1/Fev is an ETS transcription factor that is expressed soon after 5-HT
neurons become postmitotic and precedes expression of 5-HT by at least 0.5
days (Hendricks et al., 1999; Hawthorne et al., 2010). In the brain, Pet-1
expression is specific to postmitotic 5-HT neurons (Hendricks et al., 1999). Pet-1
expression appears first in the rostral domain then in caudal domain of newly
born 5-HT neurons (Hendricks et al., 1999; Pfaar et al., 2002; Scott et al.,
2005b). In absence of Pet-1 expression, a normal number of NeuN+/Gata3+
precursors are produced and most are maintained into adulthood, however ~70%
fail to express many other components of the 5-HT identity including, Tph2,
Vmat2, Sert, Aadc, Maob and 5-HT (Hendricks et al., 2003; Krueger and Deneris,
2008; Liu et al., 2010). In Pet-1 null mice, this deficit is observable at E11.5,
suggesting that these cells never fully differentiated (Hendricks et al., 2003). Pet-
1 can directly control expression of Tph2, Sert and Pet1 based on in vivo analysis using ChIP (Liu et al., 2010) but is not necessary for maintenance of
Lmx1b expression (Ding et al., 2003; Zhao et al., 2006). The human ortholog of
Pet-1, FEV, has an overall similarity of 96%, with highly conserved cis regulatory regions and an identical ETS DNA binding domains (Peter et al., 1997; Pfaar et al., 2002; Krueger and Deneris, 2008). FEV expression is specific DRN and MRN
5-HT neurons in the rhesus macaque (Lima et al., 2009) and human (Maurer et
al., 2004; Iyo et al., 2005). Furthermore, a Bac transgene encoding FEV can
rescue molecular, cellular and behavioral defects observed in the Pet-1 null
30 mouse, with the extent of rescue dependent on gene expression levels (Lerch-
Haner et al., 2008). Pet-1 is necessary for 5-HT identity in most 5-HT neurons, but not sufficient; misexpression in the chick hindbrain does not induce ectopic 5-
HT neurons (Craven et al., 2004). Ectopic expression of Pet-1 with Lmx1b is sufficient to induce ectopic 5-HT neurons in the chick ventral spinal cord and addition of Nkx2.2 induces ectopic 5-HT neuron differentiation in the dorsal spinal cord (Cheng et al., 2003).
Sim1 may be required for the maintenance of a subset of 5-HT neurons in the DRN (Osterberg et al., 2011). In Sim1-deficient mice, there are similar numbers of rostral domain 5-HT+ neurons at E14.5 and P0, but when rostral nuclei are examined independently, there is a subtle decrease in the number of
5-HT+ neurons in the DRN at P0.
Maturation and maintenance
Much less is known about the roles that these or other determinants play in later aspects of 5-HT neuron maturation or in normal maintenance/function in adulthood (Figure 2C). Some of the factors important for early developmental processes continue to be expressed into the maturation period and even into adulthood; however, conditional targeting approaches have not been applied to many of these to determine their particular contributions. 5-HT neuron maturation period continues until about the third postnatal week and is a period when cells are maintained, migrate, extend neurites and integrate into circuits. Following this period, 5-HT neurons must still be maintained and preserve plasticity.
31
Pet-1 expression continues into adulthood (Hendricks et al., 1999), contributing to multiple maturation processes and neuron maintenance. When
Pet-1 is conditionally deleted 1-2 days after neurogenesis, 5-HT neurons differentiate normally up through E11.5, however at E12.5 when Pet-1 expression has diminished, so has the number of 5-HT+ neurons (Liu et al.,
2010). Therefore, Pet-1 continues to function to maintain expression of 5-HT identity. Later aspects of 5-HT neuron maturation are also regulated by Pet-1.
Htr1a and Htr1b begin to be expressed in 5-HT neurons after E14.5, but are greatly decreased or absent in the absence of Pet-1. Target innervation in the somatosensory cortex from DRN 5-HT neurons is also disrupted in absence of
Pet-1 (Liu et al., 2010) and some cell bodies in B7 are laterally displaced
(Krueger and Deneris, 2008). In the adult, Pet-1 continues to be required for the maintenance of 5-HT identity. When Pet-1 is conditionally targeted in adulthood,
5-HT neurons lose expression of Tph2, Sert, and Vglut3 (Liu et al., 2010).
Lmx1b-deficient neurons fail to migrate properly and are scattered away from the midline at E13.5 (Ding et al., 2003). When Lmx1b expression is conditionally targeted in 5-HT neurons 1-2 days after neurogenesis, initial expression of 5-HT genes and 5-HT is unaffected; however after Lmx1b expression diminishes, Pet1, Tph2, Sert and Vmat2 expression diminish, and by
E14.5, few 5-HT+ neurons are present (Zhao2006). Therefore, Lmx1b is necessary for 5-HT neuron maintenance. In conditionally targeted Lmx1b mice,
5-HT precursors are maintained into the early postnatal period, however even the cell bodies disappear subsequently, so it is also necessary for survival.
32
Conditional targeting of Lmx1b specifically in adult 5-HT neurons results in downregulation of Tph2, 5-HT, Sert and Vmat2, however unlike during the embryonic period, Aadc and Pet-1 are not altered (Song et al., 2011).
Thus far, only a portion of determinants important for 5-HT neuron
development and function has been identified. The 5-HT system is composed of
a heterogeneous group of cells, not only based on their location and timing of
birth, by their final location in adult nuclei or by efferents/afferents, but also by other neurotransmitters expressed, physiological properties and electrophysiology. Many additional determinants important for specific aspects of
development and specific subgroups of 5-HT neurons are yet to be identified.
The quest to find additional determinants is already underway. Microarray
analysis of cell sorted 5-HT neurons has been used to compare the distinct
transcriptomes of immature 5-HT neurons from the rostral and caudal domains at
E12.5 (Wylie et al., 2010). This analysis has identified approximately 500 genes
whose expression differs between the two domains, although it is not yet clear
what role these genes play. Future studies of additional time points and cell
subgroups will further identify factors that will lead to greater understanding of the
developmental heterogeneity of the system.
Developmental neuroanatomy
In addition to differentiation of 5-HT precursors to express the genes
necessary for 5-HT signaling, these immature 5-HT neurons must migrate to their
proper location and send out projections to integrate with targets. The movement
33
of cell bodies from their location of neurogenesis to their final position is an
important aspect of 5-HT neuron development, however very little is currently
known about the factors important for this process. Some of the factors
governing neurite extension and pathfinding have been identified.
Cell body movements and formation of the 5-HT nuclei
After 5-HT precursors are born in the ventral ventricular zone at E9.5-E12,
5-HT precursors undergo what has been termed primary migration. During this
initial movement, 5-HT precursors undergo somal translocation, whereby the cell
body moves along its own process to more ventral regions of the neural tube
(Hawthorne et al., 2010). After these immature 5-HT neurons reach their
appropriate D-V position, they retract their processes, extend neurites and begin
producing 5-HT. Unlike cortical lamination processes, as new 5-HT precursors
migrate outward, cells are layered ever inward, positioned between older 5-HT
neurons and the ventricular zone. By E11.5, many 5-HT neurons have completed
this primary migration, although migrating neurons can still be observed through
E13.5. This layering process creates two bilateral clusters of immature 5-HT
neurons on either side of the midline along the D-V axis between the ventricle
and pial surfaces. Lmx1b may be involved in primary migration as Lmx1b
deficient 5-HT precursors are scattered along the D-V axis well away from the
midline at E13.5 (Ding et al., 2003).
Subsequent to the formation of bilateral clusters, 5-HT neurons undergo a secondary lateral movement both into and away from the midline, resulting in
34 fusion of the bilateral clusters to form the cytoarchitecture of the various raphe nuclei (Levitt and Moore, 1978; Lidov and Molliver, 1982a; Wallace and Lauder,
1983). This fusion is complete by the day of birth for the DRN and in the early postnatal period for the MRN. The B1 and B2 nuclei do not finish fusion until several days after birth (Levitt and Moore, 1978). B3 and B9 always remained paired nuclei, as they are situated lateral to the midline nuclei. It has been speculated that the fusion of the bilateral clusters may occur via a passive mechanism as due to extrinsic morphological changes to the neural tube (Lidov and Molliver, 1982a). However, intrinsic determinants must also be involved. In
Pet-1 null mice, a subset of developmentally halted 5-HT precursors are laterally displaced from the midline in the adult B7 nucleus (Krueger and Deneris, 2008).
The 5-HT neurons born at each rhombomere level populate specific nuclei based on fate mapping analysis using transcription factors marking the intersections between 5-HT neuron specific and rhombomere specific markers
(Figure 3) (Jensen et al., 2008). Cells born in r1 populate the entirety of the DRN and the dorsal portions of the MRN and B9 nuclei. Cells born in r2 and r3 populate the ventral portions of the MRN and B9. 5-HT neurons born in r5 compose the rostral portion of the caudal raphe nuclei; therefore, r6-r8-derived neurons must compose the rest of the caudal raphe nuclei.
Formation of ascending and descending projections
The rostral nuclei provide ascending projections to the forebrain and brainstem and the caudal raphe nuclei provide the descending projections to the
35
lower brainstem and spinal cord. Soon after 5-HT neurons complete primary
migration and begin to express 5-HT, they begin to extend axons while undergoing secondary migration (Lidov and Molliver, 1982b; Hawthorne et al.,
2010). Axons extend in bundles toward forebrain and spinal targets, splitting off as they reach target tissues. By P0, axons have reached target locations, but innervation and arborization continues into the postnatal period. Various intracellular components and signaling molecules have been identified in 5-HT neurite extension and guidance (Kiyasova and Gaspar, 2011).
One of the first steps in the extension of axons is their proper orientation
along the A-P axis. Wnt/ planer cell polarity (PCP) pathway signaling has been
implicated in 5-HT neuron orientation along the A-P axis (Fenstermaker et al.,
2010). In mice lacking the gene for the Wnt receptor, Frizzled3, axons from the
rostral domain that should only project rostrally, instead project laterally and
posteriorly at E12.5, while those in the caudal group that should only project
caudally, instead project randomly. Additionally, in Frizzled3 mutant mice, many
5-HT cell bodies fail to reorient along the A-P axis by E12.5. Mice with a mutation
in Van Gogh-like gene (Vangl2), also display caudally projecting axons from the
rostral domain and randomly projecting, tightly fasciculated axons from caudal
domain neurons. Deficits in a third PCP component, Celsr3, display many
laterally and caudally projecting rostral domain neurons, as well, but have only
mild misorientation defects in the caudal domain. Wnt5a has been suggested as
an orientation signal because of its expression pattern (along the midline, high
36
levels at the isthmus and caudal hindbrain with low expression in r4) and it can
attract 5-HT axons in explant cultures.
As axons extend in bundles toward distant targets, they are guided by
other factors. Slit/Robo signaling has been implicated in the guidance of the
medial forebrain bundle (Bagri et al., 2002). In Slit2 mutants, 5-HT+ axons in the medial forebrain bundle are ventrally displaced crossing the diencephalon and in
Slit1; Slit2 double mutants, many 5-HT+ neurons prematurely crossed the midline
within the basal telencephalon at E14.5. Finally, axons must defasciculate and
innervate their targets. Protocadherinα (Pdchα) gene subfamily was recently
identified to contribute to 5-HT+ axon innervation of multiple targets (Katori et al.,
2009). Rostral 5-HT neurons strongly express Pdchα from E14.5 through P14,
though it continues to be expressed in adulthood. During the early postnatal
period, 5-HT axons in Pdchα deficient mice reach their targets and appeared
normal at P0, however, these axons fail to fully arborize or distribute evenly
throughout the target fields. Abnormal distribution was observed in the
hippocampus, thalamus, cerebral cortex, olfactory bulb and substantia nigra.
Proteins involved in elongation and microtubule stability also contribute to
the ability of neurons to develop appropriate projections. In GAP-43 null mice,
there is a dramatic decrease in 5-HT+ axons present in the cerebral cortex and hippocampus, although there are normal numbers in the striatum and amygdala,
and greatly increased numbers in the thalamus during early postnatal time
periods and at P21 (Donovan et al., 2002). In the septum, axon density was
normal at P7 and decreased at P21. 5-HT and 5-HIAA levels reflected these
37
changes, with decreased levels in the cortex and increased levels in the
brainstem. The authors of this study speculate that the differences in the ability of
5-HT axons to innervate various brain regions could be due to differences in the
type of axon guidance being used. The microtubule-associated protein stable
tubule only polypeptide (STOP) has a similar effect on the ability of 5-HT axons
to innervate targets, with decreased Sert labeled axons in the cingulate cortex,
hippocampus and basal ganglia with increased density in the brainstem of adult mice (Fournet et al., 2010). 5-HT neurons displayed other abnormities as well,
including increased 5-HT synthesis and 5-HT1a autoreceptor levels in the
brainstem. The changes in Sert+ axons could be due to differences in the density
of axons or in the transport of Sert along the axon. STOP null mice display other
brain abnormalities that could also interact with 5-HT development.
5-HT transcriptional network and components - relevance to human health
Regulation of breathing and heart rate – similarity to SIDS
Medullary nuclei are involved in reflexive control of respiration, heart rate
and body temperature. In young pups with large deficits or absence of
serotonergic neurons due to germline targeting of Pet-1 or serotonergic specific
targeting of Lmx1b, have irregular breathing patterns with decreased intake and
frequency of ventilation along with increased occurrence and length of apneas
compared to control pups (Erickson et al., 2007; Hodges et al., 2009). These
deficits are due to disrupted and infrequent bursting activity from 5-HT neurons in
the medullary nuclei. Furthermore, Pet-1 null neonates experience episodes of
38
bradycardia during this period, often associated with apnea (Cummings et al.,
2010). The normal response to the hypoxic condition resulting from apnea or
bradycardia is a gasping reflex that restores breathing, heart rate and blood pressure. In Pet-1 null pups, this reflex is delayed (Erickson and Sposato, 2009)
and is more likely to fail to restore normal heart rate after multiple episodes
(Cummings et al., 2011). These abnormalities lead to increased likelihood of
death during the early postnatal period (Erickson et al., 2007; Hodges et al.,
2009; Cummings et al., 2011).
Sudden infant death syndrome (SIDS) has many components in common
with 5-HT neuron deficient neonates (Kinney et al., 2009; Paterson et al., 2009) ).
The triple risk hypothesis proposes that the interaction of three factors: 1) an
underlying vulnerability 2) during a critical period is 3) exasperated by a stressor.
While there are many potential vulnerabilities, abnormalities in respiratory
rhythm, gasping or inhalation initiation are thought to be common. The critical
period is the first six postnatal months. Stressors are probably a normal sleep-
related occurrence following a hypoxic or bradycardia event. Approximately 70% of SIDS infants present with markers for of 5-HT function abnormalities, including altered number of immature medullary 5-HT neurons, abnormal synapse formation, low 5-HT receptor or 5-HTT expression, altered TPH2 expression and
5-HT levels. Moreover, polymorphisms in 5-HTT, MAOA and FEV have been found to be associated with SIDS.
39
Maternal care
The 5-HT system is important for complex behaviors associated with maternal care and offspring survival. Dams with very low levels of brain 5-HT due to genetic ablation of Pet-1 or Tph2 have a high rate of neonatal pup death probably due to reduced ability to retrieve and huddle pups (Lerch-Haner et al.,
2008; Alenina et al., 2009). Pet-1 null dams fail to produce a well-structured nest
(Lerch-Haner et al., 2008). The extent of the maternal care deficit is dependent on the level of Pet-1/FEV and 5-HT expression. Dams lacking functional 5-HT1B receptor gene also have deficits in pup retrieval and nest building, which does not precipitate increased neonatal death but may contribute to reduced weight of offspring (van Velzen and Toth, 2010). Thus, the 5-HT system is important for care and survival of offspring.
In humans, the incidence of prepartum and postpartum depression are associated with reduced growth and delay in development for fetus and infant and emotional/behavioral difficulties in childhood (Field, 2011). Treatment of depression with drugs also impacts the physiological and behavioral development of offspring (Gentile, 2005, 2007; Lattimore et al., 2005).
Furthermore, the neurobehavioral profile of differ between infants of a mother with major depressive disorder with and without serotonin reuptake inhibitor treatment (Salisbury et al., 2011). Negative events early in life lead to increased anxiety and depressive response during later life in rodents, primates and humans, and these are seen to be associated with the 5-HT system (Kofman,
2002; Holmes et al., 2005; Vergne and Nemeroff, 2006; Veenema, 2009; Hale et
40
al., 2011; Nugent et al., 2011). Thus, serotonin system alterations in a mother
impact the development and quality of life of the offspring.
Mood and emotional behaviors
Mice with disrupted serotonergic system function display alterations in mood and emotion. However, there is some variation between genetic models, genetic background and testing environment (Fernandez and Gaspar, 2012).
Three aspects of mood and emotional behaviors tested in mice and of relevance
to humans are anxiety-like, depressive-like, and aggressive behaviors.
Anxiety-like behaviors are tested by putting a mouse in an environment
that conflicts innate behaviors, such as exploration or feeding, against aversive
properties of the environment, such as a novel, elevated, well lit or leaves the
mouse exposed. Mice with conditional targeting of Lmx1b (Lmx1bflox/flox; ePet-
Cre) and Vmat2 (Vmat2flox/flox; Sert-Cre) and Sert overexpression display reduced
innate anxiety-like behaviors such as a shorter delay to feed in novelty-
suppressed feeding and increased time in open arms of an elevated plus maze
(Jennings et al., 2006; Dai et al., 2008; Narboux-Nême et al., 2011). Pet-1 null
mice on a mixed 129/Sv*C57BL/6 background have displayed increased anxiety
related behaviors on the elevated plus maze and open field (Hendricks et al.,
2003), while Pet-1 null mice on a mostly C57BL/6 background display decreased
anxiety related behaviors on elevated mazes (Schaefer et al., 2009; Kiyasova et
al., 2011). 129/Sv mice display higher levels of innate anxiety than C57BL/6
(Hagenbuch et al., 2006). This is also complicated by the finding of control levels
41 of locomotor behavior on a mixed background (Hendricks et al., 2003) versus at reduced levels on the C57BL/6 background (Schaefer et al., 2009). Likewise mice with Tph2 null mutations have been observed to have normal or slightly reduced innate anxiety responses (Savelieva et al., 2008; Fernandez and
Gaspar, 2012). Both Lmx1b conditional knockout and Pet-1 null mice display increased fear memory (Dai et al., 2008; Kiyasova et al., 2011). Furthermore, mice with genetic ablation of Sert on a C57BL/6 background display increased anxiety-like behaviors (Holmes et al., 2003). Anxiety-related behavior may be due to developmental consequences of 5-HT system disruption or due to continued 5-HT system function in the adult. Conditional targeting of Pet-1 in adult mice on a mixed genetic background still display increased anxiety-like behaviors (Liu et al., 2010). Thus, the 5-HT system contributes to the anxiety state of the animal, however the effects of 5-HT system dysfunction on anxiety is more complicated, especially as both anxiety responses and 5-HT system function are affected by experience and environment.
The amount of time spent immobile during forced swim test or tail suspension test has been suggested to be a measure for depressive-like behavior because immobility time is reduced by treatment with antidepressant drugs. Vmat2 conditional knockout mice display decreased immobility in both tests (Narboux-Nême et al., 2011). Tph1/2 null mice also display decreased immobility in the forced swim test, possibly due to an inability to float, and increased immobility in the tail suspension test (Savelieva et al., 2008). Pet-1 mice were not different from controls for either test (Schaefer et al., 2009).
42
Low levels of 5-HT have also been associated with increased aggressive behaviors. Pet-1 null and Tph2 null mice display increased aggressive behaviors
(Hendricks et al., 2003; Alenina et al., 2009; Fernandez and Gaspar, 2012).
Increased marble burying has been suggested to be related to aggressive
behaviors, although this is not the consensus. Pet-1 null mice, Tph2 null mice,
Tph1/2 null bury more marbles than controls (Savelieva et al., 2008; Schaefer et
al., 2009; Fernandez and Gaspar, 2012). High extracellular 5-HT levels due to
genetic ablation of Sert reduces aggressive behaviors in a resident intruder
assay in a dosage dependent manner (Holmes et al., 2002).
In humans, 5-HT system dysfunction in also associated with altered mood
and neuropsychiatric conditions including anxiety disorders, depression, bipolar
disorder and aggression. Polymorphisms and SNPs in the SERT gene, SLCA4,
are one of the best studied (Murphy and Lesch, 2008; Caspi et al., 2010;
Nordquist and Oreland, 2010). The length of the 5-HTTLPR region and two
SNPs, rs25531 and rs25332 upstream of the transcriptional start site alter the
expression level of SLCA4, while other polymorphisms and SNPs alter the
protein. The short version of the 5-HTTLPR polymorphism reduces the level of
expression in mice, monkey and humans and is associated with anxiety-related
behaviors. The number of repeats in the MAOA-LPR region upstream of the
transcriptional start site alters the expression level of MAOA and has also been
associated with anxiety, depression and aggression (Nordquist and Oreland,
2010). Low levels of expression are correlated with maladaptive behaviors. In
both of these cases, factors of experience and environment alter the effect of the
43 genotype (Caspi et al., 2010; Nordquist and Oreland, 2010). Genetic analyses of humans have associated genetic variation in multiple components of the 5-HT system with aggression, including SLCA4, MAOA, and 5-HT receptors, and
TPH2 (Takahashi et al., 2011). Therefore, 5-HT system development and function, in conjunction with life experience, influence mood and emotional behaviors in rodents and humans.
Neurodevelopment – implications for autism spectrum disorder
Extracellular 5-HT has been implicated in the development cortical areas.
Early in development, E10.5 – E15.5, the largest source for 5-HT in the forebrain is from the placenta, while in the hindbrain, it is from maturing 5-HT neurons
(Bonnin and Levitt, 2011; Bonnin et al., 2011). After E15.5, embryonic 5-HT neurons provide most CNS 5-HT. During g development, some neurons in the developing forebrain express Sert and Vmat2, and thus can take up and store extraneously produced 5-HT (Lebrand et al., 1998). Alteration of 5-HT system development and function during embryogenesis and the early postnatal period may underlie susceptibility to neurodevelopmental and acquired disorders.
Extracellular 5-HT levels regulate the outgrowth and synapse development of axons and dendrites. High levels of 5-HT inhibit axon elongation of 5-HT neurons themselves, as increased levels of 5-HT in vitro or through drug treatment during the embryonic or early postnatal reduce 5-HT neuron outgrowth and terminal density in the forebrain(Whitaker-Azmitia and Azmitia, 1986;
Haydon et al., 1987; Shemer et al., 1991; Whitaker-Azmitia et al., 1994). Both
44
excessive and inadequate levels of 5-HT disturbs formation of cortical circuits.
One extensively studied example is that of the formation of barrel structures of the somatosensory cortex. Reduction or ablation of 5-HT through drug treatment
during the early postnatal period delays development of thalamocortical afferent
circuits forming the barrel fields and reduces their activity in the young adult (Blue
et al., 1991; Turlejski et al., 1997; Rhoades et al., 1998). Increased 5-HT through
pharmacological block of Maoa or Sert during the early postnatal period altered
barrel size, organization and refinement of barrels (Vitalis et al., 1998; Boylan et
al., 2000; Xu et al., 2004).
Appropriate levels of extracellular 5-HT are also important for generation
or maintenance of the proper number and location of neurons. In the absence of
Sert function on a C57BL/6 background, many areas of the cortex are thicker and
have increased neuronal density (Altamura et al., 2007). Apoptosis is decreased
in multiple brain areas on P1 in Sert null mice (Persico et al., 2003). Decreased
levels of extracellular 5-HT by germline targeting of Vmat2 results in increased
cell death in the cingulate and retrosplenial cortices during the neonatal period,
which is rescued by increasing 5-HT signaling with treatment of a 5-HT2 receptor
agonist (Stankovski et al., 2007). Low levels of 5-HT by Tph inhibition during late
embryogenesis also reduces cortical thickness and delays incorporation of
interneurons (Vitalis et al., 2007). High levels of 5-HT inhibits interneuron
migration in cortical slice culture and alts distribution of interneurons in Sert null
mice (Riccio et al., 2009).
45
Autism spectrum disorder is a diverse group of disorders often the result
of the interaction of multiple genetic susceptibility genes and environment that
result in altered brain development leading to altered neuronal organization and
connectivity (Pardo and Eberhart, 2007; Fatemi et al., 2012). Some of the
consistent findings of cortical abnormalities include increased neuronal density in
some areas and disordered and ectopic neurons in cortical layers (Pickett and
London, 2005; Persico and Bourgeron, 2006). Interneuron distribution was also
altered in the cortex. Abnormal cell densities and area volume were also
observed in other brain areas including the cerebellum, motor system and
amygdala. These alterations are similar to observed changes in brain
development due to manipulated brain 5-HT levels.
5-HT system functioning is altered in many individuals diagnosed with
ASD. A common finding amongst studies of ASD is that 5-HT levels in the blood
are increased (Pickett and London, 2005). Some studies have identified reduced
density and/or altered distribution of 5-HT1A and 5-HT2A receptors in the cingulate
cortex, temporal cortex and parietal cortex. Furthermore, a recent analysis found
increased rates of ASD in children born to mother who had taken SSRIs in the
year prior to delivery or while pregnant, especially in the first trimester (Croen et
al., 2011). SSRIs could increase 5-HT levels in the fetal brain, although the condition for which the mother was taking SSRIs or underlying genetic or other environmental factors could potentially increase risk. Polymorphisms in the
SLCA4 are often identified as a potential susceptibility factor. Various analyses
have found increased transmission of either the long or short version of the
46
5HTTLPR alleles or lack of association (Cook et al., 1997; Klauck et al., 1997;
Maestrini et al., 1999; Tordjman et al., 2001; Yirmiya et al., 2001). More detailed analyses have identified complex haplotypes (Kim et al., 2002; Conroy et al.,
2004; McCauley et al., 2004; Devlin et al., 2005), possibly due to the interactions
of multiple polymorphisms and associations with subsets of individuals. For
example, haplotypes including variations of four coding SNPs and 15 non-coding
SNPs were identified to be over transmitted to males diagnosed with ASD
(Sutcliffe et al., 2005). Another found increased transmission of the short
5HTTLPR allele from the mother, but not the father, associated with ASD
(Kistner-Griffin et al., 2011). Haplotypes of other 5-HT components have been
found to be over transmitted: MAOA (Davis et al., 2008; Tassone et al., 2011), 5-
HT2A (Hranilovic et al., 2010), 5-HT1B (Orabona et al., 2009), 5-HT3C (Rehnström
et al., 2009), however these have yet to be confirmed. Alterations in 5-HT system
development or function may contribute to or be affected by ASD; however,
mouse models can contribute insight into mechanisms that might be involved.
Engrailed
The engrailed (En) genes code for a homeodomain transcription factor
that is highly conserved through evolution and has been found to be involved in
many aspects of development. The structure of the En genes are conserved
between species and paralogs, containing two exons with a single intron (Figure
4A) (Gibert, 2002). In most vertebrates, there are two En genes, En1 and En2. In
47 higher insect taxa, such as Drosophila, there are also two genes, engrailed (en) and invected (inv). In most systems, the expression patterns of the two engrailed genes overlap, though there is generally some variation in temporal or spatial expression, which leads to differences in roles or tissue sensitivity. The En protein contains five highly conserved motifs EH1-5 (also referred to as domains
1-4 where EH2 and EH3 are combined into domain 2) (Figure 4B) (Logan et al.,
1992; Gibert, 2002). EH4 is the homeodomain. EH1 bind to Groucho proteins and EH2 and EH3 bind to Extradenticle/Pbx proteins. EH5 is specific to En and is involved in transcription repression. There is a high level of conservation between the engrailed proteins across evolution (Figure 4C). Within vertebrates the amino acid sequence of these motifs is 95-100% conserved within either En1 or En2 and 92-95% conserved between En1 and En2 (Logan et al., 1992). The amino acid sequence located between these motifs varies more between vertebrate species. The extent of En conservation can be observed by examining the phenotypes of mice in which the En1 coding region has been replaced with either Drosophila en or En2 coding regions (Hanks et al., 1995, 1998; Sgaier et al., 2007).
En1 deficient mice die within a day of birth, failing to feed (Wurst et al.,
1994). Newborn pups have limb and sternum defects, likely the result of defects in induction signaling from surrounding tissues. In the brain, there are large deficits in midbrain and cerebellar tissue (see below). En2 null mice are viable with mild defects in the development, size and foliation pattern of the cerebellum
(Joyner et al., 1991; Millen et al., 1994). In absence of expression of both En1/2
48
genes, tissue loss in the midbrain and cerebellum are more severe (Liu and
Joyner, 2001a; Simon et al., 2005). The Drosophila en protein is sufficiently
similar to fulfill many of the roles of En1 when the coding region of the En1 gene
is replaced with the coding region for Drosophila en (En1Denki) (Hanks et al.,
1998); more than half of the mice survived to adulthood, with a normal appearing
midbrain and cerebellum. However, it is not completely sufficient because there
were still subtle cerebellar defects, as well as digit and sternum defects (Hanks et
al., 1998) and in absence of En2 expression, the tectum and cerebellum fail to
develop (Sgaier et al., 2007). Additionally, En1 and En2 retain similar protein
structures and biochemical functions whose main differences in function relate to
differences in expression patterns. When the En1 coding region is replaced by
the coding region from En2 (En1En2ki), all of the roles of En1 can be recapitulated on a gross level; En1En2ki mice survived to adulthood and had normal appearing
sternum, digits, midbrain and cerebellum (Hanks et al., 1995). However, it is
unable to fulfill the function of En1 in the development of the postnatal limbs
(Hanks et al., 1998). Even in absence of endogenous En2 expression, En2
expressed from the En1 locus can fulfill almost all of the roles of En1 in the brain
(Sgaier et al., 2007).
Roles in the CNS
The engrailed genes govern to multiple aspects of development, including
segmentation (Kornberg, 1981), limb development (Wurst et al., 1994; Loomis et
al., 1996), include mid-hindbrain patterning (Liu and Joyner, 2001b)
49 neurogenesis and cell-type fate selection (Condron et al., 1994; Bhat and Schedl,
1997; Simon et al., 2005; Watson et al., 2011), axon guidance (Friedman and
O’Leary, 1996; Itasaki and Nakamura, 1996; Matise and Joyner, 1997;
Saueressig et al., 1999; Brunet et al., 2005; Wizenmann et al., 2009)and cell survival (Alavian et al., 2008; Alvarez-Fischer et al., 2011). The following section focuses on these roles in the nervous system, which are just a subset of tissues whose development is directed by En. In both insects and vertebrates, En contributes to early developmental tissue patterning, cell type specification and neuronal circuit formation. In mammals, En also contributes to the survival of dopaminergic neurons.
Tissue patterning
En roles in tissue patterning of the cerebellum and tectum arise from
En1/2 expression as part of the mid-hindbrain organizer. En1 and En2 are expressed across the mesoderm and r1, where they help to maintain the MHO
(Liu and Joyner, 2001b; Zervas et al., 2005). The cerebellum and tectum are derived from the dorsal r1 and mesoderm, respectively (Zervas et al., 2004), and display En1/2 dosage dependent patterning.
