DOCSLIB.ORG

Was It a Back-Stabbing Friend, Or Was Zoe Cruz Her Own Worst Enemy?

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Was It a Back-Stabbing Friend, Or Was Zoe Cruz Her Own Worst Enemy? O C V ΓΡΑΦΕΙ ΤΗΝ ΙΣΤΟΡΙΑ Bringing the news ΤΟΥ ΕΛΛΗΝΙΣΜΟΥ to generations of ΑΠΟ ΤΟ 1915 The National Herald Greek Americans A WEEKLY GREEK AMERICAN PUBLICATION c v www.thenationalherald.com VOL. 11, ISSUE 530 December 8, 2007 $1.00 GREECE: 1.75 EURO Was It A Back-Stabbing 2 More Alleged Victims Come Forward Against Katinas Friend, Or Was Zoe Cruz New Court Petition Details Alleged Cover- Her Own Worst Enemy? Up by Church Officials By Evan C. Lambrou life to the bulge bracket investment By Theodore Kalmoukos Special to The National Herald bank, Mrs. Cruz, the most powerful Special to the National Herald woman on Wall Street, was out of a NEW YORK – Before being ousted job. She joins a growing list of Wall BOSTON, Mass. – Two more al- at the end of last week, Greek-born Street’s top names who have been leged victims of former priest Zoe Cruz was considered a power- fired since the summer, including Nicholas Katinas have come for- house on Wall Street. Merrill Lynch’s Stan O’Neal and Cit- ward, according to an amended le- Initially tipped as a possible suc- igroup’s Charles O. Prince III, for gal action which has already been cessor for the top job at Morgan presiding over firms which became filed on behalf of two other alleged Stanley by the same man who basi- mired in the sub-prime mortgage victims. The fourth alleged victim is cally dumped her, Mrs. Cruz, 52, tar pit. from of Milwaukee, Wisconsin and had just been ranked fourth on the Her departure came after Mor- is referred to as John Doe IV. He has Wall Street Journal’s list of “50 gan Stanley signaled potential apparently “attempted suicide sev- Women to Watch.” fourth quarter losses, which one eral times,” according to the peti- Now, she is the latest victim of analyst estimated could swell by an tion. the credit crisis rocking the finan- additional $1.2 billion by the time The complaint also alleges Rev. cial sector. She was unexpectedly Morgan Stanley announces its re- Nicholas Triantafilou, vicar general booted as co-president of Morgan sults in mid-December. Those loss- of the Archdiocese during the time Stanley last Thursday, November es followed a series of hits totaling of the alleged sexual abuse against 29. $2.5 billion in the third quarter, minors, and currently president of Mrs. Cruz, a married mother of and included $940 million of mark- Hellenic College/Holy Cross Greek three, left the building almost im- downs for leveraged loans; a $1 bil- Orthodox School of Theology in mediately after being informed of lion revenue decline reflecting Brookline, “covered up” complaints her departure – or “retirement” – mortgage assets; and a $480 mil- about Katinas, which had been by Morgan Stanley Chairman & lion loss in quantitative stock trad- brought to his attention. Father Tri- CEO John J. Mack. ing. antafilou had many meetings with That Mr. Mack, 63, gave her the Mrs. Cruz oversaw the firm’s in- the parents and the boy, and appar- bad news made sense. He was her stitutional securities business, in- ently convinced them that their boss. But he was also supposedly vestment banking and retail bro- son, who was 11 years of age at the her friend, colleague and chief sup- kerage operations, as well as its risk time, had misunderstood Mr. Kati- porter for much of her working life, management division and trading nas’ actions and behavior. though being friends with the boss arms, and was sitting on more than Similar allegations of a cover-up was clearly not enough to save Mrs. $60 million in restricted stock, plus had been raised in the petition Cruz from the sub-prime chop. over $5 million in stock options, be- against Metropolitans Iakovos of As recently as last April at the fore being forced out. George Paraskevaides, co-founder of the J&P construction colossus and great philanthropist, passed Chicago and Isaiah of Denver. The company’s annual meeting, Mr. Just last year, she was ranked away on Wednesday, December 4, 2007 in The London Clinic. He was 91. latter was serving as chancellor of Mack noted the company’s 2006 re- 10th among FORBES magazine’s the Chicago Diocese at the time. sults, and said that “strong perfor- “100 Most Powerful Women,” and Mr. Katinas was accused of sexu- mance is in large part due to Zoe 16th in 2005. FORTUNE magazine al misconduct with minors earlier Cruz and the institutional securities ranked her 1st among the world’s this year, and was defrocked by the group, which manages a tremen- highest paid women, listing her to- Philanthropist G. Paraskevaides Dies Ecumenical Patriarchate of Con- dous amount of risk in a very smart tal compensation at $30 million in stantinople this past