En1/2 play multiple roles in the development and patterning of the cerebellum. Specific roles in neurogenesis, cell-type specification, and specification of the circuitry map collaborate to generate the overall patterning necessary for the proper development and function of the cerebellum. Initially,
En1 , and to a lesser extent En2, expression is required as a part of the mid-
50 hindbrain organizer for the generation of the dorsal r1 tissue that will give rise to most of the cerebellum (Wurst et al., 1994; Liu and Joyner, 2001a; Simon et al.,
2005). After E9, En1 regulates cerebellar patterning in more subtle ways, and
En2 takes over as the dominant paralog (Sgaier et al., 2007). En2 is involved in the timing of the formation of the anchoring centers that form the basis for individual lobules, thus contributing to the abnormal foliation patterns observed in the En2 null mouse (Sudarov and Joyner, 2007). Both genes contribute to the regulation of foliation, together producing a spatial and temporal “En code” that regulate the timing of development and positioning of cerebellar lobes and fissures (Millen et al., 1994; Sgaier et al., 2007; Cheng et al., 2010). Alterations in this code by using temporal (conditional targeting using Cre transgenes or Cre-
ER transgenes) and functional mutants (En1Denki or En1En2ki in combination with
En2 null alleles) results in a series of cerebellar phenotypes which include changes in the size, position and separation/fusion of lobules, as well as the timing and position of fissure formation. This code is observed, in part, by the differential sensitivity of cerebellar subregions to En1 or En2 expression and/or function, which may help divide the cerebellum into functional domains (Sgaier et al., 2007). This molecular code independently instructs gene expression patterns of Purkinje cell subpopulations, forming Purkinje cell parasagittal stripes along the mediolateral axis (Sillitoe et al., 2010; Wilson et al., 2011). These parasagittal stripes are marked by expression of ZebrinII or Hsp25, but more importantly provide axon guidance cues which are necessary for proper targeting of mossy fiber afferents and formation of cerebellar circuits (Sillitoe et al., 2010).
51
Overexpression delays the maturation of Purkinje cells including the expression of paravalbumin, the formation of a monolayer, reduced somal size, altered shape and delays dendritogenesis (Baader et al., 1998; Hayn-Leichsenring et al.,
2011). In addition, there is a decrease in the number of Purkinje cells, which could be the result of longer than normal maintenance of progenitors in a proliferative state (Benayed et al., 2005). En1 and En2 continue to be expressed in different cell subpopulations in the adult, suggesting long term roles in maintenance or function, as well (Wilson et al., 2011).
The tectum is another example of En roles in tissue patterning with dosage dependent tissue generation (Sgaier et al., 2007). Differences in En1 and
En2 expression patterns provide a molecular code that divides the tectum into the morphologically and functionally distinct colliculi. Analysis of the development of the superior and inferior colliculus using temporal and functional En mutants found that because of differences in gene expression patterns, the inferior colliculus is more sensitive to the loss of En1 expression, while the superior colliculus is less so (Sillitoe et al., 2008). While mice lacking all four En alleles
(En1-/-; En2-/-) fail to produce the tectum, some superior colliculus could be produced in En1Denki/Denki; En2-/-, En1flox/Cre; En2+/-, or En1-/-; En2+/+ mice, but at least one wild type En1 allele was required for generation of some inferior colliculi tissue. Surprisingly En2 expression from the En1 locus (En1En2ki; En2-/-) produced more inferior colliculus tissue.
In the Drosophila embryo, en patterns neuroectoderm by differentially directing expression of dorsally or ventrally specifying genes in the
52
deutocerebrum and tritocerebrum respectively, thus governing the proper
expression of gene patterns across the A-P and D-V axes (Seibert and Urbach,
2010).
Fate selection/ terminal cell type generation
En1/2 governs the specification of specific terminal neuronal cell types. In the mouse, En1 and En2 regulate the generation of two types of terminally differentiated neurons born in r1, while their caudally derived counterparts are not. Additional examples come from Drosophila development, where en specifies
serotonergic neurons and NB5-3, and from Schistocerca where en mediates the
fate decision between midline glia and neurons.
En1/2 govern the development of a subset of NA neurons. NA neurons
that are born in alar plate of r1 populate the locus coeruleus, while the
noradrenergic neurons that populate nucleus subcoeruleus derived from a more
caudal rhombomere (Puelles and Medina, 1994; Puelles and Verney, 1998;
Aroca et al., 2006) . In absence of expression from both En genes (En1-/-; En2-/-),
NA neurons of the locus coeruleus are absent at P0, while nearby NA neurons in the nucleus subcoeruleus are unaffected (Simon et al., 2005). En1 plays the
more dominant role in the early development of NA neurons. A single En1 allele
(En1+/-; En2-/-) is sufficient for normal numbers of locus coeruleus NA neurons,
however, in En1 null mice (En1-/-; En2+/+), the number of NA neurons in the locus
coeruleus is decreased. The severity of cell loss increases with additional loss of
an En2 allele (En1-/-; En2+/-). This suggests that En1/2 are important for the
53
development of this subset of NA neurons, however it is not clear what role
En1/2 play. Because the role of En1/2 in NA development has only been
analyzed using constitutive null alleles, it is not clear whether En1/2 are involved
in a cell autonomous manner or through an indirect mechanism. Additionally, the
loss of NA neurons could be due to early loss of progenitors or precursors or the
neurons themselves. The authors show that NA neurons are located away from
the domain of En expression at E12.5, after cell loss, which suggests either an
earlier cell-autonomous role or a non-cell-autonomous role (Simon et al., 2005).
The production of a subset of 5-HT neurons is dependent on En
expression in both the mouse and Drosophila. In the mouse, serotonergic
neurons born in r1 are derived from En1 expressing cells (Zervas et al., 2004).
These En1-derived cells populate the DRN and dorsal MRN, which is mostly
populated by r2- and r3-derived cells (Jensen et al., 2008). In En1/2 double
mutants (En1-/-; En2-/-), there is almost a complete absence of DRN 5-HT+
neurons at P0, while the number of 5-HT+ neurons MRN are unaltered (Simon et
al., 2005). As expected from the relatively minor phenotypes observed in En2 null
mice, DRN 5-HT neurons appear in normal numbers and distribution. In these
mice, there are normal 5-HT levels in most of the brain, however, 5-HT is
elevated in the cerebellum, which may suggest slight alterations to the rostral 5-
HT system (Cheh et al., 2006). In En1 null mice, the DRN is slightly decreased in
size, but the number of 5-HT+ neurons is unaltered (Simon et al., 2005).
Therefore, En1 and En2 can largely compensate for the loss of the other during early development. En1 and En2 are not completely equivalent, however,
54
because a single allele of En1 (En1+/-; En2-/-) is sufficient for normal cell numbers,
while a single allele of En2 (En1-/-; En2+/-) is not. The underlying cause for the
absence of DRN neurons is unknown. Pet-1 expression is diminished in the
rostral hindbrain at E12.5 along with a reduction in 5-HT+ neurons, which could
indicate a failure to differentiate or early cell body loss (Simon et al., 2005). While
immunohistochemical detection of En expression was not observed in 5-HT
neurons at E12.5 (Simon et al., 2005), En1 and En2 RNA transcripts were highly
enriched in cell sorted 5-HT neurons at the same age (Wylie et al., 2010). As with
NA neurons, the use of constitutive null alleles precludes determination of
intrinsic verses extrinsic roles and the developmental timing of these roles. A
similar process may be involved in the development of the subset of Drosophila
ganglionic 5-HT neurons born from the progenitor NB7-3. At the neuroblasts
stage, en directs eagle expression to drive development of the NB7-3 lineage
toward 5-HT cell fate (Lundell et al., 1996; Dittrich et al., 1997), and at a later
stage, after the GMC1 division, eagle maintains en expression to drive terminal
differentiation of 5-HT neurons (Lundell and Hirsh, 1998). When en is mutated,
only 20% of the expected number of 5-HT+ neurons develop from the NB7-3
lineage, and when both en and inv are deleted, no 5-HT+ neurons develop
(Lundell et al., 1996).
En is necessary for the neuronal-glial fate decision of median neuroblasts in the grasshopper (Schistocerca americana) embryo and for the glial-type
selection of midline glial cells in the Drosophila embryo. In the first example, multipotent progenitor cells, median neuroblasts, give rise to the midline glia and
55 most midline neurons, which express en during neurogenesis (Condron et al.,
1994). When en expression is blocked, the cells that should become midline glia, instead take on a neuronal fate, including gene expression and location, however most of these mis-specified cells lack processes. In the second example, two types of midline glia, anterior midline glia and posterior midline glia, differentiate from midline precursors with differences in gene expression patterns, migration patterns and the ability to ensheath axons (Watson et al., 2011). In response to hedgehog signaling, en specifies posterior midline glia and through mutual repression with the RUNX-transcription factor runt, maintains cell type specific gene expression for the two types of the midline glia.
In the Drosophila embryonic neuroectoderm, either en or inv is necessary to specify the progenitor NB5-3, thus preventing it from becoming NB4-2 by default (Bhat and Schedl, 1997). En/inv expression from neuroblasts in row 6/7 creates a signal that suppresses patched expression in row 5 neuroblasts
(including NB5-3 or its precursor), which prevents it from downregulating gooseberry, which in turn, initiates and maintains expression of wingless and
NB5-3 identity. Other row 5 neuroblasts also require gooseberry expression for specification; however, additional factors prevent gooseberry downregulated until after specification. Thus, en/inv contribute to the posterior-to-anterior cell-type specific patterning.
56
Cell survival
En plays a distinct role in mesDA neurons; they are necessary for mesDA
neuron survival in a cell autonomous (Albéri et al., 2004) and dosage dependent
fashion (Simon et al., 2001; Sgadò et al., 2006; Sonnier et al., 2007). En1/2 are expressed in postmitotic mesDA neurons beginning between E12 and E14, several days after neurogenesis, and continue to be expressed in adult substantia nigra and midbrain ventral tegmental area DA neurons (Simon et al.,
2001; Albéri et al., 2004). In absence of both genes (En1-/-; En2-/-), mesDA
neurons are generated and express tyrosine hydroxylase, however they undergo
apoptosis by E14. In the presence of a single En2 allele (En1-/-; En2+/-), some
mesDA neurons survive to P0, but considerably fewer than wild type. However,
expression from a single En1 allele (En1+/-; En2-/-) or both alleles of either gene
(En1-/-; En2+/+ or En1+/+; En2-/-) is sufficient to allow mesDA survival to P0. This is only a delay in cell death, as mesDA neurons degenerate postnatally in En1+/-;
En2-/- (Sgadò et al., 2006) and En1+/-; En2+/+ mice (Sonnier et al., 2007).
Surprisingly this neuroprotective role is not due to the role of En as a
transcription factor, but by protecting against apoptosis by 1) increasing the
translation of mitochondrial complex I proteins Ndufs1 and Ndufs3, which in turn
increases the activity of complex I, the impairment of which can lead to degeneration (Alvarez-Fischer et al., 2011) and 2) by downregulating the expression of the P75NTR, whose overabundance predicates caspase-dependent
apoptosis (Alvarez-Fischer et al., 2011). En may also regulate the expression of
α-synuclein (Simon et al., 2001), which is found as a component of Lewy bodies
57
and mutations of which have been associated with some familial and sporadic
forms of Parkinson’s Disease (Vekrellis et al., 2011). As DA survival has only
been studied using constitutively null alleles of En1/2, the loss of DA neurons
may be due to early developmental defects.
Axon guidance
En proteins direct axon development and guidance through several
mechanisms. In the developing vertebrate tectum, En1/2 expression in the
tectum non-cell autonomously direct retinal axons (Friedman and O’Leary, 1996;
Itasaki and Nakamura, 1996; Brunet et al., 2005; Wizenmann et al., 2009),
whereas in spinal interneurons, En1/2 cell-autonomously control axon guidance
(Matise and Joyner, 1997; Saueressig et al., 1999). En can act as a traditional
transcription factor (Matise and Joyner, 1997; Saueressig et al., 1999), regulating transcription, but they can also act as a signaling protein themselves
(Wizenmann et al., 2009), possibly affecting axonal behavior through regulating translation (Brunet et al., 2005). Furthermore, depending on the system, En may contribute to various stages of axon targeting.
In the early tectum, En1 and En2 expression create both an internal and external caudal-to-rostral gradient that is necessary for the proper topographical distribution of retinal axons (Davis and Joyner, 1988; Martinez and Alvarado-
Mallart, 1990; Davis et al., 1991; Gardner and Barald, 1992). One way that En1/2
expression contributes to the distribution of retinal axons is by regulating the
expression of Ephrins whose gradient patterns the distribution of retinal axons.
58
The Ephrins, EphrinA2 (ELF-1) and EphrinA5 (RAGS), form a caudal to rostral gradient parallel to En expression, where high expression in the caudal tectum is permissive to nasal retinal axons but repel temporal retinal axons (Cheng et al.,
1995; Drescher et al., 1995). Over expression of En1 or En2 in the chick tectum can upregulate and induce ectopic expression of EphrinA2 and EphrinA5 (Logan et al., 1996; Shigetani et al., 1997), resulting in excessive nasal retinal axons in the tectum and stunted temporal retinal axon, which often fail to enter the tectum
(Friedman and O’Leary, 1996; Itasaki and Nakamura, 1996). A second mechanism for En1/2-dependent guidance of retinal axons is by acting as an extracellular gradient itself. In the developing chick and Xenopus tectum, En1/2 form a caudal-to-rostral gradient as an external, membrane-bound protein
(Wizenmann et al., 2009). When temporal axons are given the ability to block the cell-external En signal, they aberrantly project into the caudal tectum. A similar result is seen using wild type retinal axons on En1 deficient neonatal mouse tectum in vitro. This effect appears to be due to a cooperative effect of membrane bound En increasing cell sensitivity to EpherinA5. Another potential mechanism could be through internalization of an external En signal, which has been observed for En2 by Xenopus retinal axons in vitro (Brunet et al., 2005).
This process allows for attraction of nasal retina axons and repulsion of temporal retinal axons and through a translation-dependent mechanism.
En1 is expressed in, and is important for the axon targeting of a subset of postmitotic locally projecting ipsilateral interneurons in the ventral spinal cord that project to somatic motor neurons in a two-step process, first ventrally and then
59
rostrally as a part of the ventrolateral funiculus (Matise and Joyner, 1997;
Saueressig et al., 1999). Although not critical for differentiation or for the initial
ventrally oriented axonal outgrowth, En1 is necessary for the proper organization
of axons during the second stage of axonal outgrowth. En1-deficient axons are disorganized, with some growing dorsally as well as rostrally, fasciculate into bundles not observed in controls, and terminals are distributed unevenly through target tissue. While the mechanism for En1-directed targeting is unknown, En1 expression in the interneurons suggests it could function as a transcription factor.
In the larval cockroach (Periplaneta americana) cercal system, Pa-en1 and Pa-en2 are expressed in medial mechanosensory neurons, 6m, and not in a nearby lateral set of mechanosensory neurons, 6d (Marie and Bacon, 2000;
Marie et al., 2000, 2002). Pa-en1/2 directs specific targeting of 6m axons to a distinct set of giant interneurons in the terminal ganglion, thus setting up the circuitry to respond to movement or wind flow behind the cockroach. Pa-en expression in postmitotic 6m neurons is sequentially required for the selection of axonal pathway (either that of the medial- or lateral-type neuron), axon arbor anatomy and synaptic targets selection, but not for specification or maintenance of identity. Pa-en1 and Pa-en2 act in concert for axon guidance, but Pa-en1 independently controls recognition of synaptic targets (Marie and Blagburn,
2003). It is not clear whether control of axon targeting is due to cell-intrinsic or cell-extrinsic mechanisms. Miswiring alters the direction that an juvenile cockroach will move in response to the direction of wind flow behind it, suggesting altered perception of the direction of wind flow (Booth et al., 2009).
60
Engrailed and mental health
Autism spectrum disorders (ASD) are a group of developmental disorders caused by changes in prenatal and postnatal brain development that result in altered neuronal organization and connectivity (Pardo and Eberhart, 2007;
Fatemi et al., 2012). The underlying susceptibility to development of ASD is thought to be the result of multiple factors including genetics and environment.
Several lines of evidence have led to the suggestion that En2 mutant mice could provide useful insight into ASD or that alterations in En2 expression or function might be associated with susceptibility to ASD.
First, the human En2 gene lies within an autism susceptibility locus on chromosome 7 (7q36.3) (Logan et al., 1989; Poole et al., 1989; Petit et al., 1995;
Liu et al., 2001; Alarόn et al., 2002; Auranen et al., 2002). Subsequently, multiple analyses of SNPs within En2 have found haplotypes that are more common in children diagnosed with autism. Analysis of SNPs in the En2 gene have found haplotypes that have increased rates of transmission from non-autistic parents to children diagnosed with autism from multiple populations: four American populations of mainly of European descent (Gharani et al., 2004; Benayed et al.,
2005, 2009; Brune et al., 2008), Chinese Han population (Wang et al., 2008), and an Indian population (Sen et al., 2010), while other studies failed find association with other SNPs (Chien et al., 2011). The particular SNPs analyzed in each study differed. One pair of SNPs was studied in all three populations and found to be associated with autism in all three populations under both narrow
(autism) and broad (autism spectrum disorders) definitions. The rs1861972 (A/G)
61 and rs1861973(C/T) (A-C and G-T haplotypes) alleles located in close proximity to one another within the intron. These are considered common variants and often occur together. The A and C alleles and A-C haplotype have been associated with an autistic diagnosis in most studies, however one study found in lower frequency in individuals diagnosed in autism than unrelated controls in a
Chinese Han population (Yang et al., 2008). In vitro analysis of the functional consequences of the A-C haplotype compared to the G-T haplotype suggests that the A-C haplotype increases the amount of En2 RNA and protein produced, possibly by producing additional transcription factor binding sites not found in the
G and T alleles (Benayed et al., 2009). The A allele of rs1861972 lies within a canonical binding site, CCAAT, of the transcription factor families NF1, NFY, and
C/EBP, which is predicted to be disrupted in the G allele (CCAGT). The C allele of rs1861973 lies within consensus binding sites for transcription factors of the
Sp1 and Ets families, CCTGC and CCTGCCC respectively, which could also be disrupted with the T allele. The variation in alleles could affect either transcription or splicing of En2 and the resulting underexpression or overexpression could alter neuronal development.
Secondly, morphological and behavioral similarities have been noted between ASD and En2 mutant mice. Histological and medical imaging analyses have suggested that alterations in cerebellar development, which may be fundamental to the progression of the disorders, are similar to alterations observed in En2 null mice (Kuemerle et al., 2007; Fatemi et al., 2012). ASD is associated with abnormal growth patterns in the cerebellum, cerebrum and
62
amygdala (DiCicco-Bloom et al., 2006; Fatemi et al., 2012). In some cases, the
cerebellar vermis and lobes are reduced, which is similar to observations of the
En2 null mouse (Millen et al., 1994; Sgaier et al., 2007; Cheng et al., 2010).
Decreases in the number of cerebellar Purkinje neurons have also been noted in a subset of ASD cases in multiple postmortem studies (Kinnear Kern, 2003; Blatt,
2005; Kern and Jones, 2006; Fatemi et al., 2012) and have been observed in mice with En2 null mutations and overexpression (Kuemerle et al., 1997; Baader et al., 1998; Hayn-Leichsenring et al., 2011). Behavioral symptoms of children with ASD fall into three main core domains: deficits in communication, abnormal social interactions and restrictive and or repetitive behaviors (DiCicco-Bloom et
al., 2006). While language cannot be studied in mice, En2 null mice display behavioral phenotypes, which are reminiscent of some behaviors observed in
children with ASD. Young adult mice display reduced play-like interactions
including chasing, climbing over and pushing under another mouse of the same
genotype, age and sex (Cheh et al., 2006). Furthermore, adult En2 null mice also
display reduced exploratory behavior. Individuals with ASD have difficulties with
spatial attention tasks (Marco et al., 2011) and En2 null mice have defects in
spatial learning tasks (Cheh et al., 2006). These similarities suggest that En2
mutant mice could be useful for learning about ASD, even if En2 is not directly
related to the disorder.
Mice with null alleles for En1/2 have been proposed as a model for
Parkinson’s disease because midbrain dopaminergic neurons degenerate
postnatally (Sonnier et al., 2007; Sgadò et al., 2008). En1+/-; En2-/- and En1+/-;
63
En2+/+ mice display gradual degeneration of DA neurons preferentially from the
substantia nigra (Sgadò et al., 2006; Sonnier et al., 2007), similar to observations
from patients that died from Parkinson’s disease (Hirsch et al., 1988; Damier et
al., 1999). En mutants have been primarily discussed as a model for studying the mechanisms underlying the DA neuron death, including the increased
susceptibility of the substantia nigra DA neurons. A few studies have begun to
ask whether En might also contribute to the susceptibility of developing
Parkinson’s disease. One study has found a small increase in frequency of a
SNP (rs1345514 C/T) in the promoter region of En2 in patients with young-onset
Parkinson’s disease in the United Kingdom of Germanic descent (Rissling et al.,
2009). A second study found an increase in the frequency of SNP rs154746582
(C/G) in the promoter region of En2 and SNP rs119318102 (A/G) in the intron of
En1 in one population of sporadic Parkinson’s disease patients of German origin
but found a decrease in the same En1 SNP in a second similar population
(Fuchs et al., 2009).
Aims of thesis
The serotonergic system is modulator of CNS function, whose disruption
can alter behavioral and physiological responses. Increased understanding of
transcriptional control of 5-HT neuron development may allow for insight into how
the 5-HT system functions and eventually how alterations in 5-HT neuron
development and function contribute to susceptibility to neurodevelopmental
64
disorders. 5-HT neurogenesis and maturation are primarily directed by an
intrinsic transcription factor network (Deneris and Wyler, 2012). While our
understanding of these factors is increasing, there are still many factors still to
identify.
The project in chapter two describes the analysis of 5-HT neuron-specific
targeting of the homeodomain transcription factors, En1 and En2, and the
identification cell intrinsic roles in the maturation of 5-HT neurons. En1/2 have been implicated in the early development of r1-derived 5-HT, however because
the authors did not detect En expression in postmitotic 5-HT neurons, it was
concluded that the En1/2 either play an earlier role during neurogenesis or a cell
non-intrinsic role (Simon et al., 2005). More recently, the discovery that En1 and
En2 are highly enriched in rostral 5-HT neurons suggested possible intrinsic roles
in 5-HT neuron maturation (Wylie et al., 2010). The project uses a conditional
targeting approach to ablate En1 and En2 specifically within 5-HT neurons after
neurogenesis. This approach permits analysis of specific roles for En1/2 in 5-HT
neurons distinct from earlier roles in 5-HT neuron development or from non-cell-
autonomous roles in the mid-hindbrain region. This provides for a unique
analysis of En1/2 function in the mouse. The roles in 5-HT neuron maturation are
distinct from those described in the patterning of the tectum and cerebellum or
the survival of DA neurons. Furthermore, as much as can be determined, it is the
first analysis of conditional targeting of En within monoaminergic neurons, which
may suggest a need to revisit En roles in other monoamine systems. Within the
5-HT system, this analysis identifies En1/2 as important factors in the maturation
65 of 5-HT neurons, a developmental period where few transcription factor regulators are known. Additionally, it adds to the understanding of how heterogeneity is generated within the 5-HT system, as En1/2 are only important for r1-derived 5-HT neurons.
The project described in chapter three describes the generation and analysis of congenic lines of mice carrying the Pet-1 null allele. The genetic background on which a transgene’s effect is investigated can greatly influence the observed phenotype. In some cases, modifiers within the genetic background can reduce or eliminate the observed phenotype. As most studies of the Pet-1 mutant mice have involved a mixed genetic background of 129/Sv, C57BL6 and/or SJL, differences in these strains could contribute to phenotype variation.
Furthermore, the 5-HT system has not been compared also mouse strains.
Indeed, two behaviors that are associated with 5-HT system dysfunction, anxiety and aggression, differ dramatically between these strains, suggesting that there might be genetic modifiers that could interact with the Pet-1 null allele.
66
Figure 1
67
Figure 1. Major components of 5-HT neuron identity. All of the proteins necessary for the synthesis (Thp2, Aadc), packaging (Vmat2), reuptake (Sert) and degradation (Mao) of 5-HT are expressed in 5-HT neurons. All seven subclasses of 5-HT receptors are present on 5-HT neuron targets, however only
5-HT1A and 5-HT1B act as autoreceptors. Modified from (Deneris and Wyler,
2012).
68
Figure 2
69
Figure 2. Determinants important for the development of 5-HT neurons. A,
Schematic of determinants of 5-HT progenitor specification and MHO components along with the relative positions of the mesoderm and r1 tissue that will produce 5-HT (red), DA (bright blue), NA (yellow) neurons and the tectum
(purple) and cerebellum (green). Colored arrows for Shh, Fgf8 and Wnt1 indicate
signal gradient from protein source. B, Schematic of MHO network at the time
that 5-HT and DA progenitors are specified, indicating the position of gene
expression at the mid-hindbrain boundary. Arrows indicate the positive or
negative regulation of expression. C, Schematic of the 5-HT regulatory network
that drives 5-HT neuron development. Stages-specific expression is indicated
within colored boxes. Arrows indicate regulatory relationship and are labeled if
relationship is thought to be limited to chick or r1. Genes involved in 5-HT identity
are labeled by boxes: 5-HT synthesis (orange), transport (brown), degradation
(pink), autoreceptors (blue).C is modified from (Deneris and Wyler, 2012).
70
Figure 3
71
Figure 3. Neuroanatomical origins of 5-HT neurons. The rhombomere in which 5-HT neurons are born defines their adult position. A-B, Schematic of the anatomical architecture of the developing 5-HT system from a sagittal view (A, left) and A-P view (A, right) and in the mature 5-HT system from a sagittal view
(B). Modified from (Jensen et al., 2008).
72
Figure 4
73
Figure 4. Engrailed is highly conserved amongst species and paralogs. A,
Schematic of the structure of the engrailed gene, common between species and
En1/2. B, Schematic of the structure of the engrailed protein, common between species and En1/2. The relative positions of the region coding for each protein domain (EH1-5) are marked in the same color on the gene schematic.
C, Phlogenetic tree of the evolutionary relationships of the engrailed protein for the stated species.
74
Chapter 2
Engrailed is required in maturing serotonin neurons to regulate the
cytoarchitecture and survival of the dorsal raphe nucleus
Stephanie R. Fox and Evan S. Deneris
Acknowledgements
We thank Alexandra Joyner for giving us the floxed engrailed 1 and 2 mice and the pan-engrailed antiserum. We thank Jerry Silver for valuable discussions and helpful comments. We thank Ms. Kathy Lobur for genotyping assistance. We thank Jon Rawlings for writing the program used for cell counting and Steve
Wyler, Meredith Whitney, and Clay Spencer for comments on the manuscript.
This work was supported by NIH grant RO1 MH062723 and NIMH Silvio O.
Conte Center Grant P50 MH078028 (Vanderbilt University, R. Blakely, Center
Director) to E.S.D. S.R.F. was supported by NIH predoctoral training grants
5T32HD007104 and 5T32NS067431.
Published with permission from the Journal of Neurosciences
75
Summary
Analysis of constitutive Engrailed (En) null mice previously implicated the two En homeobox paralogs in the development of serotonin (5-HT) neurons. An unresolved question is whether En plays intrinsic roles in these neurons. Here, we show that En1 and En2 are expressed in maturing 5-HT neurons that will form the dorsal raphe nucleus (DRN) and part of the median raphe nucleus
(MRN). While En1 expression in 5-HT neurons persists postnatally, En2 expression is extinguished by embryonic day 17.5. To investigate intrinsic serotonergic functions for En1/2, we generated compound conditional En mutants with floxed alleles and a cre recombinase line that becomes active in postmitotic fetal 5-HT neurons. We present evidence in support of a requirement for En1/2 in the maturation of DRN cytoarchitecture. The disruption of DRN cytoarchitecture appears to result from a defect in secondary migration of serotonergic cell bodies toward the midline rather than disruption of their primary ventral migration away from the ventricular zone. Furthermore, En1/2 are required for perinatal maintenance of serotonergic identity and postnatal forebrain 5-HT levels. Increased numbers of caspase-3+ cells and loss of significant numbers of 5-HT neuron cell bodies, indicative of apoptosis, occurred following loss of serotonergic identity. Analysis of an allelic series of conditional mutants showed that En1 is the predominant functional En paralog in maturing 5-
HT neurons although a small contribution from En2 was reproducibly detected.
Together, our findings reveal complex intrinsic functions for En in maturing 5-HT
76 neurons hence necessitating a reinterpretation of their roles in 5-HT system development.
Introduction
The development of 5-HT neurons comprises a brief period of neurogenesis followed by a prolonged maturation period in which newly born postmitotic 5-HT neurons are maintained and integrated with CNS circuitry.
During serotonergic neurogenesis, a transcriptional network (Deneris and Wyler,
2012) comprising Ascl1, Nkx2.2 and Foxa2 specifies serotonergic progenitors
(Briscoe et al., 1999; Pattyn et al., 2004; Jacob et al., 2007) and induce expression of Insm-1, Gata-2, and Gata-3. Insm-1 and Gata-2 then activate expression of Lmx1b and Pet-1 in postmitotic precursors (Craven et al., 2004;
Jacob et al., 2009), which together with Gata-3, induce transcription of a gene battery encoding 5-HT synthesis, vesicular transport, reuptake and metabolism
(Ding et al., 2003; Hendricks et al., 2003; Pattyn et al., 2004). Mouse 5-HT neuron maturation begins immediately following the cessation of serotonergic neurogenesis and continues through the third postnatal week(Lidov and Molliver,
1982a, 1982b). During this period, 5-HT neurons follow disparate migratory routes to form the various raphe nuclei in the midbrain, pons, and medulla, extend axonal projections to form the ascending and descending 5-HT subsystems and finally integrate with target circuitry by making synaptic connections. Some recent evidence indicates that after serotonergic neurogenesis, Pet-1 and Lmx1b continue to regulate key steps in 5-HT neuron
77 maturation and maintenance including the induction of the Htr1A and Htr1B autoreceptor genes (Liu et al., 2010) and postnatal survival of 5-HT neurons
(Zhao et al., 2006). However, in contrast to the growing understanding of the transcriptional network governing serotonergic neurogenesis, the regulatory factors required for maturation and maintenance of 5-HT neurons remain poorly understood (Deneris, 2011).
Engrailed (En) homeobox paralogs, En1 and En2, play critical roles in limb development (Loomis et al., 1996), mid-hindbrain patterning (Liu and Joyner,
2001b), cerebellar development (Millen et al., 1995; Kuemerle et al., 1997;
Sgaier et al., 2007; Sillitoe et al., 2008, 2010) and the maintenance and survival of midbrain dopamine neurons (Simon et al., 2001; Albéri et al., 2004). En genes have also been implicated in Drosophila and mouse 5-HT neuron development
(Lundell et al., 1996; Simon et al., 2005). In En1/2 constitutive null mice nearly all
5-HT neurons of the developing DRN were missing at embryonic day 12 while 5-
HT neurons in the MRN and posterior hindbrain were unaffected (Simon et al.,
2005). Immunohistochemical studies, however, failed to detect Engrailed expression in 5-HT neurons. These findings were interpreted as an early cell non-autonomous role for En in serotonergic development (Simon et al., 2005).
Recent microarray studies of flow-sorted 5-HT neurons demonstrated, however, that En1 and En2 are actually expressed in rostral postmitotic 5-HT neurons
(Wylie et al., 2010). These findings suggest En may play not only early patterning roles in serotonergic development but also intrinsic roles in maturing 5-HT neurons. To investigate this possibility, we conditionally targeted Engrailed
78
specifically in maturing 5-HT neurons. Our findings demonstrate that En1 plays a
dominant role over En2 in the positioning, maintenance and survival of a subset
of rostral 5-HT neurons that form the DRN.
Materials and methods
Mice
Mouse breeding and housing procedures were approved by the CWRU
School of Medicine Institutional Animal Care Committee in compliance with the
National Institutes of Health guide for the care and use of laboratory animals.
Compound En1flox/flox; En2flox/flox mice were a gift from Alexandra Joyner
(Sloan-Kettering Institute). These mice were initially crossed with ePet-Cre;
R26R mice. We generated three lines from this cross: 1) En1flox/flox; ePet-Cre;
R26R (En15HTCKO), 2) En2flox/flox; ePet-Cre; R26R (En25HTCKO), and 3) compound
En1flox/flox; En2flox/flox; ePet-Cre; R26R (En1/25HTCKO) (Figure 1A). The ePet-Cre;
R26R mice used for controls were generated from a cross between En1flox/flox;
ePet-Cre; R26R and En2flox/flox; ePet-Cre; R26R mice followed by an intercross of
their En1flox/+; En2flox/+; ePet-Cre; R26R offspring (Figure 1B). From these
matings, we identified mice with wild type En alleles, which were used for
additional matings. This scheme allowed us to retain a similar genetic
background among the En conditionally targeted mice that were used in
experiments. En1flox/+; En2flox/flox and En1flox/flox; En2flox/+ mice were generated
from a mating between a compound En1flox/flox; En2flox/flox mouse and either an
En1flox/flox or an En2flox/flox mouse (Figure 1C,D). Mice were maintained on a mixed
79
genetic background of Swiss Webster, C57BL/6 and SJL. Because there is the
potential that targeting efficiency would differ depending on expression from
either one or two ePet-Cre alleles, only one parent in each mating had the ePet-
Cre transgene. The ePet-EYFP transgene(Scott et al., 2005b) was also present
in some of the experimental mice for immunohistochemical detection of 5-HT
neurons and for their purification by flow cytometry.
Littermates with matched Enflox alleles in the absence of ePet-Cre were
used as controls for all experiments that did not include LacZ analysis. Counts of
DRN 5-HT neurons indicated comparable numbers in ePet-Cre; R26R mice and
mice with various En floxed allele combinations. In LacZ analyses, control mice
were age matched between litters. Experimental and control mice 3 weeks or
older were sex-matched.
Histology
Postnatal mice were anesthetized using avertin (0.5g tribromoethanol/39.5
ml H20 + 0.31 ml tert-amyl alcohol). Adolescent and adult mice were
transcardially perfused with ice-cold phosphate buffered saline (PBS), pH 7.4, followed with ice-cold 4% paraformaldehyde (PFA) in PBS, pH 7.4 for 10-20
minutes. The brains were removed and postfixed for two hours on ice. Newborn
mice were transcardially perfused with PBS and fixed in 4% PFA for one hour on
ice. Embryos were collected from timed pregnant mice and fixed in 4% PFA for
one hour. All tissues were cryoprotected in 20% sucrose in PBS overnight at 4°C.
Embryo and early postnatal tissues were embedded in O.C.T. Compound
80
(Tissue-Tek) and stored at -80°C. Tissue sections (20μm) were obtained using a
freezing microtome (adolescent and adult) or cryostat (embryonic and early
postnatal), mounted onto SuperFrost Plus slides (Fisher Scientific) and dried at
room temperature for two hours. Xgal staining was performed as previously
described (Scott et al., 2005a). In situ hybridizations were performed as
previously described (Wylie et al., 2010).
For fluorescent immunohistochemistry, the tissue sections were washed
three times in PBST (1XPBS, pH 7.4 and 0.1% Triton-X) and incubated in
blocking solution (PBST with 0.3% Triton-X and 5% normal serum) for at least
one hour. Newborn mouse sections were permeabilized with methanol for 30
minutes before blocking with M.O.M. Kit (Vector Laboratories). Prior to caspase-3
staining, sections underwent antigen retrieval in ~95°C citrate buffer for 10
minutes, cooled for 30 minutes and blocked with 2% normal serum. Tissue was
incubated with primary antibodies in blocking solution overnight at 4°C. The next
day, the tissue was washed three times in PBST and incubated in secondary
antibodies in blocking solution for two hours covered at room temperature. After
sections were washed three times, cover slips were attached with PermaFluor
Mountant (Thermo Scientific). Antibodies used were TPH (mouse monoclonal
anti-tryptophan hydroxylase, 1:100; Sigma), 5-HT (rabbit polyclonal anti-5-HT,
1:10,000; Immunostar), β-gal (chicken polyclonal anti-β-galactosidase, 1:1000;
Abcam), pan-Engrailed (rabbit anti-Enhb-1, gift from Alexandra Joyner, Sloan-
Kettering Institute), cleaved caspase-3 (rabbit monoclonal anti-cleaved caspase-
3, 1:100; Cell Signaling), Vmat2 (rabbit polyclonal anti-vesicular monoamine
81 transporter 2, 1:200), Aadc (rabbit polyclonal anti-aromatic amino acid decarboxylase, 1:100), Alexa488, Alexa594, and Alexa350 (1:500, Invitrogen).
Images were obtained using an Olympus Optical BX51 microscope and SPOT camera (Diagnostic Instruments), or a Zeiss LSM 510 Meta confocal microscope.
Images were processed using Adobe Photoshop.
Cell counting
5-HT neurons were identified with 5-HT immunostaining at embryonic ages and with Tph immunostaining at postnatal ages. R26RLacZ expression was detected with either Xgal staining or βgal immunostaining. All 5-HT neuron counts were obtained from every other section through the rostral hindbrain or entire rostrocaudal extent of the DRN or MRN. In E12.5 and E14.5 embryos, 5-
HT neurons were counted in the rostral hindbrain (r1 - r3) from the mid-hindbrain boundary to the pontine flexure. At late embryonic and postnatal ages, 5-HT neurons were counted in the DRN and/or MRN. A computer program was developed to permit blinded manual counting of Tph immunostained and LacZ- marked neurons in images captured from experimental and control tissue sections. To quantify the distribution of targeted 5-HT neurons in the P0 DRN, a template was generated to divide each image into midline and lateral sectors.
The width of the midline was defined as the width of B6 and caudal B7, which was consistent across multiple control mice. While blinded to the genotype, the template was positioned over each image and aligned to the shape of the nucleus and then the number of cells within each sector was recorded. From
82 these counts, the percentage of cells within either the midline sector or the adjacent lateral sector was determined and averaged across multiple animals for each rostrocaudal level of the DRN. No difference in the overall numbers of cells was observed in any of the rostrocaudal regions examined between the genotypes. For analysis of cleaved caspase-3 expression, the DRN was identified with βgal immunofluorescence and Caspase-3+/ DAPI+ cells were counted from imaged control and experimental mice.
HPLC
Tissues were dissected from E12.5, newborn (P0), 3-week-old, 6-week- old, and 12-week-old mice. Adolescent and adult mice were anesthetized with avertin and underwent cervical dislocation. Brains were quickly removed and placed in dry ice. When partially frozen, a sterile razor blade was used to cut at
Bregma area -2.92mm to separate the forebrain and then again at Bregma area -
5.68mm to isolate midbrain tissue. The cortex was removed from the midbrain tissue, which was quickly returned to dry ice. Newborn mice were decapitated, the brain exposed and cut at Bregma area -2.92mm to separate forebrain tissue from midbrain and hindbrain tissue. E12.5 embryos were collected as described and the neural tube was dissected between the mesencephalic flexure and the pontine flexure. Tissues were stored at -80°C for up to two months before HPLC analysis. For adolescent and adult mice, seven males and seven females were used for each age group and genotype. Dissected tissues were sent for HPLC
83 analysis to the Neurochemistry Core Lab in the School of Medicine at Vanderbilt
University (Nashville, TN).
Isolation of rostral domain 5-HT neurons
E12.5 En1/25HTCKO; ePet-EYFP and En1flox/flox; En2flox/flox; ePet-EYFP embryos were obtained from En1flox/flox; En2flox/flox crosses where one parent contained ePet-Cre and/or ePet-EYFP. ePet-EYFP+ E12.5 embryos were collected into ice-cold L15 media (Invitrogen) by visualization under an inverted fluorescent dissecting microscope. YFP fluorescence between the mesencephalic flexure and pontine flexure was used to dissect a portion of the neural tube containing the entire domain of rostral hindbrain 5-HT neurons. Embryos were genotyped and embryos of the same genotype were combined prior to mechanical dissociation by trituration. Cells were sorted on a Becton Dickinson FACS Aria digital cell sorter using previously established conditions for embryonic 5-HT neurons (Wylie et al., 2010). Cells were collected in Trizol (Invitrogen) and stored at -80°C until RNA extraction. A typical sort yielded ~10,000 YFP+ cells/ embryo. Cells from multiple sorts were combined to produce biological replicates of ~50,000 YFP+ rostral hindbrain neurons. 50,000 YFP- rostral hindbrain cells were also collected from each sort.
84
Real-time qRT-PCR analysis
RNA was extracted in Trizol reagent (Invitrogen) according to the manufacturer’s manual. All RNA from each sample was used for first strand cDNA synthesis (Roche). Real-time qRT-PCR was conducted in triplicate using a 25μl reaction of FastStart Universal SYBR Green Master (Roche), specific primers and 1μl cDNA. All real-time RT-PCR reactions were performed for 40 cycles with an annealing temperature of 60°C on
StepOnePlus Real-Tme PCR System (Applied Biosystems). Relative gene expression was determined using published protocols (Pfaffl et al., 2002).
The primers used for En1: forward primer GGGTCTACTGCACACGCTATT, reverse primer TTTTCTTCTTTAGCTTCCTGGTG; En2: forward primer
GCTAATCTGACCGGCCTTC, reverse primer GCTTGTCCTCTTTGTTAG
GGTTC; serotonin transporter (Sert): forward primer CAAGTTCAACA
ACAACTGTTACCAA, reverse primer TAGCCAAGCACCGTGAAGAT; Pet-1: forward primer AACATGTACCTGCCAGATCC, reverse primer CCAGGA
GAAACTGCCACAAC; Actin (reference gene): forward primer TCCTAGCA
CCATGAAGATCAAGATCA reverse primer GCAGCTCAGTAACAGTCCG.
Pup survival and maternal care analysis
Naive En1flox/flox; En2flox/flox and En1/25HTCKO dams were harem bred to
En1/25HTCKO and En1flox/flox; En2flox/flox males respectively. When a female appeared to be several days from birth, she was transferred to a clean cage with a nestlet and monitored daily for births. From P0–P7, the number of live
85
and dead pups was counted. The number of live pups was also recorded at 2
and 3 weeks of age. Percent survival was calculated as the number of pups
weaned divided by the estimated number of live/dead pups on P0. For
percent survival within a litter, the number of live pups at a given age was
divided by the number of live/dead pups found on P0. Two independent
cohorts at different times of the year were used for survival analysis.
Pups born to mothers in the first cohort were weighed on P0, P7, 2
weeks, 3 weeks, 4 weeks, 5 weeks and 6 weeks of age. Some litters were
not weighed at P0 to determine whether weighing might affect survival.
There was no indication that handing newborn pups for the purposes of
obtaining their weight affected survival.
Nest quality was recorded for the day of birth. The quality of the nest
was rated on a scale of 1–4: 1) no nest/ scattered nesting material/ flat disc
of nesting material, 2) partial nest/ nesting material piled/ some nest walls
present but has large gaps 3) incomplete nest/ walls present but has small
gaps/ orderly pile 4) complete nest/ walls that completely or almost
completely encircle the nesting area.
Statistics
Statistical analyses were carried out on normally distributed data using a t-
test for single time point comparisons between control and mutant mice or a two-
way ANOVA with Bonferroni's multiple comparison test for comparison across
multiple ages or genotypes. For analysis of the distribution of LacZ-marked
86
neurons in the P0 DRN a two-way repeated measures ANOVA with Bonferroni’s
multiple comparison test was used. Statistical analysis performed using Excel
and GraphPad Prism 5.
Results
En1 and En2 are expressed in postmitotic 5-HT neurons.
Gene expression profiling of flow sorted 5-HT neurons at E12.5 revealed
strong expression of En1 and En2 in rostral but not caudal hindbrain 5-HT
neurons (Wylie et al., 2010). In addition, immunohistochemical verification of En
expression with a pan-En antibody indicated En protein expression in postmitotic
5-HT neurons at least through E14.5 (Wylie et al., 2010). We used in situ hybridization to comprehensively map the individual spatiotemporal expression patterns of En1 and En2 in the developing rostral hindbrain. Moderate expression of En1 and strong expression of En2 was detected throughout the mid-hindbrain
region at E11.5, a stage when serotonergic neurogenesis is complete in the
rostral hindbrain (Figure 2A, B). Expression of En1 and En2 rostral to the mid-
hindbrain boundary was detected in the mesencephalic region where dopamine
neurons are born. En1 expression was also present caudal to this boundary
where developing rostral 5-HT neurons are located. This pattern of En1
expression is consistent with previous findings from mapping of lineage
boundaries using an En1-Cre knock-in allele, which suggested that En1
expression in the rostral hindbrain is restricted to rhombomere 1 (r1) (Li and
Joyner, 2001; Zervas et al., 2004). The pattern of En2 expression in the rostral
87 hindbrain overlapped with that of En1 although the En2 expression domain appeared to extent more caudally than that of En1 (Figure 2A, B). However, at
E14.5 En2 expression began to diminish while En1 expression became more prominent in the rostral hindbrain domain (Figure 2C, D). At E17.5, En1 expression persisted in the rostral domain where migrating 5-HT neurons were located. In contrast, En2 expression became undetectable in the rostral hindbrain at this stage, although its expression persisted in the mesencephalic region anterior to the mid-hindbrain boundary (Figure 2E, F). Immunohistochemistry with a pan-engrailed antibody that recognizes both En1 and En2 (Davis et al.,
1991) detected En protein expression in the nuclei of E14.5 ePet-EYFP+ 5-HT neurons in the rostral hindbrain (Figure 2G).
In situ hybridization of brain sections from 3-week-old wild type mice
(Figure 3A, B) revealed strong expression of En1 in what appeared to be all 5-HT neurons within the dorsal raphe nucleus (DRN), but in only a subset of 5-HT neurons that populate the median raphe nucleus (MRN). In contrast, En2 expression was not detected in the postnatal DRN and MRN, although its expression was present in the midbrain ventral tegmental area (VTA) and substantia nigra (SN) (data not shown). Co-immunostaining of brain sections from 3-week-old mice with the anti-pan-En antibody and an anti-Tph antibody detected nuclear En protein in all 5-HT neurons of the DRN (Figure 3C) and in 5-
HT neurons located in the dorsal, but not ventral, portions of the MRN (Figure
3D). Similar results were obtained with sections from adult mice (data not shown). These findings demonstrate that both En1 and En2 are expressed in the
88 rostral hindbrain through the stage of 5-HT neuron differentiation and into the stage of 5-HT neuron maturation. However, their respective temporal expression patterns dramatically diverge subsequently: En1 expression persists into the postnatal period in all 5-HT neurons of the DRN and some 5-HT neurons of the
MRN, while serotonergic En2 expression is present only up to mid fetal stages of
5-HT neuron maturation.
Conditional targeting of En in maturing 5-HT neurons
The persistent expression of En1/2 in postmitotic 5-HT neurons raises the possibility that these homeodomain factors are required for intrinsic regulation of
5-HT neuron development after these cells acquire their serotonergic identity. To investigate this hypothesis, we used a conditional targeting strategy to knock out
En expression specifically in maturing postmitotic 5-HT neurons while preserving their function at earlier stages of development (Figure 4A). This strategy was achieved by crossing the ePet-Cre transgene (Scott et al., 2005b) into compound
En1flox/flox; En2flox/flox mice (Sgaier et al., 2007; Cheng et al., 2010) to generate 5-
HT neuron-specific En1/2 targeted mice (En1/25HTCKO) (Figure 1A). Pet-1 and ePet-Cre are not expressed until after the proliferating progenitor stage of serotonergic neurogenesis (Hendricks et al., 1999; Scott et al., 2005b;
Hawthorne et al., 2010). Birthdating with BrdU has shown that this stage of neurogenesis ceases in r1 around E10.5, which is about 1 day before the termination of serotonergic neurogenesis in r2 and r3 of the rostral hindbrain
(Jacob et al., 2007). Moreover, we showed previously that Pet-1, Lmx1b, Tph2,
89
Sert, and 5-HT expression was normal at E11.5 in the rostral hindbrain of ePet-
Cre conditionally targeted Pet-1flox/- or Lmx1bflox/flox mice (Zhao et al., 2006; Liu et
al., 2010). At E12.5, however, expression of all of these serotonergic markers
was substantially reduced in these conditional mutant mice, showing that ePet-
Cre is effective in targeting serotonergic gene expression 1-2 days after rostral 5-
HT neurogenesis (Zhao et al., 2006; Liu et al., 2010).
Real-time RT-qPCR analysis of gene expression revealed an 85% loss of
En1 and En2 expression at E12.5 in YFP+ 5-HT neurons purified by flow
cytometry (Wylie et al., 2010) from En1/25HTCKO; ePet-EYFP mice compared to levels in En1flox/flox; En2flox/flox; ePet-EYFP controls (Figure 4B). In contrast, the
level of En expression was not altered in neighboring YFP- non-5-HT cells
(Figure 4B). Targeting efficiency and specificity was confirmed with pan-En
immunostaining in 5-HT neurons, which showed that En immunoreactivity was absent in virtually all targeted 5-HT neurons (Figure 4C).
Engrailed controls maturation of DRN cytoarchitecture
A critical step in the development of the 5-HT system is the formation of
the DRN, where greater than half of all rodent ascending 5-HT neurons are
located (Vertes and Crane, 1997). Initial movement of 5-HT neuron cell bodies
away from the ventricular zone occurs though the process of somal translocation
(Hawthorne et al., 2010) through which newly born 5-HT neurons migrate to
more ventral portions of the neural tube. This primary migratory event creates
bilateral clusters of 5-HT neurons along the dorsoventral axis as shown in the
90
transverse section presented in Figure 6C, D. The mature cytoarchitectural
organization of the DRN arises through subsequent secondary migration of 5-HT
neuron cell bodies toward the midline resulting in the fusion of the bilateral
serotonergic clusters (Levitt and Moore, 1978) as presented in Figure 5A, E, I.
Formation of the mature DRN is normally completed just prior to birth (Lidov and
Molliver, 1982a; Wallace and Lauder, 1983). Virtually nothing is known, however,
about the regulatory mechanisms involved in DRN formation and whether
intrinsic transcriptional mechanisms are involved. Indeed, it has been suggested
that DRN formation occurs passively as a result of extrinsic morphological
changes in the developing brain (Lidov and Molliver, 1982a).
Initial histological analyses suggested disorganization of DRN
cytoarchitecture at the perinatal stage in En1/25HTCKO mutants. To facilitate a
detailed investigation of this potential abnormality of DRN formation, 5-HT
neurons were permanently marked by ePet-Cre mediated recombination of the
ROSA R26RLacZ allele (Soriano, 1999). Analyses of LacZ expressing 5-HT
neurons visualized with X-gal staining in sections obtained from newborn
En1/25HTCKO mice revealed disruption of DRN cytoarchitecture at multiple levels
along its rostrocaudal axis (Figure 5B, F, J). Counts of cells at these rostrocaudal
levels revealed significant misplacement of LacZ expressing 5-HT neuron cells
bodies away from the midline (Figure 5M, N, O). However, the total number of
cell bodies in the En1/25HTCKO DRN was unchanged (Figure 9C). At the rostral
end of the DRN in the midbrain, the bilateral clusters of LacZ expressing 5-HT
neurons failed to reach the midline (compare Figure 5A with 5B), suggesting
91 these En mutant neurons were stalled in a primitive embryonic stage of DRN formation. The mis-positioned serotonergic cell bodies created a prominent gap
(Figure 5B, asterisks) at the midline compared to ePet-Cre; R26R controls
(Figure 6A, M). At more caudal levels of the midbrain DRN, En1/2 deficiency caused abnormal dense aggregations of LacZ-marked 5-HT neurons on either side of the midline (Figure 4F, arrows vs. 5E) producing a similar midline gap of cell bodies (Figure 5F, asterisk, 4N). At the caudal end of the DRN in the pons, large numbers of LacZ-marked 5-HT neuron cells bodies were laterally displaced to various extents within the surrounding ventrolateral periaqueductal gray creating a ventral “bulge” of mis-positioned serotonergic cell bodies (Figure 5J, solid arrowheads, 5O) and aberrant “wing-like” structures in the dorsal B6 DRN
(Figure 5J, open arrowheads). The altered distribution of cells was not the result of delayed cytoarchitectural maturation as the abnormal cell aggregations and midline gaps persisted through six weeks of age (Figure 10B and data not shown). We could not detect a defect in the cytoarchitecture of the MRN, perhaps either because En is not required for this maturation step in this raphe nucleus or because expression of En in only a subset of MRN 5-HT neurons precluded detection of mis-positioned LacZ-marked neurons.
We next examined mice with different combinations of En conditional alleles and the ePet-Cre; R26R transgenes to investigate the relative requirements for En1 and En2 in DRN formation. Conditional targeting of both
En1 alleles (En1flox/flox; En2+/+; ePet-Cre; R26R or En15HTCKO) in a wild type En2 background resulted in mild but obvious positioning errors, particularly in the
92
posterior DRN at P0 (Figure 5C, G, K). However, no cell aggregates or midline
gaps were observed in the DRN of these conditional mutant mice. This suggests
that En2 can incompletely compensate for loss of En1. Targeting of one En2
allele and both En1 alleles (En1flox/flox; En2flox/+; ePet-Cre; R26R) did not increase
the severity of the cytoarchitectural defects (data not shown). In contrast to the
mild phenotype in En15HTCKO mice, conditional targeting of both En2 alleles
(En1+/+; En2flox/flox; ePet-Cre; R26R or En25HTCKO) in a wild type En1 background
did not affect midline distribution of LacZ-expressing 5-HT neurons compared to
ePet-Cre; R26R controls (Figure 5D, H, L). Furthermore, additional targeting of one En1 allele together with both En2 alleles (En1flox/+; En2flox/flox; ePet-Cre;
R26R) did not result in cytoarchitectural defects (data not shown). Thus, a single
En1 allele is sufficient for normal cellular organization of the DRN. These findings suggest that En1 plays a primary role over En2 in DRN formation; however,
because the En1/25HTCKO phenotype is more severe than En15HTCKO, En2 must
also contribute prior to being turned off before E17.5.
Because En1/2 were targeted after serotonergic neurogenesis, the
disrupted formation of DRN cytoarchitecture was not likely the result of abnormal
redistribution of sites of 5-HT neuron birth in r1, which was corroborated by the
finding of a normal distribution of 5-HT neurons at E12.5 along rostrocaudal axis
(Figure 6A, B). In addition, aberrant primary migration of newborn 5-HT neurons
away from the ventricular zone toward more ventral portions of the neural tube
through somal translocation (Hawthorne et al., 2010) was not likely responsible
for disruption of DRN cytoarchitecture as we found a normal bilateral distribution
93
of newly born 5-HT neurons at E12.5 along the dorsoventral axis (Figure 6C, D).
Our findings, therefore, suggest that cytoarchitectural maturation of the DRN
depends on an intrinsic Engrailed-dependent regulatory program, which is
required in postmitotic 5-HT neurons to control secondary cell body somal
translocation or migration to the midline.
Engrailed is required for perinatal maintenance of serotonergic neuron identity.
The reduced level of 5-HT at E12.5 in ePet-Cre directed conditionally targeted Pet-1 and Lmx1b mice (Zhao et al., 2006; Liu et al., 2010) demonstrated
a requirement for these transcription factors in the early maintenance of 5-HT
neuron identity. Thus, we next investigated whether En1/2 function might also be
required for early maintenance of 5-HT neuron identity. Analyses of En1/25HTCKO
mice and littermate En1flox/flox; En2flox/flox control mice in the E12.5 rostral hindbrain
revealed that in addition to the comparable distribution and numbers of 5-HT
neurons (Figure 6A-E), tissue 5-HT levels in the rostral hindbrain determined by
HPLC were not significantly different in En1/25HTCKO and littermate En1flox/flox;
En2flox/flox control mice (Figure 6F). Furthermore, we detected similar levels of
Pet-1, Sert and Lmx1b mRNAs in FACS sorted E12.5 YFP+ 5-HT neurons
obtained from En1/25HTCKO; ePet-EYFP mice and En1flox/flox; En2flox/flox; ePet-
EYFP control mice (Figure 6G and data not shown). These findings further
support the conclusion that 5-HT neuron numbers and phenotype are not altered
in En1/25HTCKO mice at E12.5. Thus, unlike Pet-1 and Lmx1b, En1/2 do not appear to be required for early maintenance of 5-HT neurons.
94
We then investigated with either 5-HT or Tph immunostaining whether loss of En1/2 impacted serotonergic identity at later stages of life (Figure 7).
Interestingly, a large deficit in the number of Tph immunoreactive neurons in the
DRN was detected at six weeks of age (Figure 7A, B). To determine when the
loss of serotonergic identity begins, we counted the number of identifiable 5-HT
neurons at several fetal and postnatal stages. This analysis showed that a
significant deficit in the number of 5-HT+ neurons was evident beginning at E16.5
in the rostral hindbrain of En1/25HTCKO mice and that this deficit continued to
worsen into the early postnatal period (Figure 7E). Quantitation of the number of
Tph+ neurons (Figure 7E) in the DRN of En1/25HTCKO mice from P0 through 23
weeks of age indicated that the deficiency of 5-HT+ neurons appeared to be
maximal at birth. At 23 weeks of age, we found a 55% deficit in the number of
Tph+ cells in En1/25HTCKO mice, which was not significantly different from the 43%
deficit at birth. The deficit in Tph+ neurons was uniform across all rostrocaudal
levels of the En1/25HTCKO DRN. A much more modest, but significant, 18% deficit
was also found in the adult En1/25HTCKO MRN (Figure 7C, D, F), which is
consistent with En1 expression in a subset of MRN 5-HT neurons (Figure 3).
Consistent with the lack of En1/2 expression in medullary 5-HT neurons, the
number of Tph+ neurons in caudal 5-HT nuclei was similar between En1/25HTCKO
and littermate control mice (data not shown).
To confirm that the loss of Tph+ cells was due to a loss of identity and not
specifically loss of Tph expression, we immunostained for other necessary
components of 5-HT neuron identity. Aadc is another enzyme that is processes
95
L-Tryptophan into 5-HT and Vmat2 packages 5-HT into secretory vesicles. Co-
immunostaining for Aadc, Tph, and βgal showed identical expression patterns
between Aadc and Tph. The same was found for Vmat2. Any cell that failed to
express Tph also failed to express Aadc and Vmat2, further suggesting that
En1/2-deficient neurons lose their 5-HT neuron identity.
HPLC analyses in control mice revealed that midbrain and forebrain 5-HT
levels significantly increased through the early postnatal period and into young
adulthood (Figure 8). In comparison, analysis of En1/25HTCKO mice revealed
significant deficits in 5-HT levels (Figure 8A) consistent with the loss of Tph
immunoreactive neurons. The level of forebrain 5-HT in neonates was 60% of
wild type levels. At 3 weeks of age, the deficit stabilized at 50% of wild type
levels. Moreover, the normal rise in forebrain 5-HT levels seen in control animals
was attenuated in En1/25HTCKO mice, particularly in the early postnatal period. A
similar deficit in 5-HT levels was detected in dissected midbrain tissue, where
DRN and MRN cell bodies are located. However, 5-HT levels were normal at
birth in En1/25HTCKO midbrain (Figure 8A), perhaps because of largely normal
numbers of 5-HT neurons in the MRN and B9 clusters. Similar to the trajectory of
forebrain 5-HT levels, the normal postnatal rise in midbrain 5-HT levels was also
attenuated in En1/25HTCKO mice particularly in the early adolescent period.
Surprisingly, while the level of 5-HT in each brain region were similar between male and female mice for controls, levels differed between sexes for En1/25HTCKO
mice at adult ages (Figure 8B). In each case, female En1/25HTCKO mice had lower
levels of 5-HT compared to male mice. There were no observable differences in
96
number of Tph+ cell bodies, which is consistent with the relatively small
differences in 5-HT levels. Similar patterns were observed in 5-HIAA levels (data
not shown). Analysis of 5-HT metabolism identified increased ratios of 5HIAA to
5-HT in forebrain tissue of early postnatal En1/25HTCKO mice (Figure 8C).
Because the ratio is similar between En1/25HTCKO and control mice in midbrain
tissue, this difference could be due to abnormal 5-HT transport or turnover.
Additionally, both 5-HT neurons and targets express MAO genes, therefore it is not clear whether the increase in 5-HT metabolism is due to primarily cell intrinsic or extrinsic factors. It is interesting that 5-HT metabolism is altered during the critical postnatal period when munch of the brain circuitry is undergoing refinement.
Consistent with extinguished En2 expression during fetal life, conditional targeting of both En2 alleles (En25HTCKO) had no effect on the number of Tph+
cells at six weeks of age (Figure 9A). Similarly, targeting both En2 alleles and
one En1 allele (En1flox/+; En2flox/flox; ePet-Cre; R26R) did not result in a loss of
Tph+ cells at six weeks. Thus, a single En1 allele was sufficient for maintenance
of 5-HT neuron identity. In contrast, a single En2 allele was not sufficient to
maintain 5-HT neuron identity, as comparable deficits in the number of Tph+
neurons were detected in both En1/25HTCKO and En1flox/flox; En2flox/+; ePet-Cre;
R26R mice. Importantly, conditional targeting of both En1 alleles in a wild type
En2 background (En15HTCKO) resulted in significantly decreased numbers of Tph+
cells compared to littermate En1flox/flox controls at six weeks. However, this deficit
was not as severe as the deficit seen in En1/25HTCKO mice (Figure 9A),
97
suggesting a contribution from En2. To investigate this further, we examined
En15HTCKO mice at birth and found that, unlike the En1/25HTCKO mice (Figure 7E), there was no difference in the number of Tph+ cells relative to control numbers
(Figure 8B). These findings show that, similar to En allele requirements for
migration of 5-HT neuron cell bodies, En1 is the predominant functional En
paralog in postmitotic 5-HT neurons for maintenance of identity while En2 plays
an early minor role before its RNA expression is extinguished by E17.5 (Figure
2).
En1/2 deficiency causes 5-HT neuron cell death postnatally.