summer, upon and disciplined way.” 2006. The Financial Times had By Neofytos Kyriakou lan Polytechnic, Italy. The rags-to- tion equipment and later becoming the recommendation of the Holy But it was Mr. Mack who, at a written of her that she is “known as Special to The National Herald riches real-life legend of the civil engineers and contractors for Eparchial Synod of the Archdio- scheduled board meeting earlier the ‘Cruz Missile’ because of her founders of one of the leading con- major projects under British-ruled cese. The lawsuit is also lodged that morning, told the company’s ability to home in on her target and George Paraskevaides, 91, co- struction and development compa- Cyprus and other territories. against the Archdiocese, the Me- board of directors he wanted her to pursue it unswervingly.” founder of the J&P construction nies in the world started when By 1961, the two partners estab- tropolis of Denver and Holy Trinity go. Not for nothing is he known as Mrs. Cruz graduated from Har- colossus and great philanthropist, George Paraskevaides, fresh out of lished Joannou & Paraskevaides Church in Dallas, Texas where Mr. “Mack the Knife.” vard University with a bachelor’s died on Wednesday, December 5, university after World War II, part- (Overseas) Ltd. based in London Katinas served as head priest for 28 With friends like these, who degree in Literature in 1977. She 2007 at the London Clinic. nered with Stelios Ioannou to estab- that soon became one of the world's years. The parish recently sent a needs enemies? That sentiment, or received an MBA from Harvard Mr. Paraskevaides was born in lish Joannou & Paraskevaides. To- leading construction enterprises letter soliciting its parishioners for something like it, was probably Business School in 1982, and be- Athens in 1916, but soon after his gether they embarked on a historic with activities in Europe, the Middle $250,000 in extra funds to help de- playing through Mrs. Cruz’s mind gan her career with Morgan Stan- birth he moved with his family to journey that would take six decades East, Asia and Africa. The compa- fray legal fees for defending the as she stormed out of Morgan Stan- ley’s investment banking division Cyprus, where he excelled at the and span across the Middle East, ny's activities presently cover the parish. The letter stated, “The ley’s Midtown offices. Pancyprian Gymnasium in Nicosia North Africa, Cyprus and the Balka- Having devoted 25 years of her Continued on page 5 and studied architecture at the Mi- ns, starting with renting construc- Continued on page 11 Continued on page 4 Outgoing Consul General Jim Gianopulos Wows Thessaloniki Film Festival Catherine Boura Reflects on By Dan Georgakas Special to The National Herald Her 4 Years Serving in NYC A highlight of the 48th Thessa- loniki Film Festival was the involve- ment of Jim Gianopulos, chairman By Stavros Marmarinos Bouras said. of FOX Entertainment. Mr. Gianop- Special to the National Herald According to Mrs. Bouras, the ulos, one of the most powerful stu- successful games of 2004 improved dio executives in Hollywood, who NEW YORK – The Hellene Consul Greek self-esteem, brought the arrived during the climatic final General of New York Catherine country one step closer to the Inter- weekend to participate in a series Boura referred to the importance of national community and brought of formal and informal events. With unity, coordination and coopera- the world closer to Greek civiliza- every appearance, the affable Mr. tion of all forces of Hellenism in the tion and history. She also talked Gianopulos dispatched the nega- U.S. for the constant upgrading of about other important visits by tive stereotypes of Hollywood Hellenic Education. Greek officials to the United States. moguls which are pervasive in “Hellenism can and should sup- “Which confirm in many ways Greek film circles. port the traditional institutions that the Greek interest about Hellenism The most substantive Gianopu- helped it in all its steps in this coun- in America and strengthen the link los event was a two-hour master try: family, school and church are between Greece and Greek Ameri- class given at the John Cassavetes interrelated with the preservation cans,” she said. Theater. It was attended mainly by of the Hellenic education and lega- According to Mrs. Bouras, she Greek film critics, Greek film stu- cy,” she said. and her colleagues always strived dents, and the international press. During an exclusive interview for excellence in order to provide Rather than a fast-talking, grim with TNH last week, a few days be- the best service possible to Greek business executive who knows fore her departure back to Athens and Greek American citizens. more about the bottom line than after a four year assignment in New When asked about her personal ex- culture, the casually dressed Mr.
Load more

Recommended publications
  • PREDICTD: Parallel Epigenomics Data Imputation with Cloud-Based Tensor Decomposition
    bioRxiv preprint doi: https://doi.org/10.1101/123927; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. PREDICTD: PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition Timothy J. Durham Maxwell W. Libbrecht Department of Genome Sciences Department of Genome Sciences University of Washington University of Washington J. Jeffry Howbert Jeff Bilmes Department of Genome Sciences Department of Electrical Engineering University of Washington University of Washington William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington April 4, 2017 Abstract The Encyclopedia of DNA Elements (ENCODE) and the Roadmap Epigenomics Project have produced thousands of data sets mapping the epigenome in hundreds of cell types. How- ever, the number of cell types remains too great to comprehensively map given current time and financial constraints. We present a method, PaRallel Epigenomics Data Imputation with Cloud-based Tensor Decomposition (PREDICTD), to address this issue by computationally im- puting missing experiments in collections of epigenomics experiments. PREDICTD leverages an intuitive and natural model called \tensor decomposition" to impute many experiments si- multaneously. Compared with the current state-of-the-art method, ChromImpute, PREDICTD produces lower overall mean squared error, and combining methods yields further improvement. We show that PREDICTD data can be used to investigate enhancer biology at non-coding human accelerated regions. PREDICTD provides reference imputed data sets and open-source software for investigating new cell types, and demonstrates the utility of tensor decomposition and cloud computing, two technologies increasingly applicable in bioinformatics.
    [Show full text]
  • My Greece. the Journey Inside Syriza
    Robert Misik My Greece. The Journey Inside Syriza. Days of Decision. While the Greek drama moved towards a decision, I travelled into the interior of the new Greece. Meetings with Alexis Tsipras, his closest aids, local activists, young businessmen, working-class militants and people, who just manage to survive. Translation: Barbara Stanzl (Spiralcat-Translations). “To our government,” Nikos shouts, slightly sarcastically. While we are lifting our beers, Katerina adds with an additional pinch of irony and a touch of bitterness, “It’s high time that we actually start to govern.” We’re sitting at the Café Stretto in Thessaloniki and the Greece Emergency crisis summit with EU Zone leaders from last Monday evening had just finished. The latest news is coming in. There are indications that Alexis Tsipras has in fact moved his position in the direction the creditors want and that an agreement isn’t far away. Details are still lacking at this point. The next morning laughter has been replaced by shock. Katerina Notopoulous’s mobile rings every minute. The 27 year old is a member of the central committee of the governing Syriza party. We actually wanted to take the day off and drive to the coast. „Thank you Merkel and Alexis. You’ve screwed up my day,“ she says, between two telephone calls, with a strained grin and a sour face. The calls are from two outraged party members who can’t believe that the Tsipras government could agree to a new and fatal austerity program of over eight billion euros. I’m tearing along the bumpy streets to Chalkidiki in our little Fiat.