Because En1 and En2 are essential for survival of mesencephalic
dopamine neurons (Simon et al., 2004), we followed the fate of LacZ-marked,
En1/2-deficient 5-HT neurons to determine whether these factors were also
necessary for the survival of DRN 5-HT neurons. A significant deficit in the
number of βgal+ cells was detected in the adult DRN (Figure 10A, B). As
expected from the finding of normal numbers of 5-HT+ cells at E14.5, there was
no deficit in the number of LacZ-marked cells at this stage (Figure 10C).
Moreover, despite the deficit in the number of Tph+ cells in the En1/25HTCKO DRN
at birth (Figure 7E), there was no corresponding deficit in the number of LacZ-
labeled cells at this stage either (Figure 10C). However, at P10, we found a 25%
deficit in the number of βgal+ neurons in the En1/25HTCKO DRN. Furthermore, at
23 weeks of age a 60% loss of βgal+ neurons was detected (Figure 10C),
98 indicating a loss of 5-HT neuron cell bodies comparable in number to the prior loss of Tph+ cells in the mutant DRN (Figure 7E).
To determine whether the loss of βgal+ cells in the En1/25HTCKO DRN was the result of apoptosis, we immunostained sections of mutant and control DRN from P10 mice with an antibody that specifically recognizes cleaved caspase-3, a validated marker of cells undergoing programmed cell death (Nicholson et al.,
1995). We detected a significantly increased number of cleaved caspase-3 immunostained cells in the En1/25HTCKO DRN (Figure 10D, E). Counts of cleaved caspase-3 immunoreactive cells indicated an 18% increase in En1/25HTCKO mice relative to ePet-Cre; R26R controls (Figure 10E). A small number of cells immunostained for both cleaved caspase-3 and βgal were found in the
En1/25HTCKO DRN but not in the ePet-Cre; R26R control DRN (Figure 10D), thus confirming increased 5-HT neuron cell death in the mutant brain. These findings suggest that the loss of serotonergic identity in the En1/25HTCKO DRN is followed by the apoptotic elimination of 5-HT neuron cell bodies.
En1/25HTCKO dams display mild deficits in pup rearing.
Deficits in the 5-HT system negatively impact maternal behaviors and pup survival (Lerch-Haner et al., 2008; Alenina et al., 2009). While control dams raise almost all of their offspring to weaning under standard laboratory conditions, dams with low levels of serotonin lose most or all of their offspring between P0 and P4 due to a failure to maintain a huddle of pups in a well-structured nest.
Because En1/25HTCKO mice have specific defects in 5-HT neurons in the DRN and
99
dorsal MRN and have less that 50% of normal forebrain 5-HT, we next asked
whether these mice also had deficits in pup survival and maternal behaviors. 16
En1/25HTCKO dams and 12 control dams were mated were analyzed in the first
cohort and 17 En1/25HTCKO and 13 control dams in the second cohort. Dams were harem mated and separated into a fresh cage with a nestlet when they appeared to be several days from birthing. After birthing, litters were checked daily for number of living/dead pups and nest quality. Dams were observed for one to four
litters depending on the number of times she became pregnant and gave birth
during the experimental timeframe. In the first cohort, 93% of offspring born to
control dams survived to weaning compared to only 69% of offspring born to
En1/25HTCKO dams. It is accepted that some females fail to rear their first litter,
however raise all subsequent litters without issues; therefore, we compared pup
survival in inexperienced and experienced dams. As shown in Figure 11A (left),
both experienced and inexperienced En1/25HTCKO dams have reduced pup
survival compared to controls. Similar patterns of survival were observed on the
first and subsequent litters for En1/25HTCKO dams, dams with a high success rate
for the first litter tended to have high survival rates for subsequent litters, while
dams that lost the entire first litter also lost subsequent litters. When examined
over the course of the early postnatal period, most pups of the pup loss from
En1/25HTCKO litters occurred on the day of birth. Many of the pups were found
dead, sometimes in the nest or scattered around the cage on the morning of the
birth. Some pups were partially cannibalized. This early pup death differs from
previous analyses of pup survival, where pups were alive on P0, but died over
100 the next four days. Early death could be the result of physiological problems with pups or with the dam. We were unable to confirm whether pups were born alive and died soon after birth or died during/prior to birth. Pups generally appeared normal. Three En1/25HTCKO dams were given a three foster pups on P0 after all of their pups died. Two of the dams successfully reared the three pups to weaning.
The third lost these pups over four days, but was successful on a second attempt. This suggests that the dams are capable feeding and caring for pups after birth. A second cohort was set up to determine if the survival rates were replicable (Figure 11A, B right). Of 13 control dams and 17 En1/25HTCKO dams, the survival rate across all litters was 80% for control dams and 77% for
En1/25HTCKO dams. It is not clear why there was decreased pup survival from the previous cohort, but both control and En1/25HTCKO dams displayed decreases in survival rate except for inexperienced En1/25HTCKO dams.
As an attempt to identify subtle deficits in maternal care, pups from the first cohort were weighed on the day of birth and at each week thereafter (Figure
11C). Pups born to En1/25HTCKO dams weighed slightly less at all ages after P0.
When pups were weaned at 3 weeks of age, there was no difference in weight due to sex or pup genotype, thus confirming that maternal genotype is the more important factor.
One measure of maternal behavior is the ability to produce a high-quality nest. The nest quality was determined on the day of birth for the first cohort on a scale of 1 to 4. A 1 rating was given for “no nest” with nesting material either scattered or flattened into a disc-like shape. A 4 rating was given for a well-
101
organized “complete nest” with few or no gaps in the sides. Intermediate numbers represent “partial” or “mostly complete” nest. Dams of both genotypes produced nests of similar quality, suggesting that nest-building behavior is not affected. Therefore, although pups born to En1/25HTCKO dams have a reduced
survival rate, however, the reason is unclear.
Discussion
Our objective was to investigate possible intrinsic functions of En in
postmitotic 5-HT neurons. Previous analyses implicated these homeodomain
proteins in early 5-HT neuron development (Simon et al., 2005). However, the
use of constitutive targeting approaches precluded determination of intrinsic
serotonergic roles, as it is well established these factors perform critical functions
in maintaining the mid-hindbrain organizer region (Liu and Joyner, 2001b) from
which, Fgf8, an extrinsic determinant of rostral 5-HT neurons (Ye et al., 1998), is
produced and secreted (Crossley et al., 1996). Here, we used conditional
targeting approaches to investigate ongoing En1/2 function specifically in
postmitotic 5-HT neurons without perturbing earlier functions in patterning or
specification. We show that persistent En1/2 expression in postmitotic 5-HT
neurons is required for the development of the DRN cytoarchitecture and the
maintenance and survival of DRN 5-HT neurons. These unexpected roles in 5-
HT neuron maturation, maintenance and survival define an important stage of
intrinsic En function in 5-HT neurons.
102
It is now evident that the En genes are expressed in the serotonergic
lineage beginning at the progenitor stage and continuing into adulthood. Fate
mapping using an En1-Cre knock-in allele provided evidence in support of En1
expression in rostral serotonergic progenitors within r1, (Li and Joyner, 2001;
Zervas et al., 2004) which give rise to all 5-HT neurons in the DRN and a subset
of 5-HT neurons in the MRN and B9 cluster (Jensen et al., 2008). The present
analysis corroborates our earlier microarray evidence (Wylie et al., 2010) in
support of engrailed expression in rostral but not caudal postmitotic 5-HT
neurons. In addition, our findings show that while serotonergic En1 expression
extends into adulthood, En2 expression is no longer detectable at E17.5.
Because initial studies of En expression did not detect En1/2 in 5-HT neurons, it
was concluded that En regulates 5-HT neuron development indirectly through
their control of positional information emanating from the mid-hindbrain organizer
(Simon et al., 2005). Although our expression studies do not refute this interpretation, they raise the possibility that En also play an intrinsic role in
serotonergic progenitors. Distinguishing between these possibilities will require
conditional targeting of En in serotonergic progenitors.
Conditional targeting of En paralogs in 5-HT neurons enabled the identification of a unique stage of En1/2 function separate from the earlier stage revealed in constitutive En1/2 null mice (Simon et al., 2005). Our findings indicate that continued En1/2 function is required during 5-HT neuron maturation to regulate cytoarchitectural maturation of the DRN and maintenance of serotonergic identity. Conditional loss of En1 and En2 led to maturation and
103
maintenance defects in r1-derived 5-HT neurons, but not in 5-HT neurons
derived from more caudal regions. These findings are consistent with the
restricted expression of En1 in r1 of the rostral hindbrain. Interestingly, we show
that many LacZ-marked, En1/2-targeted 5-HT neuron cell bodies within the
developing DRN failed to reach the midline and appeared to be stalled in an
earlier embryonic configuration reflecting completion of only their primary ventral
migration through somal translocation away from the ventricular zone. Our
findings do not preclude an intrinsic role for En in primary migration as the loss of
En with our targeting approach may have occurred too late to detect disruption of
this developmental step. The cytoarchitectural defects were not likely the result of
altered patterns of serotonergic neurogenesis along the anterior-posterior axis as
En was targeted after this developmental stage. Together, our findings suggest that loss of engrailed disrupted subsequent secondary cell body migration during which the bilateral clusters of rostral 5-HT neurons fuse to form the midline structure of the DRN. These results, therefore, provide evidence in support of an active intrinsic regulatory program governing formation of the DRN. Targeting of
Lmx1b and Gata-3, two other post-mitotically expressed serotonergic transcriptional determinants, did not cause disruption of DRN cytoarchitecture
(Zhao et al., 2006; Liu et al., 2010) and Pet-1 deficiency caused only modest lateralization of some DRN 5-HT neuron cell bodies (Krueger and Deneris,
2008). The mis-positioning of 5-HT neuron cell bodies in the En1/2-deficient rostral hindbrain, therefore, reveals a unique function for engrailed in the cytoarchitectural maturation of the DRN.
104
In further contrast to loss of Pet-1 and Lmx1b (Zhao et al., 2006; Liu et al.,
2010), conditional En1/2-deficiency did not affect serotonergic identity immediately after neurogenesis but caused a loss of identity in the perinatal
period. Additional analyses showed that 5-HT cell bodies in En1/25HTCKO mice
were subsequently lost in the early postnatal period. A concomitant increase in
the number of cleaved caspase-3+ cells in the mutant DRN suggests that
continued En1/2 expression is required to prevent apoptosis of 5-HT neurons.
The loss of 5-HT neurons is not likely caused by 5-HT deficiency, as 5-HT- deficient neurons were not eliminated in the Pet-1-/- DRN (Krueger and Deneris,
2008). Perhaps the mis-positioning of 5-HT neurons away from the midline
renders them sensitive to limiting amounts of survival factors and hence
vulnerable to cell death. Despite our estimated targeting efficiency of 85% and
En expression in all DRN 5-HT neurons, we found that En1/2-deficiency affected
the identity and survival of only 50-60% of DRN 5-HT neurons through 23 weeks
of age. In contrast, about 90% of 5-HT+ neurons within the presumptive DRN
were missing by E12 in constitutive En1-/-; En2-/- mice (Simon et al., 2005). It is
unclear why roughly a third of En1/2-targeted 5-HT neurons were spared in
En1/25HTCKO mice. Nevertheless, a common finding is that many 5-HT neurons exhibit resistance to phenotypic changes in serotonergic transcription factor null mutants (Briscoe et al., 1999; van Doorninck et al., 1999; Hendricks et al., 2003;
Pattyn et al., 2004; Jacob et al., 2009). Interestingly, resistant 5-HT neurons in the Pet-1-/- brain constitute a distinct functional subset of Pet-1+ neurons
(Kiyasova et al., 2011). Although the 5-HT neurons that lose identity in the En1/2-
105
deficient brain appear uniformly distributed throughout the DRN and, therefore,
do not appear to be anatomically distinct, further studies will be necessary to
determine whether the En1/2 deficiency-resistant 5-HT neurons constitute a functional subclass. Engrailed also plays a critical, cell autonomous role in the survival of mesencephalic DA (mesDA) neurons as all of these neurons are missing in En1/2 homozygous null mice as a result of apoptosis at E14 (Albéri et al., 2004). In addition, a portion of SN and VTA DA neurons slowly degenerate and die postnatally in En1+/- mice and En1+/-; En2-/- mice (Sgadò et al., 2006;
Sonnier et al., 2007). Interestingly, engrailed-mediated DA neuroprotection
appears to result from post-transcriptional cytoplasmic stimulation of mRNA
translation of mitochondrial complex I proteins (Alvarez-Fischer et al., 2011).
Although we detected abundant nuclear localization of En protein in 5-HT
neurons, the findings in mesDA neurons raise the possibility that a similar post-
transcriptional mechanism might be involved in the postnatal survival of 5-HT
neurons.
The En allelic dosage requirements for postnatal 5-HT neuron identity and
survival are notably different from those at early embryonic stages of 5-HT
neuron development and in postnatal mesDA neuron development (Simon et al.,
2001; Albéri et al., 2004). First, normal numbers of DRN 5-HT neurons were
present in either En1 or En2 homozygous constitutive null (Simon et al., 2005)
and En15HTCKO mice at P0. In addition, despite the complete loss of mesDA
neurons by E14 in En1/2 homozygous null mice, normal numbers of mesDA
neurons are present in En1 or En2 constitutive null mice at P0 (Simon et al.,
106
2001; Albéri et al., 2004). Thus, En1 and En2 can fully compensate for one
another at early stages of monoaminergic neuron development. In contrast, we
found significantly fewer 5-HT neurons in young adult, conditionally targeted En1
mice (En15HTCKO), but normal numbers in En25HTCKO mice. However, the deficit in
En15HTCKO mice was not as severe as that found in En1/25HTCKO. These analyses
therefore reveal a transient and modest contribution from En2 in rostral 5-HT
neurons, which is largely consistent with normal brain 5-HT levels in En2-/- mice,
except for a slight elevation of 5-HT in the cerebellum (Cheh et al., 2006).
Second, a single En2 allele can partially compensate for constitutive loss of three
En alleles in 5-HT (Simon et al., 2005) and mesDA neuron development (Simon
et al., 2001). However, it cannot compensate for maintenance of 5-HT neuron
identity in conditional mutants (Figure 9A). Third, a single En1 allele is sufficient
to maintain normal numbers of 5-HT neurons through six weeks of age.
However, as described above, the presence of only a single functional En1 allele
causes a slow postnatal degeneration of SN DA neurons. It is not clear, however,
whether this is the result of deficient En activity in early development or during
the postnatal period (Sgadò et al., 2006). Our findings therefore reveal a
dominant cell autonomous role for En1 in rostral 5-HT neurons. Although it has
been shown that the En1 and En2 proteins are not functionally equivalent in all
cellular contexts (Sillitoe et al., 2008), the dominant role of En1 in postmitotic 5-
HT neurons is consistent with its persistent expression and the embryonic repression of En2 rather than functional differences between the two paralogs.
107
Figure 1
108
Figure 1. Mating strategies for generation of each of the genotypes used in
analyses. All matings involved one ePet-Cre+ and one ePet-Cre- mouse, so
ePet-Cre+/- experimental mice and ePet-Cre- controls are generated in the same
litter. A, Strategy for generation of the En15HTCKO, En25HTCKO, and En1/25HTCKO
lines. B, Strategy for generation of ePet-Cre; R26R controls. C, Strategy for generation of En1flox/flox; En2flox/+; ePet-Cre; R26R mice. D, Strategy for
generation of En1flox/+; En2flox/flox; ePet-Cre; R26R mice.
109
Figure 2
110
Figure 2. Spatiotemporal expression patterns of En1 and En2 in the rostral hindbrain. A-F, In situ hybridization to detect En1 (A, C, E) or En2 (B, D, F)
transcripts and immunohistochemistry to detect 5-HT (A’-F’) on adjacent sagittal
sections at the indicated stages. G-G’’’, Co-immunohistochemical staining for
pan-En and YFP in ePet-EYFP transgenic embryos. G’’, merge of images in G
and G’. G’’’, Higher magnification image of boxed region in G’’. r1, rhombomere
1; cb, cerebellum; DA, mesencephalic domain of dopaminergic neurons. Dashed
line indicates the midbrain-hindbrain boundary. Scale bar is 100μm for A-F in B’,
50μm (G-G’’), and 10μm (G’’’).
111
Figure 3
112
Figure 3. En1 expression in 5-HT neurons is maintained postnatally. A-B, In
situ hybridization to detect En1 (A, B) or En2 (A’, B’) transcripts and
immunohistochemical detection of Tph (A’’, B’’) on adjacent coronal sections in the DRN (A-A’’) and MRN (B-B’’) at 3 weeks of age. C-D, Co-immunostaining with Tph (C, D) and pan-En (C’, D’) antibodies in the DRN (C-C’’’) and MRN (D-
D’’’) in 3-week-old mice. C’’, D’’ merge of images in C and C’ or D and D’ respectively. C’’’ and D’’’, higher magnification image of boxed region in C’’ and
D’’. Scale bar for A-D in B’’ is 100μm.
113
Figure 4
114
Figure 4. Conditional targeting of En1/2 in 5-HT neurons after
neurogenesis. A, Schematic displaying En1/2 conditional targeting 1-2 days
after 5-HT neurogenesis relative to the stages of serotonergic En1 and En2
expression. B, Real-time qRT-PCR analysis of En1 and En2 expression in flow sorted YFP+ rostral hindbrain 5-HT neurons and neighboring YFP- non-5-HT
cells in En1flox/flox; En2flox/flox; ePet-EYFP control and En1/25HTCKO; ePet-EYFP mice at E12.5. n = 4 biological replicates/genotype. Data presented as mean ±
s.e.m; two-tailed t-test. C, Co-immunostaining with βgal (C) and pan-En (C’) antibodies in the DRN of 3-week-old mice. C’’ merge of the images in C and C’.
C’’’, higher magnification image of boxed region in C’’. Scale bar in C is 100μm.
115
Figure 5
116
Figure 5. Engrailed is required in rostral postmitotic 5-HT neurons to
regulate formation of the DRN. A-L, X-gal detection of LacZ expressing 5-HT
neurons on coronal sections at three different rostrocaudal levels of the DRN in
the indicated genotypes at P0: A-D, DRN (rostral B7) ventral to the periaqueductal gray, E-H, DRN (posterior B7) ventral to the periaqueductal gray, and I-L, posterior DRN (B6) in the pons. Arrows indicate abnormal aggregation of
5-HT neurons in the En1/25HTCKO DRN. Asterisks indicate midline gap in the distribution of 5-HT neurons in the En1/25HTCKO DRN. Solid arrowheads indicate
misplaced LacZ+ cells that form a bilateral bulge of mutant 5-HT neurons. Open
arrowheads indicate abnormal “wing-like” structures of misplaced mutant 5-HT
neurons. Scale bar for A-L in L is 100μm. M-N, The percentage of cells located
either within the midline or lateral to the midline relative to the distribution in
control ePet-Cre; R26R rostral DRN (rostral B7) (M), middle DRN (caudal B7) (N)
and caudal DRN (B6) (O) are shown for each indicated genotype. Indicated
significance refers to statistical comparisons to ePet-Cre; R26R controls. The relative percentage of cells statistically different between En1/25HTCKO and
En25HTCKO in the rostral DRN (midline: p < 0.001, lateral: p<0.01), middle DRN
(midline: p < 0.01, lateral: p<0.001) and caudal DRN (lateral: p<0.001). The
relative percentage of cells in En1/25HTCKO and En15HTCKO are statistically different
in the rostral DRN (midline: p < 0.05, lateral: p<0.05). The relative percentage of
cells En15HTCKO and En25HTCKO are statistically different in the middle DRN
(midline: p < 0.05) and caudal DRN (lateral: p<0.001). The distribution of cells is
not different between En25HTCKO and ePet-Cre; R26R (p > 0.05). Counts were
117 obtained from 4-7 mice/genotype. Data presented in mean ± s.e.m.; two-way repeated measures ANOVA with Bonferroni post-tests. *p < 0.05, **p < 0.01, ***p
< 0.001.
118
Figure 6
119
Figure 6. Engrailed is not required for early maintenance of 5-HT neuron
identity. A-D, Immunohistochemical detection of 5-HT at E12.5 in En1flox/flox;
En2flox/flox control (A, C) and En1/25HTCKO mice (B, D) along the rostrocaudal axis
(A,B) and the dorsoventral axis (C,D). Scale bar is 100μm. E, Relative numbers
of 5-HT+ neurons at E12.5 in the rostral hindbrain of En1flox/flox; En2flox/flox control
and En1/25HTCKO mice. n = 3 mice/genotype. F, HPLC determination of 5-HT
levels in the rostral hindbrain at E12.5 in En1flox/flox; En2flox/flox control and
En1/25HTCKO mice. n ≥ 15 mice/ genotype. G, Real-time qRT-PCR analysis of Sert
and Pet-1 mRNA in purified rostral hindbrain 5-HT neurons obtained from
En1flox/flox; En2flox/flox; ePet-EYFP control and En1/25HTCKO; ePet-EYFP mice at
E12.5. n = 3-5 biological replicates/ genotype. Data presented as mean ± s.e.m;
two-tailed t-test. p > 0.05.
120
Figure 7
121
Figure 7. Engrailed is required for maintenance of serotonergic identity in
the perinatal period. A-D, Tph immunostaining of the DRN (A, B) and MRN (C,
D) on coronal sections in 6-week-old En1flox/flox; En2flox/flox control (A, C) and
En1/25HTCKO mice (B, D). Scale bar is 100μm. E, Relative numbers of 5-HT
neurons in the rostral hindbrain at E14.5 or DRN at the indicated embryonic
stages and postnatal ages, n = 3-4 mice/genotype/age for all analyses except n =
8 mice/genotype for E16.5. Embryonic 5-HT neurons were detected with 5-HT
immunostaining and postnatal neurons with Tph immunostaining. Controls for 23-
week-old mice were ePet-Cre; R26R. F, Relative number of Tph+ neurons in the
MRN of En1flox/flox; En2flox/flox control and En1/25HTCKO mice at 6-weeks, n = 6
mice/genotype. Data presented in mean ± s.e.m.; two-tailed t-test.*p < 0.05, **p <
0.01, ***p < 0.001. G-G’’’, Co-immunostaining for Tph, Aadc, and βgal on coronal sections of a 6-week-old En1/25HTCKO mouse. G’’’ Merge of G, G’ and G’’. H-H’’’,
Co-immunostaining for Tph, Vmat2, and βgal on coronal sections of a 6-week-old
En1/25HTCKO mouse. H’’’ Merge of H, H’ and H’’. Scale bar for G-G’’’ and H-H’’’
in G is 25μm.
122
Figure 8
123
Figure 8. Engrailed is required in postmitotic 5-HT neurons for maintenance
of brain 5-HT levels. A, Levels of 5-HT determined by HPLC in dissected
midbrain or forebrain tissue at the indicated ages for En1flox/flox; En2flox/flox controls
(black bars) and En1/25HTCKO mice (gray bars). Control 5-HT levels were
significantly increased in midbrain and forebrain at each of the indicated
postnatal ages (p < 0.001). 5-HT levels in En1/25HTCKO midbrain were not
significantly increased between 3 and 6 weeks of age (p > 0.05). 5-HT levels in
En1/25HTCKO forebrain tissue were not significantly increased between P0 and 3
weeks (p > 0.05). n = 14 mice/genotype/age. B, 5-HT levels showing differences
between males (striped bars) and females (solid bars). 5-HT levels were not significantly different between sexes for control mice. n=7 mice/sex/genotype/ age. C, Rate of 5-HT metabolism in midbrain and forebrain at the indicated ages.
5-HT metabolism in midbrain tissue significantly changes between P0 and 3 weeks (p<0.001) and between 3 weeks and 6 weeks (p<0.01) for both genotypes. 5-HT metabolism changes significantly between 3 and 6 weeks in forebrain tissue (p<0.001) for both genotypes. Data presented in mean ± s.e.m.; two-way ANOVA with Bonferroni post-tests. *p<0.05, ***p < 0.001.
124
Figure 9
125
Figure 9. En1 is the predominant functional engrailed paralog for
maintenance of 5-HT neuron identity. A, The number of Tph+ neurons at six
weeks of age in the DRN of indicated control floxed mice without ePet-Cre (black bars) or En-deficient conditional knockout mice (gray bars) for each combination of floxed En1 and En2 alleles. The number of DRN Tph+ neurons in En15HTCKO
mice was significantly different from En1/25HTCKO and En1flox/flox; En2flox/+; ePet-
Cre mice (p < 0.05). The number of DRN Tph+ neurons were not significantly
different between En1/25HTCKO and En1flox/flox; En2flox/+; ePet-Cre mice (p > 0.05). n = 3-5 mice/genotype; two-way ANOVA with Bonferroni post-tests. B, Relative numbers of Tph+ neurons in the DRN of En1flox/flox controls and En15HTCKO mice at
P0. n = 3 mice/genotype; two-tailed t-test. Data presented in mean ± s.e.m. **p <
0.01, *** p < 0.001.
126
Figure 10
127
Figure 10. Engrailed is required for survival of postmitotic 5-HT neurons. A-
B, Immunohistochemical detection of β-galactosidase (βgal) expressing DRN 5-
HT neurons in ePet-Cre; R26R control (A) and En1/25HTCKO mice (B) on coronal
sections at 6 weeks of age. C, Relative numbers of LacZ-marked 5-HT neurons in the rostral hindbrain at E14.5 or DRN at postnatal ages in control and
En1/25HTCKO mice at the indicated embryonic stage or postnatal ages, n = 3-5
mice/genotype/age. D-D’’’, Co-immunostaining for cleaved caspase-3 (Casp-3),
βgal, and DAPI in the DRN of En1/25HTCKO mice at P10. D’’’, merge of D, D’, and
D’’. E, Numbers of cleaved caspase-3+/DAPI+ cells in the DRN of ePet-Cre;
R26R control and En1/25HTCKO mice at P10, n = 5 mice/genotype. Data presented
as mean ± s.e.m.; two-tailed t-test. *p < 0.05, **p < 0.01, *** p < 0.001. Scale bar for A and B in B is 100μm and for D-D’’’ in D’’ is 10μm.
128
Figure 11
129
Figure 11. Conditional targeting of En1/2 in 5-HT neurons negatively
impacts pup outcome measures. A, The percentage of litters in which no,
some or all pups were lost from the litter for control dams (black bars) and
En1/25HTCKO dams (grey bars) for either their first litter (solid bar) or for
subsequent litters (striped bar) for the same two cohorts of mice. B, The average
percentage of surviving pups in the first litter for control dams (black lines, no
marker) and En1/25HTCKO dams (grey lines, no marker) and for subsequent litter
for control dams (grey line with square marker) and En1/25HTCKO dams (grey lines
with square marker) for two cohorts of mice; n ≥ 27 litters/genotype/ cohort and n
≥ 13 dams/genotype/cohort C, The average weight of offspring born to En1flox/flox;
En2flox/flox control dams (black lines) or En1/25HTCKO dams (grey lines) at given
ages. n = 106 offspring from 12 control dams and 16 En1/25HTCKO dams; two-way
ANOVA with Bonferroni post-tests. D, Average nest quality on a scale of 1 (no
nest)–4 (complete nest) on the day of birth. n ≥ 28 litters/genotype/cohort; two-
tailed t-test. Data presented as mean ± s.e.m. **p < 0.01, *** p < 0.001.
130
Chapter 3
Effect of genetic background on serotonergic system development
and the Pet-1-/- phenotype
Acknowledgements
I thank Evan Deneris for his expertise. I thank Roxanne Murphy for initiating the backcross and contributing to the initial HPLC. This work was supported by NIH grant RO1 MH062723 to E.S.D. S.R.F. was supported by NIH predoctoral training grant 5T32NS067431.
131
Summary
The transcription factor Pet-1 is an important intrinsic determinant for
serotonin (5-HT) neuron differentiation, maturation and maintenance. In
Pet-1-/- mice, most 5-HT neurons fail to differentiate, precipitating low levels of 5-
HT and behavioral alterations (Hendricks et al., 2003). Because analysis of the 5-
HT system in general, and the Pet-1 null allele in particular, transpires using
multiple genetic backgrounds, it is necessary to determine how genetic
background influences 5-HT neuron development. We chose C57BL/6 and SJL,
because they are commonly used for generation of transgenic mice. The
distribution of 5-HT neurons was identical between C57BL/6, and SJL mice in
E12.5 and 6-week-old mice. Furthermore, 5-HT and 5-HIAA levels were similar in
the brains of adult mice; however, 5-HT levels differed in blood. The Pet-1 null
allele was crossed onto the C57BL/6 and SJL backgrounds for ten generations to
create congenic lines to determine whether there were genetic modifiers of the
Pet-1 phenotype. The distribution of 5-HT neurons did not differ between lines for
Pet-1+/+ mice at E12.5 or 6 weeks, nor for Pet-1-/- mice. At P0, 5-HT levels were only affected by genotype (Pet-1+/+, Pet-1+/- and Pet-1-/-) and not background.
However, 5-HIAA levels and rate of 5-HT turnover was significantly increased in
SJL-Pet-1+/+ and SJL-Pet-1+/- newborns than in the same genotypes on other
backgrounds. Furthermore, 5-HIAA and 5-HT metabolism were decreased in the
C57BL/6-Pet-1+/- compared to C57BL/6-Pet-1+/+. This data suggests that while
the serotonergic system is grossly the same across genetic backgrounds, subtle
differences in serotonin metabolism may influence its function.
132
Introduction
Serotonin (5-HT) neuron differentiation, maturation and maintenance of are directed by a network of transcription factors, including Pet-1, which within the brain, is unique to the 5-HT system (Hendricks et al., 1999; Pfaar et al.,
2002). Pet-1 is important for maintenance and maturation of 5-HT neurons from just after neurogenesis into adulthood. Constitutive removal of Pet-1 function prevents approximately 70% of 5-HT precursors from initiating expression of genes necessary for 5-HT synthesis, storage, reuptake and degradation, and thus attaining their 5-HT identity (Hendricks et al., 2003). In addition, a portion of these cells fail to migrate to their proper location in the DRN (Krueger and
Deneris, 2008). Conditional targeting of Pet-1 1-2 days after completion of neurogenesis allows 5-HT neurons to develop normally through E11.5, at which point cells lose 5-HT gene expression and fail to obtain additional maturation events (Liu et al., 2010). Constitutive or early conditional targeting of Pet-1 reduces 5-HT levels by 80-90% (Hendricks et al., 2003; Liu et al., 2010). Even when Pet-1 is conditionally targeted in adulthood, 5-HT neurons lose expression of serotonin-related genes, including Tph2, Pet-1, and Sert. Even with these defects in identity and maturation, most Pet-1 deficient neurons continue to survive into adulthood (Krueger and Deneris, 2008). The small group of 5-HT neurons that develop in absence of Pet-1 form a functionally distinct subgroup, providing additional evidence for the importance of Pet-1 for 5-HT identity
(Kiyasova et al., 2011). 5-HT neuron dysfunction due to the loss of Pet-1 has functional impacts on behavior. Pet-1-deficient mice display increased
133 aggressive and anxiety-like behaviors and abnormal maternal care behaviors
(Hendricks et al., 2003; Lerch-Haner et al., 2008; Liu et al., 2010).