    [Show full text]
  • Manolis Kellis Piotr Indyk
    6.095 / 6.895 Computational Biology: Genomes, Networks, Evolution Manolis Kellis Rapid database search Courtsey of CCRNP, The National Cancer Institute. Piotr Indyk Protein interaction network Courtesy of GTL Center for Molecular and Cellular Systems. Genome duplication Courtesy of Talking Glossary of Genetics. Administrivia • Course information – Lecturers: Manolis Kellis and Piotr Indyk • Grading: Part. Problem sets 50% Final Project 25% Midterm 20% 5% • 5 problem sets: – Each problem set: covers 4 lectures, contains 4 problems. – Algorithmic problems and programming assignments – Graduate version includes 5th problem on current research •Exams – In-class midterm, no final exam • Collaboration policy – Collaboration allowed, but you must: • Work independently on each problem before discussing it • Write solutions on your own • Acknowledge sources and collaborators. No outsourcing. Goals for the term • Introduction to computational biology – Fundamental problems in computational biology – Algorithmic/machine learning techniques for data analysis – Research directions for active participation in the field • Ability to tackle research – Problem set questions: algorithmic rigorous thinking – Programming assignments: hands-on experience w/ real datasets • Final project: – Research initiative to propose an innovative project – Ability to carry out project’s goals, produce deliverables – Write-up goals, approach, and findings in conference format – Present your project to your peers in conference setting Course outline • Organization – Duality:
    [Show full text]
  • Prof. Manolis Kellis April 15, 2008
    Chromosomes inside the cell Introduction to Algorithms 6.046J/18.401J • Eukaryote cell LECTURE 18 • Prokaryote Computational Biology cell • Bio intro: Regulatory Motifs • Combinatorial motif discovery - Median string finding • Probabilistic motif discovery - Expectation maximization • Comparative genomics Prof. Manolis Kellis April 15, 2008 DNA packaging DNA: The double helix • Why packaging • The most noble molecule of our time – DNA is very long – Cell is very small • Compression – Chromosome is 50,000 times shorter than extended DNA • Using the DNA – Before a piece of DNA is used for anything, this compact structure must open locally ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC ATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC AATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT GCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG TTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG AATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA
    [Show full text]
  • ENCODE Consortium Meeting
    ENCODE Consortium Meeting June 17-19, 2008 Hilton Washington DC/Rockville Executive Meeting Center Rockville, Maryland PARTICIPANTS Bradley Bernstein Piero Carninci, Ph.D. Molecular Pathology Unit Leader Massachusetts General Hospital Functional Genomics Technology Team and 149 13th Street Omics Resource Development Unit Charlestown, MA 02129 Deputy Project Director (617) 726-6906 LSA Technology Development Group (617) 726-5684 Fax Omics Science Center [email protected] RIKEN Yokohama Institute 1-7-22 Suehiro-cho, Tsurumi-ku Ewan Birney Yokohama 230-0045 Joint Team Leader Japan Panda Group Nucleotides +81-(0)901-709-2277 Panda Coordination and Outreach [email protected] Panda Metabolism European Molecular Biology Laboratory Philip Cayting European Bioinformatics Institute Gerstein Laboratory Hinxton Outstation Department of Molecular Biophysics and Wellcome Trust Genome Campus Biochemistry Hinxton, Cambridge CB10 1SD Yale University United Kingdom P.O. Box 208114 +44-(0)1223-494 444, ext. 4420 New Haven, CT 06520-8114 +44-(0)1223-494 494 Fax (203) 432-6337 [email protected] [email protected] Michael Brent, Ph.D. Howard Y. Chang, M.D., Ph.D. Professor Assistant Professor Center for Genome Sciences Stanford University Washington University Center for Clinical Sciences Research, Campus Box 8510 Room 2155C 4444 Forest Park 269 Campus Drive Saint Louis, MO 63108 Stanford, CA 94305 (314) 286-0210 (650) 736-0306 [email protected] [email protected] James Bentley Brown Mike Cherry, Ph.D. Graduate Student Researcher Associate Professor Graduate Program in Applied Science and Department of Genetics Technology Stanford University Bickel Group 300 Pasteur Drive University of California, Berkeley Stanford, CA 94305-5120 Room 2 (650) 723-7541 1246 Hearst Avenue [email protected] Berkeley, CA 94702 (510) 703-4706 [email protected] Francis S.