Pet-1 null mice were originally generated and analyzed on a mixed
129/Sv*C57BL/6 background (Hendricks et al., 2003) and the conditional knockouts on a C57BL/6*SJL*129/Sv background (Liu et al., 2010). Other tools created to study the 5-HT system using the enhancer region of Pet-1, including ePet-Cre and ePet-EYFP, were created on a C57BL/6*SJL background (Scott et al., 2005b; Deneris, 2011). Each of these strains has traits that could alter the physiological or behavioral response in conjunction with Pet-1 targeting and 5-HT system disruption. SJL mice are very aggressive, which could either enhance or conceal Pet-1-deficency derived aggressive behaviors (Hendricks et al., 2003;
Grubb et al., 2004). C57BL/6 mice tend to show reduced anxiety-like and depressive-like phenotypes, perhaps due to increased general activity levels, which could mask subtle behavioral phenotypes. Susceptibility to sensory degeneration also contributes to which behavioral tests can be used. For example, SJL mice are homozygous for Pde6brd1 and thus, become blind by weaning age and C57BL/6 mice are highly susceptible to auditory damage and degeneration in young adulthood. Cytological examinations of the 5-HT system have not been compared across mouse strains.
In this study, we analyzed C57BL/6, SJL, and mixed 129/Sv*C57BL/6 mice for differences in the 5-HT system. Then we generated congenic C57BL/6-
Pet-1 and SJL-Pet-1 lines and compared them to mixed background
192/Sv*C57BL/6-Pet-1 mice. There were no obvious differences in cell number
134
or distribution 5-HT neurons at E12.5 or in adult mice across backgrounds in
control or in Pet-1-/- mice. The lack of gross 5-HT neuron differences is
corroborated by comparable levels of 5-HT within each genotype. Differences in
5-HT degradation at P0 and blood 5-HT in adults suggests that other aspects of
5-HT metabolism may be affected. Furthermore, C57BL/6-Pet-1-/- females have
deficits in maternal behaviors and pup survival compared to control females.
Materials and methods
Mice
Mouse breeding and hosing procedures were approved by the CWRU
School of Medicine Institutional Animal Care in compliance with the National
Institutes of Health guide for the care and use of laboratory animals.
129/Sv*C57BL/6-Pet-1 mice were maintained by primarily Pet-1+/- x Pet-
1+/- crosses and genotyped as previously reported (Hendricks et al., 2003).
Congenic Pet-1 knockout mice were generated by mating mice with the Pet-1
null allele to C57BL/6 or SJL mice for ten generations. Both male and female
pure background mice were used. The C57BL/6-Pet-1 line was primarily
maintained by Pet-1+/- x Pet-1+/- crosses. Due to the aggressive nature of SJL males, Pet-1+/+ mice were commonly used for maintenance of the SJL-Pet-1 line.
SJL-Pet-1+/- x SJL-Pet-1+/- crosses were used to generate experimental mice.
C57BL/6 and SJL mice used for experiments and for backcrosses were obtained
from the Jackson Laboratory and maintained in an on-site colony.
135
Immunohistochemical analysis compared age and sex matched mice of the same genotype. For adult HPLC analysis, pure background mice and
129/Sv*C57BL/6 mice were age matched. HPLC analysis of P0 congenic and mixed background Pet-1 mice included wild-type, heterozygous and knockout mice from the same litters.
Histology
Adult mice were anesthetized using avertin (0.5g tribromoethanol/39.5ml
H20 + 0.31 ml tert-amyl alcohol) and transcardially perfused with ice-cold phosphate buffered saline (PBS), pH 7.4, followed with ice-cold 4% paraformaldehyde (PFA) in PBS, pH 7.4 for 20 minutes. The brain was removed, postfixed for two hours in 4% PFA at 4°C, and cryoprotected in 30% sucrose in
PBS overnight at 4°C. Embryos were collected from timed pregnant females, fixed in 4% PFA at 4°C and cryoprotected in 20% sucrose in PBS overnight at
4°C. Embryos were embedded in O.C.T. Compound (Tissue-Tek) and stored at -
80°C. Tissue sections (20μm) were obtained using a freezing microtome for adult tissues or cryostat for embryos. Sections mounted on SuperFrost Plus slides
(Fisher Scientific) were dried at room temperature for two hours. For immunohistochemistry, the tissue was washed three times in PBST (1XPBS, pH
7.4 and 0.1% Triton-X) and incubated in blocking solution (PBST and 5% normal serum) for at least one hour in a humidity chamber. Tissue sections were incubated with anti-5-HT (rabbit polyclonal anti-5-HT, 1:10,000; Immunostar) for embryos or anti-Tph (mouse monoclonal anti-tryptophan hydroxylase, 1:200;
136
Sigma) for adults in blocking solution overnight at 4°C in a humidity chamber. On
the following day, slides were washed three times in PBST and incubated in a
biotinylated secondary (anti-rabbit IgG biotin conjugate and anti-mouse IgG biotin
conjugate, 1:100; Sigma) for two to three hours at room temperature in a
humidity chamber. After three more washes in PBST, tissue sections were
exposed to avidin using an ABC kit (Vector Laboratories) as directed for one
hour. Slides were washed three times and developed with SigmaFast DAB
(Sigma) as directed for up to several minutes as needed. Developed sections
where rinsed in dH2O and dehydrated in 70% ethanol, 95% ethanol, 100% ethanol and xylenes before the coverslip was attached with DPX mounting media. Images were acquired using an Olympus Optical BX51 microscope and
SPOT camera (Diagnostic Instruments) and processed with Adobe Photoshop.
HPLC
Brain tissue was dissected from adult 129/Sv*C57BL/6, C57BL/6 and SJL mice and P0 Pet-1 wild-type, heterozygous and knockout mice from each background (N10F1 or mixed). Pure background mice were obtained from the
Jackson Laboratory. Adult mice were deeply anesthetized with avertin and
underwent cervical dislocation. The head was removed and blood collected in
blood storage tubes (BD Vacutainer), which were immediately placed in dry ice.
The brain was quickly removed and frozen in dry ice. Newborn (P0 or P1) mice
were decapitated and the brain was quickly removed and frozen. Samples were
stored for up to a few weeks before HPLC analysis. Tissue samples were sent to
137 the Neurochemistry Core Lab in the School of Medicine at Vanderbilt University
(Nashville, TN) for HPLC analysis. Normally distributed data was statically analyzed using a one- or two-way ANOVA with Bonferroni’s multiple comparison test using GraphPad Prism 5. Basic statistical analyses were conducted using
Excel.
Maternal behavior
Maternal behavior examination was conducted on first time mothers and up to two subsequent litters. Pet-1+/- or Pet-1-/- females were mated to Pet-1+/- or
Pet-1-/- males and moved to a clean cage with a nestlet several days prior to giving birth. Each morning females were checked for the quality of nest and number of pups alive or dead until pups reached P7. The number of pups weaned (P21) from each litter was also recorded. Pup survival was determined by averaging the percent of living pups within each litter for each day. Total survival was determined by comparing the number of live/dead pups found on P0 to the number of pups weaned. The quality of the nest was rated as “complete” if the sides were built up and surrounding an area with almost no gaps. It was rated as “partial” if there were large gaps, only portions around a centralized area, or was piled. A “no nest” rating was given if all nesting material was scattered or in a flat disc.
138
Results
Comparison of C57BL/6, SJL and wild-type 129/Sv*C57BL/6
5-HT neurons are born between E9.5 and E11.5 in two domains in the
ventral hindbrain: rostral domain at the level of r1-r3 and a caudal domain at the
level of r5-r8 and cells begin producing 5-HT before E12.5 (Lidov and Molliver,
1982a; Pattyn et al., 2003; Jacob et al., 2007). Neurons then migrate away from the ventricular zone to form each of the raphe nuclei in the midbrain, pons and medulla. Because the development of the 5-HT system could differ between mouse strains, we first compared mice from the C57BL/6 and SJL backgrounds and wild-type mice from the mixed 129/Sv*C57BL/6 background.
We began by comparing distribution of 5-HT+ neurons in the C57BL/6 and
SJL strains in newly differentiated 5-HT neurons at E12.5 and found no obvious differences in the rostral or caudal domains (Figure 1A,B). Comparisons in adulthood using Tph again showed no obvious differences in distribution of 5-HT
neurons across the DRN (Figure 1C,D) or MRN (data not shown).
HPLC was used to analyze levels of 5-HT and its metabolite, 5HIAA, in
whole brain samples and 5-HT levels in whole blood. Two independent
experiments were conducted comparing C57BL/6, SJL, and wild-type mixed
129/Sv*C57BL/6 adult mice (Figure 1E,F). In one of the two experiments, there brain 5-HT levels in C57BL/6 were reduced compared to 129/Sv*C57BL/6 mice.
However, because the other experiment showed no difference, this may be an
artifact. 5-HIAA levels did not differ between strains.
139
Peripheral 5-HT is synthesized by Tph1 in enterochromaffin cells of the gut mucosa, some of which diffuses into the blood stream where it is taken up by platelets (Walther and Bader, 2003). 5-HT is cleared from the blood in the lungs
and liver. Hyperserotonemia commonly found in autistic individuals (Pickett and
London, 2005) and may reflect altered expression or function 5-HT genes common to brain and periphery systems. In both cohorts, 5-HT levels were significantly decreased in SJL mice compared to either C57BL/6 or mixed
129/Sv*C57BL/6 (Figure 1G,H), suggesting that there are differences in 5-HT synthesis, storage, or clearance between these strains.
Interaction between Pet-1 expression and background
Pet-1 gene targeting disrupts 5-HT neuron differentiation, maintenance and
maturation. To determine whether the Pet-1 null mutation is sensitive to changes
in genetic background, congenic Pet-1 mouse lines were generated by
backcrossing Pet-1+/- mice to C57BL/6 or SJL mice for ten generations. At least
one generation included a pure background male to include the Y sex allele of
that background.
Intercrosses of mice at N4 and N10 were examined for differences in 5-HT
neuron loss in Pet-1-/-. Because the results were the same between the two
generations, only data from N10 will be presented. In wild-type E12.5 mice from
each background, a comparable distribution and number of 5-HT+ neurons in the
rostral or caudal domains were observed (Figure 2A-C). Similar results were
obtained in the adult DRN (Figure 2G-I) and MRN (data not shown). When we
140
examined the effect of the background on the Pet-1 null phenotype, again there
were no obvious differences across the rostral or caudal domains at E12.5
(Figure 2D-F) or raphe nuclei in the adult (Figure 2J-L, data not shown).
To examine interactions between Pet-1 null genotype and genetic
background in terms of 5-HT levels or metabolism, 5-HT and 5-HIAA were
measured in whole brain tissue by HPLC in newborn mice (Figure 3A). The level of 5-HT was similar for Pet-1+/+ and Pet-1+/- mice across all strains, which is
consistent with previous literature finding that a single allele of Pet-1 is sufficient
(Hendricks et al., 2003). Likewise, the level of 5-HT was similar across all
backgrounds in Pet-1-/- mice. The lack of differences in 5-HT levels between
backgrounds is consistent with 5-HT and Tph immunohistochemistry. 5-HT levels
in Pet-1 knockout mice were 12.43% of control, which is consistent with the
levels previously reported (Hendricks et al., 2003). Unexpectedly, 5-HT
degradation differed between the three backgrounds. 5-HIAA levels were
increased in SJL -Pet-1+/+ mice than in either C57BL/6 or 129/Sv*C57BL/6.
Further evaluation of 5-HT and 5-HIAA levels confirmed increased 5-HT
metabolism in SJL-Pet-1+/+ brains at P0 (Figure 3B). We next examined the
relationship between the Pet-1 null allele and 5-HT metabolism during this stage
of development. Reduction to one copy of Pet-1 does not affect 5-HT
degradation in either the mixed 129/Sv*C57BL/6 or SJL background. However,
on C57BL/6, 5-HIAA levels and 5-HT degradation in the Pet-1+/- mice are
decreased to Pet-1-/- levels (Figure 3B). As with SJL-Pet-1+/+ mice, 5-HIAA levels
and 5-HT metabolism were significantly greater than in either of other lines
141
(Figure 3B). The level of 5-HIAA is undetectable in Pet-1-/- mice of all three
strains, preventing further interpretation of the Pet-1 null allele and background
interaction. Therefore, although 5-HT levels are similar, differences in
metabolism may cause changes in 5-HT circuitry and function during this critical
period of brain development.
Reduced pup survival from C57BL/6-Pet-1-/- dams
Proper transcriptional control of 5-HT system development and adult
function is necessary for maternal behaviors. 129/Sv*C57BL/6-Pet-1-/- dams are
less likely to build a high quality nest, fail to huddle pups within the nest and are
slower to retrieve scattered pups (Lerch-Haner et al., 2008). Deficiencies in these
behaviors results in loss of all pups regardless of pup genotype during the first
four days of life, although pups survived if fostered by a control mother. Maternal
behaviors can be partially rescued with moderate expression of the human Fev gene or completely rescued with levels of Fev expression equivalent to or greater than wild-type levels of Pet-1 expression. Decreased pup survival and deficits in
pup retrieval were also observed with Tph2-/- mothers on a mostly FVB/N
background, with no deficit in nest building and included cannibalization (Alenina
et al., 2009). Thus, some aspects of maternal behavior may be consistent across
backgrounds and 5-HT gene battery components, while others may differ.
To determine whether background influenced maternal behaviors, we
compared pup survival and nest building in C57BL/6-Pet-1 -/- and C57BL/6-Pet-
1+/- females. Females were mated in harem breeding cages and moved into a
142 fresh cage with a nestlet several days before birth. Observations of nest quality and the number of live and dead pups were made daily for one to three litters. An attempt was made to include females from the SJL background, however this proved impractical because fewer dams were successful at raising litter(s) to weaning. Anecdotal observations also suggests that fewer SJL-Pet-1-/- mice are produced from SJL-Pet-1+/- x SJL-Pet-1+/- matings, perhaps due to increased susceptibility to die with reduced maternal care or increased susceptibility to bradycardia, hypothermia and apnea than Pet-1 null mice on other backgrounds
(Erickson et al., 2007; Cummings et al., 2010).
Only a small number of C57BL/6-Pet-1+/- controls was examined. These dams where highly successful in retaining pups from birth to weaning (Figure 4A,
Table). Only one of the four dams lost any pups, one pup on P1 and one on P2.
C57BL/6-Pet-1-/- dams, on the other hand, were rarely successful and none of the dams had a litter in which all pups survived. Three of thirteen dams were successful in raising any pups to weaning. One dam raised 7 of 9 pups from her first liter and 8 of 10 pups from her second. A second dam raised 4 of 6 pups and
4 of 9 pups, while the third raised 3 of 7 pups in her single litter. One other dam was able to keep a single pup alive longer than 1 week; however, it did not survive to weaning. For all other C57BL/6-Pet-1-/- dams, the entire litter was lost by P3. All of the pups survived through P0 in most litters. However, in three cases, no pups were found, and in three other cases, both live and dead pups were found on P0. Most pups in litters cared for by C57BL/6-Pet-1-/- dams died on P1–P3.
143
Because dams commonly have problems raising their first litter, we
compared pup losses between the first litter and the subsequent litters (Figure
4B). The patterns of pup survival were identical between the first and later litters,
suggesting that the quality of maternal behavior is not simply a matter of
experience. Four C57BL/6-Pet-1-/- dams were able to keep pups for a day or a
few days longer on the second attempt, but these were still ultimately
unsuccessful. Many of the deceased pups were partially or completely
cannibalized by the mother. While 95% of pups were weaned from C57BL/6-Pet-
1+/- dams, only approximately 16% were weaned from C57BL/6-Pet-1-/- dams.
Thus, C57BL/6-Pet-1-/- dams are less likely than their Pet-1+/- counterparts to be
able to successfully raise litters to weaning.
Nest building is a measure of maternal behavior (Gammie, 2005). Nest quality was rated as “complete”, “partial” or “no nest” based on the completeness of the nest on the day of birth (Figure 4C). All C57BL/6-Pet-1+/- dams made a
partial or complete nest. Slightly lower percentage of C57BL/6-Pet-1-/- dams
produced a partial or complete nest, however, unlike C57BL/6-Pet-1+/- females,
some C57BL/6-Pet-1-/- dams did not have a nest. This suggests that C57BL/6-
Pet-1-/- dams tend to produce or maintain lower quality nests around the day of
birth.
Discussion
We examined the impact of the genetic background (C57BL/6,
129/Sv*C57BL/6, or SJL) on the Pet-1-/- phenotype. Distribution of 5-HT neurons
144 was consistent between genetic backgrounds for wild-type mice and genetic background was not an important factor of the phenotype in the absence of Pet-1 expression. The level of brain 5-HT was similar between backgrounds, though metabolism was increased in newborn SJL mice. Gene expression in the
C57BL/6 background interacted with the reduced Pet-1 allelic expression to reduce 5-HT metabolism. Furthermore, blood 5-HT levels were decreased in adult SJL mice. Maternal behavior is disrupted in C57BL/6-Pet-1-/- dams, although not as severely as previously reported. The finding that anatomically, the Pet-1 null phenotype is consistent across these genetic backgrounds is reassuring considering that these mice are examined on multiple genetic backgrounds and crossed with transgenic mice produced on other genetic backgrounds. However, variances in 5-HT metabolism in newborn pups and 5-
HT levels in adult blood suggest that other components of the 5-HT synthesis, release, reuptake, and/or degradation may differ, which could lead to differences in axon target refinement, synapse development and signaling.
Variation in 5-HT signaling could contribute to conflicting analyses of anxiety behavior. 129/Sv*C57BL/6-Pet-1-/- mice were shown to have increased anxiety-like behavior in the elevated plus maze and open field (Hendricks et al.,
2003). Additionally, conditional targeting of Pet-1 in adulthood on a C57BL/6*SJL background show anxiety-like behaviors in the elevated plus maze, open field, and light-dark test in two cohorts of mice (Liu et al., 2010). However, Schaefer et al (2009) showed that Pet-1-/- mice crossed to C57BL/6 mice for 3 generations, did not show increased anxiety in an elevated zero maze or light-dark test.
145
Additionally, Kiyasova et al (2011) that Pet-1-/- mice on a C57BL/6 background
(unknown generations) found decreased anxiety-like behaviors in the elevated plus maze and novelty suppressed feeding and no differences in the open field test. Other causes for these discrepancies could be differences in testing procedures, mouse husbandry, pathogen exposure or epigenetics.
It is interesting that C57BL/6-Pet-1-/- dams’ maternal behavior deficits were not as severe in some respects as previously reported on a 129/Sv*C57BL/6 background (Lerch-Haner et al., 2008) in terms of nest quality and the capability of some dams to rear offspring. On the other hand, some pups died on the day of birth. In these cases, it was not possible to determine if death occurred because of a maternal nurturing defect or a physiological abnormality. As with anxiety-like behaviors, many factors contribute to behavior, which could impact the observed results besides genetic background. For example, the two experiments were carried out in different animal facilities with potentially different pathogens, lighting, and noise and at different times of the year. Additionally, many other genes and brain areas are involved in control of maternal behavior, and many of these genes are transcriptionally controlled, in part, by epigenetic mechanisms
(Gammie, 2005). If these changes were confirmed, however, it would be possible to begin to dissect the genetic contributions to various components of maternal behavior.
146
Figure 1
147
Figure 1. Comparison of C57BL/6, SJL and wild-type mixed 129/Sv*C57BL/6 backgrounds. A,B Immunohistochemistry for 5-HT at E12.5 in C57BL/6 and SJL
embryos. C,D Immunohistochemistry for Tph in the DRN of 6-week-old mice of
C57BL/6 and SJL strains. Scale bar in D is 100μm. E,F HPLC analysis of whole
brain tissues from two cohorts of 6-week-old C57BL/6 (blue), 129/Sv*C57BL/6
(red), and SJL (green) mice in two cohorts. G,H HPLC analysis of whole blood
from two cohorts of 6-week-old C57BL/6 (blue), 129/Sv*C57BL/6 (red), and SJL
(green) mice; cohort 1 (E,G) N=6; cohort 2 (F,H) N=5. Data presented as mean ±
s.e.m.; one-way ANOVA. **p < 0.01; ***p < 0.001
148
Figure 2
149
Figure 2. Distribution of 5-HT neurons is similar across backgrounds. A-F
5-HT staining of Pet-1+/+ (A-C) and Pet-1-/- (D-F) congenic C57BL/6 (A,D), mixed
129/Sv*C57BL/6 (B,E), and congenic SJL (C,F) backgrounds at E12.5. G-L Tph staining of Pet-1+/+ (G-I) and Pet-1-/- (J-L) congenic C57BL/6 (G,J), mixed
129/Sv*C57BL/6 (H,K), and congenic SJL (I,L) backgrounds at 6 weeks of age.
Scale bar in F and L is 100μm.
150
Figure 3
151
Figure 3. HPLC analysis of congenic and mixed background in Pet-1+/+ and
Pet-1 mutant mice. A 5-HT and 5-HIAA levels in whole brain tissue determined
by HPLC in C57BL/6 (blue bars), 129/Sv*C57BL/6 (red bars) and SJL (green
bars) for indicated genotypes at P0. B Ratio of 5-HIAA to 5-HT for indicated genotypes and backgrounds; N=8 mice/genotype/genetic background. Data presented as mean ± s.e.m; two-way ANOVA.***p < 0.001.
152
Figure 4
153
Figure 4. Pup survival and nest building behavior from C57BL/6-Pet-1+/- and Pet-1-/- dams. A, The average percentage survival or each day from birth to
P7 and at weaning from C57BL/6-Pet-1+/- (black squares) and C57BL/6-Pet-1-/-
(grey triangles) dams. Data includes all litters recorded. B, The average percentage of surviving pups from C57BL/6-Pet-1-/- dams on indicated days from their first litter (black square) or all succeeding litters (grey triangles). Data only contains litters where live pups were found on P0. C, The percentage of litters in which the C57BL/6-Pet-1+/- (black bars) or Pet-1-/- (grey bars) dam’s nest was of indicated quality on the day of delivery.
154
Table 1
Summary of pup survival Maternal genotype Pet-1+/- Pet-1-/- Litters with pups lost on P0 0/5 5/28 Dams with pups lost on P0 0/4 4/13
Litters with pups lost by P1 1/5 26/28 Dams with pups lost by P1 1/4 13/13
Litters with pups lost by P3 1/5 28/28 Dams with pups lost by P3 1/4 13/13
Litters with pups lost 1/5 28/28 Dams with pups lost 1/4 13/13
Litters with weaned pups 5/5 5/28 Dams with weaned pups 4/4 3/13
155
Chapter 4
Discussion
The serotonin (5-HT) system is composed of a relatively small number of heterogeneous cells that project throughout the brain and into the spinal cord, modulating the activity of a diverse group of targets, thus contributing to a similarly diverse set of physiological functions and behaviors. 5-HT neuron development begins with a short period of neurogenesis in the ventral hindbrain, followed by a long maturation period, in which cells are maintained, migrate to their adult locations, and integrate into CNS circuitry. These developmental processes are driven by a transcription factor network (Deneris and Wyler, 2012).
While a more complex understanding of the determinants governing 5-HT neurogenesis is being developed, much less is understood about the transcription factors involved in 5-HT neuron maintenance and maturation
(Deneris, 2011). Furthermore, less is known about how the heterogeneity within the 5-HT system is generated.
Engrailed homeobox transcription factors, En1 and En2, play crucial developmental roles in mid-hindbrain patterning (Liu and Joyner, 2001b), cell-
type specification (Condron et al., 1994; Lundell et al., 1996; Bhat and Schedl,
1997; Simon et al., 2005; Watson et al., 2011), axon guidance (Friedman and
O’Leary, 1996; Itasaki and Nakamura, 1996; Matise and Joyner, 1997;
Saueressig et al., 1999; Brunet et al., 2005; Wizenmann et al., 2009) and
156
dopaminergic neuron survival (Simon et al., 2001; Albéri et al., 2004). En1 and
En2 are expressed in the subset of 5-HT neurons born in r1 and populate the dorsal raphe nucleus (DRN) and the dorsal part of the median raphe nucleus
(MRN) and B9 nuclei (Li et al., 2002; Zervas et al., 2004; Jensen et al., 2008).
Previously, En1/2 have been implicated in the specification, differentiation or
survival of 5-HT progenitors or precursors (Simon et al., 2005). As En was not
detected in E12 anterior hindbrain 5-HT neurons, it was logically concluded that
En1/2 provided either a non-cell autonomous patterning role or another function
prior to 5-HT differentiation. The identification of En1and En2 expression in
postmitotic 5-HT neurons raised the possibility that En1/2 could play cell intrinsic
roles in the development of 5-HT neurons (Wylie et al., 2010). Further analysis of
the developmental expression patterns determined that En1 expression extended
from 5-HT neuron differentiation to maintenance in adults. En2 expression was
high at the end of 5-HT differentiation but diminished during the embryonic
maturation period. The long-term expression of En1 and the presence of En2
during early maturation reinforced the practicability of cell-intrinsic regulation by
En1/2. Conditional targeting of En1/2 specifically within 5-HT neurons after
neurogenesis identified related, but possibly independent cell-intrinsic roles in
developing r1-derived 5-HT neurons: 1) formation of the DRN cytoarchitecture, 2)
maintenance of 5-HT neuron identity and 3) cell survival.
157
5-HT neurogenesis
En1/2 contribute to the specification or differentiation of 5-HT progenitors
or precursors as Pet-1 expression and 5-HT+ neurons are greatly reduced in the
anterior hindbrain at E12 (Simon et al., 2005). En1/2 are expressed in r1
beginning at E8.5 and expressed in virtually all r1 cells at E9.5 (Li et al., 2002;
Zervas et al., 2004). 5-HT neurons are derived from En1-expressing cells
(Zervas et al., 2004), further suggesting that En1/2 can specify 5-HT progenitors or precursors. Moreover, because En1/2 are still expressed in early postmitotic neurons (see also Wylie et al., 2010), En1/2 expression probably continues
during 5-HT differentiation. Disruption at any of these stages could result in loss
of 5-HT neurons. The loss of Pet-1 expression at E12.5 could be indicative of a
halt in development prior to Pet-1 induction. Indeed, En1/2 are required for
maintenance of mid-hindbrain organizer genes, including Fgf8, whose expression
is necessary for 5-HT neurogenesis in the anterior hindbrain (Ye et al., 1998; Liu
and Joyner, 2001a). Alternatively, Pet-1 expression could have been induced and not maintained. When Pet-1 is conditionally targeted in postmitotic 5-HT
neurons using ePet-Cre, cells express Pet-1 and differentiate normally through
E11.5, however by E12.5, Pet-1 expression is greatly diminished and 5-HT neurons have begun to disappear (Liu et al., 2010). A third possibility is that cell bodies are missing. It is also possible that in the absence of En1/2, 5-HT progenitors differentiated into another cell type. Analysis of 5-HT progenitor and early precursor markers should elucidate when disruption occurs and possibly
whether cell bodies are still present. Xgal detection of En1LacZ expression would
158
confirm whether cell bodies are still present, even if they have halted
differentiation or have differentiated into a different cell type. If the cells have
undergone differentiation, two likely candidates would be mesencephalic
dopaminergic (mesDA) neurons and ventral motor neurons (vMN). MesDA neurons share many of the same environmental determinants and some of the same transcription factor determinants as 5-HT neurons and are able to
differentiate in absence of En1/2 expression. vMN also share many determinates
as r1 5-HT neurons and precede generation of 5-HT neurons in r2-r3 and r5-r8.
The normal generation of 5-HT precursors in r1 instead of vMN could be related to En1/2 expression possibly by either direct regulation of Phox2b and/or Foxa2 or indirectly through maintenance of Fgf8. Therefore, in absence of En1/2 either of these cell types could be specified instead of 5-HT cells.
En1/2 both cell intrinsically and cell extrinsically govern neural development. The use of constitutive null alleles precludes the ability to distinguish between cell intrinsic and extrinsic functions. Conditional targeting of
En1/2 alleles would be able to distinguish between these possibilities. In addition, it would be possible to more clearly define when and how En1/2 direct 5-HT neurogenesis.
Cell migration and DRN formation
En1/2 are important for the formation of the DRN cytoarchitecture. In the
En1/25HTCKO DRN, the stereotypical structures fail to completely form, leaving
large gaps in cell bodies, dense cell aggregates and many laterally displaced
159
cells. These deficits are most likely due to a problem with cell migration. Because
En1/2 are targeted after neurogenesis, their anterior-posterior (A-P) location is
unaffected and cells are correctly specified. Moreover, only 5-HT neurons are
directly affected by the absence of En1/2, therefore the failure for 5-HT neurons
to be correctly positioned must be due to a defect within 5-HT neurons. This
failure of cell migration and positioning within the DRN demonstrates that 5-HT neuron secondary migration is an active process driven by cell intrinsic mechanisms. While the first step in 5-HT neuron migration, primary migration by somal translocation, has recently been described (Hawthorne et al., 2010), it is not known which mechanisms control secondary migration. It had been suggested that 5-HT neuron bodies are passively formed into the DRN structures due to extrinsic morphological changes in the developing brain (Li.dov and
Molliver, 1982a). Furthermore, very little is known about the regulation of 5-HT neuron migration or raphe nucleus formation.
A role for En1/2 in neuronal migration has not been described before to the extent of my knowledge. However, a similar migration or cytoarchitecture formation deficit could be present in the mesDA system as well. When En1 is constitutively targeted (En1-/-), embryonic mesDA neurons are “more loosely
arranged“ than in controls (Simon et al., 2001). To better determine the general characteristics of En governance of migration and nucleus formation, it would be
interesting to look more closely at the mesDA system in En1-/- mice for
comparison. A role in migration should not be surprising as two of the
developmental roles of En, cell recognition and axon guidance, involve cell
160
adhesion and recognition. Migration may involve different cell adhesion
molecules, but the principles are the same.
DRN malformation varies along the A-P and dorsoventral (D-V) axes. In the rostral DRN, the bilateral columns formed by neuronal translocation from the ventricular zone on either side of the midline fail to fuse, leaving a large midline gap. In the middle DRN, ventral portions fuse properly, however in the dorsal
DRN, cell aggregates continue to flank a midline gap. In the caudal DRN, fusion occurs through most/all of the D-V axis, however many cells remain laterally displaced in dorsal “wing”-like structures and an unusual bulge just ventral to the wings. Even more caudally, the bulge disappears, however the wings remain.
Determination of how En is involved in cell migration and DRN formation could
generate insights into how cells become localized within a nucleus.
The distortions in the caudal DRN, the wings and bulge, are strongly
reminiscent of more rostral DRN structures. This apparent rostralization suggests
that En1/2 might be involved in allowing a cell to identify its A-P location within
the DRN, possibly by regulating expression of genes that could recognize an
external signal and/or by providing or refining the positioning information. Any of
these scenarios would be consistent with other developmental roles identified for
En1/2. In any of these cases, the lack of En1/2 expression may cause the A-P positioning information to be shifted caudally and/or lose definition (or read as such). As some parts of the DRN structures form almost normally and many cells appear to be correctly placed, En1/2 may interact with other factors to position cells and form the DRN. To guide cell positioning, En could be providing or
161
reacting to an A-P guidance signal and regulating genes involved in cell
migration and recognition.