    [Show full text]
  • Unweaving)The)Circuitry)) Of)Complex)Disease!
    Unweaving)the)circuitry)) of)complex)disease! Manolis Kellis Broad Institute of MIT and Harvard MIT Computer Science & Artificial Intelligence Laboratory Personal!genomics!today:!23!and!Me! Recombina:on)breakpoints) Me)vs.)) my)brother) Family)Inheritance) Dad’s)mom) My)dad) Mom’s)dad) Human)ancestry) Disease)risk) Genomics:)Regions))mechanisms)) Systems:)genes))combina:ons)) drugs) pathways) 1000s)of)diseaseHassociated)loci)from)GWAS) • Hundreds)of)studies,)each)with)1000s)of)individuals) – Power!of!gene7cs:!find!loci,!whatever!the!mechanism!may!be! – Challenge:!mechanism,!cell!type,!drug!target,!unexplained!heritability! GenomeHwide)associa:on)studies)(GWAS)) • Iden7fy!regions!that!coBvary!with!the!disease! • Risk!allele!G!more!frequent!in!pa7ents,!A!in!controls! • But:!large!regions!coBinherited!!!find!causal!variant! • Gene7cs!does!not!specify!cell!type!or!process! E environment causes syndrome G epigenomeX D S genome disease symptoms biomarkers effects Epidemiology The study of the patterns, causes, and effects of health and disease conditions in defined populations Gene:c) Tissue/) Molecular)Phenotypes) Organismal) Variant) cell)type) Epigene:c) Gene) phenotypes) Changes) Expression) Changes) Methyl.) ) Heart) Gene) Endo) DNA) expr.) phenotypes) Muscle) access.) ) Lipids) Cortex) Tension) CATGACTG! Enhancer) CATGCCTG! Lung) ) Gene) Heartrate) Disease) H3K27ac) expr.) Metabol.) Blood) ) Drug)resp) Skin) Promoter) Disease! ) Gene) cohorts! Nerve) Insulator) expr.) GTEx!/! ENCODE/! GTEx! Environment) Roadmap! Epigenomics/! Epigenomics!
    [Show full text]
  • Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden
    Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease 31 August–1 September 2016 in Båstad · Sweden Programme · General information · Lectures abstracts · Poster abstracts Generously supported by: PRECISION MEDICINE IN TYPE 2 DIABETES AND CARDIOVASCULAR DISEASE · 31 AUGUST–1 SEPTEMBER 2016 1 Berzelius symposium 91 Precision Medicine in Type 2 Diabetes and Cardiovascular Disease Purpose statement: Cardiovascular disease (CVD) and type 2 diabetes are devastating and costly diseases whose prevalence is increasing rapidly around the world, projected to exceed billions of people worldwide within the next deca- des. Although drug and lifestyle interventions are used widely to prevent and treat CVD and diabetes, neither is highly effective; for example, in high risk adults, intensive lifestyle intervention delays the onset of disease by roughly 3-years and with metformin by 18-months compared to placebo control interven- tion (Knowler et al, Lancet, 2009), with diabetes “prevention” being the excep- tion, rather than the rule. Moreover, whilst some patients respond very well to therapies, others benefit little or not at all, progressing rapidly through the pre-diabetic phase of beta-cell decline and later developing life-threatening complications such as retinopathy, nephropathy, peripheral neuropathy, and CVD. As such, there is an urgent need to develop innovative and effective prevention and treatment strategies. Human biology is complex and people differ in their genetic and molecular characteris- tics, which underlies the variable response to interventions and rates of disease progression. Thus, a huge, as yet unrealised opportunity exists to optimize the prevention and treatment of CVD and type 2 diabetes by tailoring therapies to the patient’s unique biology.
    [Show full text]
  • ACE II Project LEAFLET Analytical Youth Exchange Work Programme
    The project “ACE II“ ACTIVE CITIZEN in EUROPE II Active European citizens building Project Start Date: 12, September, 2019 APV: 11 – 12, October, 2019 Youth Exchange: 7 – 14 November, 2019 PARTNERSHIP Youth Team of Greece, HELLENIC MIGRATION POLICY INSTITUTE (I.ME.PO., BENEFICIARY ORGANIZATION) Youth Team of Estonia, the NGO MTÜ Lääne-Harju Koostöökogu/ LAG, Western-Harju Partnership (LHKK) Youth Team of Lithuania, the NGO Mano Europa Youth Team of Romania, the University UNIVERSITATEA DIN PITESTI/ UNIVERSITY OF PITESTI (UPIT) This Mobility project seeks how current interesting political discussions are presented by the European institutions via their social networking such as the Facebook of European Parliament and Twitter of European Commission. Thus, the participants from different European countries and organisations active in the youth field, learn about the use of Internet by young persons and citizens to understand a selection of European policy areas that trigger much public attention because of their timeliness and relevance to socially relevant important topics. In addition to that, the Youth Exchange supports specific objectives and opportunities for young participants to improve their level of key competences and skills and promote their participation in democratic life in Europe and the labour market, active citizenship, intercultural dialogue, social inclusion and solidarity. Overall, the partial activities and events are totally compatible and relevant to the work of the beneficiary organisation I.ME.PO. and the participating partners as well as to the goal of informal learning and refer to the learning by doing. They take place through voluntary activities in order to young people can acquire and develop essential competences that contribute to their personal and socio-educational development and foster their active involvement in society.
    [Show full text]
  • UNIVERSITY of CALIFORNIA RIVERSIDE RNA-Seq
    UNIVERSITY OF CALIFORNIA RIVERSIDE RNA-Seq Based Transcriptome Assembly: Sparsity, Bias Correction and Multiple Sample Comparison A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Computer Science by Wei Li September 2012 Dissertation Committee: Dr. Tao Jiang , Chairperson Dr. Stefano Lonardi Dr. Marek Chrobak Dr. Thomas Girke Copyright by Wei Li 2012 The Dissertation of Wei Li is approved: Committee Chairperson University of California, Riverside Acknowledgments The completion of this dissertation would have been impossible without help from many people. First and foremost, I would like to thank my advisor, Dr. Tao Jiang, for his guidance and supervision during the four years of my Ph.D. He offered invaluable advice and support on almost every aspect of my study and research in UCR. He gave me the freedom in choosing a research problem I’m interested in, helped me do research and write high quality papers, Not only a great academic advisor, he is also a sincere and true friend of mine. I am always feeling appreciated and fortunate to be one of his students. Many thanks to all committee members of my dissertation: Dr. Stefano Lonardi, Dr. Marek Chrobak, and Dr. Thomas Girke. I will be greatly appreciated by the advice they offered on the dissertation. I would also like to thank Jianxing Feng, Prof. James Borneman and Paul Ruegger for their collaboration in publishing several papers. Thanks to the support from Vivien Chan, Jianjun Yu and other bioinformatics group members during my internship in the Novartis Institutes for Biomedical Research.