Along the A-P axis of the DRN, there are different sensitivities to En loss.
In the caudal DRN, the pattern and extent of DRN malformation is similar
between En15HTCKO, En1flox/flox; En2flox/+; ePet-Cre; R26R, and En1/25HTCKO mice.
In the middle and rostral DRN, the disruption to DRN cytoarchitecture is much
more severe in En1/25HTCKO compared to either En15HTCKO or En1flox/flox; En2flox/+;
ePet-Cre; R26R. This suggests that En2 expression, in the absence of En1, is
important for the formation of the rostral DRN but not the caudal DRN. Because
En1 can completely compensate for the loss of En2, the influence of En2 can
only be observed in the absence of En1. En gradients of sensitivities has been
described in the development of the tectum and cerebellum as part of an En
code involved in patterning these tissues (Sgaier et al., 2007).
It is also interesting to consider that migration deficits or nucleus formation
deficits were not observed in the MRN. Due to the fact that only the dorsal subset
of MRN neurons is derived from r1, defects may have been subtle. Alternatively,
the proper localization of non-r1-derived 5-HT neurons was sufficient for the proper placement of En1/2-deficient r1 neurons. For whatever reason, r1-derived
5-HT neurons that form the MRN appear to be minimally or non-sensitive to the loss of En1/2 in terms of cell positioning.
Determination of En1/2 targets during DRN formation, especially those with known roles in cell migration and recognition, would clarify the distinct mechanism of En1/2 guidance of DRN formation. Moreover, proteins directly
162 involved in 5-HT neuron cell migration are unknown. These could be identified in an unbiased fashion by comparing the level of RNA transcripts between cells isolated from control and En1/25HTCKO DRNs. Another method could be to identify candidate genes in the database of E12.5 rostral domain 5-HT neurons that have potential En binding sites within their genetic sequence. However, this may fail to identify some candidate genes whose expression is lower, but have high impact or candidates whose expression does not increase until lateral migration begins after E12.5. Another issue is that En1/2 could function posttranscriptionally.
Three non-transcription factor roles have been identified for En: 1) as a non-cell autonomous cell-surface signaling molecule providing positional information to retinal axons within the tectum, 2) as a morphogenic gradient providing positional information to retinal axons within the tectum 3) local translation regulation of proteins involved in dopaminergic cell survival. None of these mechanisms are similar to cell-autonomous regulation of cell localization. Furthermore, En appears to be principally contained within the nucleus. Therefore, non- transcription factor roles for En1/2 are unlikely to be important in DRN formation; however, it could be useful to consider the possibility.
The formation of the DRN is a complex process whereby cells initially born in parallel rows on either side of the floorplate first translocate from the ventricular zone to more ventral portions of the neural tube to create two bilateral clusters on either side of the midline. Then cells must migrate laterally into and away from the midline for fusion of the bilateral columns and the formation of the stereotypical DRN structures. The identification of one set of genes involved in
163
DRN formation can provide the opportunity to identify others and to determine
how cells are positioned within the DRN. Conditional targeting of En1/2
principally affect migration or localization into and around the midline. Additional
genes must be more important for other aspects of cell positioning. Disruption of
DRN formation by conditional targeting of En1/2 also allows another set of
questions to be asked – how are complex three-dimensional brain nuclei formed
and how are cells localized within that structure? The patterning and positioning
of cells within the DRN cytoarchitecture is different from the cerebellum and the
cortex and thus, may provide unique insights.
Maintenance of 5-HT neuron identity
En1/2 maintain expression of genes involved in 5-HT neuron function.
Conditional targeting of En1/2 in postmitotic 5-HT neurons does not appear to
affect the maintenance of identity early, because similar numbers of 5-HT+
neurons are present in control and En1/25HTCKO rostral hindbrain at E12.5. While
it is possible that En protein is still present at this time, it seems unlikely because
En1 and En2 RNA levels are diminished within 5-HT neurons. Additionally,
conditional targeting of other transcription factors with the same ePet-Cre
transgene results in loss of gene expression and 5-HT+ neurons at E12.5 (Zhao
et al., 2006; Liu et al., 2010). En1/2 are only important for maintaining 5-HT neuron identity later in embryonic development. 5-HT+ neuron loss is detectable
beginning at E16.5 and continues only to P0, when approximately half of DRN 5-
HT neurons are missing. The timing and extent of 5-HT neuron loss is dependent
164
on En dosage. Mice with both alleles of En2 but lack En1 (En15HTCKO) maintain
normal numbers of 5-HT neurons through P0 and only about 33% of DRN
neurons disappear by 6 weeks of age. Mice with only one En2 allele (En1flox/flox;
En2flox/+; ePet-Cre; R26R) lose about 50% of 5-HT neurons by 6 weeks, while
those with at least one allele of En1 (En25HTCKO and En1flox/+; En2flox/flox; ePet-Cre;
R26R) maintain normal numbers through 6 weeks.
Loss of 5-HT identity coincides with DRN formation; therefore, both
phenotypes could be related. If DRN cell mislocalization and loss of 5-HT identity
were related, then increases in the severity of one phenotype should be reflected
in increased severity in the other phenotype. If only En15HTCKO, En25HTCKO and
En1/25HTCKO phenotypes are considered, this hypothesis holds true. DRN
formation and numbers of Tph+ DRN neurons are both normal in the En25HTCKO,
highly disrupted in the En1/25HTCKO, and intermediate in the En15HTCKO. However,
when more subtle changes in En allelic dosage are considered, the hypothesis
breaks down. En1flox/flox; En2flox/+; ePet-Cre; R26R mice have a similar level of
DRN disorder as En15HTCKO; however they display a similar loss of Tph+ neurons
as En1/25HTCKO. It would be interesting to compare the timing of identity loss in the En1flox/flox; En2flox/+; ePet-Cre; R26R. It seems likely that it would follow a
similar pattern of loss to the En1/25HTCKO as opposed to the delayed loss observed in En15HTCKO. However, if cell loss did not begin until after P0, then it
could suggest linkage.
The use of temporal restriction of En1 targeting within 5-HT neurons via
activation of ePet-CreER at or after P0 would allow examination of 5-HT identity
165 maintenance without affecting DRN formation. In addition, it would ascertain whether 5-HT neuron loss in the En15HTCKO was due to early developmental influences. If Tph+ neurons still disappeared to a similar extent, as with the
En15HTCKO, then maintenance of identity is both independent of cell placement and due to continued En1 function. The delay in identity loss in En15HTCKO DRN compared to En1/25HTCKO suggests that En2 expression is protective, even though its expression is normally downregulated by E17.5. En2 expression in absence of En1 prolongs the period in which normal numbers of Tph+ neurons are maintained and reduces the severity of cell loss. Perhaps En2 expression remains long enough to get the cells mostly, though not completely, through a critical period where En regulation of key genes is needed for identity maintenance. If this were the case, then conditional targeting of En1 at P0 would be expected to result in a more minor loss of 5-HT neurons.
Other transcription factors play a similar role in 5-HT identity maintenance.
Conditional targeting of either Pet-1 or Lmx1b in recently differentiated or adult 5-
HT neurons results in a loss of 5-HT-specific gene expression (Zhao et al., 2006;
Liu et al., 2010; Song et al., 2011). Interestingly, the promoter region of Pet-1 has a consensus site for En binding (Krueger and Deneris, 2008). Therefore, the loss of 5-HT identity in En1/2-deficient mice could be due to a loss of maintenance factors such as Pet-1. In this case, loss of expression of 5-HT production and signaling genes, such as Tph2, Vmat2 and Aadc, may be an indirect effect. To identify the mechanism by which En maintains 5-HT neuron identity, it will be necessary to identify its direct targets.
166
Cell survival
About half of En1/2-deficient 5-HT neurons in the DRN undergo apoptosis
during the early postnatal period. As 5-HT neurons do not undergo apoptosis as
a result of normal developmental pruning of cell numbers, this must be the result
of alterations in 5-HT neuron development or loss of an internal/ external survival
factor.
Apoptosis could be a long-term effect of loss of identity. It is unlikely that
just failure to express the genes necessary for 5-HT production and signaling
would lead to apoptosis, because near normal numbers of non-differentiated 5-
HT neurons are maintained into adulthood in Pet-1 null mice (Krueger and
Deneris, 2008). Loss of 5-HT identity after differentiation could have a different
result than failure to differentiate fully. Conditional targeting of Lmx1b after a
period of differentiation leads to loss of 5-HT neurons (Zhao et al., 2006),
however cell bodies are not lost with conditional targeting of Pet-1 (Liu et al.,
2010). This suggests that apoptosis is independent of 5-HT neuronal identity loss. It is possible that 5-HT neurons do not undergo apoptosis as a part of normal development processes during the postnatal period due to an aspect of
5-HT identity and fate. If this were found to be the case, then En regulation of cell identity may include the specific component that marks a cell to survive as opposed to undergoing apoptosis.
Reduced exposure to environmental survival factors through misplacement of cell bodies could also contribute to apoptosis. One way that mispositioning could lead to increased cell death could be due to altered cell
167
density. In the anterior DRN, 5-HT cell bodies are more densely packed due to
the failure to migrate into the midline, while in the caudal DRN cells are less
densely packed. However there appears to be an even distribution of cell death across the medial-lateral, D-V and A-P axes of the DRN, in terms of both the loss of cell bodies by 6 weeks of age and by cleaved caspase-3 staining at P10.
Furthermore, the cell aggregates observed in the dorsal portion of the DRN are still visible in 6-week old mice, although at a reduced density. The lack of correlation between cell density and cell death suggests that cell density is not the primary cause of cell death. However, it is also possible that the lateralization of cells in the caudal DRN also exposes these cells to reduced levels of survival factors. To test this, the numbers of apoptotic cells could be quantified in regions where many En1/2-deficient cell bodies are misplaced and compared to regions where few cell bodies are misplaced. Perhaps the dorsal portion of the middle and rostral DRN could be compared to the ventral portion of the middle DRN or the lateral portion of the caudal DRN compared to the midline region. However, this would be difficult due to the small numbers of apoptotic cells in these regions at a given age. Apoptosis appears to occur over a relatively long time span
during the postnatal period. At P10, there is only an 18% increase in apoptotic
cells in the DRN of En1/25HTCKO mice relative to controls. Preliminary analyses of
cell loss and apoptosis during the early postnatal period did not reveal a peak
period of apoptosis. This would mean that multiple ages of mice would have to
be compared to potentially identify specific areas of increased cell loss. It may be
possible to reduce the number of cells needed by examining only apoptotic 5-HT
168 neurons. Βgal disappears from the cell body soon after the cell becomes apoptotic and the membrane becomes permeable, however, a larger molecule may remain for longer. Another test of whether cell misplacement might contribute to apoptosis would be to compare the levels of cell death in the
En1/25HTCKO mice to that of the En15HTCKO, En1flox/flox; En2flox/+; ePet-Cre; R26R, and En1flox/flox; ePet-CreER; R26R, because of differences in the severity of cell disorganization or timing of targeting (see below). If similar numbers of cells are lost in the DRN of these other mutants, then the apoptosis phenotype must be due to a mechanism at least partially independent of cell positioning. The best way to determine if cell misplacement directly caused apoptosis would be to eliminate En expression only during the secondary migration period. This would require En1 expression to be only temporarily blocked from approximately E12.5 to P0 using a method such as the Tet-Off expression system in the En25HTCKO background or by reintroduction of En1 expression by injection of a virus encoding En1 into En1/25THCKO mice.
Inappropriate cell body localization may contribute to a reduction of survival factors in combination with axon guidance. En is cell autonomously involved in axon targeting for some cell types, including spinal interneurons
(Saueressig et al., 1999) and target-driven survival is a well-known developmental occurrence. Examination of the location, complexity, and density of En1/2-deficient axons compared to untargeted cells and to control mice around P0, prior to the onset of the apoptotic period, and in adults, after most apoptosis is complete, could address this. The combination of misplaced cell
169
bodies and the lack of an En-dependent guidance factor could lead to apoptosis either through a multiple insult mechanism or through decreased likelihood of axons reaching and innervating appropriate targets.
Cell death could be a distinct phenotype in that the lack of continued En expression causes failure to survive or induction of apoptotic pathway, as seen in dopaminergic neurons. Alternatively, cell death could be due to disrupted developmental processes, including the failure to maintain 5-HT identity, inappropriate cell body localization, and axon guidance. Two sets of experiments could help to distinguish between these two possibilities. The first would be to analyze cell death in the En15HTCKO and the En1flox/flox; En2flox/+; ePet-Cre; R26R
mice. Both of these genotypes have much less severe defects in DRN formation,
so if cell localization is the main cause of apoptosis, then both genotypes should
have low levels of cell death. In addition, because the level of disruption is similar
to En1/25HTCKO caudal DRN, but much less severe than the En1/25HTCKO rostral
DRN, cell death would be expected to be more severe in the caudal DRN
compared to the rostral DRN. Moreover, the two genotypes differ in the number
of Tph+ cells lost. En15HTCKO mice lose ~33% Tph+ neurons from the DRN
compared to ~53% in the En1flox/flox; En2flox/+; ePet-Cre; R26R DRN. If apoptosis
is primarily correlated with loss of cell identity, then it would be expected that
there would be similar levels of cell death in the En1flox/flox; En2flox/+; ePet-Cre;
5HTCKO 5HTCKO R26R and En1/2 DRN and only mild levels in the En1 DRN. Other
scenarios are possible if neither cell localization nor identity maintenance are
directly related to apoptosis. It may be that the reduction in Tph+ DRN neurons in
170
the En15HTCKO or the En1flox/flox; En2flox/flox; ePet-Cre; R26R are directly due to cell
death instead of cell death proceeded by loss of 5-HT-specific gene expression.
Comparison of the timing of TPH+ neuron loss and cell death in these two
genotypes would identify whether this is the case. An alternative is that cell death
has a different dosage requirement than either of the other phenotypes observed.
In this case, it is possible that there is no apoptosis in either or both En15HTCKO or
En1flox/flox; En2flox/+; ePet-Cre; R26R. Because cell loss occurs only when En1 is
expressed, it seems likely that En1 is the primary paralog involved in cell
survival. However, it is also possible that En2 provides an important contribution
to cell survival either if apoptosis is the result of abnormal development or if En2
expression is sufficient to get 5-HT neurons through a critical developmental
period, which predicates cell death.
The second set of experiments would involve conditional targeting of En1
alleles in 5-HT neurons after critical developmental periods using the ePet-
CreER transgene. By targeting En1 around P0, DRN formation would be
completed. If cell death were directly related to cell placement, then it would be
expected that cells would not undergo apoptosis. If apoptosis were directly
related to cell identity loss, then the presence or absence of cell death would be
dependent on whether identity maintenance is a continuing function of En1.
Timing of En1 targeting at P0 could potentially affect both axon guidance and
maintenance of cell identity. Therefore, later targeting in adults may further
separate developmental and continued function roles of En1 in cell survival.
171
The survival of mesDA neurons is dosage dependent. In absence of all four En alleles, dopamine neurons undergo apoptosis by E14 (Albéri et al.,
2004). A single En1 allele (En1+/-; En2-/-) delays the onset of apoptosis until ~P30
(Sgadò et al., 2006). The presence of an allele of both En1 and En2 (En1+/-;
En+/-) or of one En1 allele and two En2 alleles (En1+/-) delays cell death until 8-12 weeks (Sonnier et al., 2007; Sgadò et al., 2008). Because only constitutive null allele have been used for mesDA analysis, it is only possible to know that normal numbers survive to P0 in En1-/- mice (Simon et al., 2001). It would be interesting to know whether there is a similar time course of apoptosis with DA neuron specific conditional targeting of En1. Continued expression of both En1 and En2 suggest that both contribute to survival, especially when the dosage-dependent time course of cell death is considered. If mesDA neurons were seen to undergo apoptosis during the early postnatal period in absence of En1, it would suggest that a similar mechanism might be involved in both cell types.
Another issue to address is whether the contribution of En to cell survival is due to transcriptional regulation, a posttranscriptional role, or both. En protects mesDA neurons through local regulation of protein levels of Ndufs1/3 and α- synuclein, which are involved in mitochondrial complex I function (Simon et al.,
2001; Alvarez-Fischer et al., 2011). Ndufs1/3 were identified by exposing synaptoneurosomes isolated from the adult ventral midbrain to En1 along with
35S-methionine and 35S-cysteine to label newly translated proteins, which were identified by mass spectrometry. A similar method could be used to determine if
En was involved in local translation regulation in 5-HT terminals. Many of the
172 other methods used to identify post-transcription mechanisms use in vitro methods, which have proven difficult for 5-HT neurons. It is possible to differentiate embryonic stem cells into serotonin producing cells and there are serotonin-like cell lines, so if either of these cell types expressed r1 characteristics including En1/2, it might be possible to use similar methods. While
En is primarily nuclear, small amounts of En located in the cytoplasm or in neurites could be sufficient for non-transcriptional regulation of proteins involved in survival and apoptosis. Therefore, analysis of the subcellular localization of any En protein outside of the nucleus could suggest whether En could be involved in post-transcription regulation.
Axon projections
Analysis of 5-HT neuron projections in the En1/25HTCKO would provide a valuable contribution to this work because it would increase our understanding of the developmental and functional consequences of En1/2-deficencies in 5-HT neurons. Because En1/2 are necessary for intrinsic axon targeting for other cell types (Matise and Joyner, 1997; Saueressig et al., 1999), it is also possible that they are important for 5-HT neurons as well. Furthermore, 5-HT levels are diminished in forebrain tissue prior to loss in the hindbrain. This earlier deficit could be due to either an inability to transport 5-HT or a deficit in axons in forebrain tissue, and based on known En roles, the latter is more likely. It may be possible to compare the density of 5-HT axons and terminals in various DRN targets in the forebrain using immunohistochemistry against 5-HT or SERT.
173
However, it is likely that axon development is disrupted during the extension and early targeting phases, therefore only a reduction in axonal density would be discernible. A better way to analyze a possible axonal phenotype would be to use a transgene that is activated in conditionally targeted cells by Cre and would label axons. This would allow for specific comparison of targeted and non- targeted cells within the same mouse. Therefore, it would be possible to identify areas that are either devoid of En1/2-deficient axons or in excess. Furthermore, it would be possible to look at the complexity and structure of these axons. Even if
En1/2-deficient axons reach target areas, they may be mislocalized, have altered branching complexity or abnormal numbers or shapes of varcocities.
DRN axons are unusual in that they contain many small or fusiform
varsocities that often from non-junctional synapses. It seems unlikely that En1/2 are important for generation of this phenotype in DRN 5-HT neurons, because the axons from dorsal MRN 5-HT neurons display the same large spherical varicosities and synchronous synapses common to the rest of the MRN
(Kosofsky and Molliver, 1987; Mulligan and Törk, 1988; Törk, 1990). However, perhaps this unusual synapse structure leaves DRN neurons particularly vulnerable to the lack of target-mediated cell survival signals. To determine if this were a possibility, near normal numbers of En1/2-deficient axons would have to be observed near target regions during the early postnatal period prior to loss of cell bodies and prior to a loss of axons in target fields. If this was observed, then infusion of En into target fields may lead to increased axonal maintenance and cell survival.
174
Behavior consequences of conditional En1/2 ablation
The extent of 5-HT system dysfunction observed in En1/25HTCKO mice
would be expected to have behavioral consequences. Increased anxiety
behaviors have been observed in mice with loss of 30-40% of Tph+ neurons and
about 30% forebrain 5-HT (Liu et al., 2010). In addition, conditional targeting of 5-
HT neuron function in the DRN and dorsal MRN using En1-Cre; Pet1-Flpe; RC-
PFtox transgenes resulted in decreased anxiety related behavior in open field
test (Kim et al., 2009). Anxiety-like behaviors were analyzed in the En1/25HTCKO
mice in open field and light-dark box paradigms, but variation within each of the
genotypes was too large to make any conclusions. There are multiple potential
causes for the variation observed. One is that both males and females were
used. Additionally, because the mice were on a mixed genetic background
created by crossing mice with the En1/2 alleles on a congenic Swiss Webster background and mice with the ePet-Cre; R26R alleles on a mixed 129/Sv*SJL background. It is possible that specific alleles from these backgrounds interacted
with the conditional targeting of En1/2 to alter the phenotype and that these
alleles were only present in some of the mice used for behavioral analysis. There
is evidence for variation in Tph+ neuron loss phenotype when all experiments
from all postnatal ages are examined in aggregate. A small number of animals
had abnormally low levels of R26R activation, suggesting low levels of Cre
expression and inactivation of En alleles. In these mice there was a smaller loss of DRN Tph+ neurons. In another larger group of animals, Tph+ neuron loss
appeared to be much more severe in the rostral DRN. As this was an
175
inconsistent phenotype, factors other than just En1/2 targeting must contribute.
EPet-Cre activation level and pattern of cell loss was not examined in mice
tested for anxiety. It is also possible that epigenetic factors could contribute to
variation in phenotype; however, there is currently no evidence for an epigenetic
influence. Epigenetic differences have been shown to alter behavior in the
offspring of dams with null alleles of the 5HT1a receptor (van Velzen and Toth,
2010). Some of these factors could be address by backcrossing the conditional
targeting alleles onto a single background for at least four generations, which
would result in mice with greater than 93% genetic similarity. Epigenetic
contributions would require careful multi-generational breading strategies for generation of mice used for behavioral tests.
Final thoughts
We now know that En1/2 are expressed in and directly govern multiple aspects of r1-derived 5-HT neuron development. As En1 expression continues in adult 5-HT neurons, it may continue to maintain 5-HT neurons, and perhaps contribute to other aspects of function. Conditional targeting of En1/2 provides a novel model to explore the process of forming complex neuronal cytoarchitectural structures, as well as providing new insight into the transcription factor regulation of 5-HT neuron maturation. It also emphasizes the importance of cell type and temporal conditional targeting models, because the phenotypes analyzed here could not have been identified in constitutively null En1/2 mice, as 5-HT neurons are not present and mice do not survive past P0. Additional analysis of these
176
mutants will provide insights into En functions in the development of 5-HT
neurons that will likely be applicable to other transcription factors and other cell types. It will be interesting to learn how En govern these and other
developmental processes, whether through transcriptional regulation and through
non-transcription factor mechanisms.
Conditional targeting of En1/2 in 5-HT neurons also provides the
opportunity to specifically examine one subgroup of 5-HT neurons. En1/2 are
only expressed in the rostral-most born 5-HT neurons, born in r1 under the control of the mid-hindbrain organizer and populate the DRN and dorsal MRN
(Zervas et al., 2004; Jensen et al., 2008). These 5-HT neurons comprise over
half of the ascending 5-HT system (Vertes and Crane, 1997) with distinct
projections and behavioral consequences (Kim et al., 2009; Hale and Lowry,
2011). Further dissection of the 5-HT system will lead to insights on the
heterogeneity within the 5-HT system and how this heterogeneity contributes to
the diverse contributions of 5-HT neurons to CNS systems and functions.
The 5-HT system and engrailed have been associated with neurological
disorders, including autism spectrum disorder. Mouse models of En2 dysfunction
and multiple models of altered 5-HT system development mimic some common
biological and/or behavioral phenotypes observed in ASD. Both can cause
developmental abnormalities in multiple brain areas that could lead to the
interconnection and sensory integration problems believed to underlie ASD
symptoms. Altered function of transcription factors, such as En2, that can alter
the development of multiple systems, which can in turn alter the development of
177 other systems, could provide a basis for the underlying susceptibility to neurological and behavioral pathogenesis. ASD as well as other behavioral and physiological disorders are rarely the result of a single gene or system malfunction, instead they are derived from multiple environmental, developmental and genetic components that alter the function of multiple systems and thus comprise an underlying susceptibility (Kuemerle et al., 2007; Hohmann and Blue,
2010; Deneris and Wyler, 2012). Increased understanding of the neurological development and long term roles for developmental genes may identify new connections between these components, leading to increased understanding of neurological disorders.
178
References
Adam Y, Edwards RH, Schuldiner S (2008) Expression and function of the rat vesicular monoamine transporter 2. Am J Physiol Cell Physiol 294:C1004– 11.
Alarόn M, Cantor RM, Liu J, Gilliam TC, The Autism Genetic Resource Exchange Consortium X, Geschwind DH (2002) Evidence for a language quantitative trait locus on chromosome 7q in multiplex autism families. Am J Hum Genet 70:60–71.
Alavian KN, Scholz C, Simon HH (2008) Transcriptional regulation of mesencephalic dopaminergic neurons: the full circle of life and death. Mov Disord 23:319–328.
Albert VR, Lee MR, Bolden AH, Wurzburger RJ, Aguanno A (1992) Distinct promoters direct neuronal and nonneuronal expression of rat aromatic L- amino acid decarboxylase. Proc Natl Acad Sci U S A 89:12053–12057.
Albéri L, Sgadò P, Simon HH (2004) Engrailed genes are cell-autonomously required to prevent apoptosis in mesencephalic dopaminergic neurons. Development 131:3229–3236.
Alenina N, Kikic D, Todiras M, Mosienko V, Qadri F, Plehm R, Boyé P, Vilianovitch L, Sohr R, Tenner K, Hörtnagl H, Bader M (2009) Growth retardation and altered autonomic control in mice lacking brain serotonin. Proc Natl Acad Sci U S A 106:10332–10337.
Altamura C, Dell’Acqua ML, Moessner R, Murphy DL, Lesch KP, Persico AM (2007) Altered neocortical cell density and layer thickness in serotonin transporter knockout mice: a quantitation study. Cereb Cortex 17:1394– 1401.
Alvarez-Fischer D, Fuchs J, Castagner F, Stettler O, Massiani-Beaudoin O, Moya KL, Bouillot C, Oertel WH, Lombès A, Faigle W, Joshi RL, Hartmann A, Prochiantz A (2011) Engrailed protects mouse midbrain dopaminergic neurons against mitochondrial complex I insults. Nat Neurosci 14:1260– 1266.
Arai R, Karasawa N, Kurokawa K, Kanai H, Horiike K, Ito A (2002) Differential subcellular location of mitochondria in rat serotonergic neurons depends on the presence and the absence of monoamine oxidase type B. Neuroscience 114:825–835.
179
Aroca P, Beatriz L-C, R MF, Puelles L (2006) Locus Coeruleus Neurons Originate in Alar Rhombomere 1 and Migrate into the Basal Plate : Studies in Chick and Mouse. The Journal of Comparative Neurology 496:802–818.
Aroca P, Puelles L (2005) Postulated boundaries and differential fate in the developing rostral hindbrain. Brain Res Brain Res Rev 49:179–190.
Asano M, Gruss P (1992) Pax-5 is expressed at the midbrain-hindbrain boundary during mouse development. Mech Dev 39:29–39.
Ase AR, Reader TA, Hen R, Ria M, Descarries L (2000) Altered serotonin and dopamine metabolism in the CNS of serotonin 5-HT(1A) or 5-HT(1B) receptor knockout mice. J Neurochem 75:2415–2426.
Auranen M, Vanhala R, Varilo T, Ayers K, Kempas E, Ylisaukko-Oja T, Sinsheimer JS, Peltonen L, Järvelä I (2002) A genomewide screen for autism-spectrum disorders: evidence for a major susceptibility locus on chromosome 3q25-27. Am J Hum Genet 71:777–790.
Baader S, Sanlioglu S, Berrebi A, Parker-Thornburg J, Oberdick J (1998) Ectopic overexpression of engrailed-2 in cerebellar Purkinje cells causes restricted cell loss and retarded external germinal layer development at lobule junctions. J Neurosci 18:1763–1773.
Bagri A, Marín O, Plump AS, Mak J, Pleasure SJ, Rubenstein JLR, Tessier- Lavigne M (2002) Slit proteins prevent midline crossing and determine the dorsoventral position of major axonal pathways in the mammalian forebrain. Neuron 33:233–248.
Baker KG, Halliday GM, Halasz P, Hornung JP, Geffen LB, Cotton RG, Törk I (1991) Cytoarchitecture of serotonin-synthesizing neurons in the pontine tegmentum of the human brain. Synapse 7:301–320.
Beltramo M, Krieger M, Calas a, Franzoni MF, Thibault J (1993) Aromatic amino acid decarboxylase (AADC) immunohistochemistry in vertebrate brainstem with an antiserum raised against AADC made in E. coli. Brain Res Bull 32:123–132.
Benayed R, Choi J, Matteson PG, Gharani N, Kamdar S, Brzustowicz LM, Millonig JH (2009) Autism-associated haplotype affects the regulation of the homeobox gene, ENGRAILED 2. Biol Psychiatry 66:911–917.
Benayed R, Gharani N, Rossman I, Mancuso V, Lazar G, Kamdar S, Bruse SE, Tischfield S, Smith BJ, Zimmerman RA, Dicicco-Bloom E, Brzustowicz LM, Millonig JH (2005) Support for the homeobox transcription factor gene
180
ENGRAILED 2 as an autism spectrum disorder susceptibility locus. Am J Hum Genet 77:851–868.
Bengel D, Murphy DL, Andrews AM, Wichems CH, Feltner D, Heils A, Mössner R, Westphal H, Lesch KP (1998) Altered brain serotonin homeostasis and locomotor insensitivity to 3, 4-methylenedioxymethamphetamine (“Ecstasy”) in serotonin transporter-deficient mice. Mol Pharmacol 53:649–655.
Bhat KM, Schedl P (1997) Requirement for engrailed and invected genes reveals novel regulatory interactions between engrailed/invected, patched, gooseberry and wingless during Drosophila neurogenesis. Development 124:1675–1688.
Blakely RD, Berson HE, Fremeau RTJ, Caron MG, Peek MM, Prince HK, Bradley CC (1991) Cloning and expression of a functional serotonin transporter from rat brain. Nature 354:66–70.
Blatt GJ (2005) GABAergic cerebellar system in autism: a neuropathological and developmental perspective. Int Rev Neurobiol 71:167–178.
Blue ME, Erzurumlu RS, Jhaveri S (1991) A comparison of pattern formation by thalamocortical and serotonergic afferents in the rat barrel field cortex. Cereb Cortex 1:380–389.
Bockaert J, Claeysen S, Dumuis A, Marin P (2010) Classification and Signaling Characteristics of 5-HT Receptors (Müller CP, Jacobs BL, eds). Elsevier.
Bonnin A, Goeden N, Chen K, Wilson ML, King J, Shih JC, Blakely RD, Deneris ES, Levitt P (2011) A transient placental source of serotonin for the fetal forebrain. Nature 472:347–350.
Bonnin A, Levitt P (2011) Fetal, maternal, and placental sources of serotonin and new implications for developmental programming of the brain. Neuroscience 197:1–7.
Booth D, Marie B, Domenici P, Blagburn JM, Bacon JP (2009) Transcriptional control of behavior: engrailed knock-out changes cockroach escape trajectories. J Neurosci 29:7181–7190.
Bortolato M, Chen K, Shih JC (2010) The Degradation of Serotonin: Role of MAO. In: The Handbook of Behavioral Neuroscience (Mϋller CP, Jacobs BL, eds), pp.203–218. Amsterdam, Boston, Heidelberg, London, New York, Oxford, Paris, San Diego, San Francisco, Singapore, Sydney, Tokyo: Elsevier.