    [Show full text]
  • Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St
    Manolis Kellis Manolis Kellis (Kamvysselis) MIT Center for Genome Research Phone: (617) 452-2274 320 Charles St. Fax: (617) 258-0903 NE125-2164 web.mit.edu/manoli Cambridge MA 02142 [email protected] RESEARCH GOALS I am interested in applying computational methods to understanding biological signals. My specific interests are: (1) in the area of genome interpretation, developing comparative genomics methods to identify genes and regulatory elements in the human genome; (2) in the area of gene regulation, deciphering the combinatorial control of gene expression and cell fate specification, and understanding the dynamic reconfiguration of genetic sub-networks in changing environmental conditions; (3) in the area of evolutionary genomics, understanding the emergence of new functions, reconfiguration of regulatory motifs, and the coordinated evolution of functionally interconnected cellular components. My goal is to pursue academic research in these areas in an interdisciplinary way, working together with computer scientists and biologists. EDUCATION Massachusetts Institute of Technology 2000-2003 Doctor of Philosophy (Ph.D.) in Computer Science Dissertation title: Computational Comparative Genomics: Genes, Regulation, Evolution. Supervisors: Eric Lander and Bonnie Berger. Thesis earned MIT Sprowls award for best Ph.D. thesis in Computer Science Massachusetts Institute of Technology 1999-2000 Masters of Engineering (M.Eng.) in Electrical Engineering and Computer Science. Dissertation title: Imagina: A cognitive abstraction approach to sketch-based image retrieval Supervisor: Patrick Winston Massachusetts Institute of Technology 1995-1999 Bachelor of Science (B.S.) in Computer Science and Engineering Coursework includes Machine Learning, Robot Vision, Artificial Intelligence, Distributed Algorithms, Complexity, Probability, Statistics, Software Engineering, Programming Languages, Signal Processing, Computer Graphics, Microprocessor Design, Computer Architecture.
    [Show full text]
  • Koliastasis P Phd 280714.Pdf
    Title The permanent campaign strategy of Greek Prime Ministers (1996–2011) Candidate Panagiotis Koliastasis Degree This thesis is submitted in fulfillment of the requirements of the Degree of Doctor of Philosophy 4 Abstract Various academic authors have analysed the implementation, the causes and the impact of the permanent campaign strategy by political executives in presidential and parliamentary systems, notably the United States and United Kingdom. This study builds on this literature and extends the research on the permanent campaign in the European parliamentary majoritarian context by examining contemporary Greece as a national case study. In particular, the study addresses three questions. First, did contemporary Greek Prime Ministers adopt the permanent campaign strategy? Second, why did they do so? Third, what impact did the implementation of the permanent campaign have on their public approval? The research focuses on the cases of three successive Prime Ministers in Greece: Costas Simitis (1996–2004), Kostas Karamanlis (2004–2009) and George Papandreou (2009-2011). Simitis and Papandreou were leaders of the centre-left PASOK, while Karamanlis was the leader of the centre-right New Democracy. The study finds that all three Prime Ministers undertook the permanent campaign strategy in order to maintain public approval, aligning themselves with their British and American counterparts. They established new communication units within the primeministerial apparatus, consulted with communication professionals to form a coherent communication
    [Show full text]
  • Creative Disability Classification Systems
    Creative disability classification systems To the memory of Antonis Pavlis Studies from the Swedish Institute for Disability Research 87 ANTONIA PAVLI Creative disability classification systems The case of Greece, 1990-2015 Cover photo: Stelios Petros Chalas © Antonia Pavli, 2017 Title: Creative disability classification systems: The case of Greece, 1990-2015 Publisher: Örebro University 2017 www.publications.oru.se Print: Örebro University, Repro 8/2017 ISSN 1650-1128 ISBN 978-91-7529-204-5 Abstract Antonia Pavli (2017): Creative disability classification systems: The case of Greece, 1990-2015. Studies from the Swedish Institute for Disability Research 87. Disability classification systems belong to the core of states’ social/disability policies through which persons with disabilities are classified as eligible or ineligible for having access to disability allowances. The study of disability classification systems has stimulated the interest of several scholars from the broader area of disability studies. Either by conducting comparative studies between different states and describing the similarities and differences of these systems around the world or by conducting studies focusing on the politics and semantics in the development of disability classification systems in specific states, all studies have shown a pluralism in the systems for as- sessing and certifying disability. In Greece, the development of disability classification systems for social welfare reasons emerged as a controversy that lasted for almost twenty years. One factor that strengthened the con- troversy was the outbreak of the economic crisis late in 2009 followed by the announcement by the governmental authorities of the enactment of a new system for assessing and certifying disability as part of the austerity- driven policies that the Greek state would enact for facing the consequences of the economic crisis.
    [Show full text]