181
Boylan CB, Bennett-Clarke CA, Crissman RS, Mooney RD, Rhoades RW (2000) Clorgyline treatment elevates cortical serotonin and temporarily disrupts the vibrissae-related pattern in rat somatosensory cortex. J Comp Neurol 427:139–149.
Briscoe J, Sussel L, Serup P, Hartigan-O’Connor D (1999) Homeobox gene Nkx2. 2 and specification of neuronal identity by graded Sonic hedgehog signalling. Nature 398:622–627.
Brodski C, Weisenhorn DMV, Signore M, Sillaber I, Oesterheld M, Broccoli V, Acampora D, Simeone A, Wurst W (2003) Location and size of dopaminergic and serotonergic cell populations are controlled by the position of the midbrain-hindbrain organizer. J Neurosci 23:4199–4207.
Brune CW, Korvatska E, Allen-Brady K, Cook EH, Dawson G, Devlin B, Estes A, Hennelly M, Hyman SL, McMahon WM, Munson J, Rodier PM, Schellenberg GD, Stodgell CJ, Coon H (2008) Heterogeneous association between engrailed-2 and autism in the CPEA network. Am J Med Genet, Part B 147B:187–193.
Brunet I, Weinl C, Piper M, Trembleau A, Volovitch M, Harris W, Prochiantz A, Holt C (2005) The transcription factor Engrailed-2 guides retinal axons. Nature 438:94–98.
Canning CA, Lee L, Irving C, Mason I, Jones CM (2007) Sustained interactive Wnt and FGF signaling is required to maintain isthmic identity. Dev Biol 305:276–286.
Cases O, Lebrand C, Giros B, Vitalis T, De Maeyer E, Caron MG, Price DJ, Gaspar P, Seif I (1998) Plasma membrane transporters of serotonin, dopamine, and norepinephrine mediate serotonin accumulation in atypical locations in the developing brain of monoamine oxidase A knock-outs. J Neurosci 18:6914–6927.
Cases O, Seif I, Grimsby J, Gaspar P, Chen K, Pournin S, Müller U, Aguet M, Babinet C, Shih JC, De Maeyer E (1995) Aggressive Behavior and Altered Amounts of Brain Serotonin and Norephinephrine in Mice Lacking MAOA. Science 268:1763–1766.
Caspi A, Hariri AR, Holmes A, Uher R, Moffitt TE (2010) Genetic sensitivity to the environment: the case of the serotonin transporter gene and its implications for studying complex diseases and traits. Am J Psychiatry 167:509–527.
Chang A, Chang S, Starnes D, Schroeter S, Bauman A, Blakely R (1996) Cloning and expression of the mouse serotonin transporter. Brain Res Mol Brain Res 43:185–192.
182
Chatelin S, Wehrlé R, Mercier P, Morello D, Sotelo C, Weber MJ (2001) Neuronal promoter of human aromatic L-amino acid decarboxylase gene directs transgene expression to the adult floor plate and aminergic nuclei induced by the isthmus. Brain Res Mol Brain Res 97:149–160.
Cheh MA, Millonig JH, Roselli LM, Ming X, Jacobsen E, Kamdar S, Wagner GC (2006) En2 knockout mice display neurobehavioral and neurochemical alterations relevant to autism spectrum disorder. Brain Res 1116:166–176.
Chen K, Holschneider DP, Wu W, Rebrin I, Shih JC (2004) A spontaneous point mutation produces monoamine oxidase A/B knock-out mice with greatly elevated monoamines and anxiety-like behavior. J Biol Chem 279:39645– 39652.
Cheng HJ, Nakamoto M, Bergemann AD, Flanagan JG (1995) Complementary gradients in expression and binding of ELF-1 and Mek4 in development of the topographic retinotectal projection map. Cell 82:371–381.
Cheng L, Chen C-L, Luo P, Tan M, Qiu M, Johnson R, Ma Q (2003) Lmx1b, Pet- 1, and Nkx2.2 Coordinately Specify Serotonergic Neurotransmitter Phenotype. J Neurosci 23:9961–9967.
Cheng Y, Sudarov A, Szulc KU, Sgaier SK, Stephen D, Turnbull DH, Joyner AL (2010) The Engrailed homeobox genes determine the different foliation patterns in the vermis and hemispheres of the mammalian cerebellum. Development 137:519–529.
Chi CL, Martinez S, Wurst W, Martin GR (2003) The isthmic organizer signal FGF8 is required for cell survival in the prospective midbrain and cerebellum. Development 130:2633–2644.
Chiang C, Litingtung Y, Lee E, Young KE, Corden JL, Westphal H, Beachy PA (1996) Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383:407–413.
Chien Y-L, Wu Y-Y, Chiu Y-N, Liu S-K, Tsai W-C, Lin P-I, Chen C-H, Gau SS-F, Chien W-H (2011) Association study of the CNS patterning genes and autism in Han Chinese in Taiwan. Prog Neuropsychopharmacol Biol Psychiatry 35:1512–1517.
Condron BG, Patel NH, Zinn K (1994) Engrailed controls glial/neuronal cell fate decisions at the midline of the central nervous system. Neuron 13:541–554.
Conroy J, Meally E, Kearney G, Fitzgerald M, Gill M, Gallagher L (2004) Serotonin transporter gene and autism: a haplotype analysis in an Irish autistic population. Mol Psychiatry 9:587–593.
183
Cook EH, Courchesne R, Lord C, Cox NJ, Yan S, Lincoln A, Haas R, Courchesne E, Leventhal BL (1997) Evidence of linkage between the serotonin transporter and autistic disorder. Mol Psychiatry 2:247–250.
Craven SE, Lim K-C, Ye W, Engel JD, de Sauvage F, Rosenthal A (2004) Gata2 specifies serotonergic neurons downstream of sonic hedgehog. Development 131:1165–1173.
Croen LA, Grether JK, Yoshida CK, Odouli R, Hendrick V (2011) Antidepressant use during pregnancy and childhood autism spectrum disorders. Arch Gen Psychiatry 68:1104–1112.
Crossley PH, Martin GR (1995) The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development 121:439–451.
Crossley PH, Martinez S, Martin GR (1996) Midbrain development induced by FGF8 in the chick embryo. Nature 380:66–68.
Cummings KJ, Commons KG, Hewitt JC, Daubenspeck JA, Li A, Kinney HC, Nattie EE (2011) Failed heart rate recovery at a critical age in 5-HT-deficient mice exposed to episodic anoxia: implications for SIDS. J Appl Physiol 111:825–833.
Cummings KJ, Li A, Deneris ES, Nattie EE (2010) Bradycardia in serotonin- deficient Pet-1-/- mice: influence of respiratory dysfunction and hyperthermia over the first 2 postnatal weeks. Am J Physiol 298:R1333–42.
Côté F, Thévenot E, Fligny C, Fromes Y, Darmon M, Ripoche M-A, Bayard E, Hanoun N, Saurini F, Lechat P, Dandolo L, Hamon M, Mallet J, Vodjdani G (2003) Disruption of the nonneuronal tph1 gene demonstrates the importance of peripheral serotonin in cardiac function. Proc Natl Acad Sci U S A 100:13525–13530.
Dahlstroem A, Fuxe K (1964) Evidence for the existence of monoamine- containing neurons in the central nervous system. I. demonstration of monoamines in the cell bodies of brain stem neurons. Acta Physiol Scand, Suppl 62:SUPPL 232:1–55.
Dai J-X, Han H-L, Tian M, Cao J, Xiu J-B, Song N-N, Huang Y, Xu T-L, Ding Y- Q, Xu L (2008) Enhanced contextual fear memory in central serotonin- deficient mice. Proc Natl Acad Sci U S A 105:11981–11986.
Damier P, Hirsch EC, Agid Y, Graybiel AM (1999) The substantia nigra of the human brain II . Patterns of loss of dopamine-containing neurons in Parkinson’s disease. Brain 122:1437–1448.
184
Danielian PS, McMahon AP (1996) Engrailed-1 as a target of the Wnt-1 signalling pathway in vertebrate midbrain development. Nature 383:332– 334.
Davis CA, Holmyard DP, Millen KJ, Joyner a L (1991) Examining pattern formation in mouse, chicken and frog embryos with an En-specific antiserum. Development 111:287–298.
Davis CA, Joyner AL (1988) Expression patterns of the homeo box-containing genes En-1 and En-2 and the proto-oncogene int-1 diverge during mouse development. Genes Dev 2:1736–1744.
Davis LK, Hazlett HC, Librant AL, Nopoulos P, Sheffield VC, Piven J, Wassink TH (2008) Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene. Am J Med Genet, Part B 147B:1145–1151.
Deneris ES (2011) Molecular genetics of mouse serotonin neurons across the lifespan. Neuroscience 197:17–27.
Deneris ES, Wyler SC (2012) Serotonergic transcriptional networks and potential importance to mental health. Nat Neurosci 15:519–527.
Devlin B, Cook EH, Coon H, Dawson G, Grigorenko EL, McMahon W, Minshew N, Pauls D, Smith M, Spence MA, Rodier PM, Stodgell C, Schellenberg GD (2005) Autism and the serotonin transporter: the long and short of it. Mol Psychiatry 10:1110–1116.
DiCicco-Bloom E, Lord C, Zwaigenbaum L, Courchesne E, Dager SR, Schmitz C, Schultz RT, Crawley J, Young LJ (2006) The developmental neurobiology of autism spectrum disorder. J Neurosci 26:6897–6906.
Ding Y-Q, Marklund U, Yuan W, Yin J, Wegman L, Ericson J, Deneris E, Johnson RL, Chen Z-F (2003) Lmx1b is essential for the development of serotonergic neurons. Nat Neurosci 6:933–938.
Dittrich R, Bossing T, Gould AP, Technau GM, Urban J (1997) The differentiation of the serotonergic neurons in the Drosophila ventral nerve cord depends on the combined function of the zinc finger proteins Eagle and Huckebein. Development 124:2515–2525.
Dolmazon V, Alenina N, Markossian S, Mancip J, van de Vrede Y, Fontaine E, Dehay C, Kennedy H, Bader M, Savatier P, Bernat A (2011) Forced expression of LIM homeodomain transcription factor 1b enhances differentiation of mouse embryonic stem cells into serotonergic neurons. Stem Cells Dev 20:301–311.
185
Donovan SL, Mamounas LA, Andrews AM, Blue ME, McCasland JS (2002) GAP- 43 is critical for normal development of the serotonergic innervation in forebrain. J Neurosci 22:3543–3552. van Doorninck JH, van Der Wees J, Karis A, Goedknegt E, Engel JD, Coesmans M, Rutteman M, Grosveld F, De Zeeuw CI (1999) GATA-3 is involved in the development of serotonergic neurons in the caudal raphe nuclei. J Neurosci 19:RC12.
Drescher U, Kremoser C, Handwerker C, Löschinger J, Noda M, Bonhoeffer F (1995) In vitro guidance of retinal ganglion cell axons by RAGS, a 25 kDa tectal protein related to ligands for Eph receptor tyrosine kinases. Cell 82:359–370.
D’Souza UM, Craig IW (2010) Genetic Organization of the Serotonergic System. In: Handbook of Behavioral Neuroscience (Müller CP, Jacobs BL, eds), pp.23–50. Elsevier.
Eaton MJ, Gudehithlu KP, Quach T, Silvia CP, Hadjiconstantinou M, Neff NH (1993) Distribution of aromatic L-amino acid decarboxylase mRNA in mouse brain by in situ hybridization histology. J Comp Neurol 337:640–654.
Echelard Y, Epstein DJ, St-Jacques B, Shen L, Mohler J, McMahon JA, McMahon AP (1993) Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 75:1417–1430.
Echelard Y, Vassileva G, McMahon AP (1994) Cis-acting regulatory sequences governing Wnt-1 expression in the developing mouse CNS. Development 120:2213–2224.
Edwards DJ (1980) Molecular properties of the monoamine oxidases. Schizophr Bull 6:275–281.
Erickson JT, Shafer G, Rossetti MD, Wilson CG, Deneris ES (2007) Arrest of 5HT neuron differentiation delays respiratory maturation and impairs neonatal homeostatic responses to environmental challenges. Respir Physiol Neurobiol 159:85–101.
Erickson JT, Sposato BC (2009) Autoresuscitation responses to hypoxia-induced apnea are delayed in newborn 5-HT-deficient Pet-1 homozygous mice. J Appl Physiol 106:1785–1792.
Ericson J, Morton S, Kawakami A, Roelink H, Jessell TM (1996) Two critical periods of Sonic Hedgehog signaling required for the specification of motor neuron identity. Cell 87:661–673.
186
Evrard A, Laporte AM, Chastanet M, Hen R, Hamon M, Adrien J (1999) 5-HT1A and 5-HT1B receptors control the firing of serotoninergic neurons in the dorsal raphe nucleus of the mouse: studies in 5-HT1B knock-out mice. Eur J Neurosci 11:3823–3831.
Fabre V, Beaufour C, Evrard A, Rioux A, Hanoun N, Lesch KP, Murphy DL, Lanfumey L, Hamon M, Martres MP (2000) Altered expression and functions of serotonin 5-HT1A and 5-HT1B receptors in knock-out mice lacking the 5- HT transporter. Eur J Neurosci 12:2299–2310.
Fatemi SH et al. (2012) Consensus Paper: Pathological Role of the Cerebellum in Autism. Cerebellum.
Favor J, Sandulache R, Neuhäuser-Klaus A, Pretsch W, Chatterjee B, Senft E, Wurst W, Blanquet V, Grimes P, Spörle R, Schughart K (1996) The mouse Pax2(1Neu) mutation is identical to a human PAX2 mutation in a family with renal-coloboma syndrome and results in developmental defects of the brain, ear, eye, and kidney. Proc Natl Acad Sci U S A 93:13870–13875.
Fenstermaker AG, Prasad AA, Bechara A, Adolfs Y, Tissir F, Goffinet A, Zou Y, Pasterkamp RJ (2010) Wnt/planar cell polarity signaling controls the anterior-posterior organization of monoaminergic axons in the brainstem. J Neurosci 30:16053–16064.
Fernandez SP, Gaspar P (2012) Investigating anxiety and depressive-like phenotypes in genetic mouse models of serotonin depletion. Neuropharmacology 62:144–154.
Field T (2011) Prenatal depression effects on early development: a review. Infant Behav Dev 34:1–14.
Fon EA, Pothos EN, Sun BC, Killeen N, Sulzer D, Edwards RH (1997) Vesicular transport regulates monoamine storage and release but is not essential for amphetamine action. Neuron 19:1271–1283.
Fornal CA, Metzler CW, Gallegos RA, Veasey SC, McCreary AC, Jacobs BL (1996) WAY-100635, a potent and selective 5-hydroxytryptamine1A antagonist, increases serotonergic neuronal activity in behaving cats: comparison with (S)-WAY-100135. J Pharmacol Exp Ther 278:752–762.
Fournet V, Jany M, Fabre V, Chali F, Orsal D, Schweitzer A, Andrieux A, Messanvi F, Giros B, Hamon M, Lanfumey L, Deloulme J-C, Martres M-P (2010) The deletion of the microtubule-associated STOP protein affects the serotonergic mouse brain network. J Neurochem 115:1579–1594.
187
Friedman GC, O’Leary DD (1996) Retroviral misexpression of engrailed genes in the chick optic tectum perturbs the topographic targeting of retinal axons. J Neurosci 16:5498–5509.
Fuchs J, Mueller JC, Lichtner P, Schulte C, Munz M, Berg D, Wüllner U, Illig T, Sharma M, Gasser T (2009) The transcription factor PITX3 is associated with sporadic Parkinson’s disease. Neurobiol Aging 30:731–738.
Gammie SC (2005) Current models and future directions for understanding the neural circuitries of maternal behaviors in rodents. Behav Cogn Neurosci Rev 4:119–135.
Gardner CA, Barald KF (1992) Expression patterns of engrailed-like proteins in the chick embryo. Dev Dyn 193:370–388.
Gaspar P, Cases O, Maroteaux L (2003) The developmental role of serotonin: news from mouse molecular genetics. Nat Rev Neurosci 4:1002–1012.
Gentile S (2005) The safety of newer antidepressants in pregnancy and breastfeeding. Drug Saf 28:137–152.
Gentile S (2007) Serotonin reuptake inhibitor-induced perinatal complications. Paediatr Drugs 9:97–106.
Gharani N, Benayed R, Mancuso V, Brzustowicz LM, Millonig JH (2004) Association of the homeobox transcription factor, ENGRAILED 2, 3, with autism spectrum disorder. Mol Psychiatry 9:474–484.
Gibert J-M (2002) The evolution of engrailed genes after duplication and speciation events. Dev Genes Evol 212:307–318.
Greenawalt JW, Schnaitman C (1970) An Appraisal of the Use of Monoamine Oxidase as an Enzyme Marker for the Outer Membrane of Rat Liver Mitochondria. J Cell Biol 46:173–179.
Grimsby J, Toth M, Chen K, Kumazawa T, Klaidman L, Adams JD, Karoum F, Gal J, Shih JC (1997) Increased Stress Response and β-phenylethylamine in MAOB-deficient mice. Nat Genet 17:206–210.
Grubb S, Churchill G, Bogue M (2004) A collaborative database of inbred mouse strain characteristics. Bioinformatics 20:2857–2859.
Gutknecht L, Kriegebaum C, Waider J, Schmitt A, Lesch K-P (2009) Spatio- temporal expression of tryptophan hydroxylase isoforms in murine and human brain: convergent data from Tph2 knockout mice. Eur Neuropsychopharmacol 19:266–282.
188
Gutknecht L, Waider J, Kraft S, Kriegebaum C, Holtmann B, Reif A, Schmitt A, Lesch K-P (2008) Deficiency of brain 5-HT synthesis but serotonergic neuron formation in Tph2 knockout mice. J Neural Transm 115:1127–1132.
Hagenbuch N, Feldon J, Yee BK (2006) Use of the elevated plus-maze test with opaque or transparent walls in the detection of mouse strain differences and the anxiolytic effects of diazepam. Behav Pharmacol 17:31–41.
Hale MW, Lowry CA (2011) Functional topography of midbrain and pontine serotonergic systems: implications for synaptic regulation of serotonergic circuits. Psychopharmacology (Berl) 213:243–264.
Hale MW, Shekhar A, Lowry CA (2011) Development by environment interactions controlling tryptophan hydroxylase expression. J Chem Neuroanat 41:219–226.
Hanks M, Wurst W, Anson-Cartwright L, Auerbach AB, Joyner AL (1995) Rescue of the En-1 mutant phenotype by replacement of En-1 with En-2. Science 269:679–682.
Hanks MC, Loomis CA, Harris E, Tong CX, Anson-Cartwright L, Auerbach A, Joyner A (1998) Drosophila engrailed can substitute for mouse Engrailed1 function in mid-hindbrain, but not limb development. Development 125:4521–4530.
Hansson SR, Mezeyt E, Hoffman BJ (1998) Serotonin transporter messenger rna in the developing rat brain: early expression in serotonergic neurons and transient expression in non-serotonergic neurons. Neuroscience 83:1185– 1201.
Hawthorne AL, Wylie CJ, Landmesser LT, Deneris ES, Silver J (2010) Serotonergic neurons migrate radially through the neuroepithelium by dynamin-mediated somal translocation. J Neurosci 30:420–430.
Haydon PG, McCobb DP, Kater SB (1987) The regulation of neurite outgrowth, growth cone motility, and electrical synaptogenesis by serotonin. J Neurobiol 18:197–215.
Hayn-Leichsenring G, Liebig C, Miething A, Schulz A, Kumar S, Schwalbe M, Eiberger B, Baader SL (2011) Cellular distribution of metastasis suppressor 1 and the shape of cell bodies are temporarily altered in Engrailed-2 overexpressing cerebellar Purkinje cells. Neuroscience 189:68–78.
Heikinheimo M, Lawshé A, Shackleford GM, Wilson DB, MacArthur CA (1994) Fgf-8 expression in the post-gastrulation mouse suggests roles in the
189
development of the face, limbs and central nervous system. Mech Dev 48:129–138.
Hendricks T, Francis N, Fyodorov D, Deneris ES (1999) The ETS domain factor Pet-1 is an early and precise marker of central serotonin neurons and interacts with a conserved element in serotonergic genes. J Neurosci 19:10348–10356.
Hendricks TJ, Fyodorov DV, Wegman LJ, Lelutiu NB, Pehek EA, Yamamoto B, Silver J, Weeber EJ, Sweatt JD, Deneris ES (2003) Pet-1 ETS gene plays a critical role in 5-HT neuron development and is required for normal anxiety- like and aggressive behavior. Neuron 37:233–247.
Hirsch E, Graybiel AM, Agid YA (1988) Melanized dopaminergic neurons are differentially susceptible to degeneration in Parkinson’s disease. Nature 334:345–348.
Hodges MR, Wehner M, Aungst J, Smith JC, Richerson GB (2009) Transgenic mice lacking serotonin neurons have severe apnea and high mortality during development. J Neurosci 29:10341–10349.
Hoffman BJ, Mezey E, Brownstein MJ (1991) Cloning of a serotonin transporter affected by antidepressants. Science 254:579–580.
Hohmann CF, Blue ME (2010) The Role of Serotonin in Cortical Development: Implications for Autism Spectrum Disorder. In: Handbook of Behavioral Neuroscience (Mϋller CP, Jacobs BL, eds), pp.636–665. Elsevier.
Holmes A, le Guisquet AM, Vogel E, Millstein RA, Leman S, Belzung C (2005) Early life genetic, epigenetic and environmental factors shaping emotionality in rodents. Neurosci Biobehav Rev 29:1335–1346.
Holmes A, Lit Q, Murphy DL, Gold E, Crawley JN (2003) Abnormal anxiety- related behavior in serotonin transporter null mutant mice: the influence of genetic background. Genes Brain Behav 2:365–380.
Holmes A, Murphy DL, Crawley JN (2002) Reduced aggression in mice lacking the serotonin transporter. Psychopharmacology (Berl) 161:160–167.
Hornung J-P (2003) The human raphe nuclei and the serotonergic system. J Chem Neuroanat 26:331–343.
Hranilovic D, Blazevic S, Babic M, Smurinic M, Bujas-Petkovic Z, Jernej B (2010) 5-HT2A receptor gene polymorphisms in Croatian subjects with autistic disorder. Psychiatry Res 178:556–558.
190
Hynes M, Stone DM, Dowd M, Pitts-Meek S, Goddard A, Gurney A, Rosenthal A (1997) Control of cell pattern in the neural tube by the zinc finger transcription factor and oncogene Gli-1. Neuron 19:15–26.
Hynes M, Ye W, Wang K, Stone D, Murone M, Sauvage FD, Rosenthal A (2000) The seven-transmembrane receptor smoothened cell-autonomously induces multiple ventral cell types. Nat Neurosci 3:41–46.
Ichinose H, Sumi-Ichinose C, Ohye T, Hagino Y, Fujita K, Nagatsu T (1992) Tissue-specific alternative splicing of the first exon generates two types of mRNAs in human aromatic L-amino acid decarboxylase. Biochemistry 31:11546–11550.
Irving C, Mason I (2000) Signalling by FGF8 from the isthmus patterns anterior hindbrain and establishes the anterior limit of Hox gene expression. Development 127:177–186.
Ishimura K, Takeuchi Y, Fujiwara K, Tominaga M, Yoshioka H, Sawada T (1988) Quantitative analysis of the distribution of serotonin-immunoreactive cell bodies in the mouse brain. Neurosci Lett 91:265–270.
Itasaki N, Nakamura H (1996) A role for gradient en expression in positional specification on the optic tectum. Neuron 16:55–62.
Iyo AH, Porter B, Deneris ES, Austin MC (2005) Regional distribution and cellular localization of the ETS-domain transcription factor, FEV, mRNA in the human postmortem brain. Synapse 57:223–228.
Jacob J, Ferri AL, Milton C, Prin F, Pla P, Lin W, Gavalas A, Ang S-L, Briscoe J (2007) Transcriptional repression coordinates the temporal switch from motor to serotonergic neurogenesis. Nat Neurosci 10:1433–1439.
Jacob J, Storm R, Castro DS, Milton C, Pla P, Guillemot F, Birchmeier C, Briscoe J (2009) Insm1 (IA-1) is an essential component of the regulatory network that specifies monoaminergic neuronal phenotypes in the vertebrate hindbrain. Development 136:2477–2485.
Jahng J won, Houpt TA, Wessel TC, Chen K, Shih JC, Joh TH (1997) Localization of Monoamine Oxidase A and B mRNA in the Rat Brain by In Situ Hybridization. Synapse 25:30–36.
Jennings KA, Loder MK, Sheward WJ, Pei Q, Deacon RMJ, Benson M a, Olverman HJ, Hastie ND, Harmar AJ, Shen S, Sharp T (2006) Increased expression of the 5-HT transporter confers a low-anxiety phenotype linked to decreased 5-HT transmission. J Neurosci 26:8955–8964.
191
Jensen P, Farago AF, Awatramani RB, Scott MM, Deneris ES, Dymecki SM (2008) Redefining the serotonergic system by genetic lineage. Nat Neurosci 11:417–419.
Joyner AL (1996) Engrailed, Wnt and Pax genes regulate midbrain-hindbrain development. Trends Genet 12:15–20.
Joyner AL, Herrup K, Auerbach AB, Davis CA, Rossant J (1991) Subtle cerebellar phenotype in mice homozygous for a targeted deletion of the En-2 homeobox. Science 251:1239–1243.
Katori S, Hamada S, Noguchi Y, Fukuda E, Yamamoto T, Yamamoto H, Hasegawa S, Yagi T (2009) Protocadherin-alpha family is required for serotonergic projections to appropriately innervate target brain areas. J Neurosci 29:9137–9147.
Kern JK, Jones AM (2006) Evidence of toxicity, oxidative stress, and neuronal insult in autism. J Toxicol Environ Health B Crit Rev 9:485–499.
Kim D, Tolliver T, Huang S, Martin B (2005) Altered serotonin synthesis, turnover and dynamic regulation in multiple brain regions of mice lacking the serotonin transporter. Neuropharmacology 49:798–810.
Kim JC, Cook MN, Carey MR, Shen C, Regehr WG, Dymecki SM (2009) Linking genetically defined neurons to behavior through a broadly applicable silencing allele. Neuron 63:305–315.
Kim S, Cox N, Courchesne R, Lord C, Corsello C, Akshoomoff N, Guter S, Leventhal B, Courchesne E, Cook EJ (2002) Transmission disequilibrium mapping at the serotonin transporter gene (SLC6A4) region in autistic disorder. Molecular Psychiatry 7:278–288.
Kinnear Kern J (2003) Purkinje cell vulnerability and autism: a possible etiological connection. Brain Dev 25:377–382.
Kinney HC, Richerson GB, Dymecki SM, Darnall R a, Nattie EE (2009) The brainstem and serotonin in the sudden infant death syndrome. Annu Rev Pathol 4:517–550.
Kistner-Griffin E, Brune CW, Davis LK, Sutcliffe JS, Cox NJ, Cook EH (2011) Parent-of-origin effects of the serotonin transporter gene associated with autism. Am J Med Genet, Part B 156:139–144.
Kiyasova V, Fernandez SP, Laine J, Stankovski L, Muzerelle A, Doly S, Gaspar P (2011) A genetically defined morphologically and functionally unique
192
subset of 5-HT neurons in the mouse raphe nuclei. J Neurosci 31:2756– 2768.
Kiyasova V, Gaspar P (2011) Development of raphe serotonin neurons from specification to guidance. Eur J Neurosci 34:1553–1562.
Klauck SM, Poustka F, Benner A, Lesch KP, Poustka A (1997) Serotonin transporter (5-HTT) gene variants associated with autism? Hum Mol Genet 6:2233–2238.
Kofman O (2002) The role of prenatal stress in the etiology of developmental behavioural disorders. Neurosci Biobehav Rev 26:457–470.
Kornberg T (1981) Engrailed: a gene controlling compartment and segment formation in Drosophila. Proc Natl Acad Sci U S A 78:1095–1099.
Kosofsky BE, Molliver ME (1987) The serotoninergic innervation of cerebral cortex: different classes of axon terminals arise from dorsal and median raphe nuclei. Synapse 1:153–168.
Krueger KC, Deneris ES (2008) Serotonergic transcription of human FEV reveals direct GATA factor interactions and fate of Pet-1-deficient serotonin neuron precursors. J Neurosci 28:12748–12758.
Kuemerle B, Gulden F, Cherosky N, Williams E, Herrup K (2007) The mouse Engrailed genes: a window into autism. Behav Brain Res 176:121–132.
Kuemerle B, Zanjani H, Joyner A, Herrup K (1997) Pattern deformities and cell loss in Engrailed-2 mutant mice suggest two separate patterning events during cerebellar development. J Neurosci 17:7881–7889.
Lattimore KA, Donn SM, Kaciroti N, Kemper AR, Neal CR, Vazquez DM (2005) Selective serotonin reuptake inhibitor (SSRI) use during pregnancy and effects on the fetus and newborn: a meta-analysis. J Perinatol 25:595–604.
Lebrand C, Cases O, Adelbrecht C, Doye A, Alvarez C, El Mestikawy S, Seif I, Gaspar P (1996) Transient uptake and storage of serotonin in developing thalamic neurons. Neuron 17:823–835.
Lebrand C, Cases O, Wehrle R, Blakely RD, Edwards RH, Gaspar P (1998) Transient Developmental Expression of Monoamine Transporters in the Rodent Forebrain. J Comp Neurol 401:506–524.
Lerch-Haner JK, Frierson D, Crawford LK, Beck SG, Deneris ES (2008) Serotonergic transcriptional programming determines maternal behavior and offspring survival. Nat Neurosci 11:1001–1003.
193
Levitt P, Moore RY (1978) Developmental organization of raphe serotonin neuron groups in the rat. Anat Embryol (Berl) 154:241–251.
Levitt P, Pintar JE, Breakefield XO (1982) Immunocytochemical demonstration of monoamine oxidase B in brain astrocytes and serotonergic neurons. Proc Natl Acad Sci U S A 79:6385–6389.
Li JYH, Joyner AL (2001) Otx2 and Gbx2 are required for refinement and not induction of mid-hindbrain gene expression. Development 128:4979–4991.
Li JYH, Lao Z, Joyner AL (2002) Changing Requirements for Gbx2 in Development of the Cerebellum and Maintenance of the Mid/Hindbrain Organizer. Neuron 36:31–43.
Li Q, Wichems C, Heils A, Van De Kar LD, Lesch K-P, Murphy DL (1999) Reduction of 5-hydroxytryptamine (5-HT)(1A)-mediated temperature and neuroendocrine responses and 5-HT(1A) binding sites in 5-HT transporter knockout mice. J Pharmacol Exp Ther 291:999–1007.
Li Q, Wichems C, Heils A, Lesch K-P, Murphy DL (2000) Reduction in the density and expression, but not G-protein coupling, of serotonin receptors (5-HT1A) in 5-HT transporter knock-out mice: gender and brain region differences. J Neurosci 20:7888–7895.
Lidov HG, Molliver ME (1982a) Immunohistochemical study of the development of serotonergic neurons in the rat CNS. Brain Research Bulletin 9:559–604.
Lidov HG, Molliver ME (1982b) An immunohistochemical study of serotonin neuron development in the rat: ascending pathways and terminal fields. Brain Research Bulletin 8:389–430.
Lima FB, Centeno ML, Costa ME, Reddy a P, Cameron JL, Bethea CL (2009) Stress sensitive female macaques have decreased fifth Ewing variant (Fev) and serotonin-related gene expression that is not reversed by citalopram. Neuroscience 164:676–691.
Liu A, Joyner AL (2001a) EN and GBX2 play essential roles downstream of FGF8 in patterning the mouse mid/hindbrain region. Development 128:181– 191.
Liu A, Joyner AL (2001b) Early anterior/posterior patterning of the midbrain and cerebellum. Annu Rev Neurosci 24:869–895.
Liu A, Losos K, Joyner AL (1999) FGF8 can activate Gbx2 and transform regions of the rostral mouse brain into a hindbrain fate. Development 126:4827– 4838.
194
Liu C, Maejima T, Wyler SC, Casadesus G, Herlitze S, Deneris ES (2010) Pet-1 is required across different stages of life to regulate serotonergic function. Nat Neurosci 13:1190–1198.
Liu J, Nyholt DR, Magnussen P, Parano E, Pavone P, Geschwind D, Lord C, Iversen P, Hoh J, Ott J, Gilliam TC (2001) A genomewide screen for autism susceptibility loci. Am J Hum Genet 69:327–340.
Logan C, Hanks MC, Noble-Topham S, Nallainathan D, Provart NJ, Joyner AL (1992) Cloning and sequence comparison of the mouse, human, and chicken engrailed genes reveal potential functional domains and regulatory regions. Dev Genet 13:345–358.
Logan C, Willard HF, Johanna R, Joyner AL (1989) Chromosomal Localization of the Human Homeo Box-Containing Genes , EN1 and EN2. Genomics 4:206–209.
Logan C, Wizenmann A, Drescher U, Monschau B, Bonhoeffer F, Lumsden A (1996) Rostral optic tectum acquires caudal characteristics following ectopic engrailed expression. Curr Biol 6:1006–1014.
Loomis CA, Harris E, Michaud J, Wurst W, Hanks M, Joyner a L (1996) The mouse Engrailed-1 gene and ventral limb patterning. Nature 382:360–363.
Lundell MJ, Chu-lagraff Q, Doe CQ, Hirsh J (1996) The engrailed and huckebein Genes Are Essential for Development of Serotonin Neurons in the. Mol Cell Neurosci 7:46–61.
Lundell MJ, Hirsh J (1998) eagle is required for the specification of serotonin neurons and other neuroblast 7-3 progeny in the Drosophila CNS. Development 125:463–472.
Luque JM, Kwan S-WW, Abell CW, Da Prada M, Richards JG (1995) Cellular expression of mRNAs encoding monoamine oxidases A and B in the rat central nervous system. J Comp Neurol 363:665–680.
Maestrini E, Lai C, Marlow A, Matthews N, Wallace S, Bailey A, Cook EH, Weeks DE, Monaco AP, International Molecular Genetic Study of Autism (IMGSA) Consortium (1999) Serotonin transporter (5-HTT) and γ-aminobutyric acid receptor subunit β3 (GABRB3) gene polymorphisms are not associated with autism in the IMGSA families. Am J Med Genet, Part B 496:492–496.
Mannoury la Cour C, Boni C, Hanoun N, Lesch K-P, Hamon M, Lanfumey L (2001) Functional consequences of 5-HT transporter gene disruption on 5- HT(1a) receptor-mediated regulation of dorsal raphe and hippocampal cell activity. J Neurosci 21:2178–2185.
195
Marco EJ, Hinkley LBN, Hill SS, Nagarajan SS (2011) Sensory processing in autism: a review of neurophysiologic findings. Pediatr Res 69:48R–54R.
Marie B, Bacon JP (2000) Two engrailed-related genes in the cockroach: cloning, phylogenetic analysis, expression and isolation of splice variants. Dev Genes Evol 210:436–448.
Marie B, Bacon JP, Blagburn JM (2000) Double-stranded RNA interference shows that Engrailed controls the synaptic specificity of identified sensory neurons. Curr Biol 10:289–292.
Marie B, Blagburn JM (2003) Differential roles of engrailed paralogs in determining sensory axon guidance and synaptic target recognition. J Neurosci 23:7854–7862.
Marie B, Cruz-Orengo L, Blagburn JM (2002) Persistent engrailed expression is required to determine sensory axon trajectory, branching, and target choice. J Neurosci 22:832–841.
Martinez S, Alvarado-Mallart RM (1990) Expression of the homeobox Chick-en gene in chick/quail chimeras with inverted mes-metencephalic grafts. Developmental biology 139:432–436.
Martí E, Takada R, Bumcrot DA, Sasaki H, McMahon AP (1995) Distribution of Sonic hedgehog peptides in the developing chick and mouse embryo. Development 121:2537–2547.
Mathews TA, Fedele DE, Coppelli FM, Avila AM, Murphy DL, Andrews AM (2004) Gene dose-dependent alterations in extraneuronal serotonin but not dopamine in mice with reduced serotonin transporter expression. J Neurosci Methods 140:169–181.
Matise MP, Epstein DJ, Park HL, Platt KA, Joyner AL (1998) Gli2 is required for induction of floor plate and adjacent cells, but not most ventral neurons in the mouse central nervous system. Development 125:2759–2770.
Matise MP, Joyner AL (1997) Expression patterns of developmental control genes in normal and Engrailed-1 mutant mouse spinal cord reveal early diversity in developing interneurons. J Neurosci 17:7805–7816.
Maurer P, Rorive S, de Kerchove d’Exaerde A, Schiffmann SN, Salmon I, de Launoit Y (2004) The Ets transcription factor Fev is specifically expressed in the human central serotonergic neurons. Neurosci Lett 357:215–218.
McCauley JL, Olson LM, Dowd M, Amin T, Steele A, Blakely RD, Folstein SE, Haines JL, Sutcliffe JS (2004) Linkage and association analysis at the
196
serotonin transporter (SLC6A4) locus in a rigid-compulsive subset of autism. Am J Med Genet, Part B 127B:104–112.
McMahon A, Bradley A (1990) The Wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain. Cell 62:1073–1085.
McMahon AP, Joyner AL, Bradley A, McMahon JA (1992) The midbrain- hindbrain phenotype of Wnt-1-/Wnt-1- mice results from stepwise deletion of engrailed-expressing cells by 9.5 days postcoitum. Cell 69:581–595.
Millen KJ, Hui CC, Joyner AL (1995) A role for En-2 and other murine homologues of Drosophila segment polarity genes in regulating positional information in the developing cerebellum. Development 121:3935–3945.
Millen KJ, Wurst W, Herrup K, Joyner AL (1994) Abnormal embryonic cerebellar development and patterning of postnatal foliation in two mouse Engrailed-2 mutants. Development 120:695–706.
Mulligan KA, Törk I (1988) Serotoninergic innervation of the cat cerebral cortex. J Comp Neurol 270:86–110.
Murphy DL, Lesch K-P (2008) Targeting the murine serotonin transporter: insights into human neurobiology. Nat Rev Neurosci 9:85–96.
Narboux-Nême N, Sagné C, Doly S, Diaz SL, Martin CBP, Angenard G, Martres M-P, Giros B, Hamon M, Lanfumey L, Gaspar P, Mongeau R (2011) Severe serotonin depletion after conditional deletion of the vesicular monoamine transporter 2 gene in serotonin neurons: neural and behavioral consequences. Neuropsychopharmacology 36:2538–2550.
Neal KB, Parry LJ, Bornstein JC (2009) Strain-specific genetics, anatomy and function of enteric neural serotonergic pathways in inbred mice. J Physiol 587:567–586.
Nicholson DW, Ali A, Thornberry NA, Vaillancourt JP, Ding CK, Gallant M, Gareau Y, Griffin PR, Labelle M, Lazebnik YA (1995) Identification and inhibition of the ICE/CED-3 protease necessary for mammalian apoptosis. Nature 376:37–43.
Nordquist N, Oreland L (2010) Serotonin, genetic variability, behaviour, and psychiatric disorders--a review. Ups J Med Sci 115:2–10.
Nugent NR, Tyrka AR, Carpenter LL, Price LH (2011) Gene-environment interactions: early life stress and risk for depressive and anxiety disorders. Psychopharmacology (Berl) 214:175–196.
197
Orabona GM, Griesi-Oliveira K, Vadasz E, Bulcão VLS, Takahashi VNVO, Moreira ES, Furia-Silva M, Ros-Melo AMS, Dourado F, Matioli SR, Matioli R, Otto P, Passos-Bueno MR (2009) HTR1B and HTR2C in autism spectrum disorders in Brazilian families. Brain Res 1250:14–19.
Osterberg N, Wiehle M, Oehlke O, Heidrich S, Xu C, Fan C-M, Krieglstein K, Roussa E (2011) Sim1 is a novel regulator in the differentiation of mouse dorsal raphe serotonergic neurons. PLoS One 6:e19239.
O’Malley KL, Harmon S, Moffat M, Uhland-Smith A, Wong S (1995) The human aromatic L-amino acid decarboxylase gene can be alternatively spliced to generate unique protein isoforms. J Neurochem 65:2409–2416.
Pardo CA, Eberhart CG (2007) The neurobiology of autism. Brain Pathol 17:434– 447.
Partanen J (2007) FGF signalling pathways in development of the midbrain and anterior hindbrain. J Neurochem 101:1185–1193.
Patel PD, Pontrello C, Burke S (2004) Robust and tissue-specific expression of TPH2 versus TPH1 in rat raphe and pineal gland. Biol Psychiatry 55:428– 433.
Paterson DS, Hilaire G, Weese-Mayer DE (2009) Medullary serotonin defects and respiratory dysfunction in sudden infant death syndrome. Respir Physiol Neurobiol 168:133–143.
Pattyn A, Simplicio N, van Doorninck JH, Goridis C, Guillemot F, Brunet J-F (2004) Ascl1/Mash1 is required for the development of central serotonergic neurons. Nat Neurosci 7:589–595.
Pattyn A, Vallstedt A, Dias JM, Samad OA, Krumlauf R, Rijli FM, Brunet J-F, Ericson J (2003) Coordinated temporal and spatial control of motor neuron and serotonergic neuron generation from a common pool of CNS progenitors. Genes & development 17:729–737.
Pavone LM, Mithbaokar P, Mastellone V, Lo Muto R, Spina a, Maharajan V, Paino G, Avallone L (2008) Expression of the serotonin transporter (SERT) gene during mouse development. Vet Res Commun 32 Suppl 1:S167–9.
Persico AM, Baldi A, Dell’Acqua ML, Moessner R, Murphy DL, Lesch K-P, Keller F (2003) Reduced programmed cell death in brains of serotonin transporter knockout mice. Neuroreport 14:341–344.
Persico AM, Bourgeron T (2006) Searching for ways out of the autism maze: genetic, epigenetic and environmental clues. Trends Neurosci 29:349–358.
198
Persico AM, Mengual E, Moessner R, Hall FS, Revay RS, Sora I, Arellano J, DeFelipe J, Gimenez-Amaya JM, Conciatori M, Marino R, Baldi A, Cabib S, Pascucci T, Uhl GR, Murphy DL, Lesch KP, Keller F, Hall SF (2001) Barrel pattern formation requires serotonin uptake by thalamocortical afferents, and not vesicular monoamine release. J Neurosci 21:6862–6873.
Peter D, Jimenez J, Liu Y, Kim J, Edwards RH (1994) The chromaffin granule and synaptic vesicle amine transporters differ in substrate recognition and sensitivity to inhibitors. J Biol Chem 269:7231–7237.
Peter D, Liu Y, Sternini C, de Giorfio R, Brecha N, Edwards RH (1995) Differential expression of two vesicular monoamine transporters. J Neurosci 15:6179–6188.
Peter M, Couturier J, Pacquement H, Michon J, Thomas G, Magdelenat H, Delattre O (1997) A new member of the ETS family fused to EWS in Ewing tumors. Oncogene 14:1159–1164.
Petit E, Hérault J, Martineau J, Perrot A, Barthélémy C, Hameury L, Sauvage D, Lelord G, Müh JP (1995) Association study with two markers of a human homeogene in infantile autism. J Med Genet 32:269–274.
Pfaar H, von Holst A, Vogt Weisenhorn DM, Brodski C, Guimera J, Wurst W (2002) mPet-1, a mouse ETS-domain transcription factor, is expressed in central serotonergic neurons. Dev Genes Evol 212:43–46.
Pfaffl MW, Horgan GW, Dempfle L (2002) Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30:e36.
Pickett J, London E (2005) The neuropathology of autism: a review. J Neuropathol Exp Neurol 64:925–935.
Poole SJ, Law ML, Kao F-T, Lau Y-F (1989) Isolation and Chromosomal Location of the Human En-2 Gene. Genomics 4:225–231.
Puelles L, Medina L (1994) Development of Neurons Expressing Tyrosine Hydroxylase and Dopamine in the Chicken Brain: A Comparative segmental analysis. In: Phylogeny and Development of Catecholamine Systems in the CNSof Vertebrates (Smeets WJ, Reiner A, eds), pp.381–404. Cambridge: Cambridge University Press.
Puelles L, Verney C (1998) Early neuromeric distribution of tyrosine-hydroxylase- immunoreactive neurons in human embryos. J Comp Neurol 394:283–308.
199
Rehnström K, Ylisaukko-oja T, Nummela I, Ellonen P, Kempas E, Vanhala R, von Wendt L, Järvelä I, Peltonen L (2009) Allelic variants in HTR3C show association with autism. Am J Med Genet, Part B 150B:741–746.
Rhoades RW, Chiaia NL, Lane RD, Bennett-Clarke CA (1998) Effect of activity blockade on changes in vibrissae-related patterns in the rat’s primary somatosensory cortex induced by serotonin depletion. J Comp Neurol 402:276–283.
Riad M, Garcia S, Watkins KC, Jodoin N, Doucet E, Langlois X, el Mestikawy S, Hamon M, Descarries L (2000) Somatodendritic localization of 5-HT1A and preterminal axonal localization of 5-HT1B serotonin receptors in adult rat brain. J Comp Neurol 417:181–194.
Riccio O, Potter G, Walzer C, Vallet P, Szabó G, Vutskits L, Kiss JZ, Dayer AG (2009) Excess of serotonin affects embryonic interneuron migration through activation of the serotonin receptor 6. Mol Psychiatry 14:280–290.
Richer M, Hen R, Blier P (2002) Modification of serotonin neuron properties in mice lacking 5-HT1A receptors. European Journal of Pharmacology 435:195–203.
Rissling I, Strauch K, Höft C, Oertel WH, Möller JC (2009) Haplotype analysis of the engrailed-2 gene in young-onset Parkinson’s disease. Neurodegener Dis 6:102–105.
Rowitch DH, McMahon AP (1995) Pax-2 expression in the murine neural plate precedes and encompasses the expression domains of Wnt-1 and En-1. Mech Dev 52:3–8.
Salisbury AL, Wisner KL, Pearlstein T, Battle CL, Stroud L, Lester BM (2011) Newborn neurobehavioral patterns are differentially related to prenatal maternal major depressive disorder and serotonin reuptake inhibitor treatment. Depress Anxiety 28:1008–1019.
Sato T, Joyner AL (2009) The duration of Fgf8 isthmic organizer expression is key to patterning different tectal-isthmo-cerebellum structures. Development 136:3617–3626.
Saueressig H, Burrill J, Goulding M (1999) Engrailed-1 and netrin-1 regulate axon pathfinding by association interneurons that project to motor neurons. Development 126:4201–4212.
Savelieva KV, Zhao S, Pogorelov VM, Rajan I, Yang Q, Cullinan E, Lanthorn TH (2008) Genetic disruption of both tryptophan hydroxylase genes dramatically
200
reduces serotonin and affects behavior in models sensitive to antidepressants. PLoS One 3:e3301.
Schaefer TL, Vorhees CV, Williams MT (2009) Mouse plasmacytoma-expressed transcript 1 knock out induced 5-HT disruption results in a lack of cognitive deficits and an anxiety phenotype complicated by hypoactivity and defensiveness. Neuroscience 164:1431–1443.
Schroeter S, Blakely RD (1996) Drug Targets in the Embryo Studies on the Cocaine- and Antidepressant-Sensitive Serotonin Transporter. Ann N Y Acad Sci 801:239–255.
Schuldiner S, Shirvan A, Linial M (1995) Vesicular neurotransmitter transporters: from bacteria to humans. Physiol Rev 75:369–392.
Schwarz M, Alvarez-Bolado G, Urbánek P, Busslinger M, Gruss P (1997) Conserved biological function between Pax-2 and Pax-5 in midbrain and cerebellum development: evidence from targeted mutations. Proc Natl Acad Sci U S A 94:14518–14523.
Scott MM, Krueger KC, Deneris ES (2005a) A differentially autoregulated Pet-1 enhancer region is a critical target of the transcriptional cascade that governs serotonin neuron development. J Neurosci 25:2628–2636.
Scott MM, Wylie CJ, Lerch JK, Murphy R, Lobur K, Herlitze S, Jiang W, Conlon RA, Strowbridge BW, Deneris ES (2005b) A genetic approach to access serotonin neurons for in vivo and in vitro studies. Proc Natl Acad Sci U S A 102:16472–16477.
Seibert J, Urbach R (2010) Role of en and novel interactions between msh, ind, and vnd in dorsoventral patterning of the Drosophila brain and ventral nerve cord. Developmental biology 346:332–345.
Sen B, Singh AS, Sinha S, Chatterjee A, Ahmed S, Ghosh S, Usha R (2010) Family-based studies indicate association of Engrailed 2 gene with autism in an Indian population. Genes Brain Behav 9:248–255.
Sgadò P, Albéri L, Gherbassi D, Galasso SL, Ramakers GMJ, Alavian KN, Smidt MP, Dyck RH, Simon HH (2006) Slow progressive degeneration of nigral dopaminergic neurons in postnatal Engrailed mutant mice. Proc Natl Acad Sci U S A 103:15242–15247.
Sgadò P, Viaggi C, Fantacci C, Corsini GU (2008) Characterization of the Engrailed mutant mice as experimental models for Parkinson’s disease. Parkinsonism Relat Disord 14 Suppl 2:S103–6.
201
Sgaier SK, Lao Z, Villanueva MP, Berenshteyn F, Stephen D, Turnbull RK, Joyner AL (2007) Genetic subdivision of the tectum and cerebellum into functionally related regions based on differential sensitivity to engrailed proteins. Development 134:2325–2335.
Shamim H, Mahmood R, Logan C, Doherty P, Lumsden A, Mason I (1999) Sequential roles for Fgf4, En1 and Fgf8 in specification and regionalisation of the midbrain. Development 126:945–959.
Shemer AV, Azmitia EC, Whitaker-Azmitia PM (1991) Dose-related effects of prenatal 5-methoxytryptamine (5-MT) on development of serotonin terminal density and behavior. Brain Res Dev Brain Res 59:59–63.
Shigetani Y, Funahashi JI, Nakamura H (1997) En-2 regulates the expression of the ligands for Eph type tyrosine kinases in chick embryonic tectum. Neurosci Res 27:211–217.
Sillitoe RV, Stephen D, Lao Z, Joyner AL (2008) Engrailed homeobox genes determine the organization of Purkinje cell sagittal stripe gene expression in the adult cerebellum. J Neurosci 28:12150–12162.
Sillitoe RV, Vogel MW, Joyner AL (2010) Engrailed homeobox genes regulate establishment of the cerebellar afferent circuit map. J Neurosci 30:10015– 10024.
Simon HH, Saueressig H, Wurst W, Goulding MD, O’Leary DD (2001) Fate of midbrain dopaminergic neurons controlled by the engrailed genes. J Neurosci 21:3126–3134.
Simon HH, Scholz C, O’Leary DDM (2005) Engrailed genes control developmental fate of serotonergic and noradrenergic neurons in mid- and hindbrain in a gene dose-dependent manner. Mol Cell Neurosci 28:96–105.
Simon HH, Thuret S, Alberi L (2004) Midbrain dopaminergic neurons: control of their cell fate by the engrailed transcription factors. Cell Tissue Res 318:53– 61.
Song N-N, Xiu J-B, Huang Y, Chen J-Y, Zhang L, Gutknecht L, Lesch KP, Li H, Ding Y-Q (2011) Adult raphe-specific deletion of Lmx1b leads to central serotonin deficiency. PLoS One 6:e15998.
Sonnier L, Le Pen G, Hartmann A, Bizot J-C, Trovero F, Krebs M-O, Prochiantz A (2007) Progressive loss of dopaminergic neurons in the ventral midbrain of adult mice heterozygote for Engrailed1. J Neurosci 27:1063–1071.
202
Soriano P (1999) Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet 21:70–71.
Stankovski L, Alvarez C, Ouimet T, Vitalis T, El-Hachimi KH, Price D, Deneris E, Gaspar P, Cases O (2007) Developmental cell death is enhanced in the cerebral cortex of mice lacking the brain vesicular monoamine transporter. J Neurosci 27:1315–1324.
Sudarov A, Joyner AL (2007) Cerebellum morphogenesis: the foliation pattern is orchestrated by multi-cellular anchoring centers. Neural Dev 2:26.
Sumi-Ichinose C, Ichinose H, Takahashi E, Hori T, Nagatsu T (1992) Molecular cloning of genomic DNA and chromosomal assignment of the gene for human aromatic L-amino acid decarboxylase, the enzyme for catecholamine and serotonin biosynthesis. Biochemistry 31:2229–2238.
Sunmonu NA, Li K, Guo Q, Li JYH (2011) Gbx2 and Fgf8 are sequentially required for formation of the midbrain-hindbrain compartment boundary. Development 138:725–734.
Sutcliffe JS, Delahanty RJ, Prasad HC, McCauley JL, Han Q, Jiang L, Li C, Folstein SE, Blakely RD (2005) Allelic heterogeneity at the serotonin transporter locus (SLC6A4) confers susceptibility to autism and rigid- compulsive behaviors. Am J Hum Genet 77:265–279.
Takahashi A, Quadros IM, de Almeida RMM, Miczek KA (2011) Brain serotonin receptors and transporters: initiation vs. termination of escalated aggression. Psychopharmacology (Berl) 213:183–212.
Takahashi N, Miner LL, Sora I, Ujike H, Revay RS, Kostic V, Jackson-Lewis V, Przedborski S, Uhl GR (1997) VMAT2 knockout mice: heterozygotes display reduced amphetamine-conditioned reward, enhanced amphetamine locomotion, and enhanced MPTP toxicity. Proc Natl Acad Sci U S A 94:9938–9943.
Tassone F, Qi L, Zhang W, Hansen RL, Pessah IN, Hertz-Picciotto I (2011) MAOA, DBH, and SLC6A4 variants in CHARGE: a case-control study of autism spectrum disorders. Autism Res 4:250–261.
Thomas KR, Capecchi MR (1990) Targeted disruption of the murine int-1 proto- oncogene resulting in severe abnormalities in midbrain and cerebellar development. Nature 346:847–850.
Tison F, Normand E, Jaber M, Aubert I, Bloch B (1991) Aromatic L-amino-acid decarboxylase (DOPA decarboxylase) gene expression in dopaminergic and serotoninergic cells of the rat brainstem. Neurosci Lett 127:203–206.
203
Tordjman S, Gutknecht L, Carlier M, Spitz E, Antoine C, Slama F, Carsalade V, Cohen DJ, Ferrari P, Roubertoux PL, Anderson GM (2001) Role of the serotonin transporter gene in the behavioral expression of autism. Mol Psychiatry 6:434–439.
Torres M, Gómez-Pardo E, Gruss P (1996) Pax2 contributes to inner ear patterning and optic nerve trajectory. Development 122:3381–3391.
Turlejski K, Djavadian RL, Kossut M (1997) Neonatal serotonin depletion modifies development but not plasticity in rat barrel cortex. Neuroreport 8:1823–1828.
Törk I (1990) Anatomy of the serotonergic system. Ann N Y Acad Sci 600:9–34; discussion 34–5.
Urbánek P, Wang Z-Q, Fetka I, Wagner EF, Busslinger M (1994) Complete block of early B cell differentiation and altered patterning of the posterior midbrain in mice lacking Pax5/BSAP. Cell 79:901–912.
Vassilacopoulou D, Sideris DC, Vassiliou AG, Fragoulis EG (2004) Identification and characterization of a novel form of the human L-dopa decarboxylase mRNA. Neurochem Res 29:1817–1823.
Veenema AH (2009) Early life stress, the development of aggression and neuroendocrine and neurobiological correlates: what can we learn from animal models? Front Neuroendocrinol 30:497–518.
Vekrellis K, Xilouri M, Emmanouilidou E, Rideout HJ, Stefanis L (2011) Pathological roles of α-synuclein in neurological disorders. Lancet Neurol 10:1015–1025. van Velzen A, Toth M (2010) Role of maternal 5-HT(1A) receptor in programming offspring emotional and physical development. Genes Brain Behav 9:877– 885.
Vergne DE, Nemeroff CB (2006) The interaction of serotonin transporter gene polymorphisms and early adverse life events on vulnerability for major depression. Curr Psychiatry Rep 8:452–457.
Vertes RP, Crane AM (1997) Distribution, quantification, and morphological characteristics of serotonin-immunoreactive cells of the supralemniscal nucleus ( B9 ) and pontomesencephalic reticular formation in the rat. J Comp Neurol 378:411–424.
Vitalis T, Cases O, Callebert J, Launay JM, Price DJ, Seif I, Gaspar P (1998) Effects of monoamine oxidase A inhibition on barrel formation in the mouse
204
somatosensory cortex: determination of a sensitive developmental period. J Comp Neurol 393:169–184.
Vitalis T, Cases O, Passemard S, Callebert J, Parnavelas JG (2007) Embryonic depletion of serotonin affects cortical development. Eur J Neurosci 26:331– 344.
Vitalis T, Fouquet C, Alvarez C, Seif I, Price D, Gaspar P, Cases O (2002) Developmental expression of monoamine oxidases A and B in the central and peripheral nervous systems of the mouse. J Comp Neurol 442:331–347.
Voronova A, Fischer A, Ryan T, Al Madhoun A, Skerjanc IS (2011) Ascl1/Mash1 is a novel target of Gli2 during Gli2-induced neurogenesis in P19 EC cells. PLoS One 6:e19174.
Wallace JA, Lauder JM (1983) Development of the serotonergic system in the rat embryo: an immunocytochemical study. Brain Res Bull 10:459–479.
Walther DJ, Bader M (2003) A unique central tryptophan hydroxylase isoform. Biochem Pharmacol 66:1673–1680.
Walther DJ, Peter J-U, Bashammakh S, Hörtnagl H, Voits M, Fink H, Bader M (2003) Synthesis of serotonin by a second tryptophan hydroxylase isoform. Science 299:76.
Wang L, Jia M, Yue W, Tang F, Qu M, Ruan Y, Lu T, Zhang H, Yan H, Liu J, Guo Y, Zhang J, Yang X, Zhang D (2008) Association of the ENGRAILED 2 (EN2) gene with autism in Chinese Han population. Am J Med Genet, Part B 147B:434–438.
Wang YM, Gainetdinov RR, Fumagalli F, Xu F, Jones SR, Bock CB, Miller GW, Wightman RM, Caron MG (1997) Knockout of the vesicular monoamine transporter 2 gene results in neonatal death and supersensitivity to cocaine and amphetamine. Neuron 19:1285–1296.
Watson JD, Wheeler SR, Stagg SB, Crews ST (2011) Drosophila hedgehog signaling and engrailed-runt mutual repression direct midline glia to alternative ensheathing and non-ensheathing fates. Development 138:1285– 1295.
Whitaker-Azmitia PM, Azmitia EC (1986) Autoregulation of fetal serotonergic neuronal development: role of high affinity serotonin receptors. Neurosci Lett 67:307–312.
205
Whitaker-Azmitia PM, Zhang X, Clarke C (1994) Effects of gestational exposure to monoamine oxidase inhibitors in rats: preliminary behavioral and neurochemical studies. Neuropsychopharmacology 11:125–132.
Wilkinson DG, Bailes JA, McMahon AP (1987) Expression of the proto-oncogene int-1 is restricted to specific neural cells in the developing mouse embryo. Cell 50:79–88.
Wilson SL, Kalinovsky A, Orvis GD, Joyner AL (2011) Spatially restricted and developmentally dynamic expression of engrailed genes in multiple cerebellar cell types. Cerebellum 10:356–372.
Wizenmann A, Brunet I, Lam JSY, Sonnier L, Beurdeley M, Zarbalis K, Weisenhorn-Vogt D, Weinl C, Dwivedy A, Joliot A, Wurst W, Holt C, Prochiantz A (2009) Extracellular Engrailed participates in the topographic guidance of retinal axons in vivo. Neuron 64:355–366.
Wurst W, Auerbach AB, Joyner AL (1994) Multiple developmental defects in Engrailed-1 mutant mice: an early mid-hindbrain deletion and patterning defects in forelimbs and sternum. Development 120:2065–2075.
Wylie CJ, Hendricks TJ, Zhang B, Wang L, Lu P, Leahy P, Fox S, Maeno H, Deneris ES (2010) Distinct transcriptomes define rostral and caudal serotonin neurons. J Neurosci 30:670–684.
Xu Y, Sari Y, Zhou FC (2004) Selective serotonin reuptake inhibitor disrupts organization of thalamocortical somatosensory barrels during development. Brain Res Dev Brain Res 150:151–161.
Yang P, Lung F-W, Jong Y-J, Hsieh H-Y, Liang C-L, Juo S-HH (2008) Association of the homeobox transcription factor gene ENGRAILED 2 with autistic disorder in Chinese children. Neuropsychobiology 57:3–8.
Ye W, Bouchard M, Stone D, Liu X, Vella F, Lee J, Nakamura H, Ang SL, Busslinger M, Rosenthal A (2001) Distinct regulators control the expression of the mid-hindbrain organizer signal FGF8. Nat Neurosci 4:1175–1181.
Ye W, Shimamura K, Rubenstein JL, Hynes MA, Rosenthal A (1998) FGF and Shh signals control dopaminergic and serotonergic cell fate in the anterior neural plate. Cell 93:755–766.
Yirmiya N, Pilowsky T, Nemanov L, Arbelle S, Feinsilver T, Fried I, Ebstein RP (2001) Evidence for an association with the serotonin transporter promoter region polymorphism and autism. American journal of medical genetics 105:381–386.
206
Zervas M, Blaess S, Joyner AL (2005) Classical embryological studies and modern genetic analysis of midbrain and cerebellum development. Curr Top Dev Biol 69:101–138.
Zervas M, Millet S, Ahn S, Joyner AL (2004) Cell behaviors and genetic lineages of the mesencephalon and rhombomere 1. Neuron 43:345–357.
Zhao Z-Q, Scott M, Chiechio S, Wang J-S, Renner KJ, Gereau RW, Johnson RL, Deneris ES, Chen Z-F (2006) Lmx1b is required for maintenance of central serotonergic neurons and mice lacking central serotonergic system exhibit normal locomotor activity. J Neurosci 26:12781–12788.
207